Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome

Virus Research 97 (2003) 57–63

Cloning of biologically active genomes from a Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus isolate by using a bacterial artificial chromosome Hanzhong Wang a,1 , Fei Deng a,b,1 , Gorben P. Pijlman c , Xinwen Chen a , Xiulian Sun a , Just M. Vlak c , Zhihong Hu a,∗ a

Joint-Laboratory of Invertebrate Virology and Key Laboratory of Molecular Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, PR China b Wuhan Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, PR China c Laboratory of Virology, Wageningen University, Binnenhaven 11, 6709 PD Wageningen, The Netherlands Received 13 March 2003; received in revised form 3 July 2003; accepted 4 July 2003

Abstract Purification of genotypes from baculovirus isolates provides understanding of the diversity of baculoviruses and may lead to the development of better pesticides. Here, we report the cloning of different genotypes from an isolate of Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) by using a bacterial artificial chromosome (BAC). A transfer vector (pHZB10) was constructed which contained an Escherichia coli mini-F replicon cassette within the upstream and downstream arms of HaSNPV polyhedrin gene. Hz2e5 cells were co-transfected with wild-type HaSNPV DNA and pHZB10 to generate recombinant viruses by homologous recombination. The DNA of budded viruses (BVs) was used to transform E. coli. One of the bacmid colonies, HaBacHZ8, has restriction enzyme digestion profiles similar to an in vivo cloned strain HaSNPV-G4, the genome of which has been completely sequenced. For testing the oral infectivity, the polyhedrin gene of HaSNPV was reintroduced into HaBacHZ8 to generate the recombinant bacmid HaBacDF6. The results of one-step growth curves, electron microscopic examination, protein expression analysis and bioassays indicated that HaBacDF6 replicated as well as HaSNPV-G4 in vitro and in vivo. The biologically functional HaSNPV bacmids obtained in this research will facilitate future studies on the function genomics and genetic modification of HaSNPV. © 2003 Elsevier B.V. All rights reserved. Keywords: Baculoviruses; Genotypes; HaSNPV; Bacmid; Polyhedrin gene

1. Introduction Baculoviruses belong to a family of insect pathogens that are widely used as bioinsecticides for insect pest control, and as efficient eukaryotic expression vectors in insect cells to produce biologically active recombinant (glyco)proteins for pharmaceutical and scientific applications (Emery and Bishop, 1987; Chai et al., 1993; Joshi et al., 2001). Also, their usability as a safe gene-delivery vector in mammals is under investigation (Ghosh et al., 2002).

∗ Corresponding author. Tel.: +86-27-87199229; fax: +86-27-87198072. E-mail address: [email protected] (Z. Hu). 1 These authors contributed equally to the work.

0168-1702/$ – see front matter © 2003 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2003.07.001

Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HearNPV, also called HaSNPV), a pesticide against the cotton bollworm in China closely related to Helicoverpa zea SNPV (Chen et al., 1997), and infects a range of Helicoverpa species. For further genetic engineering of HaSNPV to improve its pesticidal activity, we have recently sequenced the whole genome of an in vivo cloned strain of HaSNPV, HaSNPV-G4 (Chen et al., 2001). Besides the construction of a genetically enhanced HaSNPV, the purification of different genotypes from the natural HaSNPV isolate may lead to the development of bioinsectides with enhanced effectiveness against the natural host. Baculovirus isolates often display a considerable degree of genotypic variation, as indicated by the presence of submolar bands in restriction enzyme digests (Munoz et al., 1999; Summers and Smith, 1978), and by the occurrence of nucleotide

