Cloning, genetic engineering and characterization of TMOF expressed in Saccharomyces cerevisiae to control larval mosquitoes

Accepted Manuscript Cloning, Genetic Engineering and Characterization of TMOF expressed in Saccharomyces cerevisiae to Control Larval Mosquitoes. Borovsky Dov, Sabine Nauewelaers, Charles A. Powell, Robert G. Shatters Jr. PII: DOI: Reference:

S0022-1910(16)30335-3 http://dx.doi.org/10.1016/j.jinsphys.2017.01.008 IP 3598

To appear in:

Journal of Insect Physiology

Received Date: Revised Date: Accepted Date:

6 October 2016 9 January 2017 10 January 2017

Please cite this article as: Dov, B., Nauewelaers, S., Powell, C.A., Shatters, R.G. Jr., Cloning, Genetic Engineering and Characterization of TMOF expressed in Saccharomyces cerevisiae to Control Larval Mosquitoes., Journal of Insect Physiology (2017), doi: http://dx.doi.org/10.1016/j.jinsphys.2017.01.008

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Cloning, Genetic Engineering and Characterization of TMOF expressed in Saccharomyces cerevisiae to Control Larval Mosquitoes.

Borovsky Dova,* Sabine Nauewelaersb Charles A. Powellc Robert G. Shatters Jr.a

a

USDA-ARS, Horticultural Research Laboratory, Ft. Pierce FL 34945, USA

b

Katholieke universiteit Leuven, Leuven B-3000, Belgium

c

Indian River Research and Education Center University of Florida, FL 34945,

USA Corresponding author. Tel.: +1 772 462 68, fax: +1 772 462 5986. E-mail address: [email protected] (D. Borovsky). Address: 2001 South Rock Road, Ft. Pierce FL 34945, USA. *

1

Abstract

Trypsin modulating oostatic factor, a decapaptide isolated from the ovaries of A. aegypti, is the physiological factor that terminates the trypsin biosynthesis after the blood meal. Earlier results obtained from feeding mosquito larvae and injecting female mosquitoes with TMOF show that trypsin biosynthesis and egg development are inhibited, indicating that TMOF traverses the gut epithelial cells and modulates trypsin biosynthesis, making it a potential larvacidal peptide hormone. Therefore, TMOF and TMOF green fluorescent protein (GFP) fusion protein with a trypsin cleavage site, allowing TMOF release in the larval gut, were expressed in S. cerevisiae cells that were transformed using homologous recombination at ura3-52 with an engineered plasmid (pYDB2) carrying tmfA and gfp-tmfA and a strong galactose promoter (PGAL1). Southern blot analyses showed that each cell incorporated a single tmfA or gfp-tmfA. Western blot analyses of cells that were fermented up to 48 h showed that the engineered S. cerevisiae cells synthesized both TMOF and GFP-TMOF and heat treatment did not affect the recombinant proteins. Engineered S. cerevisiae (3 x 108 cells) that were fermented for 4 hours produced (2.1 + 0.2 µg + S.E.M) of TMOF. Feeding the engineered cells producing TMOF and GFP-TMOF to larval mosquito caused high mortalities (66 + 12% and 83 + 8%, respectively). S. cerevisiae cells transfected with pYEX-BX carrying gfp-tmfA and (DPAR)4 or transformed by

2

homologous recombination of pYDB2-gfp-tmfA carrying a heat shock promoter (PHP ) were ineffective. Engineered heat treated yeast cells are consumed by mosquito larvae, and could be used to control mosquitoes.

Keywords: Saccharomyces cerevisiae, cloning by homologous recombination, genetic analysis, Trypsin Modulating Oostatic Factor, larval control.

Abbreviations: Bti :B. thuringiensis subsp. israelensis , (DPAR)4: a TMOF analogous, GAL: galactose, gfp: Green Fluorescent Protein gene, GFP: green fluorescent protein, his: histidine gene, HSE: heat shock elements, Ig: immunoglobulins, LB: Luria-Bertani plates, Leu: Leucine gene, MATα : S. cerevisiae mating gene, OD600: optical density at 600 nm, PAGE: poly acrylamide gel electrophoresis, PCUP1: copper1 inducible promoter, PCR: polymerase chain reaction, PGAL1: galactose1 promoter, PHP: Heat shock promoter, RAF: raffinose, S. cerevisiae: Saccharomyces cerevisiae, SDS: sodium dodecyl sulfate, ssa1, ssa2, ssa3 and ssa4: stress seventy subfamily A genes, TMOF: Aedes aegypti Trypsin modulating oostatic factor, tmfA : Aedes aegypti TMOF gene, trp: tryptophan gene, UAS: upstream activation site, URA: uracil, ura: uracil gene

1. Introduction Mosquitoes (Diptera: Culicidae) are vectors of serious human infectious diseases, including malaria, dengue, yellow fever, encephalitis

3

(Spielman 2001) and Zika virus, causing microcephaly cause havoc and misery worldwide. Malaria, alone, is responsible for the death of more than one million people each year (mostly African children) with a total of 300-500 million clinical cases annually (WHO,1998). To eradicate mosquitoes many techniques have been tried such as spraying with chemical pesticides (DDT, Malathion, Dibrom and Baytex) use of chemical treated bed nets with pyrethroids and source reduction (eliminating mosquito breeding sites, http://www.fmel.ifas.ufl.edu/whitep.htm). These chemical pesticides, however, cause environmental and human health problems, and development of resistance in mosquitoes. To overcome these problems, new approaches need to be developed that replace the chemical with biological insecticides. The discovery that the bacterium Bacillus thuringiensis subsp. Israelenis (Goldberg and Margalit, 1977), allowed the use for the first time an effective alternative for chemical adulticides that targeted many species of larval mosquitoes. The use of products based on B. thuringiensis subsp. israelensis (Bti) having its own limitations (Porter et al. 1993) and indiscriminate use may cause development of resistance, even though the crystal toxin is made up of several toxins that slows the development of resistance as compared with mono molecular chemical insecticide like pyrethyroid that is used in bed nets to control malarial transmitting mosquitoes and already causing resistance (Ranson et al. 2011). Bti toxins are highly effective against larval mosquitoes and blackflies, however, several reports indicate that it also affects non-target species (Boisvert and Boisvert, 2000). An alternative to bacterial toxins like Bti is to use insect

4

peptide hormones that specifically control diverse physiological processes such as digestion, reproduction, water balance, feeding behavior, methamorphosis and sex attraction in insects and since they control specific physiological functions and are naturally found in insects, disruption of their biological function(s) could specifically cause demise to these insects (Gade and Goldsworthy, 2003). Trypsin modulating oostatic factor (TMOF), an unblocked decapeptide (NH2-YDPAPPPPPP-COOH), isolated from the ovaries of Aedes aegypti (Borovsky, 1985) is the physiological factor that regulates trypsin biosynthesis in the mosquito midgut (Borovsky et al. 1993). The hormone is released into the hemolymph starting 20 h after female mosquito takes a blood meal reaching a peak at 33 h binding gut epithelial cells receptor (Borovsky et al. 1994 a, b, Borovsky, 2015) and terminating trypsin biosynthesis (Borovsky,1988). Feeding or injecting female mosquitoes with TMOF inhibits trypsin biosynthesis and egg development because the blood meal cannot be digested. This indicates that TMOF traverses the gut epithelial cells into the hemolymph where it binds to specific TMOF receptor(s) modulating trypsin biosynthesis (Borovsky and Mahmood, 1995). This property makes TMOF a potential new biological insecticide. However, the peptidic nature of TMOF precludes it from being used as an adulticide, on the other hand, larva with their aquatic life style and their use of trypsin (accession numbers AAL93209, AAO43403) and chymotrypsin-like enzymes to digest their food (Yang and Davies, 1971), are more attractive target group (Borosvky,1989).

