- Email: [email protected]
Cloning, expression and structural stability of a cold-adapted β-galactosidase from Rahnella sp. R3
Protein Expression and Purification xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3 Yuting Fan a,b, Xiao Hua a, Yuzhu Zhang c, Yinghui Feng b, Qiuyun Shen b, Juan Dong a, Wei Zhao b, Wenbin Zhang b, Zhengyu Jin a, Ruijin Yang a,b,⇑ a b c
State Key Laboratory of Food Science and Technology, Jiangnan University, 214122 Wuxi, China School of Food Science and Technology, Jiangnan University, 214122 Wuxi, China U.S. Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center, Albany, CA 94710, United States
a r t i c l e
i n f o
Article history: Received 22 May 2015 and in revised form 2 July 2015 Accepted 2 July 2015 Available online xxxx Keywords: b-Galactosidase Cold-adapted enzyme Enzyme structure stability Lactose hydrolysis
a b s t r a c t A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp. R3. The gene encoded a cold-adapted b-galactosidase (R-b-Gal). Recombinant R-b-Gal was expressed in Escherichia coli BL21 (DE3), purified and characterized. R-b-gal belongs to the glycosyl hydrolase family 42. Circular dichroism spectrometry of the structural stability of R-b-Gal with respect to temperature indicated that the secondary structures of the enzyme were stable to 45 °C. In solution, the enzyme was a homo-trimer and was active at temperatures as low as 4 °C. The enzyme did not require the presence of metal ions to be active, but Mg2+, Mn2+, and Ca2+ enhanced its activity slightly, whereas Fe3+, Zn2+ and Al3+ appeared to inactive it. The purified enzyme displayed Km values of 6.5 mM for ONPG and 2.2 mM for lactose at 4 °C. These values were lower than the corresponding Kms reported for other cold-adapted b-Gals. Ó 2015 Elsevier Inc. All rights reserved.
1. Introduction Cold-adapted enzymes isolated from psychrophilic microorganisms are capable of functioning at low temperatures ranging from 0 to 30 °C. These enzymes are extremely powerful tools for not only biotechnological purposes but also for industrial applications [1]. Because of their highly flexible structures, cold-adapted enzymes unfold at low to moderate temperatures [2], and unfolding can result in enzyme inactivation. The inactivation of enzymes at moderate temperatures is convenient in practice but also restricts reactions to low temperatures. Enzymes catalyze specific reactions at their catalytic sites, whose geometry is usually maintained under certain conditions (temperature, pH, presence of salts, etc.). As the ambient temperature increases, structural variations (of the secondary and tertiary structures) in cold-adapted enzymes distort the active site and decrease the enzyme’s activity. Thus,
Abbreviations: b-Gal, b-galactosidase; R-b-Gal, cold-adapted b-galactosidase from Rahnella sp. R3; X-Gal, 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; ONPG, ortho-nitrophenyl-b-galactoside; ONP, o-nitrophenol; CD, circular dichroism spectroscopy. ⇑ Corresponding author at: School of Food Science and Technology, Jiangnan University, 214122 Wuxi, China. E-mail addresses: [email protected] (Y. Fan), [email protected] (X. Hua), [email protected] (R. Yang).
understanding the mechanism of conformational variations with environmental changes for cold-adapted enzymes is undoubtedly instructive to engineering enzymes with specific purposes. b-Galactosidases (EC 3.2.1.23) (b-Gals) from many organisms have been widely used in food manufacturing, such as in dairy processing (to hydrolyze lactose) and the synthesis of functional oligosaccharides. These enzymes play a crucial role in overcoming lactose intolerance, which is a global health issue, especially in Asia because of the lack of b-Gal in the human intestine. Cold-adapted b-Gals isolated from psychrophilic and psychrotrophic microorganisms living in cold environments (below 5 °C) [3] can be used to process dairy products at 4 °C to avoid spoilage and flavor changes [4]. Currently, the major commercial b-Gals used in lactose hydrolysis, such as Lactozym PureÒ (Novozymes) and MaxilactÒ (DSM Food Specialties), are usually optimally active at moderate temperatures (around 37 °C) but display low activity at 4 °C. Thus, the dairy industry is in great need of cold-adapted b-Gals that are optimally active at conditions compatible with dairy processing (pH 6.5, and not inhibited by sodium, calcium or glucose) [5]. In recent years, several cold-adapted b-Gals have been isolated from different sources including Arthrobacter sp. C2-2 [6], Lactococcus lactis IL1403 [7] and Halomonas sp. S62 [8]. Recently, we discovered a cold-adapted b-Gal from Rahnella sp. R3
http://dx.doi.org/10.1016/j.pep.2015.07.001 1046-5928/Ó 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
2
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
(R-b-Gal), a psychrophilic microorganism isolated from the No. 1 Glacier in the Tianshan Mountains (Xinjiang, China). The Rahnella species, first isolated from water samples in France [9], are gram-negative and facultative anaerobes [10,11]. To date, three Rahnella strains, namely Rahnella sp. BS 1, Rahnella sp. HS-39 [12] and Rahnella aquatilis 14-1 [13], have been reported to produce b-Gals with different enzymatic properties. In comparison to these b-Gals, R-b-Gal from Rahnella sp. R3 exhibited much higher catalytic activity (27 U/mg) at low temperatures. In the present work, R-b-Gal was cloned and expressed in Escherichia coli BL21 (DE3). The variations in enzyme activity with temperature, pH and metal ions, were investigated with substrates of ONPG and lactose. The kinetic parameters (Km, Vmax and Kcat) were calculated by nonlinear regression. The structural stability was investigated by circular dichroism (CD) spectroscopy to monitor the variations in conformation (secondary structure) when the enzyme was incubated under different conditions. Furthermore, the relationship between enzyme structure and activity is discussed; future research will attempt to elucidate the evolution of this enzyme. 2. Materials and methods 2.1. Materials 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) was purchased from Sangon Biotech (Shanghai, China). orthoNitrophenyl-b-galactoside (ONPG) and o-nitrophenol (ONP) were purchased from Sigma–Aldrich (St. Louis, MO, USA). All the restriction enzymes were obtained from Takara Biotechnology Co., Ltd. (Dalian, China) and were used according to the manufacturer’s instructions. Nutrient media were supplied by Oxoid (Basingstoke, UK). All other reagents were analytical grade and were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). 2.2. Bacterial strains, plasmids, growth conditions The Rahnella sp. R3 strain (CCTCC NO. M2012250) was isolated from frozen soil samples obtained by our group from Glacier No. 1, Tianshan Mountains. The strain was cultivated in Luria Broth (LB, 10 g/L tryptone, 5 g/L yeast extract and 10 g/L NaCl) and was grown at 15 °C with rotary shaking at 200 r/min for 24 h. E. coli DH5a and BL21 (DE3) (stored in our lab) were cultured in LB medium supplemented, as necessary, with ampicillin (100 lg/mL), X-Gal (40 lg/mL), and IPTG (24 lg/mL). The cloning vector pMD19-T and expression vector pCold I (Takara, Dalian, China) were used following the manufacturer’s instructions. 2.3. R-b-Gal gene cloning The Rahnella sp. R3 strain was grown at 15 °C in LB to the mid-log phase, and the chromosomal DNA from the cells was isolated using a Genomic DNA Prep Kit (Sangon Biotech, Shanghai, China) according to the protocol for gram-negative bacteria. A partial gene sequence was amplified using a pair of primers RQ-F1 and RQ-R1 (Table 1) designed from highly conserved regions, which were identified by multiple sequence alignment of amino acid sequences of b-Gals from the Rahnella genus. PCR amplification was performed in an Applied Biosystem ProFlex™ 3 32-well PCR System (Life technologies, NY, USA), and the amplified fragment of expected size was gel purified and was cloned into a pMD19-T vector for sequencing. The sequence of the amplified fragment was analyzed by the BLAST (National Center of Biotechnology Information, USA), and nested sequence-specific primers (sp1, sp2, sp3) for thermal asymmetric interlaced PCR