58

H. Wang et al. / Virus Research 97 (2003) 57–63

polymorphisms revealed by shotgun sequencing of complete baculovirus genomes (Chen et al., 2001). The selection of genotypes with superior biological activity from baculovirus isolates can be performed by plaque purification or in vivo cloning methods (Smith and Crook, 1988). However, these procedures are tedious and may prove complicated, especially when the desired genotypes are subdominant and/or confer a selection disadvantage. Similarly, the construction and purification of recombinant baculoviruses for insect pest control or protein production in insect cells by the conventional co-transfection/plaque assay method is time consuming. Numerous approaches have become available to quickly generate baculovirus recombinants (Merrington et al., 1996), most notably the Bac-to-BacTM system (Invitrogen). The Bac-to-BacTM system is a rapid and efficient method to generate recombinant baculoviruses by using site-specific transposition to insert foreign genes into a bacmid propagated as a bacterial artificial chromosome (BAC) in Escherichia coli cells (Luckow et al., 1993). Pure composite bacmid DNA is infectious when introduced into insect cells and expresses the foreign gene(s) under the control of the strong very late polyhedrin/p10 promoters. Recombinant bacmid DNA isolated from E. coli is genetically homogeneous, thereby eliminating the time-consuming steps of plaque purification, which reduces the time to generate recombinant viruses from several weeks to 7–10 days. The bacmids are also very useful for the research on functional genomics of baculoviruses. In some studies the available bacmid DNA was used to delete genes by site-specific recombination in E. coli (Lin and Blissard, 2002a,b; Hou et al., 2002; Lung et al., 2002; Pijlman et al., 2002). The so-called null bacmid was subsequently examined to determine if the defect in viral replication resulted from a defect in DNA replication or from a defect in transcription (Lin and Blissard, 2002b). Bacmids make it also easier to introduce specific site mutations in a baculovirus genome. First of all, a bacmid of the baculovirus with similar bioactivities as the wild-type virus was required. In this paper, we report the cloning of different HaSNPV-genotypes as bacterial artificial chromosomes using the bacmid backbone from the existing Autographa californica nucleopolyhedrovirus (AcMNPV) Bac-to-BacTM system. We also show the functionality of the HaSNPV Bac-to-BacTM system and the biological activity of the HaSNPV bacmid HaBacDF6, which is not significantly different from the in vivo cloned strain HaSNPV-G4.

Hubei isolate (Sun et al., 1998) and was used as a positive control in the experiment. The complete genome sequence of HaSNPV-G4 was recently reported (Chen et al., 2001). The H. zea cell line Hz2e5 cells (McIntosh and Ignoffo, 1983) were cultured in Grace’s insect medium supplemented with 10% fetal bovine serum (GIBCO/BRL) using standard techniques (O’Reilly et al., 1992). 2.2. Construction of the bacmid transfer vector A 2.3 kb segment upstream of the HaSNPV polyhedrin gene was subcloned from plasmid pCXW13 (a pUC19 plasmid containing the HindIII-D fragment of HaSNPV) using XhoI and HindIII, and was inserted into plasmid pBluescriptKS+. A 1.3 kb segment downstream of the HaSNPV polyhedrin gene (708nt-1985nt in the HaSNPV-G4 genome) was amplified by PCR from pCXW99, a pTZ19R plasmid containing the EcoRI-A fragment of HaSNPV (Chen et al., 2000), using a forward primer with BamHI and Bsu36I sites (underlined) (5 -GGATCCTGAGGCCTCCTCCTCTATACACTGGTCC3 ) and a reverse primer with a XbaI site (underlined) (5 -TCTAGATTCGCAATAATGGTTCAAGTG-3 ). The PCR product was cloned into the plasmid containing the upstream fragment. The mini-F replicon, a kanamycin resistance gene and the Tn7 target sites were cut out as a 8.5 kb Bsu36I fragment from plasmid BAC-Bsu36I (Pijlman et al., 2002) and inserted into the Bsu36I site to generate transfer vector pHZB10 (Fig. 1B). 2.3. Cloning and identification of HaSNPV bacmids Plasmid pHZB10 DNA was co-transfected with wild-type HaSNPV DNA into Hz2e5 cells using lipofectin (GIBCO/ BRL). Budded viruses (BVs) were retrieved from the supernatant. The DNA of BVs was purified and transformed into E. coli DH10␤ cells (GIBCO/BRL). Colonies were selected in the presence of kanamycin and X-Gal. Ten colonies were chosen randomly and of which the bacmid DNAs were purified and digested with restriction enzyme for comparison with wild-type HaSNPV DNA (Fig. 2A). Colony #8, HaBacHZ8, which had similar DNA REN profiles to that expected from HaSNPV-G4 of which the genome has been completely sequenced (Chen et al., 2001), was chosen for further analysis (Fig. 2B). 2.4. Reintroduction of the polyhedrin gene into HaBacHZ8