5

Chemically synthesized TMOF that is directly applied to water in the marsh limits the peptide usefulness as a commercial product because of high production cost and rapid degradation of the peptide in the marsh due to sun exposure and bacterial attack. Our earlier studies focused on expressing both TMOF and individual Bti cry toxins in Pichia pastoris and TMOF in Chlorella desiccata (Borovsky et al. 2010, 2011, 2016). This report investigates the possibility of expressing TMOF in S. cerevisiae cells which are readily eaten by mosquito larvae and can be easily and inexpensively fermented in large quantities as a delivery system that will target mosquito larvae in the marsh. This study expands initial reports presented earlier in a symposium proceeding and a book chapter on the cloning of and expression of gfp-tmfA and tmfA in S. cerevisiae (Nauwelaers and Borovsky, 2002, Borovsky, 2015) describing and characterizing in details the genetic engineering of the plasmids used, the strategy of transformation, the genetic analyses of the engineered cells using Southern and Western blot analyses that are not found in the earlier reports (Nauwelaers and Borovsky, 2002, Borovsky, 2015). Four genes were constructed and cloned into two different expression vectors with two S. cerevisiae strains as hosts. Feeding of recombinant S. cerevisiae strains that were transformed with gfp-tmfA and tmfA to Ae. aegypti larvae caused high larval mortalities when compared with cells that were not transformed. These results indicate that engineered S. cerevisiae cells expressing GFP-TMOF and TMOF can be used as biorational larvicides against mosquito larvae in the marsh.

6

2. Materials and methods 2.1. Plasmids, Bacterial and Yeast strains

E. Coli InvαF’ strain (Invitrogen) was used for plasmid propagation. S. cerevisiae, strain1, a haploid strain with a MATα, his3-∆1, leu2, trp1-289, ura3-52 genotype (Invitrogen, CA USA)) and strain2, a haploid strain with genotype MATα , leu2-3,112 ura3-52 (APEX, NC, USA) were used for transformation. A yeast plasmid pYES2 (Invitrogen, CA USA) and pYDB2, the latter was genetically engineered from pYES2 using the restriction enzymes NaeI and ClaI (Fig. 1). pYDB2 is 1.9 Kbp smaller than pYES2 lacking the f1 ori and the 2µ ori sites, thus making the plasmid an integrating vector that can carry the genes cloned in the multiple cloning site in the yeast genome by homologous recombination (Fig. 2) (Borovsky, 2015). The plasmid was used to transform the yeast strains. Plasmid cycle 3-GFP (Fukuda et al. 2000; accession number 1B9C_C), provided by Professor Bill Dawson (University of Florida, Lake Alfred) was used as a template for construction of pYDB2 gfp-tmfA. 2.2. Genes construction 2.2.1. Primers All primers were synthesized by Gemini Biotech, (FL. USA) (Table 1). Primer DB 207 (forward) containing KpnI restriction site at its 5’ end following by the first 21 nucleotides of cycle 3 mutant gfp from the jellyfish Aequorea Victoria (accession number 1B9C_C) and DB209 (reverse) containing XbaI restriction site at its 5’ end following by a stop signal, the nucleotide sequence of tmfA, IEGR and the last 18 nucleotides of gfp were used by PCR to synthesize dsDNAs of gfp-tmfA. To amplify dsDNA of gfp-IEGR, DB 207 (forward) and DB229 (reverse) were used. Primer DB 229 contains XbaI restriction site, the nucleotide sequence coding for the amino acid sequence IEGR, a stop signal 7

and the last 18 nucleotides of gfp. To amplify gfp DB207 (forward) and DB230 (reverse) were used. Primer DB 230 contains XbaI restriction site and the last 18 nucleotides of gfp with including a stop signal. A synthetic dsDNA of tmfA was obtained by annealing DB192 (forward) and DB 193 (reverse) (see section 2.2.2). To amplify (DPAR)4 a template (DB 515) and primers DB 507 and 508 were used. Table 1 lists all the primers and the restriction sites that were used for cloning after the PCR into the different plasmids.

2.2.2. PCR and preparation of synthetic tmfA To amplify gfp-tmfA, gfp-IEGR and gfp by PCR Cycle 3-gfp plasmid was used as a template and PCR DNA kit (Perkin Elmer). PCR reaction mixture (50 µl) containing 4.0 µl MgCl2 (25mM), 5.0µl of 10x PCR Gold buffer, 4 µl dNTP mix (2.5mM each of dATP, dTTP, dCTP and dGTP), 32.5µl of sterile deionized ultrafiltered water (Fisher Scientific), 1µl of a forward primer, 1µl of a reverse primer, 0.5µl of Amplitaq Gold (2.5 U) and 2µl of cycle 3 gfp plasmid template (200-400 ng). PCR amplification was done using GeneAmp PCR system 2400 (PerkinElmer) as follows: 95°C for 3 min, denaturation at 95°C for 1 min, annealing at 55°C for 30 sec and extension at 72°C for 3 min (40 cycles) with the last extension cycle at 72°C for 15 min. After PCR, the amplicons were analyzed by electrophoresis on a 2% agarose gel (Gibco BRL) and visualized with ethidium bromide (Sigma). DNA fragments were eluted from the agarose gel using Millipore Ultrafree-DA spin columns (Amicon), purified by QIAquick columns (QIAGEN, CA) and stored at –20°C. A synthetic dsDNA of tmfA was prepared by denaturing oligonucleotides DB 192 and DB 193 (10 µg each) at 95°C for 10 min followed by 30 min cool down to 20 0C. (DPAR)4 template was amplified by PCR as described above using annealing at 42 °C for 30 sec, extensions at 55 0C for 30 sec and at 72 0C for 3 min (40 cycles). After PCR, the amplified DNA was analyzed on 4% agarose gel, purified by QIAquick column (QIAGEN, CA, USA) and stored at -20 0C. 8

2.3. Cloning into S. cerevisiae expression vectors The PCR-amplified genes were digested with restriction enzymes KpnI and XbaI (5 units each) following manufacturer recommendation (Gibco BRL, NY, USA) and inserted between the KpnI and XbaI sites of pYDB2 and pYES2, whereas tmfA was inserted between the XhoI and XbaI sites of pYDB2 and pYES2 (Fig. 1). For pYEX-BX PCR amplified genes were inserted directionally and in frame between PstI and EcoRI (gfp-tmfA) and BamHI and EcoRI (DPAR)4 (Fig. 3). Ligations were performed overnight at 14°C using T4 DNA ligase and cloning was carried out using a TA cloning kit (Invitrogen, CA, USA). Transformed E. coli InvαF’ were selected on Luria-Bertani (LB) plates containing 50µg/ml Ampicillin (Sigma, MO. USA). Extraction and purification of plasmid DNA were performed using the QIAprep Spin Miniprep kit (Qiagen, CA, USA). Recombinants were screened by restriction enzyme and PCR analyses. Plasmids that contained inserts were sequenced by the dideoxynucleoside chain termination method (Sanger et al, 1977) with [α35S]dATP and the enzyme T7Sequenase (version 2.0; US Biochemicals) (Tabor and Richardson,1987) or with ABI PRISM BigDye terminator cycle sequencing ready reaction kit (PE Biosystems, CA, USA) and purified on DyeEx columns (Qiagen, CA, USA) and analyzed on an Applied Biosystems Model 377 DNA sequencer (Perkin Elmer, CA, USA). Competent S. cerevisiae cells from strain 1 and 2 were prepared using the S.c. Easycomp transformation kit (Invitrogen, CA, USA) and transformed using the LiAc/SS-DNA/PEG procedure (Gietz, et al., 1995). Competent cells were stored at -80 0C. Prior to transformation the pYDB2 vectors were linearized with ApaI to facilitate homologous recombination. Transformants were selected on plates lacking Uracil (DOBA –URA+2%GAL+1%RAF) (BIO101 CA, USA).

2.4. Expression of genetically engineered S. cerevisiae (shake flask fermentation) 2.4.1. pYES2 and pYDB2 engineered cell 9

Single colonies of S. cerevisiae cells after transformation with pYES2 and pYDB2 that were engineered with tmfA, gfp-tmfA and gfp (control) (Fig. 1) were isolated and grown at 30°C in synthetic medium lacking uracil and 2% raffinose (DOB-URA+2%RAF) (BIO101, CA, USA), and 1.7 g yeast nitrogen base without amino acids, 5 g ammonium sulfate and 10 g purified raffinose as a carbon source. After 48 h, the cells were stimulated in fresh medium containing 2%GAL (DOB-URA+2%GAL+2%RAF, BIO101, CA USA) (1.7 g yeast nitrogen base without amino acids, 5 g ammonium sulfate, 20 g galactose, 10 g purified raffinose without uracil). At different times after the induction aliquots (5 mL) were removed and stored at -20°C until further analysis.