Table 1 Primers used for R-b-Gal cloning. Primer name
Primer sequence
RQ-F1 RQ-R2 AC LAD1-1 LAD1-2 LAD1-3 LAD1-4 Sp1 Sp2 Sp3 Bgal-BamH I-F Bgal-EcoR I-R
ATGACGAAATTTCCTCTTCTGAGC TSACCTGATCGGTGTTAAAACGAC ACGATGGACTCCAGAG ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA ACGATGGACTCCAGAGCGGCCGCBDNBNNNCGGT AAAAGTGCAGCTGATGAACGGGC GGCGGCGAATGCCATTGCGACAC ACCTTCTGGAGCCACACTTACACC CGCGGATCCATGACGAAATTTCCTCTTCTGAGC CCGGAATTCTTATTGTGTGATTTTACGCGTCAG
(TAIL PCR) were designed and were used to isolate the complete sequence. Arbitrary degenerate primers (AC, LAD1-1, LAD1-2, LAD1-3 and LAD1-4) were also designed and synthesized (Table 1). The reaction parameters and arbitrary degenerate primers for TAIL PCR were modified as described in the report by Liu and Chen [14]. Nucleotide and amino acid sequence homology searches were performed using the BLAST. The signal peptides and cleavage sites were predicted with the Signal program (http:// www.cbs.dtu.dk/services/SignalP). Bioinformatics analysis was performed with Vector NIT (Life technologies, NY, USA). 2.4. Expression and purification of recombinant R-b-Gal PCR was performed with primers Bgal-BamHI-F (forward) and Bgal-EcoRI-R (reverse) (Table 1) to amplify the R-b-Gal encoding sequences with an upstream BamHI site and a downstream EcoRI site incorporated in the forward and reverse primers, respectively. The PCR product was digested with BamHI and EcoRI and was inserted into the expression vector pCold I. The recombinant plasmid pCold I-Bgal was transformed into E. coli BL21 (DE3). The transformants were cultured at 37 °C in LB medium containing 100 lg/mL ampicillin with shaking (200 r/min) to an optimal density of 1.2 at 600 nm and were then transferred to 20 °C and were induced with 0.2 mM IPTG for an additional 32 h. The cells were harvested by centrifugation at 5000g for 30 min. Approximately 15 g of wet weight cells were obtained from 1 L of culture, and then resuspended in 50 ml binding buffer (6 mM imidazole, 20 mM Tris– HCl, 500 mM NaCl, pH 7.4). After the cells were disrupted by sonication on ice, the total lysate was cleared by centrifugation at 12,000g for 40 min at 4 °C and was then loaded onto a Ni–NTA Sefinose column (1.0 1.0 cm) (Sangon Biotech, Shanghai, China). Non-specific adsorbed materials were removed with a wash buffer (20 mM imidazole, 20 mM Tris–HCl, 500 mM NaCl, pH 7.4). The column was then eluted with an elution buffer (250 mM imidazole, 20 mM Tris–HCl, 500 mM NaCl, pH 7.4). The Ni-column eluent containing R-b-Gal appeared as a single band on 12% SDS PAGE. 2.5. Molecular mass determination The relative molecular weight of the purified R-b-Gal was estimated by size exclusion chromatography with HR 10/30 Superdex-200 column (GE Healthcare, MI, USA). Protein molecular mass standards (thyroglobumin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; aldolase 158 kDa; and ovalbumin, 43 kDa) were purchased from GE Healthcare. 2.6. Enzyme assay The hydrolytic activity of the recombinant R-b-Gal was determined by measuring the released ONP from ONPG and was quantified from the absorbance at 420 nm. One unit is defined as 1 lmol
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
of ONP released per minute. The reaction mixture contained 200 lL of diluted enzyme solution, 800 lL of 2.5 g/L ONPG in 10 mM potassium phosphate buffer (pH 6.5) and the reaction was stopped after 10 min of incubation at 35 °C by adding 1 mL of 10% (w/v) sodium carbonate. When lactose is the substrate, one unit of lactase activity is defined as the amount of enzyme required to release 1 lmol of D-glucose
per minute under given conditions. The reaction was initiated by adding 200 lL of diluted enzyme solution to 800 lL of 0.5% lactose in 10 mM potassium phosphate buffer (pH 6.5) and was stopped after incubation at 35 °C for 10 min by heating the mixture to 90 °C for 2 min. After being cooled to room temperature, the released D-glucose in the mixture was determined by both colorimetry using a commercial Glucose (GO) assay kit (Sigma–Aldrich, St. Louis, USA) and HPLC using a Rezex Rcm-Monosaccharide Ca+ (8%) column (Phenomenex Inc., CA, USA). 2.7. Effect of temperature, pH, and metal ions on enzymatic activity The effect of temperature on the recombinant R-b-Gal was determined by measuring the enzyme activity at temperatures ranging from 4 to 55 °C. The stability of the R-b-Gal with temperature was monitored by incubating the enzyme at specified temperatures for 2 h and withdrawing aliquots at 15 min interval [15]. The pH dependence of the enzyme activity was measured at pH values between 5.5 and 9.0 (pH 5.5–8.0, 10 mM potassium phosphate buffer; pH 8.0–9.0, 10 mM Tris–HCl buffer). To investigate the effects of metal ions on the enzyme activity, diluted R-b-Gal was first incubated with 10 mM EDTA at 4 °C for 20 min to remove any bound metal ions. Afterward, the enzyme was loaded onto an Econo-Pac 10DG Desalting column (Bio-Rad, CA, USA) and was eluted with 10 mM Tris–HCl (pH 6.5) buffer. The protein was assayed with 2.5 g/L ONPG in 10 mM Tris–HCl (pH 6.5) in the presence of various metal ions, including Na+, K+, Ca2+, Zn2+, Mg2+, Co2+, Mn2+, Fe3+, and Al3+, at a final concentration of 5 mM at 35 °C for 10 min. The enzyme sample eluted in purified water without any reagents was used as a control. 2.8. Kinetic parameters The kinetic parameters for ONPG and lactose were calculated by nonlinear regression, and the observed data were fit to the Michaelis–Menten equation using GraphPad Prism (GrahPad Software, Inc., CA, USA). The kinetic assays for ONPG and lactose
3
were measured in 10 mM potassium phosphate buffer (pH 6.5) with various concentrations of ONPG (1–35 mM) and lactose (1– 500 mM) at 4, 15, 25 and 35 °C. 2.9. Circular dichroism (CD) spectroscopy For the CD experiments, the buffer for the purified recombinant R-b-Gal was changed to the specified buffers (temperature stability: 10 mM, pH 6.5 potassium phosphate buffer; pH stability: pH 5.5–8.0 10 mM potassium phosphate buffer, pH 8.5–9.0 10 mM sodium borate buffer; metal ion stability: 5 mM different metal ion buffers) by repeated concentration and dilution in an Amicon Ultra centrifugal filter device with a 30 kDa molecular weight cutoff for proteins (Millipore, MA, USA). For each buffer, the protein was incubated at the specified temperature (temperature stability: 4, 15, 25, 35 and 45 °C; the other samples: 4 °C) for 1 h. The method for calculating the free energy of unfolding for a protein has been described in other reviews [16]. Spectra in the far-UV region (195–260 nm) were collected with a J-815 CD spectrometer (Jasco, Tokyo, Japan) and a quartz cuvette with a path length of 2.0 mm. Wavelength scans were performed at a speed of 50 nm/min at 20 °C, and 10 scans were accumulated for each sample and were displayed as mean residue ellipticity (° cm2/dmol 1). The protein concentration used for the CD measurements was 0.11 mg/mL. All the measurements were conducted three times separately. The results are presented as the means with standard deviations. The relative activities were estimated by comparison to the highest activity (100%). The nucleotide sequence of Rahnella sp. R3 b-gal was submitted to GenBank and was assigned accession number KM486621. 3. Results 3.1. Sequence analysis An R-b-Gal gene from Rahnella sp. R3 genomic DNA was successfully cloned by TAIL PCR. The entire R-b-Gal gene has an open reading frame of 2064 bp encoding 687 amino acid residues with a predicted mass of 77.1 kDa and a theoretical pI (isoelectric point) of 5.81. This enzyme contained 203 charged amino acid residues (29.6% by frequency), 173 polar amino acids (25.2%) and 243 hydrophobic amino acids (35.4%). The estimated a-helix and b-strand contents were 21% and 31%, respectively.
