Cloning of a G protein-activated inwardly rectifying potassium channel from human cerebellum

MOLECULAR BRAIN RESEARCH ELSEVIER

Molecular Brain Research 39 (1996) 23-30

Research report

Cloning of a G protein-activated inwardly rectifying potassium channel from human cerebellum 1 Oscar Schoots a,b, Kay-Tsz Yue c, John F. MacDonald a, David R. Hampson Jose N. Nobrega a, Lori M. Dixon a, Hubert H.M. Van Tol a,~,*

C

a Clarke Institute of Psychiatry, 250 College Street, Toronto, Ont. M5T IR8, Canada b Rudolf Magnus Institute, Universiteitsweg 100, 3584 CG Utrecht, Netherlands c Department of Pharmacy, University of Toronto, Canada d Department of Physiology, University of Toronto, Canada e Department of Pharmacology, University of Toronto, Canada Accepted 12 December 1995

Abstract

Based on sequence homology with the rat atrial G protein-coupled muscarinic potassium channel (GIRK1 or KGA1/KGB 1), a human cDNA encoding a G protein-activated inwardly rectifying K + channel (HGIRK1) was isolated. The cDNA encodes a protein of 501 amino acids and shares 99% identity to rat GIRK1 in its total amino acid sequence. Southern blot analysis of genomic DNA indicates a high degree of conservation among various species. In the human population a useful NlaIII restriction fragment length polymorphism was found in the coding sequence of HGIRKI. Co-expression of HGIRK1 and the 5-HTIA receptor in Xenopus oocytes resulted in opening of the channel upon treatment with serotonin. HGIRK1 currents showed strong inward rectification and could be blocked by extracellular Ba 2+. Northern blot analysis shows that HGIRK1 expression in human is most abundant in the brain, while lower levels are found in kidney and heart. Keywords." Inward rectifier; Potassium channel; G protein; cDNA cloning; Human cerebellum; Restriction fragment length polymorphism; Serotonin receptor

1. Introduction

Direct coupling of neurotransmitter receptors to ion channels via G proteins is an important mechanism for signal transduction. The best characterized example is the G protein-coupled muscarinic potassium channel which is present in the atria of vertebrates. Parasympathetic innervation by the vagus nerve results in the release of acetylcholine and subsequent slowing of the heart rate. These physiological effects are mediated through binding of acetylcholine to the muscarinic M2 receptor which activates an inwardly rectifying potassium channel [32]. This activation is through a membrane-delimited pathway which does not involve cytoplasmic intermediates [3,13,30]. In excised membrane patches both G~i as well as G ~ show activation of this K + channel [23,39]. The rat muscarinic

* Corresponding author. Fax: (1) (416) 979-4663. The Genbank accession number for HGIRK1 nucleotide sequence is U50954. 0169-328X/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved SSDI O169-328X(95)O0349-5

potassium channel, or at least one of its important subunits, has been cloned by homology screening [21] and expression cloning [7] and named GIRK1 and KGA1 respectively. Recently Krapivinsky et al. [20] showed that GIRK1 can form heteromultimeric complexes with another cardiac inwardly rectifying K + channel subunit, CIR. The GIRK 1 / C I R heteromultimer more closely resembles I K ~,ch than either homomeric channel does. More importantly, the potential for heteromultimer formation drastically increases the number of possible inwardly rectifying potassium channels. Studies on the cloned channels indicate that both GIRK1 and CIR are regulated by Ggv [20,31,36,38]. However, this does not preclude a regulatory role for G~ with these or other inward rectifiers [6]. Inward rectification of this class of channels is attributed to a voltage-dependent internal block by Mg2+ and polyamines [9,10,25,26,37]. G I R K 1 / K G A 1 / K G B 1 is widely expressed in the brain [17] suggesting an important role in receptor mediated inhibitory postsynaptic potentials. Sev-

24

O. Schoots et al. / Molecular Brain Research 39 (1996) 23 30

eral other inwardly rectifying potassium channels that have been cloned are also expressed in the nervous system [2,14,15,19-22,27,29,35]. In this study we describe the cloning, characterization and expression of the human homologue of rat G I R K 1 / K G A I / K G B I . The human homolog was designated HGIRKI and was characterized by electrophysiological studies in Xenopus oocytes. HGIRKI was expressed alone, or co-expressed with the 5-HTIA receptor [1].

2. Materials and methods

2,1. cDNA cloning Total RNA was isolated from rat atrium (RNAgents, Promega) and first strand cDNA synthesis was done with 2.5 beg total RNA (Preamplification System, GIBCO BRL) using a rat GIRKl-specific primer (5'-TTATGATGTCCTCCCTTTGT-3', nt 1689 to 1670, numbering according to [24]). The first round of amplification was performed with this primer and a second rat GIRKl-specific primer (5'-CGCCTCCGCTTCGTGTTTGA-3', nt - 4 2 to - 2 3 ) for 25 cycles at 50 s 94°C, 50 s 55°C and 30 s 72.5°C (Coy Tempcycler). A re-amplification of 40 cycles was done with a nested primer set ( 5 ' - T C C C C T C C G T A T TATGTCTG-3', nt - 13 to 7 and 5'-ATGCCTAATGGGGTGTTTTG-3', nt 1526 to 1507) using the same conditions. The PCR mix was run on a 0,7% agarose gel and a fragment of 1.5 kb was isolated and subcloned into pBluescript S K ( - ) (Stratagene). Sequencing proved it to be the rat G I R K 1 / K G A I cDNA. This 1.5 kb cDNA clone was excised from the vector, electrophoresed on an agarose gel and purified by freeze phenol extraction. One hundred ng of this 1.5 kb cDNA was labelled by random priming using [c~-32P]dCTP (Random Primed labelling kit, Boehringer Mannheim) and used to screen 800000 recombinants of a Agtl0 human cerebellar cDNA library (Clontech) under low stringency conditions (5 × SSPE, 0.1% SDS, 5 ×Denhardts, 100 beg/ml herring sperm DNA, 30% formamide at 42°C). Four strongly hybridizing plaques were picked for secondary screening, and A-phage DNA was isolated. The inserts were subcloned in pBluescript S K ( - ) and sequenced. A 2.9 kb clone containing a 1.5 kb open reading frame named HGIRKI was used for further characterization, Sequencing was done by the dideoxy chain-termination method [33] using Sequenase and 7deaza-dGTP (United States Biochemical).