2.4.2. pYDB2-PHP –gfp-tmfA engineered cells pYDB2-PHP carrying a heat shock promoter (PHP) was engineered using primers DB 258 and DB 257 (Table 1) to amplify the promoter region of ssa1 containing HSE1, HSE2 and HSE3 (Slater and Craig, 1989) in the genomic DNA of S. cerevisiae. The PCR amplicon was then ligated into an open pYDB2-gfptmfA (Fig. 4), that was cut with PinAI and PvuII to remove the PGAL1, and the transformed cells isolated and grown for 18 h at 30 0C in DOB, 2%RAF medium (BIO 101) (10 mL) a fresh DOB, 2%RAF medium was then added and the cells were grown at 30 0C for additional 48 h, centrifuged at 5000 g for 7 min, resuspended in fresh medium and heat shocked for 7 h at 37 0C. Aliquots (5 mL) were removed at 1 h intervals for 7 h and stored at -20 0C.

2.4.3. pYEX-BX engineered cells Single colonies after transformation with engineered pYEX-BX carrying tmfA, gfp-tmfA, or TMOF analogue (DPAR)4 that was shown to be 2-fold more effective than TMOF against mosquito larvae (Borovsky and Meola, 2004) (Fig. 3) were isolated and grown for 18 h at 30 0C in a medium lacking uracil. Aliquot (10 mL) was removed and added to a medium lacking leucine (DOB-URA, 2%GAL, 1%RAF) (BIO 101) and the cells were grown at 30 0C for 18 h. The cells were then centrifuged at 5000 g, resuspended and induced with a fresh 10

medium lacking leucine and containing copper sulfate (0.5 mM). At different times after the Cu+2 induction, aliquots (5 mL) were removed and stored at -20 0

C.

2.4.4. Large scale fermentation Large scale fermentations (10 L) of S. cerevisiae transformed with pYDB2gfp-tmfA were done by APEX Bioscience Inc. (Durham, NC, USA). Transformed cells (5 mL) were grown in minimal salts medium containing glucose (2%) for 18 h in a floor shaker at 30 0C. The overnight culture was microscopically checked for growth and contamination before adding an aliquot of the initial culture (250 mL) into a 10 L fermenter (A. B. Braun Biostat E fermenter) containing 5 L of sterile minimal salts medium and glucose (2%). The temperature, pH, agitation rate, dissolved oxygen concentrations, antifoam and base consumption were monitored and controlled during the fermentation including the inlet air flow rate and the supplement feed rate. The temperature was maintained at 30 0C, the pH at 5.0 and the dissolved oxygen concentrations at a minimum of 20%. The culture was grown to OD600 of 54.2 on increment of 50% glucose feed over 41 h and the culture was then induced with galactose (40%) for 42 at a rate of 1.0 mL/min to maintain a constant concentration of 20% galactose during the induction period. Samples (20 mL) were removed at 0, 6, 9, 15, 18, 26, 33 and 42 h, the cells centrifuged at 5000 g and stored at -20 0C. 2.5. ELISA TMOF and GFP-TMOF expressed in recombinant cells was followed by a modified ELISA (Borovsky et al. 1992) using amine binding maleic anhydride 8 well strips (Pierce, IL, USA). Briefly, fermented recombinant S. cerevisiae cells (3x108) were extracted in Y-PER (Pierce, IL USA) and the proteins bound to maleic anhydride activated strip plates, washed blocked and assayed with TMOF specific antiserum using phosphate buffered saline buffer (0.1 M sodium phosphate, 0.15 M sodium chloride, pH 7.2) and the absorbance at 405 nm was read using a Bio-Rad microplate reader (Richmond, CA) (Borovsky et al. 1992). 11

Each determination was done in triplicates and the amount of TMOF or GFPTMOF is expressed as means of 3 determinations + S.E.M. A new calibration curve was run for each determination and the assay detects ng amounts of TMOF.

2.6. Western blot analysis

Cultures fermented for 0-48 h of recombinant S. cerevisiae (8 x 107 cells) were centrifuged in Falcon tubes (15 mL) in Sorvall RT600 tabletop centrifuge at 5000 g for 8 min. Each pellet was resuspended in water (9 ml). At interval (0, 6, 11, 17, 25, 32 and 48 h) samples (1 OD600) were removed for immunoblot analysis and centrifuged at 5000 g, each pellet resuspended in 40µl 2x reducing SDS sample buffer broken with glass beads, heated at 80 0 C for 5 min and 5µl of each sample was loaded onto 14% Tris glycine gels (Novex). Proteins were separated at 130 Volts for 1.5 h, and electrophoretically transferred onto nitrocellulose membranes (Novex) at 30 Volts for 1.5h. The membranes were blocked with TBS containing nonfat dry milk (3%) and probed with anti-GFP antibodies (Clontech) or diluted anti-TMOF serum (1:100) in TBS dry milk (1%). The immunoblots were incubated overnight with the antibodies, washed with TBS, Tween20 (0.025%) followed by incubation with goat anti-rabbit IgG-horse radish peroxidase conjugated secondary antibody (1: 2000) (Bio-Rad) at 42°C for 3 h. After incubation and washing with TBS, Tween (0.025%), the blots were developed with Super Signal chemiluminescent substrate (Pierce, IL USA) or with metal-enhance diaminobezidine substrate kit (Pierce). 2.7. Southern blot analysis

S. cerevisiae genomic DNA was isolated using the fast DNA kit from BIO 101 (CA, USA) using recombinant and control wild type yeast cells (1.5x108 3x108 cells). The cells were broken in 2 mL tubes containing Sphere and Garnet Matrix and yeast cell lysis buffer in a FastPrep instrument (FP120, Savant, CA 12

USA). After breaking the cells and separating the supernatants by centrifugation, the genomic DNA was isolated following the manufacturer’s protocol and samples were stored at -20°C. Southern blot analysis was done according to Sambrook et al. (1989) using Ambion SouthernMax kit (Ambion, TX, USA). S. cerevisiae genomic DNA was cut with HindIII (5 units) (Gibco BRL, NY, USA) at 37 0C for 18 h. The cut DNA fragments (10 µG/lane) were separated by electrophoresis (110 V for 1 h) using agarose gel (0.8%), the gel was treated and transferred under alkaline conditions to positively charged nylon membrane (BrightStar-Plus, Ambion) following manufacturer’s protocol. The membrane was hybridized with a purified denatured [32P]ura3 probe (1107 bp) amplified by PCR from pYDB2 (Fig. 1) using primer pair DB 212 and 213 (Table 1) or probed with [32P]gfp probe amplified from pYDB2-gfp-tmfA (Fig. 2) using primer pair DB 207 and 230 (Table 1). The probes were labeled with [α32P]dCTP using a RediprimeII random prime labeling kit (Amersham Pharmacia Biotech UK limited). To reduce background interference, the labeled probes were purified on a Qiaquick PCR column (Qiagen, CA USA). Prehybridization and hybridization was done at 42°C in rotating hybridization bottles using a hybridization oven (Enprotech, MA, USA). After washing, the filter was wrapped in plastic foil and exposed to an X-ray film overnight at -80 0C freezer. To allow re-probing of the membranes with a different probe, the membrane was incubated with SDS (0.1%) solution that was preheated to 100 0C. The incubation mixture was allowed to cool down to room temperature, the membrane removed and scanned for radioactivity with a hand-held Geiger counter. The procedure was repeated until no radioactivity was detected. 2.8. Larvicidal activity of recombinant S. cerevisiae tmfA, gfp-tmfA and (DPAR)4 Newly hatched Ae. aegypti larvae were individually reared at 24 0C in 48 microtiter well plates containing 1ml of sterile water/well and 2x107 transformed or wild type (wld) S. cerevisiae cells. The yeast cells were washed three times by centrifugation in sterile distilled water prior to the feeding to remove the medium in which the cells were grown. Larval growth, development and mortality was 13