Fig. 1. Purification of R-b-Gal and determination of its oligomeric state. (A) SDS PAGE analysis of the purified recombinant R-b-Gal expressed in E. coli. Lane 1: Molecular mass standards (kDa); Lane 2: cell lysate; Lane 3: purified R-b-Gal. (B) Estimation of molecular weight of R-b-Gal in solution using size exclusion chromatography. Protein molecular mass standards (d) and purified R-b-Gal (N) was applied to a HR 10/30 Superdex-200 column. The molecular mass of R-b-Gal was calculated by calibration curve determined with the elution of the protein standards.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
4
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
The R-b-Gal was classified as a candidate of the GH (glycosyl hydrolase) family 42, which contains an A4 b-galactosidase fold. Sequence analysis showed that the R-b-Gal gene had high sequence similarity to the genes from R. aquatilis CIP 78.65 [11], Rahnlla sp. Y9602, and R. aquatilis HX2. On the protein level, the R-b-Gal shared 91% identity with the b-Gals from R. aquatilis (WP_015696732) and Rahnella sp. Y9602 (WP_013574914). 3.2. Expression and purification of the recombinant R-b-Gal The R-b-Gal was expressed in E. coli BL21 (DE3) and was purified. SDS PAGE analysis showed that the purified recombinant R-b-Gal expressed in E. coli BL21 (DE3) had a single band of approximately 73 kDa (Fig. 1A), which was consistent with the molecular mass deduced from the protein sequence (77.1 kDa). In addition, the relative molecular mass of the purified enzyme was estimated to be 225 kDa (Fig. 1B) according to size exclusion chromatography, indicating that the R-b-Gal was a homo-trimer. This was consistent with the reported oligomeric state of several other b-galactosidases [17–19]. 3.3. Enzyme properties 3.3.1. Effect of temperature The temperature dependence of the activity of the recombinant R-b-Gal is shown in Fig. 2A. With ONPG as the substrate, the highest hydrolytic activity was achieved at 35 °C; this activity corresponds to a specified activity of 27 U/mg, and 27% of the maximum activity was retained at 4 °C. When lactose was the substrate, the enzyme showed high activity in a wide and low temperature range from 4 to 35 °C; additionally, it displayed nearly 80% of maximum activity at 4 °C. High-activity in this low ambient temperature range distinguished this enzyme from most of the previously reported cold-adapted b-Gals from Arthrobacter psychrolactophilus (optimum temperature range: 15–20 °C) [20], Antarctic Arthrobacter (40–50 °C) [17] and Antarctic bacterium Pseudoalteromonas (35–45 °C) [21]. Thermostability assays with different substrates (Fig. 2B and C) showed that the cold-adapted R-b-Gal was stable at temperatures of 35 °C or lower for at least 2 h. However, approximately 70% of the maximum activity was lost within 15 min when the enzyme was incubated above 45 °C, and complete deactivation occurred with 5 min at 55 °C or higher temperatures. 3.3.2. Effect of pH The R-b-Gal demonstrated high and relatively stable activity in the pH range of 5.5–8.0 (10 mM potassium phosphate buffer) with lactose as the substrate (Fig. 3). When ONPG was the substrate, the pH dependence was more obvious, and the optimal activity was at pH 6.5. Furthermore, Tris–HCl buffer (pH 8.0–9.0) significantly reduced enzyme activity even at a concentration of 10 mM and completely deactivated the enzyme at a concentration of 100 mM (data not shown). 3.3.3. Effect of metal ions Some b-Gals use metal ions, such as Mg2+, Mn2+ and Na+, as co-factors for their hydrolytic activities [6,22]. Moreover, metal ions can also induce structural changes that lead to denaturation of the enzyme. To test whether metal ions have any effect on the catalytic activity of R-b-Gal, the protein was first treated with EDTA to remove divalent metal ions. Different metal ions (5 mM) were added to the enzyme solution and the enzyme activity was examined (Fig. 4). Na+, K+ and Co2+ were found to slightly reduce enzyme activity whereas Ca2+, Mg2+, and Mn2+ increased the activity by approximately 15%. Therefore, according to these data, metal ions might not be required for enzyme activity. Additionally, Zn2+,
Fig. 2. Effect of temperature on the recombinant R-b-Gal. (A) Enzyme activity measured at 35 °C for 10 min with 2.5 g/L ONPG (d) and 0.05 g/L lactose (j) as the substrates. (B) Thermostability of R-b-Gal with 2.5 g/L ONPG as the substrate: preincubation of R-b-Gal at 4 °C (d); 15 °C (j); 25 °C (N); 35 °C (.); 45 °C () and 55 °C (s) for various time points. (C) Thermostability of R-b-Gal with 0.05 g/L lactose as the substrate: preincubation of R-b-Gal at 4 °C (d); 15 °C (j); 25 °C (N); 35 °C (.); 45 °C () and 55 °C (s) for various time points.
Fe3+ and Al3+ apparently deactivated the R-b-Gal. To further investigate the effect of Zn2+, Fe3+ and Al3+ on the enzyme activity, we incubated the R-b-Gal at a higher concentration than that used to measure activity with 5 mM Zn2+, Fe3+ and Al3+ at 4 °C. After 10 min, the samples were centrifuged at 14000g for 10 min and then the concentration was measured. The results showed that when treated with Fe3+, the protein concentration remained nearly unchanged. However, the protein concentration was much lower while treated with Zn2+ and Al3+. Thus, we propose Fe3+ might inactive the enzyme, while Zn2+ and Al3+ might mostly precipitate the enzyme.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
5
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
Fig. 3. Effect of pH on the activity of the recombinant R-b-Gal with 2.5 g/L ONPG (d) and 0.05 g/L lactose (j) as the substrates. Buffers: pH 5.5–8.0, 10 mM potassium phosphate; pH 8.0–9.0, 10 mM Tris–HCl.
3.3.5. Structural characterization by CD spectroscopy The CD spectra of the recombinant R-b-Gal (Fig. 5A) suggest that it is a typical protein with mixed a-helix and b-sheet secondary structures [23]. The effect of temperature on the secondary structure of the R-b-Gal was monitored by collecting CD spectra of the enzyme samples after they were incubated at 4, 15, 25, 35 and 45 °C for 1 h. No discernible changes in the secondary structures could be detected when the incubation was at 35 °C or lower (Fig. 5A). However, when the sample was incubated at 45 °C, the characteristic protein spectra almost completely disappeared. The enzyme’s secondary structure varied slightly under different pH conditions, as shown in Fig. 5B. Between pH 7.0 and 8.0, the conformation of the R-b-Gal was essentially unchanged. The different metal ions had significant effects on the enzyme conformations (Fig. 5C). Whereas Na+, Mg2+ and Mn2+ did not the change enzyme structure and Ca2+ only slightly affected the secondary structure. 4. Discussion
Fig. 4. Effect of various metal ions (5 mM) on the activity of the recombinant R-bGal. The enzyme without EDTA-treatment (none) was included for comparison.
3.3.4. Kinetic properties The kinetic parameters for the reaction with both the ONPG and lactose substrates were calculated (Table 2). At the same temperature, the half saturation coefficient (Km) for lactose was much smaller than that for ONPG, indicating the R-b-Gal had a higher affinity for lactose. Interestingly, the Vmax for ONPG increased as the temperature increased whereas the Vmax for lactose did not change significantly with temperature. As a result, the Kcat/Km for ONPG at each temperature was close to that for lactose. Furthermore, the variation in Kcat/Km was in good agreement with the relative activity examined at different temperatures (Fig. 2A).
In this study, a novel cold-adapted b-Gal from Rahnella sp. R3 was cloned and expressed, and the enzymatic properties were systematically investigated. Several cold-adapted b-Gals from Rahnella strains, including Rahnella sp. BS 1, Rahnella sp. HS-39 [12] and R. aquatilis 14-1 [13] had previously been discovered; however, information about their gene sequences and lactose hydrolysis activities were limited. Sequence analysis showed that R-b-Gal shared high sequence homology to the other b-Gals in GH42. For this reason, this enzyme can be tentatively classified as a GH42 enzyme, which usually have a catalytic dyad at the C-terminal ends of b-strands 4 and 7 within a classical (b/a) 8 TIM barrel (domain A) [19]. The enzyme cloned in this study hydrolyzed glycosidic bonds involving galactosyl, such as those in lactose and ONPG. The enzyme exhibited relative high activity toward lactose at 4 °C and pH 6.0–8.0, therefore it may potentially be used in dairy production [5]. Heat lability is a common property of most cold-adapted enzymes [24] with a few exceptions [7]. Not surprisingly, the R-b-Gal was denatured at 40 °C according to the CD investigation. However, its conformation was unchanged in the temperature range from 4 to 35 °C (Fig. 5A), so its active site was not affected. This finding is also consistent with the results shown in Fig. 2. Thus, the increase in the activity of the enzyme over this temperature range (Fig. 2A) could be attributed to the acceleration of the catalytic reaction with increasing temperature. The increase in Vmax for ONPG in Table 2 was caused by acceleration of the reaction by temperature. Km reflects the affinity of the active site for the substrate and is determined by both the geometry of the active site and the substrate. Consequently, there was no significant change in Km as the temperature increased (Table 2). pH represents the concentration of H+ in aqueous solutions. The pH value determines the dissociation state of charged amino acids
Table 2 Kinetic parameters for R-b-Gal. 1
Substrate
Temperature (°C)
Km (mM)
Vmax (U/mg)
Kcat (s
ONPG
4 15 25 35
6.5 ± 0.65 9.3 ± 1.46 8.0 ± 0.45 10.8 ± 0.54
6.2 ± 0.16 8.9 ± 0.46 18.3 ± 0.32 33.7 ± 0.60
7.9 ± 0.21 11.4 ± 0.59 23.5 ± 0.41 43.2 ± 0.77
)
Kcat/Km (s 1.2 ± 0.13 1.2 ± 0.20 3.0 ± 0.17 4.0 ± 0.21
Lactose
4 15 25 35
2.2 ± 0.59 1.5 ± 0.48 0.9 ± 0.22 1.4 ± 0.60
1.94 ± 0.08 2.3 ± 0.10 1.97 ± 0.06 2.3 ± 0.13
2.5 ± 0.10 3.0 ± 0.13 2.54 ± 0.07 3.0 ± 0.18
1.1 ± 0.31 2.0 ± 0.68 2.9 ± 0.73 2.2 ± 0.95
1
mM
1
)
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
6
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
Various metal ions played different roles in the enzymatic reactions. The EDTA-treated enzyme demonstrated activity close to that of the untreated enzyme, indicating that this enzyme was independent of divalent metal ions. Na+ and K+ may help stabilize the enzyme conformation but had no influence on hydrolysis. Mg2+ and Mn2+ induced unnoticeable increases in the enzyme activity (Fig. 4) and did not induce changes in the secondary structures (Fig. 5C). These effects might be involved in the transfer of electrons and lowering of the activation energy. Interestingly, the CD curve for the sample supplemented with Ca2+, which is supposed to be an activator, is slightly different from that for the other activators (Mg2+ and Mn2+). This result suggests that some partial secondary structure change induced by Ca2+ might result in a more suitable conformation for the enzyme reaction. Co2+ caused partially breakage of the secondary structures (Fig. 5C); however, this change may take place far from the active sites. As a result, the geometry of the active site was slightly affected and the corresponding activity decreased mildly (Fig. 4). Zn2+ is a transition metal ion containing empty d-orbitals; therefore, it is able to complex with certain residues, such as His, Lys and Trp, from the same or different enzyme molecules. Its attachment can cause enzyme aggregation, which can be confirmed by the deduction of enzyme concentration upon the addition of Zn2+. CD spectra of the enzyme in the presence of Al3+ showed that Al3+ might partially precipitate the protein, so we propose that Al3+ could unfold and aggregate the enzyme. While according to the results of CD and enzyme precipitation, Co2+ and Zn2+ mainly precipitated the enzyme. R-b-Gal was capable of hydrolyzing both ONPG and lactose; however, the Km for lactose was 3 to 10 times smaller than that for ONPG. This finding is in contrast to previously reported results [25,26]. It is easy to understand that b-Gal was synthesized by the host to digest lactose; therefore, the geometry of its active site has high affinity to lactose. The Vmax for converting lactose increased significantly with a rise in temperature (Table 2), and the increase means this reaction has a low activation energy and is a kinetically controlled process. Unexpectedly, the Vmax for converting lactose remained low over a temperature range from 4 to 35 °C (Table 2). We tentatively propose that lactose hydrolysis by the enzyme has a relatively high activation energy and was a thermodynamically controlled process. Although the Kcat/Km values for ONPG and lactose are close, the mechanisms for the two substrates are different. Conflict of interest The authors declare no conflict of interest. Acknowledgments
Fig. 5. CD spectral characterization of enzyme structure. (A) Effect of temperature on enzyme structure. (B) Effect of pH on enzyme structure. (C) Effect of metal ions on enzyme structure.