formamide at 42°C) with the 2.9 kb HGIRKI cDNA as probe, washed in 0.1 × S S C , 0.1% SDS at 65°C and exposed for 36 h at - 7 5 ° C to X-ray film using an intensifying screen (Reflection, NEN-Dupont). Probe was prepared as described in Section 2.1, but now using the 2.9 kb human cDNA clone. RNA on this blot was isolated from heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. Each lane contains ~ 2 beg RNA, except skeletal muscle for which ~ 4 beg poly A + RNA was used. Following hybridization with HGIRKI, the integrity of the Northern blot was confirmed by hybridization with a [c~32p]dCTP random primed /3-actin control probe. Exposure to X-ray film was for 4 h at - 7 5 ° C with an intensifying screen.

2.3. Southern blot analysis To study the conservation of GIRK1 among species, a Southern blot containing genomic DNA from various species (ZOO blot Clontech; 8 # g of EcoRI digested genomic DNA per lane) was probed with the 2.9 kb HGIRK1 cDNA. The conditions used were identical to those described for Northern blot hybridization. The final washes however were in 0.05 × SSC, 0.05% SDS at 70°C. Following washing, the blot was exposed to X-ray film for 4 days at - 7 5 ° C in the presence of an intensifying screen (Reflection, NEN Dupont). The sources for genomic DNA were human, Rhesus monkey, Sprague-Dawley rat, B A L B / c mouse, dog, cow, rabbit, chicken and Saccharomyces ceret,isiae. Except for yeast and human, all genomic DNAs were isolated from kidney tissue. Human genomic DNA was isolated from placental tissue.

2.4. NlaIH restriction.fragment length polymorphism anal~,sis Of 45 unrelated Caucasians, 100 ng genomic DNA was amplified by PCR using the HGIRKl-specific primers 5'TCCTTAGAAGAGGGATTCTTTA3' (nt 994 to 1015) and 5'GGAAAGTCTTCTCTTCCAGTAA3' (nt 1238 to 1217). Forty cycles (0 s 94°C, 0 s 57°C, 15 s 72°C) were done in 10 bel of 50 mM Tris, 250 beg/ml BSA, 0.5% Ficoll, 1 mM Tartrazine, 3 mM MgC12, 0.5 beM of both primers and 1 unit Taq polymerase using a 1605 Air Thermo-Cycler (Idaho Technology). After PCR, each sample was incubated at 37°C for 2 h with 2 units of the restriction endonuclease NlaIlI (New England Biolabs), and electrophoresed on a 6% nusieve agarose gel (FMC Bioproducts).

2.2. Northern blot analysis 2.5. Expression and electrophysiology Tissue distribution of HGIRKI mRNA was studied by Northern blot and in situ hybridization. A poly A + Human Multi Tissue Northern Blot (Clontech) was hybridized under high stringency conditions (5 × SSPE, 0.5% SDS, 10 × Denhardt's, 100beg/ml herring sperm DNA, 50%

For expression in Xenopus oocytes, the cDNAs were subcloned in the expression vector pCIS2 which uses the cytomegalovirus early gene promoter for transcription initiation. Oocytes were isolated by partial ovariectomy under

O. Schoots et a l . / Molecular Brain Research 39 (1996) 23-30

tricaine anesthesia (0.15%). Oocytes were treated for 2 h with 2 m g / m l collagenase (Sigma type 1A) in OR-2, followed by, if necessary, careful removal of the follicle -196 -141 1 -15

25

cells with tweezers. Between 2 and 4 h after defolliculation, the nuclei were injected with 60 nl of 600 n g / / z l plasmid DNA. Oocytes were injected with the HGIRK1 or

ctccgtcccaggggagaaggagaggcgtctgcagggggcagagaccgcagctacc tgccgggtgcgccccccacccaggagcgctcgcttcgccccctttcctccccccgcccccacctcc•tattggtgctagtttgcagcgcccagctcctgcgccttcgcttcgcgtttgaatctggc Met

~cgccccttcgtatt

AT

Set Ala Leu Arg Arg Lys Phe Gly Asp Asp Tyr Gln Val Val Thr Thr Ser Set Set Gly Set Gly Leu Gln Pro CAG CCC

TCT GCA CTC CGA AGG AAA ~IT GGG GAC GAT TAT CAG GTA GTG ACC ACA TOG TCC AGC GGC TCG GGC ~

-142 -16 26 78

Gly 27 79

Gln Gly Pro Gly Gln A ~ Pro Gln Gln Gin Leu Val Pro Lys Lys Lys A ~ Gln Arg Phe Val Asp Lys ASh GIy Arg Cys Asn Val 01n CAG GGG CCA GGC CAG GAC CCT CAG CAG CAG CTT G'~ CCC AAG AAG AAG CGG CAG CGG TTC G ~ GAC AAG AAC GGC CGG TGC AAT GTA CAG

56 168

57 169

MYR MYR PKC CKI I Hls Gly ASh Leu Gly Ser GIu Thr Set Arg Tyr Leu Set Asp I.eu Phe Thr Thr Leu Val ASp Leu Lys Trp Arg Trp Ash Leu [Pbe Ile CAC GGC AAC CTG GGC AGC GAG ACA AGC CGC T~E CIC TOG GAC CTC TIE ACC ACG CI~ G ~ GAC C'IC AAG T~G CGC TGG AAC CTC [TIC ATC

86 258

87 259

I£I CKII Arg Gly Asp Leu Asn Lys Ala His Phe Ile Leu Thr Tyr Thr Val Ala Tzp Leu Phe Met Ala Ser Met Tzp Tzp Val Ile Ala ]Tyr ~ AT~ CTC ACC TAC ACC GTG GCC TGG CTT A ~ GCG TCC A T TGG T~G G ~ ATC GCC ITAC ACT CGG GGC GAC C ~ AAC AAA GCC CAC