monitored daily for 12 days. Expression of Green Fluorescent Protein was monitored under a Fluorescence Microscope (Olympus IX70 with FITC filter) or directly under a UV hand held UV lamp (Model UVS-11, CA USA). 3. Results 3.1. Cloning of gfp-tmfA and tmfA in S. cerevisiae 3.1.1 Southern blot analysis Two S. cerevisiae haploid strains were used to transform and express genes with the following genotypes strain 1 and 2. Both strains are uracil deficient carrying a Ty transposable element (Rose and Winston, 1984) and were transformed with pYES2 an episomal plasmid that does not integrate into the yeast genome and pYDB2 and integrating plasmid (Fig. 1) carrying gfp-tmfA and tmfA. Cells transformed with pYDB2-gfp-tmfA were then analyzed by Southern blot analysis (Fig. 5) to find out if the genes integrated into the chromosomal DNA of S. cerevisiae by homologous recombination (Fig. 2). After HindIII cutting of the yeast cells extracted genomic DNA and Southern blotting, the DNA samples were hybridized with ura3 and gfp specific probes. Four DNA bands are expected (5446, 4340, 1825 and 126 bp) after HindIII digestion of the genomic DNA of ura-3-52-gfp-tmfA transformed yeast cells (Fig. 6c), whereas, three DNA bands (4925, 4340 and 1825 bp) are expected after HindIII cutting of the genomic DNA of ura3-52-tmfA transformed cells (Fig. 6b), and two DNA bands (4340 and 2725 bp) are expected after HindIII cutting of the genomic DNA of ura3-52(wld) yeast cells (Fig. 6a). Southern blot analysis of the gfp-tmfA transformed cells show two bands (5446 and 1825 bp) (Fig. 5a). The 4340 bp band does not contain the gfp-tmfA and is part of the 5’ upstream region of ura352 gene containing a Ty transposon (Fig. 6a) (Rose and Winston, 1984). The upstream 5’ region is susceptible to point mutations during homologous recombination as was reported by Kunz et al. (1994) and Yoshida et al. (2003) abolishing the HindIII site and preventing the release of the 4340 bp DNA band. The 125 bp DNA band is too short to be retained by the agarose gel (0.9% ) used for the Southern blot analysis and elutes off during the electrophoresis step. 14

Similar results were obtained when the genomic DNA of pYDB2-tmfA transformed cells were cut by HindIII and analyzed by Southern blot analysis, only the 1825 and 4925 bp bands were found and the 4340 bp band is missing (Fig. 6b) (results are not shown). This is probably also due to a point mutation caused by the homologous recombination that abolished the HindIII site on ura352-tmfA 5’ end (Rose and Winston, 1984, Kunz et al. 1994, Yoshida et al. 2003) . After stripping the membrane and reprobing it with a gfp probe an expected DNA band of 5446 bp was detected (Fig. 6c), a second expected DNA band of 126 bp (Fig. 6c) migrated off the gel during the electrophoresis as was observed with the ura3 probe, and thus could not be detected. The 5446 bp DNA band contains the large portion of gfp-tmfA and the results strongly suggest that a full length gfp-tmfA integrated into the genome of S. cerevisiae. When S. cerevisiae ura352 wld DNA from cells that were not subjected to homologous recombination (control) was cut with HindIII, the expected band sizes (4340 and 2725 bp) (Fig. 6a) were detected using ura3 probe (Fig. 5) (Rose and Winston, 1984).

3.1.2 Western blot analysis To find out if GFP-TMOF was expressed pYDB2-gfp-tmfA transformed S. cerevisiae cells, the recombinant cells were induced with galactose and at different intervals (0-48 h) aliquots were removed, cells of strain #2 were broken by glass beads in the presence of SDS and protein separated by SDS-PAGE, transferred onto nitrocellulose membranes by Western blotting. The membranes were incubated with antisera against GFP or TMOF (Fig. 7). No band were detected before the galactose stimulation (0 h). A single band (31 kDa) of the expected GFP-TMOF fusion protein was detected at 6, 11, 17, 25, 32 and 48 h after galactose stimulation using antiserum against TMOF or GFP (Fig. 7a and b, of Strain #2). Heating the cells at 48 h for 3 h at 75 0C after galactose fermentation did not affect the GFP-TMOF fusion protein (Fig. 7a, b). These results indicate that the S. cerevisiae transformed cells of strain #2 express GFPTMOF. The same results were obtained when strain #1 was used (results not

15

shown) and the Western blot analyses were repeated 2 times showing the same results. 3.1.3 ELISA To follow the synthesis of TMOF expressed in transformed S. cerevisiae cell (strain #1) by pYDB2-gfp-tmfA and pYDB2-tmfA cells were stimulated with galactose for (0-8 h) and at intervals cells (3 x 108 cells) were removed, protein extracted in Y-PER (Pierce, IL, USA) with glass beads and analyzed for the presence of TMOF by ELISA (Borovsky et al. 1992). Cells transformed with gfptmfA expressed 2 + 0.34, 2.1 + 0.21, 2.14 + 0.24 and 2.16 + 0.25 µg + S.E.M of TMOF at 1, 4, 6, and 8 h after galactose stimulation. Before galactose stimulation no TMOF was detection (Fig. 8). Nauwelaers and Borovsky (2002) reported that S. cerevisiae cells transformed with a free replicating plasmid (pYES2-gfp-tmfA) (Fig. 1) after induction with galactose for 4 and 8 h synthesized lower amounts of TMOF (0.4 + 0.06 and 0.7 + 0.1 µg + S.E.M, respectively) by 3 x 108 cells. These results indicate that cells transformed by homologous recombination with pYDB2-gfp-tmfA expressed more TMOF than cells transformed with pYES2-gfp-tmfA.

3.2. Feeding of transformed S. cerevisiae cells to mosquito larvae 3.2.1 Cells transformed with pYDB2-gfp-tmfA and pYDB2-tmfA S. cerevisiae cells (strains #1 and #2) that were transformed with pYDB2gfp-tmfA or pYDB2-tmfA and fermented for 8 h were fed to mosquito larvae to test their larvacidal activity. Larval mortality reached 97 + 1.25 (% + S.E.M) after 6 days of feeding strain #1 (pYDB2-gfp-tmfA) that was stimulated with galactose for 8 h and then heat treated (75 0C, 3 h) (Fig. 9), whereas cells that were not heat treated caused only 58 + 2.4 (% + S.E.M) mortality (results not shown). These results indicate that heat treated cells release more of the synthesized GFP-TMOF inside the larval gut causing higher mortality. Cells that were engineered with pYDB2-gfp or with pYDB2-gfp-IEGR (controls) caused significant lower larval mortalities (1% and 13%, p<0.001 and p<0.004, respectively) (Fig. 9). Larvae that were fed strain #1 of S. cerevisiae transformed 16

with pYDB2-gfp-tmfA did not grow because of starvation caused by TMOF and lack of trypsin biosynthesis as compared with larvae that were fed S. cerevisiae transformed with pYDB2-gfp-IEGR that grew normally (Fig. 10).

Stimulating

strain #2 (pYDB2-gfp-tmfA) for 4 h with galactose following by heat treatment (75 0

C, 3 h) caused lower larval mortality (75 + 2.4 % + S.E.M) after 12 days of

feeding, whereas control cells (pYDB2-gfp and pYDB2-gfp-IEGR) caused significantly low mortalities of 10 + 0.7 and 12 + 0.6 (% + S.E.M, p<0.008 and p<0.005, respectively) (Fig. 11). Feeding Ae. aegypti larvae engineered S. cerevisiae cells (pYDB2-tmfA) strain #2 that were stimulated for 24 h in the presence of galactose and afterwards heat treated (75 0C, 3 h) caused 90 + 0.7 (% + S.E.M) mortality after 10 days of feeding, whereas cells that were transformed with an empty plasmid (pYDB2) did not cause mortality after 10 days of feeding (Fig. 12). These results indicate that a longer fermentation period (24 h) increases the potency of the genetically modified (pYDB2-tmf) strain #2 cells. 3.2.2 Cells transformed with pYEX-BX Plasmid pYEX-BX is a high copy plasmid that is driven by a strong copper promoter (Fig. 3). To find out if S. cerevisiae cells (strains #1 and #2) that were transformed with pYEX-BX carrying gfp-tmfA and (DPAR)4 can be used to control mosquito larvae, transformed cells were stimulated in the presence of copper for 6 and 24 h and fed to Ae. aegypti larvae in 48 well plates for 12 days. Larvae that were fed S. cerevisiae transformed with pYEX-BX-(DPAR)4 (strains #1 and #2) and stimulated with copper for 24 h killed 38% and 21% of the larvae in 12 days, similarly cells that were transformed with pYEX-BX-gfp-tmfA and stimulated with copper for 6 h killed 38% of the fed larvae in 12 days (Table 2) indicating that high levels of GFP-TMOF and (DPAR)4 required to kill mosquito larvae were not produced after copper stimulation.