We are grateful to the Key project of the National Natural Science Fund (31230057) and the National Key Technology R&D Program in the 12th Five year Plan of China (2011BAD23B03) for financial support. The author is grateful to for the visiting scholarship funded by the China Scholarship Council. References
(e.g., glutamic acid, aspartic acid and histidine) and consequently alters the charge distribution on the protein surface and affects electrostatic interactions. In the data presented here for R-b-Gal, the overall secondary structural components were not affected at weakly acidic (5.5) to weakly basic (9.0) pH values (Fig. 5B). Correspondingly, the enzyme activity remained stable over this pH range when lactose was the substrate (Fig. 3). Additionally, the low activity in Tris–HCl buffer could be attributed to the interaction between Tris and the enzyme.
[1] D. Georlette, M. Bentahir, P. Claverie, T. Collins, S. Damico, D. Delille, G. Fellee, E. Gratia, A. Hoyoux, T. Lonhienne, M.-A. Meuwis, L. Zecchinon, Ch. Gerday, Cold-adapted enzymes, Phys. Chem. Basis Biotechnol. (2002) 177–196. Springer. [2] K.S. Siddiqui, R. Cavicchioli, Cold-adapted enzymes, Annu. Rev. Biochem. 75 (2006) 403–433. [3] R. Margesin, F. Schinner, Cold-Adapted Organisms Ecology Physiology Enzymology and Molecular Biology, Springer Science & Business Media, 1999. [4] T. Nakagawa, Y. Fujimoto, R. Ikehata, T. Miyaji, N. Tomizuka, Purification and molecular characterization of cold-active b-galactosidase from Arthrobacter psychrolactophilus strain F2, Appl. Microbiol. Biotechnol. 72 (2006) 720–725.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx [5] L. Van Den Berg, Changes in pH of milk during freezing and frozen storage, J. Dairy Sci. 44 (1961) 26–31. [6] P. Karasová-Lipovová, H. Strnad, V. Spiwok, Š. Malá, B. Králová, N.J. Russell, The cloning, purification and characterisation of a cold-active b-galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter sp. C2-2, Enzyme Microb. Technol. 33 (2003) 836–844. [7] V. Vincent, N. Aghajari, N. Pollet, A. Boisson, S. Boudebbouze, R. Haser, E. Maguin, M. Rhimi, The acid tolerant and cold-active b-galactosidase from Lactococcus lactis strain is an attractive biocatalyst for lactose hydrolysis, Antonie Van Leeuwenhoek 103 (2013) 701–712. [8] G.X. Wang, Y. Gao, B. Hu, X.L. Lu, X.Y. Liu, B.H. Jiao, A novel cold-adapted betagalactosidase isolated from Halomonas sp. S62: gene cloning, purification and enzymatic characterization, World J. Microb. Biotechnol. 29 (2013) 1473–1480. [9] D. Izard, F. Gavini, P. Trinel, H. Leclerc, Rahnella-aquatilis, new member of the enterobacteriaceae, Ann. Microbiol. (Paris) (1979) 163–177. [10] Y. Guo, Z. Jiao, L. Li, D. Wu, D.E. Crowley, Y. Wang, W. Wu, Draft genome sequence of Rahnella aquatilis Strain HX2, a plant growth-promoting rhizobacterium isolated from vineyard soil in Beijing, China, J. Bacteriol. 194 (2012) 6646–6647. [11] R.J. Martinez, D. Bruce, C. Detter, L.A. Goodwin, J. Han, C.S. Han, B. Held, M.L. Land, N. Mikhailova, M. Nolan, L. Pennacchio, S. Pitluck, R. Tapia, T. Woyke, P.A. Sobecky, Complete genome sequence of Rahnella sp. strain Y9602, a Gammaproteobacterium isolate from metal-and radionuclide-contaminated soil, J. Bacteriol. 194 (2012) 2113–2114. [12] J.W. Park, Y.S. Oh, J.Y. Lim, D.H. Roh, Isolation and characterization of coldadapted strains producing b-galactosidase, J. Microbiol. (Seoul Korea) 44 (2006) 396–402. [13] W. Liu, Y. Shi, X. Wang, C. Wei, K. Lou, Isolation and identification of a strain producing cold-adapted b-galactosidase, and purification and characterisation of the enzyme, CZECH J. Food Sci. 26 (2008) 284–290. [14] Y.G. Liu, Y. Chen, High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences, Biotechniques 43 (2007) 649–656. [15] W. Chen, H. Chen, Y. Xia, J. Zhao, F. Tian, H. Zhang, Production, purification, and characterization of a potential thermostable galactosidase for milk lactose hydrolysis from Bacillus stearothermophilus, J. Dairy Sci. 91 (2008) 1751–1758.
7
[16] Y.Z. Zhang, W.X. Du, C. Fregevu, M.H. Kothary, L.A. Harden, T. McHugh, Expression, purification, and characterization of almond (Prunus dulcis) allergen Pru du 4, J. Agric. Food Chem. 52 (2014) 12695–12700. [17] P. Hildebrandt, M. Wanarska, J. Kur, A new cold-adapted b-D-galactosidase from the Antarctic Arthrobacter sp. 32c–gene cloning, overexpression, purification and properties, BMC Microbiol. 9 (2009) 151. [18] S.W.A. Hinz, L.A.M. van den Broek, G. Beldman, J.P. Vincken, A.G.J. Voragen, bgalactosidase from Bifidobacterium adolescentis DSM20083 prefers b(1,4)galactosides over lactose, Appl. Microbiol. Biotechnol. 66 (2004) 276–284. [19] M. Hidaka, S. Fushinobu, N. Ohtsu, H. Motoshima, H. Matsuzawa, H. Shoun, T. Wakagi, Trimeric crystal structure of the glycoside hydrolase family 42 bgalactosidase from Thermus thermophilus A4 and the structure of its complex with galactose, J. Mol. Biol. 1 (2002) 79–91. [20] J.A. Coker, P.P. Sheridan, J. Loveland-Curtze, K.R. Gutshall, A.J. Auman, J.E. Brenchley, Biochemical characterization of a b-galactosidase with a low temperature optimum obtained from an Antarctic Arthrobacter isolate, J. Bacteriol. 185 (2003) 5473–5482. [21] H. Cies´lin´ski, J. Kur, A. Białkowska, I. Baran, K. Makowski, M. Turkiewicz, Cloning, expression, and purification of a recombinant cold-adapted bgalactosidase from Antarctic bacterium Pseudoalteromonas sp. 22b, Protein Expression Purif. 39 (2005) 27–34. [22] J.B. Bultema, B.J. Kuipers, L. Dijkhuizen, Biochemical characterization of mutants in the active site residues of the b-galactosidase enzyme of Bacillus circulans ATCC 31382, FEBS Open Bio. 4 (2014) 1015–1020. [23] N.J. Greenfield, Using circular dichroism spectra to estimate protein secondary structure, Nat. Protoc. 1 (2006) 2876–2890. [24] N.J. Russell, Toward a molecular understanding of cold activity of enzymes from psychrophiles, Extremophiles 4 (2000) 83–90. [25] T.H. Nguyen, B. Splechtna, M. Steinböck, W. Kneifel, H.P. Lettner, K.D. Kulbe, D. Haltrich, Purification and characterization of two novel b-galactosidases from Lactobacillus reuteri, J. Agric. Food Chem. 54 (2006) 4989–4998. [26] N.M. Samoshina, V.V. Samoshin, The michaelis constants ratio for two substrates with a series of fungal (mould and yeast) b-galactosidases, Enzyme Microb. Technol. 36 (2005) 239–251.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
Contents lists available at ScienceDirect
Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep
Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3 Yuting Fan a,b, Xiao Hua a, Yuzhu Zhang c, Yinghui Feng b, Qiuyun Shen b, Juan Dong a, Wei Zhao b, Wenbin Zhang b, Zhengyu Jin a, Ruijin Yang a,b,⇑ a b c
State Key Laboratory of Food Science and Technology, Jiangnan University, 214122 Wuxi, China School of Food Science and Technology, Jiangnan University, 214122 Wuxi, China U.S. Department of Agriculture, Agriculture Research Service, Pacific West Area, Western Regional Research Center, Albany, CA 94710, United States
a r t i c l e
i n f o
Article history: Received 22 May 2015 and in revised form 2 July 2015 Accepted 2 July 2015 Available online xxxx Keywords: b-Galactosidase Cold-adapted enzyme Enzyme structure stability Lactose hydrolysis
a b s t r a c t A novel gene was isolated for the first time from a psychrophilic gram-negative bacterium Rahnella sp. R3. The gene encoded a cold-adapted b-galactosidase (R-b-Gal). Recombinant R-b-Gal was expressed in Escherichia coli BL21 (DE3), purified and characterized. R-b-gal belongs to the glycosyl hydrolase family 42. Circular dichroism spectrometry of the structural stability of R-b-Gal with respect to temperature indicated that the secondary structures of the enzyme were stable to 45 °C. In solution, the enzyme was a homo-trimer and was active at temperatures as low as 4 °C. The enzyme did not require the presence of metal ions to be active, but Mg2+, Mn2+, and Ca2+ enhanced its activity slightly, whereas Fe3+, Zn2+ and Al3+ appeared to inactive it. The purified enzyme displayed Km values of 6.5 mM for ONPG and 2.2 mM for lactose at 4 °C. These values were lower than the corresponding Kms reported for other cold-adapted b-Gals. Ó 2015 Elsevier Inc. All rights reserved.