116 348

117 349

N-Glyc Val Gly Asn Tyr Thr Pro Cys Val Ala ASh val Tyr ASh Phe Pro Ser [Aim phe Leu Phe Phe Ile GIu Thr Glu Ala Thx Ile Gly Tyr GTC GGT AAC TAC A(~ CCT TGC Gq~ GOC AAT G~C TAT AAC TIE CCT TCTIGCC TIC C'fC TIC T ~ ATC GAG ACG GAG GCC ACC A ~ GGC TAT

146 438

m

CKII 147 439

Gly Tyr Arg Tyr]Ile Thr ASp Lys Cys Pro Glu Gly Ile Ile Leu Phe Leu Phe Gln Set Ile Leu Gly Set Ile Val Asp Ala Phe Leu GGC TAC CGA TAC JATC ACA GAC AAG TGC CCC GAG GGC ATC ATC CIC TIC CIE TIC CAG TCC ATC CTG GGC ~

A~/C GTG GAC GCC TIC CTC CKII

176 528

177 529

pKA PKC Ile Gly Cys [Met Phe Ile Lys Met Set Gln Pro LFS Lys AI~ Ala Glu Thr Leu Met Phe Ser GIU His Ala Val Ile Ser Met Arg ASp A~C GGC TGC [A'i~ ~ A ~ AAG ATG TOC CAG CCC AAG AAE CGC GCC GAG AOC CTC ATG ~ AGC GAG CAC GCG G ~ Aq~ ~ ATG AGG GAC

206 618

207 619

MYR Gly Lys Leu ~ Leu Met P~e Arg Val Gly Asn Leu Arg Asn Ser His Met Val Set Ala Gln Ile Arg Cys Lys Leu Leu 5ys Set Arg GGA AAA CTC ACG CIT A ~ TTC CGG G ~ GGC AAC CTG CGC AAC AGC CAC A~G G ~ TCC GOG CAG ATr CGC TGC AAG CTG C'IU AAA TCT CGG

236 708

237 709

CKII Gln Thr Pro Glu Gly GIu Phe Leu Pro Leu Asp Gln Leu GIU Le~ Asp Val Gly Phe Ser Thr Gly Ala Asp Gln Leu Phe Leu Val Set CAG ACA CCT GAG GGT GAG ~ C'Ff CCC CIT GAC CAA CIT GAA CI~ GAT GTA GGT TIT AGT ACA GGG GCA GAT CAA CIT TIT CIT GTG TCC

266 798

267 799

Val PKC Pro neu Thr Ile Cys HlS Val Ile Asp Ala Lys Ser Pro Phe Tyr AS~ 5es Ser Gln Arg Ser Met Gln Thr Glu Gln Phe Glu Ile Val CAG CGA AGC ATG CAA ACT GAA C~C TIC GA~ AT~ GTC CCC C~C ACA ATr TOC CAC GTG ATC GAT GCC AAA AGC CCC q'IT TAT GAC CTA ~

296 888

CKII Glu Asp Glu Val Leu Trp Gly His Arg Glu Thr Thr Gly Met Thr Cys Gln Ala Arg Thr Set Tyr CAA GCT CGA ACA ~ TAT ACT GAA GAT GAA GTT C'Ff TGG GGT CAT CGT GAA ACA ACT GOG A T ACT ~

326 978

GIU Glu Gly Phe Phe Lys Val ASP q~yr Ser Gln Phe His Ala Thr Phe Glu Val Pro Thr Pro Pro Tyr GAA GAG GGA TIE TIT AAA G~Ff GAT TAC TCC CAG TIC CAC GCA ACA TIT GAA GTC CCC ACC CCA CC~ TAC

356 1068

297 889 327 979

Val Ile Leu Glu Gly Ile Val G~C A~/C CTA GAA GGC AT~ G ~ CKI I Phe phe Pro Val Ile Set Leu ~ %"IT CCT GTA ATr TCC q'rA

v

CAT

G.

Nla

IZ~ m i t e

357 1069

PKC Set Val Lys Glu Gln GIu GIu Met Leu Leu Met Ser Ser Pro Leu Ile Ala Pro Ala Ile Thr ASh Ser Lys Glu Arg His Asn Set Val AGT GTG AAA GAG CAG GAG GAA A%~ CIT CTC A~G TCG TCC CCT ~TA ATA GCA CCA GCC ATA ACT AAC AGC AAA GAA AGA CAT AAT q~CT GTG

386 1158

387 1159

PKC CKII Set PKC Thr Lys Le~ Pro Ser Lys Leu Gln Lys Ile ~nr Gly Arg GIu Asp Phe Pro Lys Lys heu Glu Cys 5eu Asp Gly Leu Asp ASp Ile GAA T~C ~ A GAT GGA CTA GAT GAT AqT ACT ACA AAA CTA CCA T~T AA~ C'[G CAG AAA ATT ACT GGA AGA GAA GAC TIT COC AAA AAA CTC

416 1248

417 1249

CKI I PKC CKII • Leu Arg Met Set Ser Thr Thr Set Glu 5ys Ala Tyr Ser Leu Gly A~@ Leu Pro Met Lys Leu Gln Arg Ile Ser Set Val Pro Gly Asn TIG AGG A T ACT TCT ACA ACT TCA GAA AAA GCC TAC AGC ~ GGA GAC TTG CCC A T AAA CIT CAA CGA ATA AGT TCA GTr CCG GGC AAC

446 1338

447 1339

CKII PKC Ser Glu Glu Lys Leu Val Ser Lys Thr Thr r.ys Met Leu Set Asp Pro Met Set Gln Ser Val Ala Asp Leu Pro Pro Lys Leu Gln Lys TCA GAA GAA AAA CTG GTA ~ AAA ACC ACC AAG ATG TTA TCT GAT CCC ATG AGC CAG TCT G~G GC~ GAT q'IG CCA CCA AAG CTT CAA AAG

476 1428

477 1429

PKC PKA Met Ala Gly Gly Ala Ala AZ~ Met GIU Gly A~m Leu Pro Ala Lys Leu Arg Lys Met Asn Set ASp Arg Phe Thr stop ATG GCT GGA GGA GCA GOt AGG ATG GAA GGG AAC C'IT CCA GCC AAA ~ A AGA AAA ATG AAC TOT GAT COC TIC ACA TAA caaagcactcccttag