3.2.3 Cells transformed with pYDB2-PHP To find out if a galactose promoter can be substituted by a heat shock promoter pYDB2 was engineered and a heat shock promoter (PHP) was substituted for the galactose promoter and the S. cerevisiae (strains #1 and #2) 17

cells were transformed by homologous recombination with pYDB2-PHP-gfp-tmfA (Fig. 4). Transformed cells from strains #1 and #2 were fermented, heat shocked for 5 h and fed to Ae. aegypti larvae causing low mortalities after 12 days of feeding (25% and 8%, respectively, Table 2). When examined under a fluorescence microscope the cells poorly fluoresced (results not shown) indicating that low amounts of GFP-TMOF were synthesized. 3.2.4 Large scale fermentation of recombinant S. cerevisiae (pYDB2-gfp-tmfA) For future industrial production of GFP-TMOF to control mosquito larvae the marsh, S. cerevisiae cell (strain #2) that were previously transformed by homologous recombination with pYDB2-gfp-tmfA were fermented in 10 L fermenter. Samples were removed after galactose induction at intervals (0, 6, 12, 15, 18, 26, 33 and 42 h) and analyzed by ELISA for TMOF (Table 3). TMOF biosynthesis in the bio fermenter reached a peak (0.99 µg/3 x 108 cells) after 6 h galactose induction with some variations during the fermentation period of 42 h (Table 3). Feeding Ae. aegypti larvae S. cerevisiae after 6 h induction (107 cells) that were heat inactivated (75 0C, 3 h) caused 92 + 4 (% + S.E.M) mortality after 12 days of feeding, whereas cells that were removed before the galactose induction cause only 10% mortality (results not shown). Even without galactose induction the transformed cells synthesized small amounts of TMOF 10-fold less than galactose induced cells (0.08 and 0.92 µg/3 x 108 cells, respectively, Table 3). Indicating that the PGAL1 maybe leaky allowing small amounts of GFP-TMOF to be synthesized without galactose induction. 4. Discussion Recombinant protein expression in S. cerevisiae is well established accounting for 20% of the recombinant proteins expressed by biopharmaceutical companies (Martinez et al. 2012). Few examples are, insulin, hepatitis B surface antigen, urate oxidase, glucagons and platelet derived growth factor (Demain and Vaishnav, 2009). Most of the proteins that are currently expressed by S. 18

cerevisiae for industrial purposes are secretory proteins (Graf et al. 2009). We, on the other hand, were looking to express our recombinant larvacidal proteins (TMOF, GFP-TMOF and (DPAR)4) inside the yeast cells because yeast cells are readily consumed by mosquito larvae in the laboratory and the yeast cell provides a protection layer to the recombinant proteins from exposure to sunlight and bacterial degradation in field applications (Manasherob et al. 2002). In earlier reports we explored the possibility of using an autonomous high-copy replicating episomal plasmid (pYES2, Invitrogen, CA, USA) that maintains up to 40 copies in the nucleus of S. cerevisiae based on the 2µ yeast origin of replication. However, only moderate larval mortalities of 67 + 4 and 46 + 8 (% + S.E.M) were achieved feeding the recombinant S. cerevisiae cells that were transformed with pYES2-gfp-tmfA and pYES2-tmfA to larval Ae. aegypti, respectively (Nauwelaers and Borovsky, 2002, Borovsky 2015). A second episomal vector pYEX-BX which can maintain up to 400 copies because of partial defective mutation to leu2 (leu2-d) was then used to express GFP-TMOF and (DPAR)4 in S. cerevisiae (strains #1 and #2) cells (Fig. 3). However, similar to our earlier published reports (Nauwelaers and Borovsky, 2002 and Borovksy, 2015) low mortalities (37% and 21%) were observed after 6 and 24 h stimulation with copper (Table 2). Even though the recombinant yeast cells could, in theory harbor up to 400 copies of pYEX-BX, and produce more of the recombinant insecticidal proteins, in practice, expression of more recombinant proteins may tax the cell biosynthetic pathway causing less synthesis of recombinant proteins. Similar observations were reported by Robinson et al. (1994) showing that high copy plasmids produced less recombinant proteins when compared with single or low copy plasmids. Free expressing plasmids like pYES2 and pYEX-BX in transformed yeast cells may pose environmental safety threats because they carry antibiotic resistant genes that could be transferred to other organisms when the recombinant yeast cells are used in the field (Berglund, 2015). Thus, transformation by homologous recombination (Fig. 2) is preferred allowing gfptmfA and tmfA to stably integrate into the S. cerevisiae genome at a predictable site on the ura3-52 (Rose and Winston, 1984, Fig. 6) and can be confirmed by 19

Southern blot analysis (Fig. 5). Our yeast strains (#1 and #2) contain the ura3-52 that carries a transposable element (Ty) at the 5’ non-coding region of the affected gene (Rose and Winston, 1984). In order to repair the URA deficiencies in strains #1 and #2 we used homologous recombination of the engineered plasmid pYDB2 carrying gfp-tmfA and tmfA. Homologous recombination in S. cerevisiae in strains carrying ura3-52 have been reported to cause single base substitutions or deletions (Kunz et al. 1994) thus, it is very likely that the loss of the HindIII site at the 5’ end of the ura3-52 after homologous recombination is due to either point mutation or deletion of HindIII cleavage site and not due to methylation event that does not happen at a HindIII site (New England Biolabs supplier information). Fermenting recombinant pYDB2-gfp-tmfA cells ( 3 x 108) of strain #1 in shake flask and strain #2 by large scale fermentation for 6 h indicated that the shake flask fermentation by strain #1 produced more GFP-TMOF than strain #2 during a large scale fermentation (2 µg and 0.92 µg, respectively, Fig.8 and Table 3). The differences in producing GFP-TMOF are not surprising. A large scale fermentation needs to be optimized before high quantities of GFP-TMOF can be achieved as was shown for S. cerevisiae cells producing ethanol during high scale industrial fermentations (Mukhtar et al. 2010). Because our large scale fermentation was not fully optimized for strain #2 future high volume fermentation of S. cerevisiae-gfp-tmfA cells needs to be fully optimized. Although the recombinant GFP-TMOF protein produced by the S. cerevisiae cells of strains #1 and #2 was not assayed by mass spectrometry to identify GFP and TMOF the Western blot analyses using specific antisera against GFP and TMOF identified the synthesized recombinant protein as GFP-TMOF (Fig. 7a, b). The recombinant protein ran by SDS PAGE as Mr 29 kDa which is close to the expected Mr of 28.64 kDa of the recombinant fusion protein GFP-TMOF (27.6 kDa GFP, and 1.047 kDa, TMOF). The potency of the recombinant S. cerevisiae cells (strain #1 and #2) expressing GFP, GFP-IEGR, GFP-TMOF and TMOF were tested and compared. Control cells expressing GFP, GFP-IEGR and control cells that were transformed with an empty plasmid (pYDB2) did not affect 20

Ae. aegypti larvae, only cells that were expressing GFP-TMOF and TMOF significantly killed mosquito larvae as compared with controls (Figs. 9, 11, 12). Strain #1 expressing GFP-TMOF killed larval Ae. aegypti much faster than strain #2 when both were fermented in a shake flask (6 days 97% and 12 days 75%, respectively) (Figs 9, 11). Strain #2 cells were transformed with pYDB2-gfptmfA and fermented by large scale fermentation and then heat treated killed 94% of the larvae even though they produced half the amount of TMOF that strain #1 cells produced (0.9 and 2 µg, respectively) (Fig. 12). These results indicate that 2.2-fold lower amounts of TMOF (87 nM) produced by strain #2 cells are effective in controlling larval mosquitoes. These results confirm an earlier report that 66 nM and 130 nM of TMOF expressed by recombinant P. pastoris cells killed 50% and 90% of Ae. aegypti larvae that were fed these cells (Borovsky, 2015). Transforming strain #2 with pYDB2-tmfA produced cells that killed 95% of the fed larvae in 10 days (Fig. 12). Since GFP does not affect mosquito larvae (Figs. 9 and 11) it is the TMOF moiety that is released by larval trypsin from GFP-IEGRTMOF after the recombinant cells are fed to mosquito larvae. A similar observation was reported using genetically modified TMV coat protein-IEGRTMOF that was fed to mosquito larvae. Feeding the TMV coat protein alone did not affect mosquito larvae, however, feeding TMV coat protein-IEGR-TMOF caused rapid mortality to mosquito larvae after the TMOF was released from the coat protein by trypsin in the mosquito gut (Borovsky et al. 2006) Several promoters were tested to find out a robust promoter to drive tmfA. S. cerevisiae recombinant cells (strains #1 and #2). Our engineered pYDB2 has a GAL1 promoter (PGAL1). The PGAL1 belongs to a powerful and tightly regulated promoters of S. cerevisiae that regulate galactose metabolism (PGAL1, PGAL7 and PGAL10) and are inducible in the presence of galactose and repressed in the presence of glucose. Activation by galactose at the upstream activation site (UAS) allows binding of GAL4 to the UAS of gal1 and in the process induces a robust expression level that depends on how many 17 bp palindromic sequences GAL4 binds (Schneider and Guarente, 1991). When S. cerevisiae cells were 21