1. Introduction Cold-adapted enzymes isolated from psychrophilic microorganisms are capable of functioning at low temperatures ranging from 0 to 30 °C. These enzymes are extremely powerful tools for not only biotechnological purposes but also for industrial applications [1]. Because of their highly flexible structures, cold-adapted enzymes unfold at low to moderate temperatures [2], and unfolding can result in enzyme inactivation. The inactivation of enzymes at moderate temperatures is convenient in practice but also restricts reactions to low temperatures. Enzymes catalyze specific reactions at their catalytic sites, whose geometry is usually maintained under certain conditions (temperature, pH, presence of salts, etc.). As the ambient temperature increases, structural variations (of the secondary and tertiary structures) in cold-adapted enzymes distort the active site and decrease the enzyme’s activity. Thus,
Abbreviations: b-Gal, b-galactosidase; R-b-Gal, cold-adapted b-galactosidase from Rahnella sp. R3; X-Gal, 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside; ONPG, ortho-nitrophenyl-b-galactoside; ONP, o-nitrophenol; CD, circular dichroism spectroscopy. ⇑ Corresponding author at: School of Food Science and Technology, Jiangnan University, 214122 Wuxi, China. E-mail addresses: [email protected] (Y. Fan), [email protected] (X. Hua), [email protected] (R. Yang).
understanding the mechanism of conformational variations with environmental changes for cold-adapted enzymes is undoubtedly instructive to engineering enzymes with specific purposes. b-Galactosidases (EC 3.2.1.23) (b-Gals) from many organisms have been widely used in food manufacturing, such as in dairy processing (to hydrolyze lactose) and the synthesis of functional oligosaccharides. These enzymes play a crucial role in overcoming lactose intolerance, which is a global health issue, especially in Asia because of the lack of b-Gal in the human intestine. Cold-adapted b-Gals isolated from psychrophilic and psychrotrophic microorganisms living in cold environments (below 5 °C) [3] can be used to process dairy products at 4 °C to avoid spoilage and flavor changes [4]. Currently, the major commercial b-Gals used in lactose hydrolysis, such as Lactozym PureÒ (Novozymes) and MaxilactÒ (DSM Food Specialties), are usually optimally active at moderate temperatures (around 37 °C) but display low activity at 4 °C. Thus, the dairy industry is in great need of cold-adapted b-Gals that are optimally active at conditions compatible with dairy processing (pH 6.5, and not inhibited by sodium, calcium or glucose) [5]. In recent years, several cold-adapted b-Gals have been isolated from different sources including Arthrobacter sp. C2-2 [6], Lactococcus lactis IL1403 [7] and Halomonas sp. S62 [8]. Recently, we discovered a cold-adapted b-Gal from Rahnella sp. R3
http://dx.doi.org/10.1016/j.pep.2015.07.001 1046-5928/Ó 2015 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
2
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
(R-b-Gal), a psychrophilic microorganism isolated from the No. 1 Glacier in the Tianshan Mountains (Xinjiang, China). The Rahnella species, first isolated from water samples in France [9], are gram-negative and facultative anaerobes [10,11]. To date, three Rahnella strains, namely Rahnella sp. BS 1, Rahnella sp. HS-39 [12] and Rahnella aquatilis 14-1 [13], have been reported to produce b-Gals with different enzymatic properties. In comparison to these b-Gals, R-b-Gal from Rahnella sp. R3 exhibited much higher catalytic activity (27 U/mg) at low temperatures. In the present work, R-b-Gal was cloned and expressed in Escherichia coli BL21 (DE3). The variations in enzyme activity with temperature, pH and metal ions, were investigated with substrates of ONPG and lactose. The kinetic parameters (Km, Vmax and Kcat) were calculated by nonlinear regression. The structural stability was investigated by circular dichroism (CD) spectroscopy to monitor the variations in conformation (secondary structure) when the enzyme was incubated under different conditions. Furthermore, the relationship between enzyme structure and activity is discussed; future research will attempt to elucidate the evolution of this enzyme. 2. Materials and methods 2.1. Materials 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside (X-Gal) was purchased from Sangon Biotech (Shanghai, China). orthoNitrophenyl-b-galactoside (ONPG) and o-nitrophenol (ONP) were purchased from Sigma–Aldrich (St. Louis, MO, USA). All the restriction enzymes were obtained from Takara Biotechnology Co., Ltd. (Dalian, China) and were used according to the manufacturer’s instructions. Nutrient media were supplied by Oxoid (Basingstoke, UK). All other reagents were analytical grade and were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). 2.2. Bacterial strains, plasmids, growth conditions The Rahnella sp. R3 strain (CCTCC NO. M2012250) was isolated from frozen soil samples obtained by our group from Glacier No. 1, Tianshan Mountains. The strain was cultivated in Luria Broth (LB, 10 g/L tryptone, 5 g/L yeast extract and 10 g/L NaCl) and was grown at 15 °C with rotary shaking at 200 r/min for 24 h. E. coli DH5a and BL21 (DE3) (stored in our lab) were cultured in LB medium supplemented, as necessary, with ampicillin (100 lg/mL), X-Gal (40 lg/mL), and IPTG (24 lg/mL). The cloning vector pMD19-T and expression vector pCold I (Takara, Dalian, China) were used following the manufacturer’s instructions. 2.3. R-b-Gal gene cloning The Rahnella sp. R3 strain was grown at 15 °C in LB to the mid-log phase, and the chromosomal DNA from the cells was isolated using a Genomic DNA Prep Kit (Sangon Biotech, Shanghai, China) according to the protocol for gram-negative bacteria. A partial gene sequence was amplified using a pair of primers RQ-F1 and RQ-R1 (Table 1) designed from highly conserved regions, which were identified by multiple sequence alignment of amino acid sequences of b-Gals from the Rahnella genus. PCR amplification was performed in an Applied Biosystem ProFlex™ 3 32-well PCR System (Life technologies, NY, USA), and the amplified fragment of expected size was gel purified and was cloned into a pMD19-T vector for sequencing. The sequence of the amplified fragment was analyzed by the BLAST (National Center of Biotechnology Information, USA), and nested sequence-specific primers (sp1, sp2, sp3) for thermal asymmetric interlaced PCR
Table 1 Primers used for R-b-Gal cloning. Primer name
Primer sequence
RQ-F1 RQ-R2 AC LAD1-1 LAD1-2 LAD1-3 LAD1-4 Sp1 Sp2 Sp3 Bgal-BamH I-F Bgal-EcoR I-R
ATGACGAAATTTCCTCTTCTGAGC TSACCTGATCGGTGTTAAAACGAC ACGATGGACTCCAGAG ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA ACGATGGACTCCAGAGCGGCCGCBNBNNNGGTT ACGATGGACTCCAGAGCGGCCGCVVNVNNNCCAA ACGATGGACTCCAGAGCGGCCGCBDNBNNNCGGT AAAAGTGCAGCTGATGAACGGGC GGCGGCGAATGCCATTGCGACAC ACCTTCTGGAGCCACACTTACACC CGCGGATCCATGACGAAATTTCCTCTTCTGAGC CCGGAATTCTTATTGTGTGATTTTACGCGTCAG