501 1522

Pro Thr

MYR

2531

gcattatttaatgtttgatttagtaatagtccaatatttggcgatgaggtaattctccctaaggaatctgaaagtata~tttcctcccagttctacagcatatt~cgagaaccc~tcc~tt~ccaa gtattgcgaa•gtGcagaaagcaacagttacggagggaggacatcataag•aagt•attaacgggcatgtattatcacatcaagcatgcaataatgtgcaaattttgcatttagttttatggcatg a•ttatatatggcatatttatattgtatattctggaaaaaaaaatatatatatatatttaaaggggagatactctccctgacatttctaacatat•tattaagccaaacatgagtgaatagctttc agggcgataaaactaaatatatgtctgtgtgtgtg~gtgtatgtatacacacatatacatatatatatacacatacatacacatacatacatacatacatatatatctgataaaattgtgatg~t tgttcaaagttgtagttcttgtgcatgtttactttattagagtaggaagg¢tactggc&ttaattattaatacc~aatattttagccttaa&tttttgtcatt~taaa~tctgatttaatgttttc tg•tgtttaaggtcttgggaggc•ttcaattgtattttacatgagagaa•cacacaag•ttgtgctatctatggccctgcaaaaatataaccattacatgtttaaattgtaaattt•agagcatac ca~tactca~tatagcatt~aacatttcttatgatttttaaaagttgctagtactggggagaaataattgttgat~aatttgagaattattcctttcctagactaattaaaatc~ggaaatctgtt ttgtatatgatctaatacaaagatgagctctgaacaaacactgaatcatgttaatagacagtagccaagttatattgaatatatcagaatctgtgtgaa•ttacacaattaattgtccctgtttca aactgagtaaattggaaacattttctttctttttctggaaattttgtccattttaaaaaccaatcattttaagaagacatgacaatgcaatgaaacagatgataaatatttatgcttaaaataaaa

2657

aaaaaaaaa

1523 1649 1775 1901 2027 2153 2279 2405

1648 1774 1900 2026 2152 2278 2404 2530 2656 2665

Fig. 1. Nucleotide and deduced amino acid sequences of the 2.9 kb HGIRK1 cDNA. The proposed transmembrane domains, MI and M2, and the pore forming domain H5 are boxed. Residues that are different in rat GIRK1 are shown in italics above the human sequence. The human coding nucleotide sequence shows 95% homology to rat (not shown), resulting in a protein that is 99% identical. Asn119 in the putative extracellular domain is a potential N-glycosylation site (N-Glyc). Four putative myristylation sites (MYR) are present in the intracellular amino and carboxy tails as well as consensus sequences for nine protein kinase C (PKC), two protein kinase A (PKA) and 11 casein kinase II (CKII) phosphorylation sites. Two of the casein kinase II consensus sequences are not in the predicted intracellular domains. The polymorphism at nt 1038 (C or T) that codes for a NlaII1 site is indicated in bold below the sequence. Primers used for NlaIII RFLP detection are indicated by arrows. Nucleotide A of the translation start codon (ATG) is assigned as + I. The polyadenylation signal consensus sequence is underlined.

26

o. Schoots et al. / Molecular Brain Research 39 (1996) 23-30

5-HT1A receptor c D N A s [1] alone, or co-injected. After injection, oocytes were maintained in ND96 supplemented with 1 m M sodium pyruvate and 100 / x g / m l gentamycin. Three days later whole oocytes were voltage clamped using two electrodes and an Axoclamp-2 amplifier (Axon Instruments). Microelectrodes were filled with 3 M KC1 and had tip resistances of 0 . 7 - 1 . 0 k ~Q. For electrophysiological characterization the oocytes were placed in a chamber perfused with ND96 and the holding potential set at - 6 0 inV. For reduced K + concentrations the potassium was replaced by equimolar Na + in the ND96 buffer. Currents were recorded either with or without the inclusion of 1 /xM serotonin in the various buffers. C u r r e n t - v o l t a g e characteristics were studied using voltage ramps that ran from - 100 to + 4 0 mV (70 m V / s ) . The block of currents by extracellular Ba ~+ was studied by adding 100, 200 or 300 /xM BaC12 to the perfusion buffer. All recordings were done at room temperature.

~1

23.5

o

~6

o

o

o

r~

~

--

9.4-6.7--

4.4--

2.3

--

2.0--

3. Results 3.1. S t r u c t u r e a n d tissue d i s t r i b u t i o n o f H G I R K I

Reverse transcription and PCR amplification of rat atrial total R N A with G I R K l - s p e c i f i c primers resulted in the amplification of a 1.5 kb fragment (not shown). Sequencing confirmed that this fragment contained all of the coding sequence of the rat G I R K 1 / K G A 1 cDNA. Hybridization of a human cerebellum library with this rat G I R K I PCR fragment resulted in the isolation of a 2.9 kb cDNA. Sequencing of this clone showed that it contained a 1.5 kb open reading frame with 95% nucleotide sequence homology with rat G I R K I . The 2.9 kb clone codes for a protein of 501 amino acids with a calculated M W of 56.6 kDa that displays 99% identity to the rat protein (Fig. 1). Two of the five differences in amino acid sequence represent conservative changes (Va1295 to Ile295, and Ser396 to Thr396). The change of serine to threonine results in preservation of the consensus sequence for phosphorylation by protein kinase C. The remaining three amino acid differences are non-conservative changes (Gly32 to Asp32, Pro481 to Ala481, and Thr482 to Ala482). Based on the high degree of homology with the rat GIRK1 cDNA, this human clone was named HGIRK1. The rat and human GIRK1 c D N A s share 87% nucleotide homology over 63 bp in the 5' and 78% over 531 bp in the 3' untranslated region. The human c D N A clone that was isolated has a longer sequence at the 5' end than the rat KGB1 and uses another polyadenylation site farther into the 3' untranslated region of the gene (Fig. 1). The three other c D N A s isolated from the library were partial HGIRK1 clones, one extending another 1.4 kb farther into the 3' untranslated region (not shown). Southern blot analysis (Fig. 2) of E c o R 1 digested human genomic D N A probed with the 2.9 kb H G I R K I fragment indicated the presence of 3 strongly