transformed with pYDB2-gfp-tmfA or with pYDB2-tmfA carrying the PGAL1 high amounts of GFP and TMOF were produced after galactose stimulation that caused high fluorescence (GFP) and high larval mortalities (TMOF) when the engineered cells were fed to Ae. aegypti larvae. On the other hand, GFP or GFPIEGR caused very low mortalities (Figs. 8, 9, 11). S. cerevisiae cells that were transformed with pYEX-BX carrying gfp-tmfA and (DPAR)4 (Fig. 3) and a CUP1 inducible promoter (PCUP1) (Macreadie et al. 1991) were also tested. The advantage of using PCUP1 is that the level of induction depends only on external copper ions because it is not always desirable to change the glucose or nitrogen source to induce production of heterologous proteins. However, the pYEX-BX vector, caused low fluorescence (GFP) and low mortalities (Table 2). A third promoter, heat shock promoter (PHP) was also tested. Heat shock proteins are highly conserved proteins and are rapidly induced in the presence of heat, anorexia, ethanol and heavy metal ions (Lindquist and Craig, 1988). S. cerevisiae contains a large family of genes related to hsp70, the major heat shock inducible gene of Drosophila melanogaster. A ‘stress seventy subfamily A’ genes (ssa1, ssa2, ssa3 and ssa4) are induced when the temperature is shifted up and thus can provide a selective advantage for recombinant proteins production when transformed cells are grown for long term at 37 0C (WernerWashburne et al. 1987). The heat shock elements (HSE) are highly conserved and are located in the upstream promoter region of these genes. The PSSA1 contains a number of the HSE and HSE2 that seem to be important for heat inducible and the basal expression of the ssa1 (Park et al. 1989) as well as adjoining nucleotides at the heat shock upstream activation site (UASHS) (Slater and Craig, 1989). Cells that were transformed by homologous recombination using pYDB2 in which the PGAL1 was replaced with a PHP (Fig. 4) were not effective in killing larvae in the laboratory (Table 2) exhibiting low level of fluorescence. Thus, the PCUP1 and PHP although considered strong promoters were inferior to the PGAL1 in driving gfp-tmfA and tmfA. Similar observations were reported by Liu et al. (2012) testing two similar plasmids (POTud and CPOTud) carrying two different promoters PTEF1 and PTPI1 to drive a lacZ reporter gene in S. 22

cerevisiae. Although PTEF1 is considered a stronger promoter than PTPI1 the final recombinant protein production was lower in cells that were transformed with the plasmid that was driven by the strong PTEF1. As expected for a strong promoter, more transcript was indeed produced in the recombinant S. cerevisiae by PTEF1, however, the final protein titer was lower indicating that the choice of a promoter is not directly influencing the amount of protein synthesized. Other events including post transcriptional regulation are probably involved and affect the recombinant protein synthesis (Liu et al. 2012). Borovsky et al. 1994a and Borovsky 2015 reported that 33% of the TMOF that is synthesized by the mosquito ovary of Ae. aegypti is secreted into the hemolymph (37 ng or 3.5 x 10-5 M) enough to completely shut trypsin biosynthesis. Using this information, it is possible to calculate the amount of TMOF needed to be synthesized by the recombinant S. cerevisiae cells to completely shut off trypsin biosynthesis in the larval gut after feeding causing starvation and larval death. The average size of the yeast cell is 7.5 µm and the cell’s volume is 1.7 x 10-9 mL. Our shake flask ELISA results show that 2 µg TMOF (Mr 1047) were synthesized by 3 x 108 cells (Fig. 8) or 3.75 nM TMOF per cell. Thus, 7.5 x 103 cells of fermented recombinant S. cerevisiae cells will be able to completely shut off trypsin biosynthesis in adult or larval mosquito assuming that all the cells are broken in the gut and all the synthesized TMOF is released. Since we fed each larval mosquito 2 x107 cells, the amount of TMOF that each larvae consumed, assuming that all the cells were eaten by day 12, could easily shut off trypsin biosynthesis in 2,500 adults and larval mosquitoes. Thus, the amount synthesized by pYDB2-gfp-tmfA and pYDB2-tmfA transformed cells is sufficient to control mosquitoes in the marsh. Before genetically transformed yeast cells can be release into the marsh, they first must be heat inactivated to prevent accidental transfer pf genetic material to other organisms. The transformed S. cerevisiae cells that we tested were heated at 75 0C for 3h prior to feeding. This heating period was sufficient to make all the cells non-viable and plating these cells did not detect any viable 23

colonies (results not shown). Heat inactivated cells were more digestible by larval mosquitoes and the biological activity of TMOF was not affected (Figs 912). Heating the yeast cells for prolonged amount of time (75 0C, 3 h) releases carbohydratases and proteases that can partially hydrolyze the cell wall (Jones, 1991, Nguyen et al. 1998) making TMOF readily accessible in the larval gut. Heat treatment did not affect GFP-TMOF when the recombinant protein was tested with antisera against TMOF and GFP (Fig. 7). These results show that S. cerevisiae cells transformed with our engineered plasmids pYDB2-gfp-tmfA and pYDB2-tmfA could be used in the future to control mosquito larvae in the marsh.

Acknowledgements This work was supported by DACS, USA-Israel BSF, IBI and STTR grants to D.B. One of us (D.B.) is an established scientist fellow at the Oak Ridge Institute for Science and Education (ORISE). This research was supported in part by an appointment to the Agricultural Research Service (ARS) Research Participation Program administered by the Oak Ridge Institute for Science and Education (ORISE) through an interagency agreement between the U.S. Department of Energy (DOE) and the U.S. Department of Agriculture (USDA). ORISE is managed by ORAU under DOE contract number DE-AC05-06OR23100. All opinions expressed in this paper are the author's and do not necessarily reflect the policies and views of USDA, ARS, DOE, or ORAU/ORISE. References Berglund, B. 2015. Environmental dissemination of antibiotic resistance genes and correlation to anthropogenic contamination with antibiotics. Infect Ecol. Epidemiol. 5: 10.3402/iee.v5.28564

24

Boisvert, M., Boisvert, J. 2000. Effects of Bacillus thuringiensis var. israelensis on target and nontarget organisms: a review of laboratory and field experiments. Biocontrol Science and Technology. 10, 517-561. Borovsky, D. 1985 Isolation and characterization of highly purified mosquito oostatic hormone. Arch. Insect Biochem. Physiol. 2, 333-349. Borovsky, D. 1988 Oostatic hormone inhibits biosynthesis of midgut proteolytic enzymes and egg development in mosquitoes. Arch. Biochem. Physiol. 7,187-210. Borovsky, D., Mahmood, F., Carlson, D.A. 1989. J. Fla anti-Mosq. Assoc. 60, 66-70. Borovsky, D., Powell, C. A., Carlson, D. A. 1992. Development of specific RIA and ELISA to study trypsin modulating oostatic factor in mosquitoes. Arch. Insect Biochem. Physiol. 21, 13-21. Borovsky, D., Carlson, D.A., Griffin, P.R., Shabanowitz, J., Hunt. D.F. 1993. Mass spectrometry and characterization of Aedes aegypti trypsin modulating oostatic factor (TMOF) and its analogs. Insect Biochem. Mol. Biol. 23, 703712. Borovsky, D. Song, Q., Ma, M., Carlson, D. A., 1994a. Biosynthesis, secretion and cytoimmunochemistry of trypsin modulating oostatic factor of Aedes aegypti. Arch. Insect Biochem. Physiol. 27, 27-38. Borovsky, D. Powell, C. A., Nayar, J. K., Blalock, J. E., Hayes, T. K., 1994b. Characterization and localization of mosquito-gut receptors for trypsin modulating oostatic factor (TMOF) using a complementary peptide and immunocytochemistry. FASEB J. 8, 350-355. Borovsky, D., Mahmood. F. 1995. Feeding the mosquito Aedes aegypti with TMOF and its analogs; effect on trypsin biosynthesis and egg development. Reg. Peptides 57, 273-281. Borovsky, D., Rabindran, S., Dawson, W.O., Powell, C. R., Iannotti, D., Morris, T., Shabanowitz, J., Hunt, D. F., De Bondt, H. L. and De Loof A. 2006. Expression of Aedes TMOF on the virion of TMV: potential larvicide. Proc. Nat. Acd. Sciences 103 (50), 18963-18968. Borovsky, D., Khasdan, V., Nauwelaers, S., Theunis, C., Bertier, L., Ben-Dov, E. and Zaritsky, A. 2010. Synergy between Bacillus thuringiensis subsp. israelensis Crystal Proteins and Aedes aegypti Trypsin Modulating Oostatic Factor. Open Toxinology Journal 3, 116-125. 25