(TAIL PCR) were designed and were used to isolate the complete sequence. Arbitrary degenerate primers (AC, LAD1-1, LAD1-2, LAD1-3 and LAD1-4) were also designed and synthesized (Table 1). The reaction parameters and arbitrary degenerate primers for TAIL PCR were modified as described in the report by Liu and Chen [14]. Nucleotide and amino acid sequence homology searches were performed using the BLAST. The signal peptides and cleavage sites were predicted with the Signal program (http:// www.cbs.dtu.dk/services/SignalP). Bioinformatics analysis was performed with Vector NIT (Life technologies, NY, USA). 2.4. Expression and purification of recombinant R-b-Gal PCR was performed with primers Bgal-BamHI-F (forward) and Bgal-EcoRI-R (reverse) (Table 1) to amplify the R-b-Gal encoding sequences with an upstream BamHI site and a downstream EcoRI site incorporated in the forward and reverse primers, respectively. The PCR product was digested with BamHI and EcoRI and was inserted into the expression vector pCold I. The recombinant plasmid pCold I-Bgal was transformed into E. coli BL21 (DE3). The transformants were cultured at 37 °C in LB medium containing 100 lg/mL ampicillin with shaking (200 r/min) to an optimal density of 1.2 at 600 nm and were then transferred to 20 °C and were induced with 0.2 mM IPTG for an additional 32 h. The cells were harvested by centrifugation at 5000g for 30 min. Approximately 15 g of wet weight cells were obtained from 1 L of culture, and then resuspended in 50 ml binding buffer (6 mM imidazole, 20 mM Tris– HCl, 500 mM NaCl, pH 7.4). After the cells were disrupted by sonication on ice, the total lysate was cleared by centrifugation at 12,000g for 40 min at 4 °C and was then loaded onto a Ni–NTA Sefinose column (1.0 1.0 cm) (Sangon Biotech, Shanghai, China). Non-specific adsorbed materials were removed with a wash buffer (20 mM imidazole, 20 mM Tris–HCl, 500 mM NaCl, pH 7.4). The column was then eluted with an elution buffer (250 mM imidazole, 20 mM Tris–HCl, 500 mM NaCl, pH 7.4). The Ni-column eluent containing R-b-Gal appeared as a single band on 12% SDS PAGE. 2.5. Molecular mass determination The relative molecular weight of the purified R-b-Gal was estimated by size exclusion chromatography with HR 10/30 Superdex-200 column (GE Healthcare, MI, USA). Protein molecular mass standards (thyroglobumin, 669 kDa; ferritin, 440 kDa; catalase, 232 kDa; aldolase 158 kDa; and ovalbumin, 43 kDa) were purchased from GE Healthcare. 2.6. Enzyme assay The hydrolytic activity of the recombinant R-b-Gal was determined by measuring the released ONP from ONPG and was quantified from the absorbance at 420 nm. One unit is defined as 1 lmol
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
of ONP released per minute. The reaction mixture contained 200 lL of diluted enzyme solution, 800 lL of 2.5 g/L ONPG in 10 mM potassium phosphate buffer (pH 6.5) and the reaction was stopped after 10 min of incubation at 35 °C by adding 1 mL of 10% (w/v) sodium carbonate. When lactose is the substrate, one unit of lactase activity is defined as the amount of enzyme required to release 1 lmol of D-glucose
per minute under given conditions. The reaction was initiated by adding 200 lL of diluted enzyme solution to 800 lL of 0.5% lactose in 10 mM potassium phosphate buffer (pH 6.5) and was stopped after incubation at 35 °C for 10 min by heating the mixture to 90 °C for 2 min. After being cooled to room temperature, the released D-glucose in the mixture was determined by both colorimetry using a commercial Glucose (GO) assay kit (Sigma–Aldrich, St. Louis, USA) and HPLC using a Rezex Rcm-Monosaccharide Ca+ (8%) column (Phenomenex Inc., CA, USA). 2.7. Effect of temperature, pH, and metal ions on enzymatic activity The effect of temperature on the recombinant R-b-Gal was determined by measuring the enzyme activity at temperatures ranging from 4 to 55 °C. The stability of the R-b-Gal with temperature was monitored by incubating the enzyme at specified temperatures for 2 h and withdrawing aliquots at 15 min interval [15]. The pH dependence of the enzyme activity was measured at pH values between 5.5 and 9.0 (pH 5.5–8.0, 10 mM potassium phosphate buffer; pH 8.0–9.0, 10 mM Tris–HCl buffer). To investigate the effects of metal ions on the enzyme activity, diluted R-b-Gal was first incubated with 10 mM EDTA at 4 °C for 20 min to remove any bound metal ions. Afterward, the enzyme was loaded onto an Econo-Pac 10DG Desalting column (Bio-Rad, CA, USA) and was eluted with 10 mM Tris–HCl (pH 6.5) buffer. The protein was assayed with 2.5 g/L ONPG in 10 mM Tris–HCl (pH 6.5) in the presence of various metal ions, including Na+, K+, Ca2+, Zn2+, Mg2+, Co2+, Mn2+, Fe3+, and Al3+, at a final concentration of 5 mM at 35 °C for 10 min. The enzyme sample eluted in purified water without any reagents was used as a control. 2.8. Kinetic parameters The kinetic parameters for ONPG and lactose were calculated by nonlinear regression, and the observed data were fit to the Michaelis–Menten equation using GraphPad Prism (GrahPad Software, Inc., CA, USA). The kinetic assays for ONPG and lactose
3
were measured in 10 mM potassium phosphate buffer (pH 6.5) with various concentrations of ONPG (1–35 mM) and lactose (1– 500 mM) at 4, 15, 25 and 35 °C. 2.9. Circular dichroism (CD) spectroscopy For the CD experiments, the buffer for the purified recombinant R-b-Gal was changed to the specified buffers (temperature stability: 10 mM, pH 6.5 potassium phosphate buffer; pH stability: pH 5.5–8.0 10 mM potassium phosphate buffer, pH 8.5–9.0 10 mM sodium borate buffer; metal ion stability: 5 mM different metal ion buffers) by repeated concentration and dilution in an Amicon Ultra centrifugal filter device with a 30 kDa molecular weight cutoff for proteins (Millipore, MA, USA). For each buffer, the protein was incubated at the specified temperature (temperature stability: 4, 15, 25, 35 and 45 °C; the other samples: 4 °C) for 1 h. The method for calculating the free energy of unfolding for a protein has been described in other reviews [16]. Spectra in the far-UV region (195–260 nm) were collected with a J-815 CD spectrometer (Jasco, Tokyo, Japan) and a quartz cuvette with a path length of 2.0 mm. Wavelength scans were performed at a speed of 50 nm/min at 20 °C, and 10 scans were accumulated for each sample and were displayed as mean residue ellipticity (° cm2/dmol 1). The protein concentration used for the CD measurements was 0.11 mg/mL. All the measurements were conducted three times separately. The results are presented as the means with standard deviations. The relative activities were estimated by comparison to the highest activity (100%). The nucleotide sequence of Rahnella sp. R3 b-gal was submitted to GenBank and was assigned accession number KM486621. 3. Results 3.1. Sequence analysis An R-b-Gal gene from Rahnella sp. R3 genomic DNA was successfully cloned by TAIL PCR. The entire R-b-Gal gene has an open reading frame of 2064 bp encoding 687 amino acid residues with a predicted mass of 77.1 kDa and a theoretical pI (isoelectric point) of 5.81. This enzyme contained 203 charged amino acid residues (29.6% by frequency), 173 polar amino acids (25.2%) and 243 hydrophobic amino acids (35.4%). The estimated a-helix and b-strand contents were 21% and 31%, respectively.