2. Materials and methods 2.1. Virus and insect cells The HaSNPV was isolated from diseased H. armigera larvae in Hubei province in China (Hubei isolate, Zhang et al., 1981) and was used as the wild-type HaSNPV in the experiment. HaSNPV-G4 is an in vivo cloned strain of the

For reintroducing the polyhedrin gene into HaBacHZ8, a transfer vector pHaFastBac1 was constructed by replacing the AcMNPV polyhedrin promoter of the commercially available pFastBac1 (Bac-to-BacTM Baculovirus Expression System/GIBCOBRL) with the HaSNPV polyhedrin promoter. The HaSNPV polyhedrin promoter (-144nt-4nt in the HaSNPV-G4 genome) was obtained by PCR with primers

H. Wang et al. / Virus Research 97 (2003) 57–63

59

(A) Tn7R Ampr

Gmr

pHaFastBac1 ~4.7kb

pPolh-Ha MCS

Ori

SV40 Tn7L f1intergenic lacZ region

(B)

Ha polyhedrin promoter sequence: GCCTGAGGGATTTCTGTCGTCGTGTTGAAA ATTTGTAATAAAACTAAATAAACCTTTAAT ATAAATATTAAACATACACTTTTATTTTTA AAATAAGTATTTTTTTCCTATTGTTCAAGA TTGTGAAAAATCAAATATCCCATAATTC

HindIII

XhoI

HindIII

HindIII

118489

129339

0 255 708 1985

3254

D

K Polyhedrin gene

2.3kb

Uptream

8.6kb

Kana r

lacZ:attTN7:lacZ

Mini F-replicon

1.3kb

Downstream

Fig. 1. (A) Physical map of donor plasmid pHaFastBac1 and the polyhedrin promoter sequence. The original Ac-polh promoter of pFastBac1 was replaced with the polyhedrin promoter of HaSNPV (shown in the box). (B) The upper bar indicates the HindIII restriction map of the HaSNPV polyhedrin region. The numbers above the bar denoted the nt location in the genome DNA of HaSNPV-G4. The lower bar indicates the inserted bacmid cassette and the homologous recombination arms in transfer vector pHZB10. Kana, Kanamycin gene; lazZ:attTN7:lacZ, LacZ gene with Tn7 attaching site.

Fig. 2. (A) HindIII restriction profiles of different HaSNPV bacmid genotypes. wt, wild-type HaSNPV DNA. Lanes 1–10 represent the DNA from the positive colonies #1–#10, respectively. (B) BglII restriction profiles of HaBacHZ8 and HaSNPV-G4. M, ␭/EcoRI/BamHI/HindIII marker. G4, HaSNPV-G4 DNA. HaBacHZ8, the DNA of positive colony #8 bacmid. The arrows indicated the bands in HaBacHZ8 which were different from that of HaSNPV-G4.