Fig. 2. Southern blot of genomic DNA of various vertebrates and yeast hybridized under high stringency conditions with the 2.9 kb HGIRKI cDNA. EcoRl-digested human genomic DNA displays strong hybridization for a 28, 14 and 7 kb fragment. All species give a relatively strong hybridization signal when compared to human, indicating a high degree of homology. Rat GIRK1/KGA1/KGB1 has 95% homology over the 1.5 kb coding sequence, and approximately 80% in part of the 5' and 3' untranslated regions. Each lane contains 8 /xg of EcoRI digested genomic DNA of the species indicated. The final wash was in 0.05 × SSC, 0.05% SDS at 70°C and exposure was for 4 days at -75°C using an intensifying screen. Size markers (in kb) are indicated on the left.

hybridizing bands of approximately 28, 14 and 7 kb. Genomic D N A of the other vertebrates and yeast, present on this blot, also displayed strong hybridization signals. In the deduced amino acid sequence several consensus sequences for post-translational modifications can be recognized. Two consensus sequences with a relatively high probability for phosphorylation by cAMP-dependent protein kinase [ ( L y s / A r g ) - ( L y s / A r g ) - X a a - X a a - ( S e r / T h r ) , Fig. 1] as well as another 8 with a lower probability [ ( L y s / A r g ) - X a a - ( S e r / T h r ) ] (not indicated) are present in the putative intracellular carboxy tail [18]. in addition, 9 potential protein kinase C, 11 casein kinase I1 as well as four consensus sequences for myristylation were identified in the putative cytoplasmic amino- and carboxy terminal domains of the channel protein (Fig. 1). A single putative N-linked glycosylation site was found at A s n l l 9 in the predicted extracellular domain between the first membrane spanning domain, M1 and the pore-forming region, H5 (Fig. l ). The distribution of HGIRK1 in human tissues as determined by Northern blot analysis showed that the most

O. Schoots et al. / Molecular Brain Research 39 (1996) 23-30

27

abundant expression was in the brain (Fig. 3). Two major RNA bands of 4.3 and 6.2 kb hybridized with the 2.9 kb cDNA probe. Longer exposure showed clear expression of a 4.3 and 6.2 kb transcript in kidney, though in whole heart only very faint bands were visible. Hybridization with the /3-actin probe after HGIRK1 hybridization shows the integrity of the Northern blot. For heart and skeletal muscle, the smaller transcript of 1.7 kb is, as expected more abundant than the 2.0 kb transcript. The increased intensity of the radioactive signal for the skeletal muscle is in agreement with the use of more poly A + RNA for this sample (see Materials and methods).

(A)

V(mV)

[Kq 5 0 m M ~

3.2. Nlalll restriction fragment length polymorphism

(B)

-60

-40

I00

20

-20

-50 -I00

-~5o I(nA) -200 -250

96 mM

-300 -350

PCR amplification of the genomic DNA samples showed upon gel electrophoresis a single 245 bp fragment in all 45

[Ba:+]

V(mV) 300I~M

! -80

200 ~tM ~

'

100I~M ~ " /

100j...~

! ! i - 6 0 ~ f

~

/

20 -tO0 -200

D [o

0

/

I(nA)

-300 -400

9.5

--

7.5-4.4--

2.4

--

1.35

--

HGIRKI

~-actin

Fig. 3. Northern blot analysis of HGIRK1 mRNA expression in various tissues. The arrows indicate the two major HGIRKI mRNA transcripts of 4.3 and 6.2 kb found in brain, kidney and heart. Longer exposure showed a more clear signal in kidney, but in heart the signal remained faint (not shown). Each lane represents approximately 2 /xg of human poly A + RNA of the indicated tissues, except skeletal muscle for which ~ 4 /zg was used. The blot was hybridized under high stringency conditions with the 2.9 kb HGIRK1 cDNA as a probe. Final washes were in 0.1 ×SSC, 0.1% SDS at 65°C followed by exposure to film at - 75°C for 36 h with an intensifying screen. The positions of RNA size markers (in kb) are indicated on the left. Hybridization with a /3-actin control probe confirms that the blot is intact and indicates relative quantities of RNA.

Fig. 4. (A) HGIRKI currents studied by coupling to 5-HTIA receptors, co-expressed in Xenopus oocytes. The nucleus of each oocyte was injected with expression vectors containing cDNAs for the 5-HT1A receptor and for HGIRKI. Three or four days later oocytes were voltageclamped and currents evoked by application of 1 /xM serotonin. Currents were studied with various concentrations of extracellular K +. In each case, the oocyte was voltage-clamped to - 6 0 mV and inwardly rectifying HG1RKI channels were activated using voltage-ramps which ran from - 1 0 0 to + 4 0 mV (70 m V / s ) . Current-voltage plots were generated by subtracting the currents observed in the absence of serotonin from those recorded in its presence. Potassium was replaced by equimolar sodium. As would be anticipated, increasing concentrations of extracellular K + strongly enhanced the activation of HGIRKl-mediated currents. (B) In the presence of 96 mM K + currents were progressively diminished by increasing concentrations of the divalent cation barium.

samples. This 245 bp PCR fragment has one polymorphic and one non-polymorphic NlalII site. Digestion with the restriction enzyme NlalII produced two (137 and 109 bp; allele al), three (137, 63 and 46 bp; allel a2) or four (137, 109, 63, and 46 bp; allele al and a2) fragments depending on the individual the genomic DNA sample was taken from (not shown). Analysis of the frequency of this polymorphism in 45 unrelated Caucasians showed that 8 individuals were homozygous for allele al, 19 were homozygous for allele a2 and 18 were heterozygous.

3.3. Electrophysiology In oocytes expressing both HGIRKI and 5HT1A receptors, applications of serotonin evoked inward K + currents (Fig. 4A). Increasing the concentration of extracellular potassium resulted in larger currents and the slope conductance was dependent on [K+]o. The activation potential

28

O. Schoots et al. / Molecular Brain Research 39 (1996) 23-30

(defined as the potential at which the slope conductance changes noticeably) varied with [K+]o and paralelled E K as would be predicted from the Nernst equation. Outward currents at potentials more depolarized than E K were less than would be predicted by a linear current-voltage relation. For oocytes expressing both HGIRK1 and 5-HT1A receptors, change of the perfusion buffer from 5 mM K + to 96 mM K + evoked inward K + currents of 70.3 + 24.6 nA (n = 29). Applications of serotonin to the 96 mM K ÷ buffer further increased this current to 153.2 + 19.3 nA (n = 29). External Ba 2+ in the presence of 96 mM K + caused a concentration-dependent block of the serotonin activated HGIRK1 current (Fig. 4B). Control oocytes displayed inward currents of 27.3 _+ 2.4 nA for uninjected (n = 9) upon change to 96 mM K + , or 33.2 _+ 6.8 nA for 5HTIA injected (n = 8) upon change to 96 mM K + perfusion buffer with the inclusion of 1 /xM serotonin.

4. Discussion Sequencing of the 2.9 kb HGIRK1 clone showed that this eDNA is highly conserved from rat to human, coding for channel proteins that are 99% identical. All consensus sequences for phosphorylation are conserved, an observation which suggests that the human GIRK1 might also be differentially regulated by PKA and PKC as was seen for rat GIRK1 [4]. In the rat, activation of PKC resulted in potentiated desensitization while activation of PKA abolishes desensitization. Data from a partial human GIRK1 eDNA (250 bp) by Stoffel et al. [34] display for amino acids 115-200 98% homology compared to rat GIRK1. However, our data show 100% identity between rat and human in this area. Southern blot analysis indicates that GIRK1 is well conserved in the species tested. Since yeast after high stringency washes also gives a clear hybridization signal, it may be expected that early single-cell eukaryotes (protists) have similar channels. If so, then the ancestral gene for this class of inwardly rectifying potassium channels existed prior to the origin of the kingdoms of fungi, plants and animals. Neither rat nor human GIRK1 eDNA sequences have EcoRI restriction sites. Therefore the pattern of 2 or 3 strongly hybridizing EcoRI fragments for rat and human respectively as seen on the Southern blot (Fig. 2) indicates the presence of at least 1 intron in the rat and 2 in the human GIRKI gene. Analysis of the genomic organization of the HGIRK1 gene confirms the presence of three exons and two introns (manuscript in preparation). The high degree of homology between rat and human GIRK1 cDNAs extends into the 5' and 3' untranslated sequences, however, the functional significance of these sequences is unknown. One of the partial HGIRK1 clones isolated extends farther into the 3' untranslated region than the 2.9 kb eDNA clone, revealing that at least one other consensus sequence for polyadenylation is used. This probably accounts for the longer transcripts that are seen on the Northern blot (Fig. 3).

We performed in situ hybridization for GIRKI on rat brain using specific oligonucleotide probes directed against the 3' untranslated of the rat mRNA (not shown). The expression pattern observed was similar to that reported by Karschin et al. [17] who used [35S]UTP labelled RNA probes for detection. However, by Northern blot analysis we observe HGIRKI hybridization in human kidney, while no signal could be detected by in situ hybridization in rat kidney [17]. This may be due to species differences, or a homogeneous low level of expression for which there is a relative better sensitivity in Northern blot analysis as compared to in situ hybridization. Northern analysis for HGIRKI indicates low levels of expression in the human heart, while for rat GIRK1 high levels of expression were shown in atrium but not in ventricle [17,21]. This low level of HGIRK1 mRNA as detected for the human heart is likely from expression in atrium. However, the Northern blot used was made with poly A ÷ RNA from total heart containing predominantly RNA from heart ventricle instead of atrium. When analyzing one of our genomic HGIRKI clones (manuscript in preparation), a single nucleotide silent mismatch with the eDNA was found (a C at nt 1038 in the eDNA clone compared to a T at this position in the genomic clone). Though the mismatch does not result in a change of the amino acid sequence, it did code for a NlalII restriction site in the genomic DNA sequence. Analysis of this polymorphism in 45 unrelated Caucasians showed that the frequency of allele 1 (nt 1038 = C) is 0.38, and of allele 2 (nt 1038 = T) is 0.62. Estimated from these data, the heterozygosity is 0.47 and the polymorphic information content (PIC) is 0.36. A PIC value of 0.36 is close to the maximum of 0.375 for a two allele polymorphism. Stoffel et al. [34] mapped the HGIRKI gene to chromosome 2q24.1 and found a (CA) n simple tandem repeat polymorphism. Electrophysiological characterization showed that switching of HGIRK1 injected oocytes to a high potassium buffer evoked an inwardly rectifying current that was significantly larger than in uninjected oocytes. This current demonstrates the agonist independent activity of this channel in oocytes. Application of agonist further increased this current illustrating coupling to the activated G-linked receptor. Current-voltage relations for HGIRKI demonstrated that the channel is inwardly rectifying and that activation depends on the extracellular K + concentration (Fig. 4A). The channel is also blocked by extracellular Ba 2+ (Fig. 4B), a characteristic seen for various inward rectifiers. The diminished rectification at high K + (Fig. 4A) is different from what is reported for rat GIRKI expressed oocytes. Whether this is a species difference or caused by a 5HT-induced outward current endogenous to the oocytes remains to be further investigated. However, this outward current was Ba2+-sensitive, suggesting that the current originates from HGIRK1. An effort was made to stably co-express HGIRK1 as

O. Schoots et aL / Molecular Brain Research 39 (1996) 23-30

well various G protein-coupled receptors in CHO-K1 cells (Chinese hamster ovary, ATCC) to study channel characteristics and receptor-coupling. However, even though mRNA levels were abundant as determined by Northern blot hybridization (not shown), no new inwardly rectifying currents were detected in transfected cells. Recently Krapivinsky et al. [20] showed that co-expression of GIRKI with another inwardly rectifying potassium channel, CIR, was necessary to obtain currents in CHO cells. Apparently GIRK1 cannot form a functional channel as a homomultimer in these cells. In oocytes, channel activity improves dramatically when GIRK1 and CIR are co-expressed. Besides with CIR, heteromultimer formation of GIRK1 with GIRK2 [22] and GIRK2 with CIR has been demonstrated in oocytes [8]. Receptors known to activate inwardly rectifying potassium channels belong to the family of G protein-coupled receptors. For the cloned rat G I R K 1 / K G A channel, coupling has been demonstrated for various G linked receptors including the muscarinic m2, 5-HT1A, /32-adrenergic, 8-opioid, K-opioid and /x-opioid receptor [4,7,11,12,21]. GIRK1/KGA1 was also shown to be activated by G~v but not by G, subunits [20,31,36,38], and especially the G~lr2 dimer seems to regulate activity of this channel. However, in excised patches IK.ACh shows some activation by G~ in approximately 30% of the patches [16,24,28]. With the cloning of numerous inwardly rectifying potassium channel subunits and the potential for heteromultimer formation, this may be explained by the subunit composition of a specific channel. In addition, the number of G protein c~, /3 and 3/ subunits identified has increased dramatically and many different combinations of association are possible [5] of which only very few were tested to date. Future studies determining the subcellular co-localization of the G-linked receptors, G protein ce, /3, and 3/ subunits and inwardly rectifying K ÷ channel subunits will be needed to understand their specific contribution to membrane excitability.

5. Abbreviations Denhardt's, 0.2 m g / m l Ficoll (type 400, Pharmacia), 0.2 m g / m l polyvinylpyrrolidone, 0.2 m g / m l bovine serum albumin (Sigma, fraction V); bp, basepair; E K, equilibrium potential for potassium; [K+]o, extracellular K + concentration; ND96, 96 mM NaC1 2 mM KCI, 1.8 mM CaC12, 1 mM MgC12, 5 mM HEPES, pH 7.5; nt, nucleotide; OR-2, 82.5 mM NaC1, 2.5 mM KC1, 1 mM MgC12, 5 mM HEPES, pH 7.5; PBS, phosphate buffered saline; PCR, polymerase chain reaction; PIC, polymorphic information content; PKA, cAMP-dependent protein kinase; PKC, protein kinase C; RFLP, restriction fragment length polymorphism; SDS, sodium dodecyl sulphate; SSC, 150 mM NaC1, 15 mM sodium citrate, pH 7.0; SSPE, 150 mM NaCI, 10 mM Nail 2PO4, 1 mM EDTA, pH 7.4.

29

Acknowledgements We thank P.R. Albert for the 5-HT1A cDNA clone, L.-Y. Wang for electrophysiology on the CHO-K1 stable cell lines, J. Kennedy for genomic DNA samples, E.A. Billet for technical assistance and A. Petronis for assistance with the genetic analysis. H.H.M. Van Tol is a Career Scientist of the Ontario Ministry of Health. This work is supported by the Heart and Stroke Foundation of Ontario ( # NA2966).

References [1] Albert, P.R., Zhou, Q.-Y., Van Tol, H.H.M., Bunzow, J.R. and Civelli, O., Cloning, functional expression and mRNA tissue distribution of the rat 5-HTra receptor gene, J. Biol. Chem., 265 (1990) 5825-5832. [2] Ashford, M.L.J., Bond, C.T., Blair, T.A. and Adelman, J.P., Cloning and expression of a rat heart KATp channel, Nature, 370 (1994) 456-459. [3] Breitwieser, G. and Szabo, G., Uncoupling of cardiac muscarinic and /3-adrenergic receptors from ion channels by a guanine nucleotide analogue, Nature, 317 (1985) 538-540. [4] Chert, Y. and Yu, L., Differential regulation by cAMP-dependent protein kinase and protein kinase C of the ~-opioid receptor coupling to a G protein-activated K + channel, J. BioL Chetri., 269 (1994) 7839-7842. [5] Clapham, D.E. and Neer, E.J., Bifurcating pathways for transmembrane signaling; new roles for G protein /3y subunits, Nature, 365 (1993 ) 403 -406. [6] Clapham, D.E., Direct G protein activation of ion channels? Annu. ReL,. Neurosci., 17 (1994) 441-464. [7] Dascal, N., Schreibmayer, W., Lira, N.F., Wang, W., Chavkin, C., DiMagno, L., Labarca, C., Kieffer, B.L., Gavernaux-Ruff, C., Trollinger, D., Lester. H.A. and Davidson, N., Atrial G proteinactivated K + channel: expression cloning and molecular properties, Proc. Natl. Acad. Sci. USA, 90 (1993) 10235-10239. [8] Duprat, F., Lesage, F., Guillemare, E., Fink, M., Hugnot, J.-P., Bigay, J., Lazdunski, M., Romey, G. and Barhanin, J., Heterologous multimeric assembly is essential for K + channel activity of neuronal and cardiac G-protein-activated inward rectifiers, Biochem. Biophys. Res. Commun,, 212 (1995) 657-663. [9] Fakler, B., Briindle, U., Glowatzki, E., Weidemann, S., Zenner, H.-P. and Ruppersberg, J.P., Strong voltage-dependent inward rectification of inward rectifier K + channels is caused by intracellular sperrnine, Cell, 80 (1995) 149-154. [10] Ficker, E., Taglialatella, M., Wible, B.A., Henley, C.M. and Brown, A.M., Spermine and spermidine as gating molecules for inward rectifier K + channels, Science, 266 (1994) 1068-1072. [11] Fidler Lira, N,, Dascal, N., Labarca, C., Davidson, N. and Lester, H.A., A G protein-gated K channel is activated via /32-adrenergic receptors and G/3y subunits in Xenopus oocytes, J. Gen. PhysioL, 105 (1995) 421-439. [12] Henry, D.J., Grandy, D.K., Lester, H.A., Davidson, N. and Chavkin, C., x-Opioid receptors couple to inwardly rectifying potassium channels when coexpressed by Xenopus oocytes, Mol. Pharmacol., 47 (1995) 551-557. [13] Hille, B., Ionic Channels of Excitable Membranes, 2nd edn., Sinauer, Sunderland, 1992. [14] Ho, K., Nichols, C.G., Lederer, W.J., Lytton, J., Vassilev, P.M., Kanazirska, M.V. and Hebert, S.C., Cloning and expression of an inwardly rectifying ATP-regulated potassium channel, Nature, 362 (1993) 31-37.

30

O. Schoots et al. / Molecular Brain Research 39 (1996) 23-30

[15] lshii, K., Yamagishi, T. and Taira, N,, Cloning and functional expression of a cardiac inward rectifier K + channel, FEBS Lett., 338 (1994) 107-111. [16] Ito, H., Tung, R.T., Sugimoto, T., Kobayashi, I., Takahashi, K., Katada, T., Ui, M. and Kurachi, Y., On the mechanism of G protein /3y subunit activation of the muscarinic K + channel in guinea pig atrial cell membrane, J. Gen. Physiol., 99 (1992) 961-983. [17] Karschin, C., Schreibmayer, W., Dascal, N., Lester, H., Davidson, N. and Karschin, A., Distribution and localization of a G proteincoupled inwardly rectifying K + channel in rat, FEBS Lett., 348 (1994) 139-144. [18] Kennelly, P.J. and Krebs., E.G., Consensus sequences as substrate specificity determinants for protein kinases and protein phosphatases, J. Biol. Chem., 266 (1991) 15555-15558. [19] Koyama, H., Morishige, K.-1., Takahashi, N., Zanelli, J.S., Fass, D.N. and Kurachi, Y., Molecular cloning, functional expression and localization of a novel inward rectifier potassium channel in the rat brain, FEBS Lett., 341 (1994) 303-307. [20] Krapivinsky, G., Gordon, E.A., Wickman, K., Velimirovi6, B., Krapivinsky, L. and Clapham, D.E., The G protein-gated atrial K + channel IKACh is a heteromultimer of two inwardly rectifying K +channel proteins, Nature, 374 (1995) 135-141. [21] Kubo, Y., Reuveny, E., Slesinger, P.A., Jan, Y.N. and Jan, L.Y., Primary structure and functional expression of a rat G protein-coupled muscarinic potassium channel, Nature, 364 (1993) 802-806. [22] Lesage, F., Duprat, F., Fink, M., Guillemare, E., Coppola, T., Lazdunski, M. and Hugnot, J.P., Cloning provides evidence for a family of inward rectifier and G protein-coupled K + channels in the brain, FEBS Lett., 353 (1994) 37-42. [23] Logothetis, D.E., Kurachi, Y., Galper, J., Neer, E.J., Clapham, D.E., The /3y subunits of GTP-binding proteins activate the muscarinic K + channel in heart, Nature, 325 (1987) 321 326. [24] Logothetis, D.E., Kim, D., Northup, J.K., Neer, E.J. and Clapham, D.E., Specificity of action of guanine nucleotide binding regulatory protein subunits on the cardiac muscarinic K + channel, Proc. Natl. Acad. Sci. USA, 85 (1988) 5814-5818. [25] Lopatin, A.N., Makhina, E.N. and Nichols, C.G., Potassium channel block by cytoplasmic polyamines as the mechanism of intrinsic rectification, Nature, 372 (1994) 366-369. [26] Lu, Z. and Mackinnon, R., Electrostatic tuning of Mg 2+ affinity in an inward-rectifier K + channel, Nature. 371 (1994) 243 246. [27] Makbina, E.N., Kelly, A.J., Lopatin, A.N., Mercer, R.W. and Nichols, C.G,, Cloning and expression of a novel human brain inward rectifier potassium channel, J. Biol. Chem., 269 (1994) 20468-20474.

[28] Nanavati, C., Clapham, D.E., lto, H. and Kurachi, Y., A comparison of the roles of purified G protein subunits in the activation of the cardiac muscarinic K + channel. In G Proteins and Signal Transduction, Rockefeller Univ. Press, New York, 1990, pp. 29-42. [29] P~rier, F., Radeke, C. and Vandenbergh, C.A., Primary structure and characterization of a small-conductance inwardly rectifying potassium channel from human hippocampus, Proc. Natl. Acad. Sci. USA, 91 (1994) 6240-6244. [30] Pfaffinger, P.J., Martin, J.M., Hunter, D.D., Nathanson, N.M. and Hille, B., GTP-binding proteins couple cardiac muscarinic receptors to a K channel, Nature, 317 (1985) 536-538. [31] Reuveny, E., Slesinger, P.A., Inglese, J., Morales, J.M., lfiiguezLluhi, J.A., Lefkowitz, R.J., Bourne, H.R., Jan, Y.N. and Jan, L.Y., Activation of the cloned muscarinic potassium channel by G protein /3y subunits, Nature, 370 (1994) 143-146. [32] Sakmann, B., Noma, A. and Trautwein, W., Acetylcholine activation of single muscarinic K channels in isolated pacemaker cells of the mammalian heart, Nature, 303 (1983) 250-253. [33] Sanger, F., Nicklen, S. and Coulson, A.R., DNA sequencing with chain terminating inhibitors, Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467. [34] Stoffel, M., Espinosa lIl, R., Powell, K.L., Philipson, L.H., Le Beau, M.M. and Bell, G.I., Human G-protein-coupled inwardly rectifying potassium channel (GIRK1) gene (KCNJ3): localization to chromosome 2 and identification of a simple tandem repeat polymorphism, Genomics, 21 (1994) 254-256. [35] Takahashi, N., Morishige, K.I., Jahangir, A., Yamada, M., Findlay, I., Koyama, H. and Kurachi, Y., Molecular cloning and functional expression of cDNA encoding a second class of inward rectifier potassium channels in the mouse brain, J. Biol. Chem., 269 (1994) 23274 23279. [36] Takao, K., Yoshii, M., Kanda, A., Kokobun, S. and Nukada, T., A region of the muscarinic-gated atrial K + channel critical for activation by G protein /3y subunits, Neuron, 13 (1994) 747-755. [37] Wible, B.A., Taglialatella. M., Ficker, E. and Brown, A~M., Gating of inwardly rectifying K + channels localized to a single negatively charged residue, Nature, 371 (1994) 246-250. [38] Wickman, K.D., Ifiiguez-Lluhi, J.A., Davenport, P.A., Taussig, R., Krapivinsky, G.B., Linder, M.E., Gilman, A.G. and Clapham, D.E., Recombinant G protein /3y-subunits activate the muscarinic gated atrial potassium channel, Nature, 368 (1994) 255-257. [39] Yatani, A., Mattera, R., Codina, J., Graf, R., Okabe, K., Padrell, E., Iyengar, R., Brown, A.M. and Birnbaumer, L., The G protein-gated atrial K + channel is stimulated by three distinct Gic~-subunits, Nature, 336 (1988) 680 682.