Fig. 1. Purification of R-b-Gal and determination of its oligomeric state. (A) SDS PAGE analysis of the purified recombinant R-b-Gal expressed in E. coli. Lane 1: Molecular mass standards (kDa); Lane 2: cell lysate; Lane 3: purified R-b-Gal. (B) Estimation of molecular weight of R-b-Gal in solution using size exclusion chromatography. Protein molecular mass standards (d) and purified R-b-Gal (N) was applied to a HR 10/30 Superdex-200 column. The molecular mass of R-b-Gal was calculated by calibration curve determined with the elution of the protein standards.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
4
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
The R-b-Gal was classified as a candidate of the GH (glycosyl hydrolase) family 42, which contains an A4 b-galactosidase fold. Sequence analysis showed that the R-b-Gal gene had high sequence similarity to the genes from R. aquatilis CIP 78.65 [11], Rahnlla sp. Y9602, and R. aquatilis HX2. On the protein level, the R-b-Gal shared 91% identity with the b-Gals from R. aquatilis (WP_015696732) and Rahnella sp. Y9602 (WP_013574914). 3.2. Expression and purification of the recombinant R-b-Gal The R-b-Gal was expressed in E. coli BL21 (DE3) and was purified. SDS PAGE analysis showed that the purified recombinant R-b-Gal expressed in E. coli BL21 (DE3) had a single band of approximately 73 kDa (Fig. 1A), which was consistent with the molecular mass deduced from the protein sequence (77.1 kDa). In addition, the relative molecular mass of the purified enzyme was estimated to be 225 kDa (Fig. 1B) according to size exclusion chromatography, indicating that the R-b-Gal was a homo-trimer. This was consistent with the reported oligomeric state of several other b-galactosidases [17–19]. 3.3. Enzyme properties 3.3.1. Effect of temperature The temperature dependence of the activity of the recombinant R-b-Gal is shown in Fig. 2A. With ONPG as the substrate, the highest hydrolytic activity was achieved at 35 °C; this activity corresponds to a specified activity of 27 U/mg, and 27% of the maximum activity was retained at 4 °C. When lactose was the substrate, the enzyme showed high activity in a wide and low temperature range from 4 to 35 °C; additionally, it displayed nearly 80% of maximum activity at 4 °C. High-activity in this low ambient temperature range distinguished this enzyme from most of the previously reported cold-adapted b-Gals from Arthrobacter psychrolactophilus (optimum temperature range: 15–20 °C) [20], Antarctic Arthrobacter (40–50 °C) [17] and Antarctic bacterium Pseudoalteromonas (35–45 °C) [21]. Thermostability assays with different substrates (Fig. 2B and C) showed that the cold-adapted R-b-Gal was stable at temperatures of 35 °C or lower for at least 2 h. However, approximately 70% of the maximum activity was lost within 15 min when the enzyme was incubated above 45 °C, and complete deactivation occurred with 5 min at 55 °C or higher temperatures. 3.3.2. Effect of pH The R-b-Gal demonstrated high and relatively stable activity in the pH range of 5.5–8.0 (10 mM potassium phosphate buffer) with lactose as the substrate (Fig. 3). When ONPG was the substrate, the pH dependence was more obvious, and the optimal activity was at pH 6.5. Furthermore, Tris–HCl buffer (pH 8.0–9.0) significantly reduced enzyme activity even at a concentration of 10 mM and completely deactivated the enzyme at a concentration of 100 mM (data not shown). 3.3.3. Effect of metal ions Some b-Gals use metal ions, such as Mg2+, Mn2+ and Na+, as co-factors for their hydrolytic activities [6,22]. Moreover, metal ions can also induce structural changes that lead to denaturation of the enzyme. To test whether metal ions have any effect on the catalytic activity of R-b-Gal, the protein was first treated with EDTA to remove divalent metal ions. Different metal ions (5 mM) were added to the enzyme solution and the enzyme activity was examined (Fig. 4). Na+, K+ and Co2+ were found to slightly reduce enzyme activity whereas Ca2+, Mg2+, and Mn2+ increased the activity by approximately 15%. Therefore, according to these data, metal ions might not be required for enzyme activity. Additionally, Zn2+,
Fig. 2. Effect of temperature on the recombinant R-b-Gal. (A) Enzyme activity measured at 35 °C for 10 min with 2.5 g/L ONPG (d) and 0.05 g/L lactose (j) as the substrates. (B) Thermostability of R-b-Gal with 2.5 g/L ONPG as the substrate: preincubation of R-b-Gal at 4 °C (d); 15 °C (j); 25 °C (N); 35 °C (.); 45 °C () and 55 °C (s) for various time points. (C) Thermostability of R-b-Gal with 0.05 g/L lactose as the substrate: preincubation of R-b-Gal at 4 °C (d); 15 °C (j); 25 °C (N); 35 °C (.); 45 °C () and 55 °C (s) for various time points.
Fe3+ and Al3+ apparently deactivated the R-b-Gal. To further investigate the effect of Zn2+, Fe3+ and Al3+ on the enzyme activity, we incubated the R-b-Gal at a higher concentration than that used to measure activity with 5 mM Zn2+, Fe3+ and Al3+ at 4 °C. After 10 min, the samples were centrifuged at 14000g for 10 min and then the concentration was measured. The results showed that when treated with Fe3+, the protein concentration remained nearly unchanged. However, the protein concentration was much lower while treated with Zn2+ and Al3+. Thus, we propose Fe3+ might inactive the enzyme, while Zn2+ and Al3+ might mostly precipitate the enzyme.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
5
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
Fig. 3. Effect of pH on the activity of the recombinant R-b-Gal with 2.5 g/L ONPG (d) and 0.05 g/L lactose (j) as the substrates. Buffers: pH 5.5–8.0, 10 mM potassium phosphate; pH 8.0–9.0, 10 mM Tris–HCl.
3.3.5. Structural characterization by CD spectroscopy The CD spectra of the recombinant R-b-Gal (Fig. 5A) suggest that it is a typical protein with mixed a-helix and b-sheet secondary structures [23]. The effect of temperature on the secondary structure of the R-b-Gal was monitored by collecting CD spectra of the enzyme samples after they were incubated at 4, 15, 25, 35 and 45 °C for 1 h. No discernible changes in the secondary structures could be detected when the incubation was at 35 °C or lower (Fig. 5A). However, when the sample was incubated at 45 °C, the characteristic protein spectra almost completely disappeared. The enzyme’s secondary structure varied slightly under different pH conditions, as shown in Fig. 5B. Between pH 7.0 and 8.0, the conformation of the R-b-Gal was essentially unchanged. The different metal ions had significant effects on the enzyme conformations (Fig. 5C). Whereas Na+, Mg2+ and Mn2+ did not the change enzyme structure and Ca2+ only slightly affected the secondary structure. 4. Discussion
Fig. 4. Effect of various metal ions (5 mM) on the activity of the recombinant R-bGal. The enzyme without EDTA-treatment (none) was included for comparison.
3.3.4. Kinetic properties The kinetic parameters for the reaction with both the ONPG and lactose substrates were calculated (Table 2). At the same temperature, the half saturation coefficient (Km) for lactose was much smaller than that for ONPG, indicating the R-b-Gal had a higher affinity for lactose. Interestingly, the Vmax for ONPG increased as the temperature increased whereas the Vmax for lactose did not change significantly with temperature. As a result, the Kcat/Km for ONPG at each temperature was close to that for lactose. Furthermore, the variation in Kcat/Km was in good agreement with the relative activity examined at different temperatures (Fig. 2A).
In this study, a novel cold-adapted b-Gal from Rahnella sp. R3 was cloned and expressed, and the enzymatic properties were systematically investigated. Several cold-adapted b-Gals from Rahnella strains, including Rahnella sp. BS 1, Rahnella sp. HS-39 [12] and R. aquatilis 14-1 [13] had previously been discovered; however, information about their gene sequences and lactose hydrolysis activities were limited. Sequence analysis showed that R-b-Gal shared high sequence homology to the other b-Gals in GH42. For this reason, this enzyme can be tentatively classified as a GH42 enzyme, which usually have a catalytic dyad at the C-terminal ends of b-strands 4 and 7 within a classical (b/a) 8 TIM barrel (domain A) [19]. The enzyme cloned in this study hydrolyzed glycosidic bonds involving galactosyl, such as those in lactose and ONPG. The enzyme exhibited relative high activity toward lactose at 4 °C and pH 6.0–8.0, therefore it may potentially be used in dairy production [5]. Heat lability is a common property of most cold-adapted enzymes [24] with a few exceptions [7]. Not surprisingly, the R-b-Gal was denatured at 40 °C according to the CD investigation. However, its conformation was unchanged in the temperature range from 4 to 35 °C (Fig. 5A), so its active site was not affected. This finding is also consistent with the results shown in Fig. 2. Thus, the increase in the activity of the enzyme over this temperature range (Fig. 2A) could be attributed to the acceleration of the catalytic reaction with increasing temperature. The increase in Vmax for ONPG in Table 2 was caused by acceleration of the reaction by temperature. Km reflects the affinity of the active site for the substrate and is determined by both the geometry of the active site and the substrate. Consequently, there was no significant change in Km as the temperature increased (Table 2). pH represents the concentration of H+ in aqueous solutions. The pH value determines the dissociation state of charged amino acids
Table 2 Kinetic parameters for R-b-Gal. 1
Substrate
Temperature (°C)
Km (mM)
Vmax (U/mg)
Kcat (s
ONPG
4 15 25 35
6.5 ± 0.65 9.3 ± 1.46 8.0 ± 0.45 10.8 ± 0.54
6.2 ± 0.16 8.9 ± 0.46 18.3 ± 0.32 33.7 ± 0.60
7.9 ± 0.21 11.4 ± 0.59 23.5 ± 0.41 43.2 ± 0.77
)
Kcat/Km (s 1.2 ± 0.13 1.2 ± 0.20 3.0 ± 0.17 4.0 ± 0.21
Lactose
4 15 25 35
2.2 ± 0.59 1.5 ± 0.48 0.9 ± 0.22 1.4 ± 0.60
1.94 ± 0.08 2.3 ± 0.10 1.97 ± 0.06 2.3 ± 0.13
2.5 ± 0.10 3.0 ± 0.13 2.54 ± 0.07 3.0 ± 0.18
1.1 ± 0.31 2.0 ± 0.68 2.9 ± 0.73 2.2 ± 0.95
1
mM
1
)
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
6
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx
Various metal ions played different roles in the enzymatic reactions. The EDTA-treated enzyme demonstrated activity close to that of the untreated enzyme, indicating that this enzyme was independent of divalent metal ions. Na+ and K+ may help stabilize the enzyme conformation but had no influence on hydrolysis. Mg2+ and Mn2+ induced unnoticeable increases in the enzyme activity (Fig. 4) and did not induce changes in the secondary structures (Fig. 5C). These effects might be involved in the transfer of electrons and lowering of the activation energy. Interestingly, the CD curve for the sample supplemented with Ca2+, which is supposed to be an activator, is slightly different from that for the other activators (Mg2+ and Mn2+). This result suggests that some partial secondary structure change induced by Ca2+ might result in a more suitable conformation for the enzyme reaction. Co2+ caused partially breakage of the secondary structures (Fig. 5C); however, this change may take place far from the active sites. As a result, the geometry of the active site was slightly affected and the corresponding activity decreased mildly (Fig. 4). Zn2+ is a transition metal ion containing empty d-orbitals; therefore, it is able to complex with certain residues, such as His, Lys and Trp, from the same or different enzyme molecules. Its attachment can cause enzyme aggregation, which can be confirmed by the deduction of enzyme concentration upon the addition of Zn2+. CD spectra of the enzyme in the presence of Al3+ showed that Al3+ might partially precipitate the protein, so we propose that Al3+ could unfold and aggregate the enzyme. While according to the results of CD and enzyme precipitation, Co2+ and Zn2+ mainly precipitated the enzyme. R-b-Gal was capable of hydrolyzing both ONPG and lactose; however, the Km for lactose was 3 to 10 times smaller than that for ONPG. This finding is in contrast to previously reported results [25,26]. It is easy to understand that b-Gal was synthesized by the host to digest lactose; therefore, the geometry of its active site has high affinity to lactose. The Vmax for converting lactose increased significantly with a rise in temperature (Table 2), and the increase means this reaction has a low activation energy and is a kinetically controlled process. Unexpectedly, the Vmax for converting lactose remained low over a temperature range from 4 to 35 °C (Table 2). We tentatively propose that lactose hydrolysis by the enzyme has a relatively high activation energy and was a thermodynamically controlled process. Although the Kcat/Km values for ONPG and lactose are close, the mechanisms for the two substrates are different. Conflict of interest The authors declare no conflict of interest. Acknowledgments
Fig. 5. CD spectral characterization of enzyme structure. (A) Effect of temperature on enzyme structure. (B) Effect of pH on enzyme structure. (C) Effect of metal ions on enzyme structure.
We are grateful to the Key project of the National Natural Science Fund (31230057) and the National Key Technology R&D Program in the 12th Five year Plan of China (2011BAD23B03) for financial support. The author is grateful to for the visiting scholarship funded by the China Scholarship Council. References
(e.g., glutamic acid, aspartic acid and histidine) and consequently alters the charge distribution on the protein surface and affects electrostatic interactions. In the data presented here for R-b-Gal, the overall secondary structural components were not affected at weakly acidic (5.5) to weakly basic (9.0) pH values (Fig. 5B). Correspondingly, the enzyme activity remained stable over this pH range when lactose was the substrate (Fig. 3). Additionally, the low activity in Tris–HCl buffer could be attributed to the interaction between Tris and the enzyme.
[1] D. Georlette, M. Bentahir, P. Claverie, T. Collins, S. Damico, D. Delille, G. Fellee, E. Gratia, A. Hoyoux, T. Lonhienne, M.-A. Meuwis, L. Zecchinon, Ch. Gerday, Cold-adapted enzymes, Phys. Chem. Basis Biotechnol. (2002) 177–196. Springer. [2] K.S. Siddiqui, R. Cavicchioli, Cold-adapted enzymes, Annu. Rev. Biochem. 75 (2006) 403–433. [3] R. Margesin, F. Schinner, Cold-Adapted Organisms Ecology Physiology Enzymology and Molecular Biology, Springer Science & Business Media, 1999. [4] T. Nakagawa, Y. Fujimoto, R. Ikehata, T. Miyaji, N. Tomizuka, Purification and molecular characterization of cold-active b-galactosidase from Arthrobacter psychrolactophilus strain F2, Appl. Microbiol. Biotechnol. 72 (2006) 720–725.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001
Y. Fan et al. / Protein Expression and Purification xxx (2015) xxx–xxx [5] L. Van Den Berg, Changes in pH of milk during freezing and frozen storage, J. Dairy Sci. 44 (1961) 26–31. [6] P. Karasová-Lipovová, H. Strnad, V. Spiwok, Š. Malá, B. Králová, N.J. Russell, The cloning, purification and characterisation of a cold-active b-galactosidase from the psychrotolerant Antarctic bacterium Arthrobacter sp. C2-2, Enzyme Microb. Technol. 33 (2003) 836–844. [7] V. Vincent, N. Aghajari, N. Pollet, A. Boisson, S. Boudebbouze, R. Haser, E. Maguin, M. Rhimi, The acid tolerant and cold-active b-galactosidase from Lactococcus lactis strain is an attractive biocatalyst for lactose hydrolysis, Antonie Van Leeuwenhoek 103 (2013) 701–712. [8] G.X. Wang, Y. Gao, B. Hu, X.L. Lu, X.Y. Liu, B.H. Jiao, A novel cold-adapted betagalactosidase isolated from Halomonas sp. S62: gene cloning, purification and enzymatic characterization, World J. Microb. Biotechnol. 29 (2013) 1473–1480. [9] D. Izard, F. Gavini, P. Trinel, H. Leclerc, Rahnella-aquatilis, new member of the enterobacteriaceae, Ann. Microbiol. (Paris) (1979) 163–177. [10] Y. Guo, Z. Jiao, L. Li, D. Wu, D.E. Crowley, Y. Wang, W. Wu, Draft genome sequence of Rahnella aquatilis Strain HX2, a plant growth-promoting rhizobacterium isolated from vineyard soil in Beijing, China, J. Bacteriol. 194 (2012) 6646–6647. [11] R.J. Martinez, D. Bruce, C. Detter, L.A. Goodwin, J. Han, C.S. Han, B. Held, M.L. Land, N. Mikhailova, M. Nolan, L. Pennacchio, S. Pitluck, R. Tapia, T. Woyke, P.A. Sobecky, Complete genome sequence of Rahnella sp. strain Y9602, a Gammaproteobacterium isolate from metal-and radionuclide-contaminated soil, J. Bacteriol. 194 (2012) 2113–2114. [12] J.W. Park, Y.S. Oh, J.Y. Lim, D.H. Roh, Isolation and characterization of coldadapted strains producing b-galactosidase, J. Microbiol. (Seoul Korea) 44 (2006) 396–402. [13] W. Liu, Y. Shi, X. Wang, C. Wei, K. Lou, Isolation and identification of a strain producing cold-adapted b-galactosidase, and purification and characterisation of the enzyme, CZECH J. Food Sci. 26 (2008) 284–290. [14] Y.G. Liu, Y. Chen, High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences, Biotechniques 43 (2007) 649–656. [15] W. Chen, H. Chen, Y. Xia, J. Zhao, F. Tian, H. Zhang, Production, purification, and characterization of a potential thermostable galactosidase for milk lactose hydrolysis from Bacillus stearothermophilus, J. Dairy Sci. 91 (2008) 1751–1758.
7
[16] Y.Z. Zhang, W.X. Du, C. Fregevu, M.H. Kothary, L.A. Harden, T. McHugh, Expression, purification, and characterization of almond (Prunus dulcis) allergen Pru du 4, J. Agric. Food Chem. 52 (2014) 12695–12700. [17] P. Hildebrandt, M. Wanarska, J. Kur, A new cold-adapted b-D-galactosidase from the Antarctic Arthrobacter sp. 32c–gene cloning, overexpression, purification and properties, BMC Microbiol. 9 (2009) 151. [18] S.W.A. Hinz, L.A.M. van den Broek, G. Beldman, J.P. Vincken, A.G.J. Voragen, bgalactosidase from Bifidobacterium adolescentis DSM20083 prefers b(1,4)galactosides over lactose, Appl. Microbiol. Biotechnol. 66 (2004) 276–284. [19] M. Hidaka, S. Fushinobu, N. Ohtsu, H. Motoshima, H. Matsuzawa, H. Shoun, T. Wakagi, Trimeric crystal structure of the glycoside hydrolase family 42 bgalactosidase from Thermus thermophilus A4 and the structure of its complex with galactose, J. Mol. Biol. 1 (2002) 79–91. [20] J.A. Coker, P.P. Sheridan, J. Loveland-Curtze, K.R. Gutshall, A.J. Auman, J.E. Brenchley, Biochemical characterization of a b-galactosidase with a low temperature optimum obtained from an Antarctic Arthrobacter isolate, J. Bacteriol. 185 (2003) 5473–5482. [21] H. Cies´lin´ski, J. Kur, A. Białkowska, I. Baran, K. Makowski, M. Turkiewicz, Cloning, expression, and purification of a recombinant cold-adapted bgalactosidase from Antarctic bacterium Pseudoalteromonas sp. 22b, Protein Expression Purif. 39 (2005) 27–34. [22] J.B. Bultema, B.J. Kuipers, L. Dijkhuizen, Biochemical characterization of mutants in the active site residues of the b-galactosidase enzyme of Bacillus circulans ATCC 31382, FEBS Open Bio. 4 (2014) 1015–1020. [23] N.J. Greenfield, Using circular dichroism spectra to estimate protein secondary structure, Nat. Protoc. 1 (2006) 2876–2890. [24] N.J. Russell, Toward a molecular understanding of cold activity of enzymes from psychrophiles, Extremophiles 4 (2000) 83–90. [25] T.H. Nguyen, B. Splechtna, M. Steinböck, W. Kneifel, H.P. Lettner, K.D. Kulbe, D. Haltrich, Purification and characterization of two novel b-galactosidases from Lactobacillus reuteri, J. Agric. Food Chem. 54 (2006) 4989–4998. [26] N.M. Samoshina, V.V. Samoshin, The michaelis constants ratio for two substrates with a series of fungal (mould and yeast) b-galactosidases, Enzyme Microb. Technol. 36 (2005) 239–251.
Please cite this article in press as: Y. Fan et al., Cloning, expression and structural stability of a cold-adapted b-galactosidase from Rahnella sp. R3, Protein Expr. Purif. (2015), http://dx.doi.org/10.1016/j.pep.2015.07.001