60

H. Wang et al. / Virus Research 97 (2003) 57–63

HaPH1: 5 -CTGCAGCCTGAGGGATTTCTGTCGTCGTG TTGA-3 and HaPH2: 5 -CTGCAGAATTATGGGATATTTGATTTTTC-3 , containing PstI sites (underlined). The ATG of the polyhedrin promoter was mutated to ATT by changing oligonucleotide C to A on primer HaPH2 (bold). Plasmid pFastBac1 was digested with Bst1107I and BamHI and the PCR product of the HaSNPV polyhedrin promoter was cleaved by Pst1 and cloned into the pFastBac1 to generate pHaFastBac1 (Fig. 1A). The entire polyhedrin ORF of HaSNPV (1nt-738nt in the HaSNPV-G4 genome) was amplified from plasmid pCXW99 by PCR. The forward primer was 5 -GGGGAATTCTGTATACTCGTTACAGTTACAGC-3 with an EcoRI site (underlined) and the reverse primer was 5 -CGCTCTAGATTAATATGCAGGACCAGTGTA-3 with an XbaI site (underlined). The PCR product was cloned into a pGEM-T easy vector (Promega) and subsequently cloned into pHaFastBac1, generating pDF6. Prior to transposition, the E. coli DH10␤ cells containing the HaSNPV bacmid (HaBacHZ8) were transformed with the transposition helper plasmid pMON7124 (Luckow et al., 1993). Transposition was carried out by transforming pDF6 into the HaBacHZ8 harbouring E. coli according to Bac-to-BacTM system manual. White recombinants were selected and checked by PCR.

Hz2e5 cells, and the final results were checked 7 days after EPDA. After one round amplification in larvae, the polyhedra of HaBacDF6 and HaSNPV-G4 were used for bioassays. The LD50 values of the viruses were determined using third instar H. armigera by the drop-let feeding bioassay as described by Hughes et al. (1986). Larvae were exposed to five concentrations: 1 × 106 , 3 × 105 , 1 × 105 , 3 × 104 , 1 × 104 PIBs/ml of each, 48 insects per dose and checked for mortality daily. The bioassay was repeated three times. LD50 values were calculated using the computer program POLO (Russell et al., 1997) and compared by paired-sample t-test (SPSS v10.0).

2.5. Transfection of insect cells

3. Results

Bacmid DNA of HaBacHZ8 and recombinant bacmid DNA from a positive transposition colony (HaBacDF6) were isolated by methods developed for large plasmids (Instruction Manual of Bac-to-BacTM system/Life Technologies). HaBacHZ8 and HaBacDF6 DNA were used to transfect Hz2e5 insect cells with lipofectin. DNA from HaSNPV-G4 was used as a control.

3.1. Cloning bacmids with different genotypes from wild-type HaSNPV

2.6. Protein analysis Hz2e5 cells were infected with budded virus HaSNPV-G4, HaBacHZ8 and HaBacDF6 at a MOI of 5. At 72 h post infection (hpi), cells were washed twice in PBS (pH 7.4). Cell proteins were separated on a 12% SDS-PAGE gel and transferred onto a nitrocellulose membrane by semi-dry electroblotting (BioRad). Western blotting was performed using a polyclonal antibody against the HaSNPV polyhedrin protein. The second antibody was goat–anti-rabbit conjugated with alkaliphosphatase (SABC/China). The Western blot was stained with the BCIP/NBT kit (SABC/China). 2.7. One-step growth curve and bioassay For one-step growth curve, Hz2e5 cells were infected with each virus (HaSNPV-G4, HaBacHZ8, HaBacDF6) at an MOI of 5. Supernatants were collected at the indicated times pi (0, 8, 18, 24, 36, 48, 72). The titers of supernatants were determined by end point dilution assay (EPDA) on

2.8. Electron microscopy 106 Hz2e5 cells were infected with HaSNPV-G4, HaBacHZ8 and HaBacDF6 at a MOI of 5, respectively. Infected cells were harvested at 72 hpi and washed twice with PBS. The polyhedra from infected larvae with HaSNPV-G4 and HaBacDF6 were purified. All samples were processed for electron microscopy examination as described by Van Lent et al. (1990).

After co-transfection of pHZB10 and wild-type HaSNPV DNA, viral DNA was isolated from BVs and transformed to E. coli DH10␤ cells. Bacmid DNA of 10 randomly selected colonies were purified, digested with HindIII and compared with wild-type HaSNPV DNA. Several genetic variations existed in the colonies (Fig. 2A). Colony #2 and #8 showed restriction profiles as predicted from the wild-type HaSNPV. Colony #8, HaBacHZ8, was analysed with additional restriction enzymes (Fig. 2B) in comparison with HaSNPV-G4 DNA. With the insertion of the 8.5 kb Bsu36I fragment into the HaBacHZ8, two additional BglII sites should be introduced into the original BglII-D fragment of HaSNPV. It therefore, should resulted in the decrease of the size of BglII-D from 14.9 to 13.6 kb, as well as adding two BglII fragments with the sizes of 7.4 and 2.1 kb in HaBacHZ8. As showed in Fig. 2B, the BglII digestion profile of HaBacHZ8 was as expected. It indicated that HaBacHZ8 contained the full-length genome as the HaSNPV-G4 strain and therefore this bacmid was used for further investigations. Most of the remaining bacmids had deletions and/or mutations in their genome and they were not further considered in this paper. 3.2. Biological activities of HaBacHZ8 When HaBacHZ8 was transfected to Hz2e5 cells, the typical CPE for baculovirus infection appeared 5–7 days

H. Wang et al. / Virus Research 97 (2003) 57–63

61

virus growth curve 0-72 hrs 1.00E+09 1.00E+08

IU/ml

1.00E+07 1.00E+06 1.00E+05

HaSNPV-G4

1.00E+04

HaBacDF6 HaBacHZ8

1.00E+03 1.00E+02 0

12

24

36

48

60

72

84

Hours post infection

Fig. 3. One-step growth curves in Hz2e5 cells. The infections with HaSNPV-G4, HaBacHZ8 and HaBacDF6 were performed at an MOI of 5. The supernatants of infections were collected and assayed by end point dilution assay (EPDA).

post transfection, such as enlarged nuclei and detachment from the bottom of the flask. All the infected cells were occlusion minus. The mock-infected cells attached tightly to the bottom of flask and the HaSNPV-G4 DNA transfected cells contained many occlusion bodies (data not shown). The one-step growth curve of the BVs of HaBacHZ8 was similar to that of HaSNPV-G4 (Fig. 3). The Hz2e5 cells infected by HaBacHZ8 were analyzed by transmission electron microscopy. The result showed that the virus replicated in the nucleus of the cells, but there was no occlusion body formation in the nucleus because HaBacHZ8 lacks the polyhedrin gene (Fig. 4A). Results of SDS-PAGE and Western blotting also showed that there was no polyhedrin produced in HaBacHZ8 infected cells (Fig. 5A and B).

Fig. 4. Morphology of HaBacHZ8, HaBacHZ6 and HaSNPV-G4. (A) Electron micrographs of Hz2e5 cells infected with HaBacHZ8 (72 h post infection). (B) Polyhedra purified from dead insects infected with HaBacDF6. (C) Purified polyhedra from dead insects infected with HaSNPV-G4. Nu, nucleus; nm, nuclear membrane; C, cytoplasm; cp, calyx precursor; V, virions; PE, polyhedron envelope.

Fig. 5. Polyhedrin expression in the infected cells. (A) SDS-PAGE of total protein of infected cells harvested at 72 h post infection. Arrows indicate the polyhedrin protein (∼32 kDa). (B) Western blotting with HaSNPV polyhedrin antibodies. Arrows indicate a positive band around 32 kDa. Proteins from about 3 × 104 cells were loaded in each lane.

62

H. Wang et al. / Virus Research 97 (2003) 57–63

3.3. Reintroduction of polyhedrin gene into HaBacHZ8 In order to test the oral infectivity, the polyhedrin gene was reintroduced into HaBacHZ8. A transfer vector pHaFastBac1 was constructed according to Section 2. The region of HaSNPV polyhedrin promoter in pHaFastBac1 was sequenced and proved to be correct (Fig. 1A). The HaSNPV polyhedrin ORF was inserted into pHaFastBac1 and generated pDF6. The pDF6 DNA was transformed into the bacterial cells harbouring HaBacHZ8 and the transposition helper plasmid. With the help of the transpotase expressed by helper plasmid, the polyhedrin gene was transposed into the Tn7 attaching site within the LacZ gene of the mini-F cassette. The positive colonies were analysis by PCR and restriction enzyme analysis, and one of the polyhedrin positive bacmid was designated HaBacDF6 and used for further investigation. 3.4. Biological activity of HaBacDF6 HaBacDF6 DNA was isolated from E. coli and transfected into Hz2e5 cells. Cytopathic effects became apparent 3 days later. Occlusion bodies were seen in the nucleus of cells by light microscopy. Infected cells were harvested, analyzed by electron microscopy and revealed the formation of occlusion bodies in the nuclei (data not shown). Polyhedra with singly enveloped virions purified from HaBacDF6 infected larvae had similar shape and size as those of HaSNPV-G4 (Fig. 4B and C). Total proteins from the infected cells were analyzed by SDS-PAGE and Western blotting, and the results indicated that there was expression of polyhedrin in HaBacDF6 infected cells (Fig. 5A and B). The temporal kinetics of the one-step growth curve of budded virus of HaBacDF6 was similar to that of HaSNPV-G4 and HaBacHZ8 (Fig. 3). Though the titers at 0 hpi of HaBacDF6 and HaBacHZ8 were slightly lower than HaSNPV-G4, the profile of the whole curves was similar. All titers increased to the highest at 72 hpi. Therefore, budded viruses of the three genotypes, including the polyhedrin null virus HaBacHZ8 and polyhedrin reintroduced recombinant virus HaBacDF6, have the same infectivity in Hz2e5 insect cells. The bioassay result showed that LD50 of HaBacDF6 against third instar larvae was not significantly different from that of HaSNPV-G4 (Table 1). HaBacDF6 had the Table 1 Dose-mortality relationship of HaSNPV-G4 and HaBacDF6 in early third instar H. armigera larvae Virus

HaSNPV-G4 HaBacDF6 a

LD50 (polyhedra)

101.9a 144.4a

No significant difference.

95% confidence Slope limits Lower

Upper

74.7 104.2

139.9 206.2

1.781 ± 0.216 1.622 ± 0.206

same biological activity as HaSNPV-G4, it is indicated that the foreign bacmid cassette insertion does not influence the activity of the recombinant virus.

4. Discussion Cloning of baculovirus genomes as bacterial artificial chromosomes is a very useful strategy to identify the genetic variability of natural occurring baculovirus isolates. Moreover, defective genotypes can only replicate with the aid of a helper virus and thus cannot be purified by plaque assay and/or in vivo cloning methods. The method described here allows rapid isolation of defective viruses and evaluation of their genetic and biological properties. In some cases, defective genomes act as parasitic genotypes (Munoz et al., 1998), and it is of great fundamental interest to investigate the basis for this phenomenon by studying these genomes in detail. Bacmids also are excellent tools to study baculovirus gene function, using targeted mutagenesis in E. coli (Bideshi et al., 2000; Blissard et al., 2001; Pijlman et al., 2002; Hou et al., 2002). The same techniques may be exploited to enhance the insecticidal properties of baculoviruses for insect pest control by genetic engineering. In this research, 2 out of 10 randomly selected bacmids appeared to contain complete genome. This relatively low number of complete genomes may reflect the high degree of genetic variation in the natural isolate. In a previous study with SeMNPV it was shown that out of the 111 bacmids generated by direct clone, only three contained the entire genome (Pijlman et al., 2002). Therefore, the resulting library of BAC clones might not give directly a quantitative, but rather a qualitative reflection of the heterogeneity of natural baculovirus isolates. The HaSNPV bacmid (HaBacHZ8) generated in this research proved to be infectious to insect cells, and after reintroduction of polyhedrin into the bacmid, the biological properties of this bacmid (HaBacDF6) were not significantly different from the in vivo cloned strain HaSNPV-G4. The development of HaBacHZ8 and pHaFastBac1 has provided a useful HaSNPV Bac-to-Bac system and can be used to construct HaSNPV recombinants for expressing foreign proteins and for genetic modification. The HaSNPV bacmids will facilitate detailed studies on baculovirus gene function by targeted or random mutagenesis in E. coli. Also, the further investigation of the genetic and biological properties of the other genotypes in the bacmid library will give valuable information about the role of deleted genomes in natural baculovirus isolates.

χ2 /d.f.

Acknowledgements 0.04 0.79

We acknowledge Dr. Basil M. Arif for his professional assistance, and Magda Usmany for technical assistance with cell culture maintenance. This research was

H. Wang et al. / Virus Research 97 (2003) 57–63

supported in partly by the National Natural Science Foundation of China (grant no. 30025003, 3000034, 39980001), Chinese Academy of Sciences (CAS) (grant no. Kscx21-02, Kscx2-SW-301-09), 863 project of China (grant no. 2001AA214031), and a jointed grant from CAS and the Royal Netherlands Academy of Sciences (grant no. 99CDP023). References Bideshi, D.K., Bigot, Y., Federici, B.A., 2000. Molecular characterization and phylogenetic analysis of the Harrissina brillians granulovirus granulin gene. Arch. Virol. 145, 1933–1945. Chai, H., Vasudevan, S.G., Porter, A.G., Chua, K.L., Oh, S., Yap, M., 1993. Glycosylation and high-level secretion of human tumour necrosis factor-beta in recombinant baculovirus-infected insect cells. Biotechnol. Appl. Biochem. 3, 259–273. Chen, X., Vlak, J.M., Hu, Z.H., 1997. Nucleotide sequence analysis of the polyhedrin gene of Heliothis armigere single nucleocapsid nuclear polyhedrosis virus. Virol. Sinica 12, 346–353. Chen, X., Li, M., Sun, X., Arif, B.M., Hu, Z.H., Vlak, J.M., 2000. Genomic organization of Heliocoverpa armigera single-nucleocapsid nucleopolyhedrovirus. Arch. Virol. 145, 2539–2555. Chen, X., IJkel, W.F.J., Tarchini, R., Sun, X., Sandbrink, H., Wang, H., Peters, S., Zuidema, D., Lankhorst, R.K., Vlak, J.M., Hu, Z.H., 2001. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J. Gen. Virol. 82, 241–257. Emery, V.C., Bishop, D.H., 1987. The development of multiple expression vectors for high level synthesis of eukaryotic proteins: expression of LCMV-N and AcNPV polyhedrin protein by a recombinant baculovirus. Protein Eng. 1, 359–366. Ghosh, S., Parvez, M.K., Banerjee, K., Sarin, S.K., Hasnain, S.E., 2002. Baculovirus as mammalian cell expression vector for gene therapy: an emerging strategy. Mol. Ther. 6, 5–11. Hou, S., Chen, X., Wang, H., Tao, M., Hu, Z.H., 2002. Efficient method to generate homologous recombinant baculovirus genomes in E. coli. Biotechniques 32, 783–789. Hughes, P.R., van Beek, N.A.M., Wood, H.A., 1986. A modified droplet feeding method for rapid assay of Bacillus thuringiensis and baculovirus in noctuid larvae. J. Invertebr. Pathol. 58, 7–192. Joshi, L., Shuler, M.L., Wood, H.A., 2001. Production of a sialylated N-linked glycoprotein in insect cells. Biotechnol. Progr. 17, 822– 827. Lin, G., Blissard, G.W., 2002a. Analysis of an Autographa californica multicapsid nucleopolyhedrovirus lef-6-null virus: LEF-6 is not essential for viral replication but appears to accelerate late gene transcription. J. Virol. 76, 5503–5514.

63

Lin, G., Blissard, G.W., 2002b. Analysis of an Autographa californica nucleopolyhedrovirus lef-11 knockout: LEF-11 is essential for viral DNA replication. J. Virol. 76, 2770–2779. Luckow, V.A., Lee, S.C., Barry, G.F., