Cloning of a Human Homolog of theDrosophila Enhancer of zesteGene (EZH2) That Maps to Chromosome 21q22.2

GENOMICS

38, 30 –37 (1996) 0588

ARTICLE NO.

Cloning of a Human Homolog of the Drosophila Enhancer of zeste Gene (EZH2) That Maps to Chromosome 21q22.2 HAIMING CHEN,* COLETTE ROSSIER,†

AND

STYLIANOS E. ANTONARAKIS*,†,1

*Laboratory of Human Molecular Genetics, Department of Genetics and Microbiology, University of Geneva Medical School, Geneva, Switzerland; and †Division of Medical Genetics, Cantonal Hospital, Geneva, Switzerland Received May 30, 1996; accepted September 9, 1996

including some that map in the so-called Down syndrome critical region (DSCR) (Delabar et al., 1993; McCormick et al., 1989), may be involved in the development of certain phenotypes in Down syndrome. The notion of a specific, well-defined DSCR is, however, no longer widely accepted since genes outside this region may be involved in the pathophysiology of Down syndrome (Korenberg et al., 1994). To date only about 55 genes on HC21 have been cloned and partially characterized (Genome Data Base (GDB): http://gdbwww.gdb.org, and SWISS-PROT entries: http://expasy.hcuge. ch/cgi-bin /lists?humchr21.txt). The cloning and characterization of most of the genes on HC21 are necessary steps in understanding the pathogenesis and pathophysiology of Down syndrome and the molecular etiology of monogenic disorders and traits that map to this chromosome. The genetic and physical maps of HC21 are already well developed (Chumakov et al., 1992; McInnis et al., 1993; Ichikawa et al., 1993; Nizetic et al., 1994; Soeda et al., 1995), and the transcription (genic) map of this chromosome and the cloning and characterization of its genes are progressing rapidly (Cheng et al., 1994; Peterson et al., 1994; Lucente et al., 1995; Xu et al., 1995; Yaspo et al., 1995, Tassone et al., 1995; Chen et al., 1996). To contribute to the development of the genic map, we have used exon trapping (Buckler et al., 1991; Church et al., 1994) on DNA from HC21-specific cosmids to identify potential exons of genes on 21q and thereafter to clone their corresponding cDNAs. Here we report the cloning, characterization, and mapping of the cDNA of a human homolog of the Drosophila enhancer of zeste E(z) gene (Phillips and Shearn, 1990; Jones and Gelbart, 1990, 1993). In Drosophila, the E(z) protein belongs to the polycomb group genes that encode trans-regulators of homeotic gene function (for review see Kennison, 1995). E(z) is involved in the maintenance of chromatin structure through formation of large complexes with several additional proteins of the polycomb group that bind to common sites on polytene chromosomes and co-immunoprecipitate (Franke et al., 1992; Rastelli et al., 1993). The possible contribution

To identify genes that map on human chromosome 21 (HC21) and that may contribute to the phenotype of Down syndrome (DS), exon trapping was applied to cosmid DNA from an HC21-specific library LL21NCO2Q. More than 550 potential exons were cloned and partially characterized. One of these, hmc23b04 (GenBank X88270) showed strong homology to the Drosophila Enhancer of zeste protein (GenBank U00180) from amino acid 665 to 694 ( p Å 7.6 1 10011 ). We have cloned the fulllength cDNA for this human homolog of the Drosophila E(z) gene (termed EZH2) and mapped it to within YACs 64f11 and 809b11 between markers D21S65 and ERG on human chromosome 21q22.2. Sequence analysis indicates that EZH2 encodes a 746-amino-acid polypeptide that shows 60.5% identity to the Drosophila E(z) protein and contains a trithorax-like domain and a DNA-binding motif. Northern blot analysis revealed that EZH2 is expressed in several tissues. Alternatively spliced mRNA species have been observed. The Drosophila E(z) protein is a member of the polycomb group genes that maintain homeotic gene repression and are thought to control gene expression by regulating chromatin. The strong sequence conservation suggests a possible function of EZH2 in regulation of gene transcription and chromatin structure; it may therefore contribute to certain phenotypes of Down syndrome by altered regulation of its target genes. q 1996 Academic Press, Inc.

INTRODUCTION

Trisomy 21 (Down syndrome) is one of the most common chromosomal abnormalities. Human chromosome 21 (HC21) was estimated to contain 600 – 1000 genes (Antonarakis, 1993). Many HC21 genes, Sequence data reported in this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. X88270 (hmc23b04) and X95653 (cDNA). 1 To whom correspondence should be addressed at Division de Genetique Medicale, Centre Medical Universitaire, 1 rue Michel Servet, 1211 Gene`ve, Switzerland. Telephone: 41-22-7025707. Fax: 41-227025706. E-mail: [email protected]. 0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

AID Genom 4393

/

6r22$$$$41

30

11-05-96 09:31:53

gnma

AP: Genomics

31

EZH2 MAPS TO CHROMOSOME 21q22.2

of EZH2 to the complex phenotypes of Down syndrome is currently unknown.

CATTCTCTATCC3 * ). The resulting PCR products were subjected to sequence analysis on an automated ABI 373 DNA sequencer.

RESULTS

MATERIALS AND METHODS Exon trapping. HC21-specific cosmids from the LL21NCO2-Q library (kindly supplied by Pieter de Jong) (Soeda et al., 1995) were used in exon trapping experiments as described (Buckler et al., 1991; Church et al., 1994; Chen et al., 1996; Gibco/BRL, 1994). EcoRI or PstI fragments of pooled DNA prepared from these cosmids were subcloned in vector pSPL3, and recombinant plasmids were transfected into COS7 cells using lipofectACE. RT-PCR products of the trapped sequences from total RNA of the COS7 cells using the trapping vector-specific oligonucleotide primers were subcloned into pAMP10 by uracil DNA glycosylase (UDG) cloning. After elimination of false-positive, vector self-spliced clones using oligonucleotide screening (for oligonucleotide sequences, see Chen et al., 1996), the inserts (trapped sequences) of individual pAMP10 clones were sequenced on an ABI373A automated sequencer. Nucleotide and predicted amino acid homologies were analyzed through the NCBI email server with BLASTN and BLASTX searches (Altschul et al., 1990) on the nonredundant and dbEST databases. Chromosomal mapping of the EZH2 locus. Trapped sequence hmc23b04 was used to probe a subset of the HC21-specific LL21NCO2-Q cosmid library arrayed in 96-well plates. PCR amplification using oligonucleotide primers (hmc23b04F, 5*AGAAGAGGGAAAGTGTGTGATA3 *; and hmc23b04R, 5*CTTGCAGGTTGCATCCACCA3 *) specific for the initial trapped sequence of clone hmc23b04 was performed on DNAs from a panel of HC21-derived YACs that cover the entire 21q (Chumakov et al., 1992) and on selected cosmids. In addition, PCR amplification with the same primers was carried out on genomic DNA from two panels of somatic cell hybrids: (i) the monochromosomal hybrid panel (NIGMS2; Drwinga et al., 1993), and (ii) that containing defined portions of HC21 (kindly supplied by David Patterson) (Patterson et al., 1993). Cloning of the EZH2 cDNA. To clone the full-length cDNA corresponding to trapped sequence hmc23b04 and encoding for an E(z)-like gene on chromosome 21, we have screened all the clones from the normalized infant brain (NIB) library arrayed in microtiter 96-well plates (Soares et al., 1994) using the trapped sequence hmc23b04 as a probe; single positive colonies were isolated that contained partial cDNA sequences. To clone the full-length cDNA, approximately 500,000 plaques from a human fetal brain library (Clontech Catalog No. HL3003a) were screened using the most 5* end sequence of a positive clone obtained from the NIB library. The inserts of positive phage clones were subcloned from lgt10 to plasmid pAMP10. Nucleotide sequences of the subclones in both orientations were determined using standard protocols for the ABI373A automated sequencer. Northern and Southern blot analysis. The insert of a cDNA clone that contained the coding region and a portion of the 3*UTR of the EZH2 gene was used to probe two commercially available human multiple tissue Northern blots (Clontech Catalog Nos. 7760-1 and 7756-1). Hybridization was carried out according to the manufacturer’s protocol PT1200-1. Southern blot hybridization of PstI digested genomic DNA from human, mouse, and somatic cell hybrid WAV17 containing only HC21 was performed using the same probe. RT-PCR and sequence analysis of alternatively spliced mRNAs. Reverse transcription (RT) of total RNA was carried out using a Superscript preamplification kit from Life Technologies (GIBCO BRL Catalog No. 18089-011). About 3 m g of total RNA from different human tissues including kidney, placenta, skin, thymus, and testis was tested. The RT products were used for PCR amplification with the cDNA-specific oligonucleotide primers (EZSP6-1, 5*TCAGAGTACATGCGACTGAG3 *; and EZR4, 5*CTCCAAATGCTGGTAACACTG3 * ). The PCR products were separated on 3% agarose gel, purified using a GeneClean kit from BIO 101, Inc. (Catalog No. 1001-400), and reamplified with nested primers (OL1, 5*TGTTTAGTTCCAATCGTCAG3 *; and OL2, 5*ATAAACCCA-

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

Identification of an Exon of a Human Homolog of the Drosophila E(z) Gene As part of our project to clone a large number of fragments of HC21 genes, we have used pools of HC21-specific cosmids from the LL21NCO2-Q library in exon trapping experiments. A total of 559 potential exons have been identified to date (Chen et al., 1996). Sequence comparisons using the BLASTN and BLASTX algorithms (Altschul et al., 1990) showed significant homology of trapped sequence hmc23b04 (GenBank X88270) to Drosophila Enhancer of zeste, E(z), gene (GenBank U00180). A predicted polypeptide for the 113-nt clone hmc23b04 showed 86% identity with the Drosophila E(z) protein (amino acid residues 665– 694) (Fig. 1). In addition, the nucleotide sequence of clone hmc23b04 was identical to regions of the following human expressed sequence tags (EST) (GenBank H75287, T99430, Z40549, T99536, T89364, and T79837). Isolation and Sequencing Analysis of the cDNA for the EZH2 Gene A human fetal brain cDNA library (Clontech Catalog No. HL3003a) and a NIB cDNA library (Soares et al., 1994) were screened (see Materials and Methods) and several positive clones were obtained. Two positive clones (241H8 and 315F4) from the NIB library were isolated and sequence analysis revealed that these two clones contain only a part of the coding region and the 3 *UTR of the EZH2 gene. Sequencing analysis on overlapping clones from the fetal brain library indicated that one clone contained the whole coding sequence by comparison to the Drosophila E(z). The full-length cDNA encoding this human homolog of the Drosophila E(z) gene is presented in Fig. 1. The trapped sequence hmc23b04 is identical to the cDNA in a region of nt 2008– 2097 (Fig. 1). The nucleotide sequence around the presumed initiation codon ATG (nt 58 –60) conforms to the Kozak consensus sequence (Kozak, 1991). A polyadenylation signal sequence was observed at nt 2538 and a long poly(A) stretch was found after nt 2558. This gene was termed EZH2 by the Gene Nomenclature Committee; the name EZH1 was given to the gene for a similar protein that maps on human chromosome 17. The predicted polypeptide of the EZH2 gene contains 746 amino acids and shows homology (60.5% identity) to the Drosophila E(z) protein (Jones and Gelbart, 1993); in addition, this EZH2 is also similar to EZH1 (67% identity), which maps to human chromosome 17 (Dr. Kenneth J. Abel, Ann Arbor, Feb. 1996, pers. comm.; Rommens et al., 1995). Figure 2 shows multiple sequence alignments of the EZH2 predicted polypep-

gnma

AP: Genomics

32

CHEN, ROSSIER, AND ANTONARAKIS

FIG. 1. Nucleotide and predicted amino acid sequences of the EZH2 gene. The two sequences involved in alternative splicing are underlined (seqX of 27 bp) and doubly underlined (seqY of 117 bp), respectively. Also underlined is the codon for the initiation methionine, the potential poly(A) adenylation signal, and the oligonucleotides used for mapping (hmc23b04F and hmc23b04R) and detection of the alternatively spliced mRNAs (OL1 and OL2). The dotted underline indicates the corresponding amino acid sequence of the originally trapped exon hmc23b04 (from nt 2008 to nt 2097).

tide with the Drosophila E(z) (U00180, Jones and Gelbart, 1993), EZH1 (sequence kindly provided before publication from Dr. Kenneth J. Abel), and partial sequences (the trx region) from several trithorax proteins (Q03164, Tkachuk et al., 1992; L17069, Ma et al., 1993;

Z50038, Tillib et al., 1995; P02659, Mazo et al., 1990; P38827, Johnston et al., 1994; U13875, Wilson et al., 1994). The Lys-rich potential nuclear localization signal from amino acid residues 489 –496, the Cys-rich region of residues 523 –604, and the trithorax domain

FIG. 2. Multiple sequence alignment of EZH2 polypeptide with the Drosophila E(z), EZH1 (Kenneth J. Abel, Ann Arbor, Feb. 1996, personal communication) and the trithorax region of several proteins generated from the CLUSTAL V program (Higgins et al., 1992). Identical amino acids between EZH2 and other sequences are shown in red, identical amino acids among other sequences are indicated in green, and conservative changes are indicated in blue. The one-letter code for amino acids is used. The potential nuclear localization signal and the conserved Cys-rich region are underlined. EZH2-chr21 is the human homolog of the Drosophila Enhancer of zeste gene described here; E(z)_Drom denotes Drosophila E(z) (U00180); EZH1 is another human homolog of the Drosophila Enhancer of zeste mapped to chromosome 17 (Kenneth J. Abel, University of Ann Arbor, MI); hum ALL-1 denotes a human trithorax-like gene (Q03164); Ms All-1 is a mouse trithorax-like gene (L17069): Drov trx is the Drosophila virilis trithorax gene; Drom trx is the Drosophila melanogaster trithorax gene; s.c. YHR119W indicates a yeast hypothetical protein (trithorax-like, P38827); and C.el trx is the Caenorhabditis elegans hypothetical protein from cosmid C26E6 (U13875).