Borovsky, D., Nauwelaers, S., Van Mileghem, A., Meyvis, Y., Laeremans, A., Theunis, C., Bertier, L. and Boons, E. 2011. Control of mosquito larvae with TMOF and 60kDa Cry4Aa expressed in Pichia pastoris. Pestycyde/Pesticides 1-4: 5-15. Borovsky, D., Sterner, A. and Powell, C. A. 2016. Cloning and Expressing Trypsin Modulating Oostatic Factor (TMOF) in Chlorella desiccata to control Mosquito Larvae. Archives of Insect Biochem Physiol. 91, 17-36. DOI:10.1002/arch.21306. Borovsky, D. 2015. Trypsin Modulating Oostatic Factor (TMOF) and Insect Biotechnology. In Insect Molecular Biology and Ecology (ed. Klaus Hoffmann) pp.318-349. CRC Press, Boca Raton, London, New York Demain, A. L., Vaishnav, P. (2009). "Production of recombinant proteins by microbes and higher organisms." Biotechnol Adv 27, 297-306 Fukuda, H., Arai, M., Kuwajima, K. 2000. Folding of green fluorescent protein and the cycle3 mutant. Biochemistry, 39, 12025-12032. Gade, G and Goldworthy, G. J. 2003. Insect peptide hormones: a selective review of their physiology and potential application for pest control. Pest Manag. Sci. 59, 1063-1075. Gietz, R.D., Schiestl, R.H., Willems, A.R. , Woods, R.A. 1995. Studies on the Transformation of Intact Yeast Cells by the LiAc/SS-DNA/ PEG Procedure. Yeast 11, 355-360. Goldberg, L. J., Margalit, J. 1977. A bacterial spore demonstrating rapid larvicidal activity against Anopheles sergentii, Uranotaenia unguiculata, Culex univitattus, Aedes aegypti, and Culex pipiens. Mosq. News 37,355–358. Graf, A., M. Dragosits, M., Gasser, B., Mattanovich, D. (2009). "Yeast systems biotechnology for the production of heterologous proteins." FEMS Yeast Res 9(3): 335-348. Jone, E. W. 1991. Tacking the protease problem in Saccharomyces cerevisiae. Method. Enzymol. 194, 428-453. Kunz, B. A., Henson, E. S., Roche, H., Ramotar, D., Nunoshiba, T., Demple, B. 1994. Specificity of the mutator caused by deletion of the yeast structural gene (APN1) for the major apurinic endonuclease. Proc. Natl. Acad. Sci. USA. 91, 8165-8169.

26

Lindquist, S., Craig, E. A. 1988. The heat-shock proteins. Annu. Rev. Genet. 22, 631-677. Liu, Z., Tyo, K., E., J., Martínez, J., L., Petranovic, D., Nielsen, J. 2012. Different Expression Systems for Production of Recombinant Proteins in Saccharomyces cerevisiae. Biotechnol Bioeng. 109(5), 1259–1268. doi:10.1002/bit.24409. Macreadie, I.G., Horaitis, O., Verkuylen, A. J., Savin, K. W. 1991 Improved shuttle vectors for cloning and high-level Cu2+- mediated expression of foreign genes in yeast. Gene 104: 107-111. Manasherob, R., Ben-Dov, E., Xiaoqiang, W., Boussiba, S., Zaritsky, A. 2002. Protection from UV-B damage of mosquito larvicidal toxins from Bacillus thuringiensis subsp. Israelensis expressed in Anabaena PCC 7120. Current Microbiology, 45, 217-220. DOI: 10.1007//s00284-001-01065-5. Martínez, J. L., Liu, L., Petranovic, D., Nielsin, J. (2012). "Pharmaceutical protein production by yeast: towards production of human blood proteins by microbial fermentation." Curr Opin Biotechnol. 23 (6), 965-971. DOI: 10.1016/j.copbio.2012.03.011 Mukhtar, K., Asgher, M., Afghan, S., Hussain, K., Zia-ul-Hussnain, S. 2010. Comparative study of two commercial strains of Saccharomyces cerevisiae for optimum ethanol production of industrial scale. J. Biomedicine Biotechnology, 2010, ID 419586, 5 pages. DOI: 10,1155/2010/419586 Nauwelaers, S., Borovsky, D. 2002. Cloning and expression of trypsin modulating oostatic factor (Aea-TMOF) and green fluorescent protein (GFP) in Saccharomyces cerevisiae. Pp. 138-140. In: D. Konopinska, G. Coast, G. Goldworthy, R. J. Nachman and G. Rosinski (eds.). Arthropods 2001. Wydawnictawa Uniwersytetu, Wroclawskiego, Nguyen T, Fleet G, Rogers P. 1998. Composition of the cell walls of several yeast species. Appl Microbiol Biotechnol. 50, 206–212. Park, H., -O., Craig, E. A. 1989). Positive and negative regulation of basal expression of a yeast HSP70 gene. Mol. Cell Biol. 9(5), 2025-2033. Porter, A.G., Davidson, E. W., Liu. J.W. 1993. Mosquitocidal Toxins of Bacilli and Their Genetic Manipulation for Effective Biological Control of Mosquitoes. Microbiol.Rev. 57, 838-861. Ranson, H., N’Guessan, R., Lines, J., Moiroux, N., Nkuni, Z., Corbel, V. (2011) Pyrethroid resistance in African anopheline mosquitoes: what are the implications for malaria control? Trends in Parasitology. 27 (2), 91-98. 27

Robinson, A.S., Hines, V., Wittrup, K. D. 1994. Protein disulfide isomerase overexpression increases secretion of foreign proteins in Saccharomyces cerevisiae. Nat Biotechnol 12(4), 381–384. Rose, M., Winston, F. 1984. Identification of the Ty insertion within the coding sequence of the S. cerevisiae URA3 Gene. Mol. Gen. Genet. 193, 557-560. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press: New York Slater, M. R., Craig, E. A. 1989. The SSA1 and SSA2 genes of the yeast Saccharomyces cerevisiae. Nucleic Acids Res. 17(2), 805-806. Sanger, F., Nicklen, S., Coulson, A. R., 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA. 74, 5463-5467. Schneider, J. C., Guarente. L. 1991. Vectors for Expression of Cloned Genes in Yeast: Regulation, Overproduction, and Underproduction. Methods in enzymology. 194, 373-389. doi: 10.1016/0076-6879(91)94028-B. Tabor, S., Richardson, C. C. 1987. DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA. 84, 47674771. Werner-Washburne, M., Stone, D.E., Craig, E. A. 1987. Complex interactions among members of an essential subfamily of hsp70 genes in Saccharomyces cerevisiase. Mol. Cell Biol. 7(7), 2568-2577. WHO World Health Organization. 1998. Fact sheet 203. Roll Back Malaria Yang, Y.J., Davies, D. M. 1971. Trypsin and chymotrypsin during metamorphosis in Aedes aegypti and properties of the chymotrypsin. J. Insect Physiol. 17,117-131. Yoshida, J., Umezu, K., Maki, H. 2003. Positive and negative roles of homologous recombination in the maintenance of genomic stability in Sacchromyces cerevisiae. Genetics, 164, 31-46.

28

Figure legends Fig. 1. Construction of S. cerevisae plasmid pYDB2 from pYES2 for expressing GFP-TMOF and TMOF at the pYDB2 multiple cloning site is highlighted. The restriction enzyme ApaI for homologous recombination of pYDB2 carrying TMOF and GFP-TMOF and the direction of replication from the PGAL1 are indicated. An extensive figure appeared earlier showing different cloning strategies (see also Borovsky, 2015, Fig. 8). Fig. 2. Homologous recombination of pYDB2-gfp-tmfA at the mutated ura352 of S. cerevisiae. PYDB2-gfp-tmfA was opened with ApaI and homologous recombination occurred at S. cerevisiae ura3 resulting in S. cerevisiae genome carrying a mutated ura3, non-mutated ura3, gfp-tmfA and PGAL1. Incubation in the presence of galactose stimulate GFP-TMOF production. Fig. 3. Structure of pYEX-BX and construction of pYEX-BX carrying gfptmfA and (DPAR)4 and the position of the cloned genes in the multiple cloning site. The position of the ura3 and the leu2-d and the direction of replication from PCUP1 is also indicated. Fig. 4. Construction of pYDB2 carrying PHP including the position of gfp-tmfA in the multiple cloning site with the trypsin cleavage sequence (IEGR), ura3 and the ApaI restriction enzyme site for homologous recombination. The direction of replication from the PHP and the insertion site at the PinAI and the PuvII restriction sites on pYDB2-gfp-tmfA. Fig. 5. Southern blot analysis of S. cerevisiae cells that were transformed with pYDB2 carrying gfp-tmfA or tmfA. Recombinant cells were broken, genomic DNA isolated and cut with HindIII. DNA (5 µg/lane) was analyzed by Southern blot using ura3 probe (a, c) and gfp probe (b). The size of the DNA markers (on the left side) and the expected bands are indicated by arrows. Fig. 6. Genomic map of S. cerevisiae ura3 transformed with pYDB2-gfp-tmfA and pYDB2-tmfA. (a) Non-transformed wild type ura3-52 (Rose and Winston, 1984), (b) transformed ura3 with pYDB2-gfp, (c) transformed ura3 with pYDB2-gfp-tmfA. Map distances in bp are not to scale between HindIII and ApaI restriction sites. Triangles in a, b and c represent inserted Ty transposable element into ura3 to create ura3-52. Fig. 7. Western blot analysis of S. cerevisiae cells that were transformed with pYDB2-gfp-tmfA. Transformed S. cerevisiae cells were stimulated with 29

galactose and at intervals (0 to 48 h) and analyzed for GFP-TMOF synthesis with TMOF and GFP antisera (a and b, respectively). The sizes of the protein standards are indicated on the left. Fig. 8. Synthesis of GFP-TMOF in S. serevisiae (strain #1) cells transformed with pYDB2-gfp-tmfA at different intervals (0-8 h) during galactose stimulation. Cells were broken and analyzed by ELISA (Borovsky et al. 1992) and results are expressed as means of 3 determinations (ng + S.E.M) in 3 x 108 cells. Fig. 9. Feeding of larval Ae. aegypti heat treated S. cereviciae cells (strain #1) transformed with pYDB2-gfp-tmfA (GFP-IEGR-TMOF), pYDB2-gfp (GFP, control) and pYDB2-gfp-IEGR (GFP-IEGR, control). The cells were stimulated with galactose for 8 h and 2x107 cells were fed to 3 groups of 1st instar Ae. aegypti larvae (24 larvae/group). Survival was daily monitored for 12 days and the results are expressed as means of 3 determinations of live larvae/group + S.E.M. Fig. 10. Effect of feeding larval Ae. aegypti for 4 days S. cerevisiae cells (strain #1) engineered pYDB2-gfp-tmfA to (right and left) and with pYDB2gfp-IEGR (middle, control). Larvae fed with GFP-TMOF (right and left) their growth was severely retarded, whereas larvae fed with GFP-IEGR grew normally (middle). Fig. 11. Feeding larval Ae. aegypti heat treated cells (strain #2) transformed with pYDB2-gfp-tmfA (GFP-IEGR-TMOF), pYDB2-gfp (GFP, control) and pYDB2-gfp-IEGR (GFP-IEGR, control). The cells were stimulated with galactose for 8 h and 2x107 cells were fed to 3 groups of 1st instar Ae. aegypti larvae (24 larvae/group). Survival was daily monitored for 12 days and the results are expressed as means of 3 determinations of live larvae/group + S.E.M. Fig. 12. Feeding larval Ae. aegypti heat treated cells (strain #2) transformed with pYDB2-tmfA (TMOF) and pYDB2 (control). The cells were stimulated with galactose for 24 h and 2x107 cells were fed to 3 groups of 1st instar Ae. aegypti larvae (24 larvae/group). Survival was daily monitored for 12 days and the results are expressed as means of 3 determinations of live larvae/group + S.E.M.

30

31

32

33

34

35

36

37

38

39

40

41

42

Table 1. Primers used for the genetic engineering of S. cerevisiae plasmids Primers

Primer sequence (5’ to 3’)

tm (0C) pYDB2 and pYES2 gfp-tmfA: DB 207 (forward) 62 DB 209 (reverse) 68

AAGGTACCATGGCTAGCAAAGGAGAAGAA TTTCTAGATCAAGGAGGAGGAGGAGGAGGTGCTGGATCATA TCTACCTTCGATTTTGTAGAGCTCATCCAT

gfp-IEGR: DB 207 (forward) 62 DB 229 (reverse) 63 gfp: DB 207 (forward) 62 DB 230 (reverse) 57 tmfA: DB 192 (forward) 70 DB 193 (reverse) pYEXpYEX - BX gfp-tmfA: DB 208 (forward) 62 DB 210 (reverse) (DPAR)4 DB 515 (template) DB 507 (forward) 42 DB 508 (reverse)

sequence as above TTTCTAGATCATCTACCTTCGATTTTGTAGAGCTCATCCAT

sequence as above TTTCTAGATTCATTTGTAGAGCTCATCCAT

TCGAGATGTATGATCCAGCACCTCCTCCTCCTCCTCC TTGAT CTAGATCAAGGAGGAGGAGGAGGAGGTG CTGGATCATACATC

68

AAGAATTCATGGCTAGCAAAGGAGAAGAA TTCTGCAGTCAAGGAGGAGGAGGAGGAGGTGCTGGATCATA TCTACCTTCGATTTTGTAGAGCTCATCCAT

68

CCAACGAATTCATG ATGGATCCAGCTAGAGATCCAGCTAGAGATCCA ATG GCTAGAGATCCAGCTAGATGA TGAGGATCCGGCC TGA CCAACGAATCCATG GGCCGGATCCTCA

48

CTTTTCAATTCAATTCATCATT TGGGTAATAACTGATATAATTA

51 51

ura3 DB 213 (forward) DB 212 (reverse)

PHP DB 258 (forward) 65 DB 257 (backward)

AAACCGGTCCAGAACATTCTAGAAAG AACAGCTGCTCGAAGATACATCAATC

65

Underlined sequences indicate restriction enzymes cleavage sites for primers: DB 207 KpnI, DB 209, DB 229, DB 230, DB 193 XbaI, DB 192 XhoI, DB515 (template) EcoRI and BamHI including start ATG and stop TGA (bold) signals, DB 507 EcoRI, DB 508 BamHI, DB257 PvuII and DB258

PinAI.

Table 2. Feeding Ae. aegypti larvae with recombinant S. cerevisiae strains transformed with pYEXpYEX -BX and pYDB2pYDB2-P HP Yeast strains #1 pYEX-BX-(DPAR) 4

Groups 3

Stimulation (h) 24

43

Live larvae + S. E.M) 15 + 1.2

#2 pYEX-BX-gfp-tmfA 3 6 15 + 1.2 #2 pYEX-BX-(DPAR) 4 3 24 19 + 1.5 #1 pYDB2-PHP-gfp-tmfA 3 5 18 + 6 #2 pYDB2-PHP-gfp-tmfA 3 3 22 + 3 #1 Control (wld) 3 4 24 + 0 #2 Control (wld) 3 4 23 + 1 7 Three groups of Ae. aegypti (24 larvae/group) were fed recombinant yeast (2 x 10 cells) for 12 days. Larval survival was daily monitored and expressed as means of 3 determination + S.E.M. S. cerevisiae cells were stimulated with copper (pYEX-BX) or by heat shock (pYDB2PHP).

Table 3. Synthesis of GFP and TMOF by S. cerevisiae (strain #2) transformed with pYDB2pYDB2-gfpgfp-tmfA during a large scale fermentation. Galactose stimulation (h) TMOF (µg/3x108 cells) 0 0.08 6 12 15 18 26 33 42

0.92 0.73 0.42 0.79 1.1 0.99 0.59 S. cerevisiae cells were broken with glass beads at different times after the galactose induction, and assayed by ELISA using antiserum against TMOF. Results are means of two determination with variation of 5-10% between each determination.

44

Graphical abstract

45

High Lights • • • •

GFP-TMOF Expression in S. cerevisiae Homologues recombination Larval control with recombinant S. cerevisiae-tmfA Genetic engineering of S. cerevisiae

46