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

gnma

AP: Genomics

EZH2 MAPS TO CHROMOSOME 21q22.2

AID Genom 4393

/

6r22$$4393

11-05-96 09:31:53

gnma

AP: Genomics

33

34

CHEN, ROSSIER, AND ANTONARAKIS

FIG. 3. (A) RT-PCR products of alternatively spliced mRNA species. RT-PCR was performed on total RNA from several tissues as indicated. RT/ shows cDNA synthesis with the reverse transcriptase, while RT0 without the reverse transcriptase in the reaction; cDNAs EZ4, 32, and 30 contain sequences seqX, seqY, and seqX and seqY, respectively (see text). (B) Schematic representation of the alternative splicing in EZH2 mRNA. Four isoforms of cDNA were observed (a, b, c, d of 376, 349, 259, and 232 bp, respectively). The two sequences, seqX (27 bp, shown as black box) and seqY (117 bp, shown as gray box), are involved in alternative splicing. Oligonucleotide primers OL1 and OL2 were used in nested PCR amplification. Adjacent cDNA sequences are shown as white boxes.

of residues 618–732 are all highly conserved (Fig. 2) (Jones and Gelbart, 1993). Except for the last cysteine of the Cys-rich region, which is offset by one amino acid, the remaining 17 Cys are the same in E(z), EZH1, and EZH2. The trithorax domain in the carboxyl-terminus, which is also called the SET domain (from the Drosophila Su(var)3-9, E(z), and Trx genes; Tschiersch et al., 1994), is also remarkably well conserved among the human EZH2 and EZH1 sequences and the Drosophila E(z) sequence. RT-PCR Revealed Alternative Splicing in the EZH2 mRNA Sequencing the 5* regions of some cDNA clones showed alternative mRNA species, possibly indicating alternatively spliced forms of the EZH2 mRNAs. To study this better, we performed RT-PCR amplification analysis from total RNA of different human tissues (including testis, thymus, skin, placenta, and kidney) using oligonucleotide primers OL1 and OL2 (see Materials and Methods), which flank the potentially alternatively spliced sequences as shown in Figs. 1 and 3. Four RT-PCR products were observed (shown as (a) 376 nt, (b) 349 nt, (c) 259 nt, and (d) 232 nt in Fig. 3); the predominant product was that of 376 nt. Sequence analysis of the RT-PCR products indicated that two sequences, named seqX of 27 bp (nt 277– 303 of Fig. 1) and seqY of 117 bp (nt 304–420 of Fig. 1), are involved in alternative splicing on the EZH2 mRNA as shown schematically in Fig. 3. The most abundant isoform of EZH2 contains both seqX and seqY (isoform a). Isoform b lacks seqX, isoform c lacks seqY, and isoform d lacks

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

both seqX and seqY. All four isoforms are in frame and probably result in polypeptide products. The functional significance of the several isoforms of EZH2 is unknown. Northern and Southern Blot Analysis Northern blot analysis of different human tissues using an EZH2 cDNA clone as a probe revealed a prominent mRNA species of approximately 2.9 kb in all fetal and adult tissues examined but remarkably reduced in adult heart, brain, and kidney; an additional weak

FIG. 4. Expression pattern of EZH2 mRNA in different tissues. Northern blots from Clontech (Catalog Nos. 7760-1 and 7756-1) were probed with an EZH2 cDNA (see Materials and Methods). The human tissues examined are shown per lane. A prominent mRNA species of approximately 2.9 kb was detected in the majority of the tissues. Equal amounts of mRNA (2 mg of poly(A)/) were loaded in all lanes as detected by hybridization with an actin probe (not shown).

gnma

AP: Genomics

EZH2 MAPS TO CHROMOSOME 21q22.2

35

hybridization band of approximately 5 kb was also detected (Fig. 4). It is unknown if this larger hybridizing mRNA species represents mRNAs from genes homologous to the EZH2 (such as EZH1) or from EZH2 with different lengths of 5*UTR or 3*UTR. Southern blot analysis using the same probe revealed four human genomic PstI fragments of 9, 7.5, 4.5, and 3 kb that map to HC21; in addition two PstI fragments of 2.7 and 2.2 kb were present in human DNA and could be due to hybridization with EZH1-containing genomic fragments (data not shown). The results of Southern blot analysis confirm that EZH2 maps to HC21. Physical Mapping of an EZH2 Gene to Chromosome 21q22.2 PCR amplification of the 84-bp specific fragment with primers hmc23b04F and hmc23b04R (see Materials and Methods) was performed on genomic DNA from a series of somatic cell hybrids containing either single human chromosomes (NIGMS 2; Drwinga et al., 1993) or defined portions of HC21 (Patterson et al., 1993). Only the hybrid containing HC21 was positive from the panel of monochromosomal hybrids (data not shown). From the HC21 specific hybrids, the following showed amplification of the 84-bp target fragment: R451-29C5, 725, 135E7B, WAV17, 2Fur1, JC6A, ACEM2-10d, 6918-al, 8q-, GA9-3, GA9-3, R50-3, 1881C-13b, Raj5, and 9528C-1. In contrast, somatic cell hybrid 21q/ and MRC-2G were negative by PCR. In combination, these results localized the EZH2 gene between markers D21S65 and ERG on chromosome 21q22.2. The original trapped sequence, hmc23b04, was also used to probe a subset of the cosmid library LL21NC02Q that was used in the exon trapping experiments. Cosmids Q33D3, Q33D6, Q47A12, Q48B6, Q54F6, Q64B3, and Q64D2 were positive. These positive cosmids were also checked for amplification of the 84-bp fragment specific to exon clone hmc23b04 using oligonucleotides hmc23b04F and hmc23b04R (Fig. 5A). PCR amplification of total yeast DNA from 79 YACs covering the entire 21q (Chumakov et al., 1992) using the same oligonucleotides identified two positive YACs 64F11 and 809B11 (Fig. 5A). These two YACs are also positive to markers D21S211 and D21S17 and were previously placed to the region of 21q22.2 (Chumakov et al., 1992) just proximal to the so-called Down syndrome critical region (previously defined as a region between markers D21S17 and ETS2). The physical location of the EZH2 gene on HC21 is schematically shown in Fig. 5B. DISCUSSION

Using exon trapping we have cloned a sequence hmc23b04 (Chen et al., 1996), the predicted polypeptide of which is homologous to a region of the Drosophila E(z) gene (Jones and Gelbart, 1993). The full-length cDNA that encodes a human homolog of the Drosophila E(z) gene, termed EZH2, was then cloned and mapped

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

FIG. 5. (A) Mapping of the EZH2 on chromosome 21. PCR amplification with primers hmc23b04F and hmc23b04R from selected YACs, cosmids, and genomic DNA from a somatic cell hybrid, human, and mouse. The specific PCR product is 84 bp. YACs are from the HC21 contig of Chumakov et al. (1992) and map between D21S65 and ERG; cosmids are from the LL21NC02-Q library; WAV17 is a HC21-only human –mouse somatic cell hybrid. (B) Schematic representation of the mapping position of the EZH2 gene. The EZH2 gene maps to YACs 64F11 and 809b11, which are also positive with markers D12S17 and D21S211. The location of EZH2 relative to these two markers has not been determined and is arbitrarily shown as proximal to both. The transcription orientation of EZH2 relative to the telomere is also unknown.

to human chromosome 21q22.2, around marker D21S17 and proximal to CBR. The predicted amino acid sequence of EZH2 shows 60.5% identity to the Drosophila E(z) protein. The potential nuclear localization signal (PRKKKK/R), the Cys-rich region, which could be a DNA binding motif (Mazo et al., 1990), and the trithorax (or SET) domain are highly conserved (Fig. 2). Four isoforms of the EZH2 cDNA were observed due to alternative splicing; the predominant form is the largest one that contains both sequences involved in alternative splicing (Fig. 3). The functional significance of the four isoforms is currently unknown. Recently another human homolog of the Drosophila

gnma

AP: Genomics

36

CHEN, ROSSIER, AND ANTONARAKIS

E(z) gene, designated EZH1, has been cloned and mapped to chromosome 17 (Kenneth J. Abel, Ann Arbor, Feb. 1996, pers. comm.). EZH2 is similar but not identical to EZH1; there is overall 67% identity between the two predicted proteins (Fig. 2). EZH2 is expressed in all fetal and adult tissues tested, but remarkably reduced in adult heart, brain, and kidney (Fig. 4). The Drosophila E(z) protein belongs to the Polycomb group of proteins, which encode trans-regulators of homeotic genes that in turn regulate the identities of Drosophila segments (Phillips and Shearn, 1990; Jones and Gelbart, 1990, 1993; Kennison, 1995). The E(z) gene was defined as a member of the polycomb group by genetic analysis (Phillips and Shearn, 1990; Jones and Gelbart, 1990). Reduction of E(z) activity leads to both suppression of the z-w (zeste-white protein) interaction and ectopic expression of segment identity genes of the Antennapedia (ANT-C ) and bithorax (BX-C ) gene complexes; E(z) is not required to initiate the pattern of expression of these genes, but to maintain their repressed state. Mutant E(z) alleles also produce homeotic transformations (Phillips and Shearn, 1990; Jones and Gelbart, 1990). E(z) is required for the chromosome binding of other polycomb proteins that have related chromosome binding sites (Rastelli et al., 1993) such as Psc (Posterior sex combs) and Su(z)2 (Supressor 2 of zeste) (Brunk et al., 1991). The conservation of the nuclear localization signal, the Cys-rich region, and the trithorax domain in EZH2 protein suggests that it may have functions similar to those of the Drosophila E(z). It could be speculated that EZH proteins bind to DNA or chromatin through their Cys-rich motif and to other components, either nucleic acid or protein, through the trithorax (SET) domain to regulate transcription (Jones and Gelbart, 1993). Recently, overexpression of genes of the polycomb group and targeted disruption of trithorax genes in mice have been reported. Overexpression of Bmi-1, an oncogene with homology to Psc and Su(z)2, showed transformation of the axial skeleton in transgenic mice (Alkema et al., 1995). It has been proposed Bmi-1 is a member of a vertebrate Polycomb complex that regulates segmental identity by repressing Hox genes during development. Heterozygous mice (homozygosity is lethal) with targeted disruption of the mouse All-1 gene had retarded growth, displayed hematopoietic abnormalities, and demonstrated bidirectional homeotic transformations of the axial skeleton as well as sternal malformations (Ma et al., 1993; Yu et al., 1995). The related human ALL-1 gene is a homolog of the Drosophila trithorax gene and is associated with acute leukemia when disrupted by chromosomal translocations (Tkachuk et al., 1992). Overexpression of the EZH2 gene in trisomy 21 may therefore be associated with some phenotypes of Down syndrome. Transgenic mice with an extra copy or targeted disruption of the EZH2 gene may produce evidence for the function of the EZH2 protein and provide clues

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

to the involvement in Down syndrome and /or monogenic disorders associated with dysfunction of this gene. ACKNOWLEDGMENTS We thank Kenneth J. Abel for the availability of the EZH1 nucleotide sequence prior to publication, Pieter de Jong for the HC21-specific cosmid library LL2INCO2-Q, and David Patterson for the chromosome-21 specific somatic cell hybrids. We also thank J. Y. Su for her contribution to screening of cDNA libraries, Hamish S. Scott for his critical review of the manuscript, and Vincent Pirrotta for advice throughout the project. This study was supported by Grants 31.33965.92 and 31-40500.94 from the Swiss FNRS, the European Union Grant GENE-CT93-0015, and by funds from the University and the Cantonal Hospital of Geneva. Note added in proof. The gene for EZH1 which is homologous to the EXH2 described here has been recently published in Abel, K. J., Brody, L. C., Valdes, J. M., Erdos, M. R., McKinley, D. R., Castilla, L. H., Merajver, S. D., Couch, F. J., Friedman, L. S., Ostermeyer, E. A., Lynch, E. D., King, M.-C., Welcsh, P. L., Osborne-Lawrence, S., Spillman, M., Bowcock, A. M. Collins, F. S., and Weber, B. L. Characterization of EZH1, a human homolog of Drosophila Enhancer of zeste near BRCA1, Genomics, in press.

REFERENCES Alkema, M. J., van der Lugt, N. M. T., Bobeldijk, R. C., Berns, A., and van Lohuizen, M. (1995). Transformation of axial skeleton due to overexpression of bmi-1 in transgenic mice. Nature 374: 724–727. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J. Mol. Biol. 215: 403 – 410. Antonarakis, S. E. (1993). Human chromosome 21: Genome mapping and exploration, circa 1993. Trends Genet. 9: 142– 148. Brunk, B. P., Martin, E. C., and Alder, P. N. (1991). Drosophila genes Posterior Sex Combs and Supressor two of zeste encode proteins with homology to the murine bmi-1 oncogene. Nature 353: 351– 353. Buckler, A. J., Chang, D. D., Graw, S. L., Brook, J. D., Haber, D. A., Sharp, P. A., and Housman, D. E. (1991). Exon amplification: A strategy to isolate mammalian genes based on RNA splicing. Proc. Natl. Acad. Sci. USA 88: 4005 –4009. Chen, H., Chrast, R., Rossier, C., Morris, M. A., Lalioti, M. D., and Antonarakis, S. E. (1996). Cloning of 559 potential exons of the genes of human chromosome 21 by exon trapping. Genome Res. 6: 747–760. Cheng, J. F., Boyartchuk, V., and Zhu, Y. (1994). Isolation and mapping of human chromosome 21 cDNA: Progress in constructing a chromosome 21 expression map. Genomics 23: 75 –84. Chumakov, I., Rigault, P., Guillou, S., Ougen, P., Billaut, A., Guasconi, G., Gervy, P., LeGall, I., Soularue, P., Grinas, L., Bougueleret, L., Bellanne-Chantelot, C., Lacroix, B., Barillot, E., Gesnouin, P., Pook, S., Vaysseix, G., Frelat, G., Schmitz, A., Sambucy, J. L., Bosch, A., Estivill, X., Weissenbach, J., Vignal, A., Riethman, H., Cox, D., Patterson, D., Gardiner, K., Hattori, M., Sakaki, Y., Ichikawa, H., Ohki, M., Le Paslier, D., Heilig, R., Antonarakis, S. E., and Cohen, D. (1992). A continuum of overlapping clones spanning the entire human chromosome 21q. Nature 359: 380– 386. Church, D. M., Stotler, C. J., Rutter, J. L., Murrell, J. R., Trofatter, J. A., and Buckler, A. J. (1994). Isolation of genes from complex sources of mammalian genomic DNA using exon amplification. Nature Genet. 6: 98 –105. Delabar, J. M., Theophile, D., Rahmani, Z., Chettouh, Z., Blouin, J. L., Prieur, M., Noel, B., and Sinet, P. M. (1993). Molecular mapping of twenty-four features of Down syndrome on chromosome 21. Eur. J. Hum. Genet. 1: 114 –124. Djabali, M., Selleri, L., Parry, P., Bower, M., Young, B. D., and Evans,

gnma

AP: Genomics

EZH2 MAPS TO CHROMOSOME 21q22.2 G. A. (1992). A trithorax-like gene is interrupted by chromosome 11q23 translocations in acute leukemias. Nature Genet. 2: 113– 118. Franke, A., DeCamillis, M., Zink, D., Cheng, N., Brock, H. W., and Paro, R. (1992). Polycomb and polyhomeotic are constituents of a multimeric protein complex in chromatin of Drosophila melanogaster. EMBO J. 11: 2941 –2950. Gibco BRL (1994). ‘‘Exon Trapping System,’’ Instruction manual 18449-017. Higgins, D. G., Bleasby, A. J., and Fuchs, R. (1992). CLUSTAL V: Improved software for multiple sequence alignment. CABIO 8: 189–191. Ichikawa, H., Hasada, F., Arai, Y., Shimizu, K., Ohiva, M., and Ohki, M. (1993). A Not I restriction map of the entire long arm of human chromosome 21. Nature Genet. 4: 361 –366. Johnston, M., Andrews, S., Brinkman, R., Cooper, J., Ding, H., Dover, J., Du, Z., Favello, A., Fulton, L., Gattung, S., Geisel, C., Kirsten, J., Kucaba, T., Hillier, L., Jier, M., Johnston, L., Langston, Y., Latreille, P., Louis, E. J., Macri, C., Mardis, E., Menezes, S., Mouser, L., Nhan, M., Rifkin, L., Riles, L., St. Peter, H., Trevaskis, E., Vaughan, K., Vignati, D., Wilcox, L., Wohldman, P., Waterston, R., Wilson, R., and Vaudin, M. (1994). Complete nucleotide sequence of Saccharomyces cerevisiae chromosome VIII. Science 265: 2077 –2082. Jones, R. S., and Gelbart, W. M. (1990). Genetic analysis of the enhancer of zeste locus and its role in gene regulation in Drosophila melanogaster. Genetics 126: 185– 199. Jones, R. S., and Gelbart, W. M. (1993). The Drosophila polycombgroup gene enhancer of zeste contains a region with sequence similarity to trithorax. Mol. Cell. Biol. 13: 6357 – 6366. Kennison, J. A. (1995). The polycomb and trithorax group proteins of Drosophila: Trans-regulators and homeotic gene function. Annu. Rev. Genet. 29: 289– 303. Korenberg, J. R., Chen, X. N., Schiper, Z., Gonsky, R., Gerwehr, S., Carpenter, N., Daumer, C., Dignan, P., Disteche, C., Graham, J. M., Jr., Hugdins, L., McGillivray, B., Miyazaki, K., Ogasawara, N., Park, J. P., Pagon, R., Pueschel, S., Sack, G., Say, B., Schuffenhauer, S., Soukup, S., and Yamanaka, T. (1994). Down syndrome phenotypes: The consequences of chromosomal imbalance. Proc. Natl. Acad. Sci. USA 91: 4997 – 5001. Kozak, M. (1991). Structure features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem. 266: 19867 – 19870. Lucente, D., Chen, H. M., Shea, D., Samec, S. N., Rutter, M., Rossier, C., Buckler, A., Antonarakis, S. E., and McCormick, M. K. (1995). Localization of 102 exons to a 2.5 Mb region involved in Down syndrome. Hum. Mol. Genet. 4: 1305 –1311. Ma, Q., Alder, H., Nelson, K. K., Chatterjee, D., Gu, Y., Nakamura, T., Canaani, E., Croce, C. M., Siracusa, L. D., and Buchberg, A. M. (1993). Analysis of the murine All-1 gene reveals conserved domains with human ALL-1 and identifies a motif shared with DNA methyltransferases. Proc. Natl. Acad. Sci. USA 90: 6350 – 6354. Mazo, A. M., Huang, D.-H., Mozer, B. A., and Dawid, I. B. (1990). The trithorax gene, a trans-acting regulator of the bithorax complex in Drosophila, encodes a protein with zinc-binding domains. Proc. Natl. Acad. Sci. USA. 87: 2112 –2116. McCormick, M. K., Schinzel, A., Petersen, M. B., Stetten, G., Driscoll, D. J., Cantu, E. S., Tranebjaerg, L., Mikkelsen, M., Watkins, P. C., and Antonarakis, S. E. (1989). Molecular genetic approach to the characterization of the ‘‘Down syndrome region’’ of chromosome 21. Genomics 5: 325– 331. McInnis, M. G., Chakravarti, A., Blaschak, J., Petersen, M. B., Sharma, V., Avramopoulos, D., Blouin, J. L., Ko¨nig, U., Brahe, C., Cox Matise, T., Warren, A. C., Talbot , C. C., Jr., Van Broeckhoven, C., Litt, M., and Antonarakis, S. E. (1993). A linkage map of human chromosome 21: 43 PCR markers at average intervals of 2.5 cM. Genomics 16: 562–571.

AID Genom 4393

/

6r22$$$$41

11-05-96 09:31:53

37

Nizetic, D., Gellen, L., Hamvas, R. M. J., Mott, R., Grigoriev, A., Vatcheva, R., Zehetner, G., Yaspo, M. L., Dutriaux, A., Lopes, C., Delabar, J. M., Van Broeckhoven, C., Potier, M. C., and Lehrach, H. (1994). An integrated YAC-overlap and ‘‘cosmid-pocket’’ map of the human chromosome 21. Hum. Mol. Genet. 3: 759 –770. Patterson, D., Rahmani, Z., Donaldson, D., Gardiner, K., and Jones, C. (1993). Physical mapping of chromosome 21. Progr. Clin. Biol. Res. 384: 33– 50. Peterson, A., Patil, N., Robbins, C., Wang, L., Cox, D. R., and Myers, R. M. (1994). A transcript map of the Down syndrome critical region on chromosome 21. Hum. Mol. Genet. 3: 1735 – 1742. Phillips, M. D., and Shearn, A. (1990). Mutations in polycombeotic, a Drosophila polycomb-group gene, cause a wide range of maternal and zygotic phenotypes. Genetics 125: 91–101. Rastelli, L., Chan, C. S., and Pirrotta, V. (1993). Related chromosome binding sites for zeste, suppressors of zeste and polycomb group proteins in Drosophila and their dependence on Enhancer of zeste function. EMBO J. 12: 1513 –1522. Rommens, J. M., Durocher, F., McArthur, J., Tonin, P., LeBlanc, J-F., Allen, T., Samson, C., Ferri, L., Narod, S., Morgan, K., and Simard, J. (1995). Generation of a transcription map at the HSD17B locus centromeric to BRCA1 at 17q21. Genomics 28: 530 – 542. Soares, M. B., Bonaldo, M. D., Jelene, P., Su, L., Lawton, L., and Efstratiadis, A. (1994). Construction and characterization of a normalized cDNA library. Proc. Natl. Acad. Sci. USA 91: 9228 – 9232. Soeda, E., Hou, D. X., Osoegawa, K., Atshuchi, Y., Yamagata, T., Shimokawa, T., Kishida, H., Soeda, E., Okano, S., Chumakov, I., Cohen, D., Raff, M., Gardiner, K., Graw, S. L., Patterson, D., Jong, P. D., Ashworth, L. K., Slezak, T., and Carrano, A. V. (1995). Cosmid assembly and anchoring to human chromosome 21. Genomics 25: 73– 84. Tassone, F., Xu, H., Burkin, H., Weissman, S. M., and Gardiner, K. (1995). cDNA selection from 10 Mb of chromosome 21 DNA: Efficiency in transcriptional mapping and reflections of the genome organization. Hum. Mol. Genet. 4: 1509 –1518. Tillib, S., Sedkov, Y., Mizrokhi, L., and Mazo, A. (1995). Conservation of structure and expression of the trithorax gene between Drosophila virilis and Drosophila melanogaster. Mech. Dev. 53: 113–122. Tkachuk, D. C., Kohler, S., and Cleary, M. L. (1992). Involvement of a homolog of Drosophila trithorax by 11q23 chromosomal translocations in acute leukemias. Cell 71: 691–700. Tschiersch, B., Hofmann, A., Krauss, V., Dorn, R., Korge, G., and Reuter, G. (1994). The protein encoded by Drosophila positioneffect variegation suppressor gene Su(var)3-9 combines domains of antagonistic regulators of homeotic gene complexes. EMBO J. 13: 3822 –3831. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., Coulson, A., Craxton, M., Dear, S., Du, Z., Durbin, R., Favello, A., Fulton, L., Gardner, A., Green, P., Hawkins, T., Hillier, L., Jier, M., Johnston, L., Jones, M., Kershaw, J., Kirsten, J., Laister, N., Latreille, P., Lightning, J., Lloyd, C., McMurray, A., Mortimore, B., O’Callaghan, M., Parsons, J., Percy, C., Rifken, L., Roopra, A., Saunders, D., Shownkeen, R., Smaldon, N., Smith, A., Sonnhammer, E., Staden, R., Sulston, J., Thierry-Mieg, J., Thomas, K., Vaudin, M., Vaughan, K., Waterston, R., Watson, A., Weinstock, L., Wilkinson-Sproat, J., and Wohldman, P. (1994). 2.2 Mb of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368: 32–38. Xu, H., Wei, H., Tassone, F., Graw, S., Gardiner, K., and Weissman, S. M. (1995). A search for genes from the dark band regions of human chromosome 21. Genomics 27: 1– 8. Yaspo, M. L., Gellen, L., Mott, R., Korn, B., Nizetic, D., Poustka, A., and Lehrach, H. (1995). Model for a transcript map of human chromosome 21: Isolation of new coding sequences from exon and enriched cDNA libraries. Hum. Mol. Genet. 4: 1291 –1304. Yu, B. D., Hess, J. L., Horning, S. E., Brown, G. A. J., and Korsmeyer, S. J. (1995). Altered Hox expression and segmental identity in Mllmutant mice. Nature 378: 505– 508.

gnma

AP: Genomics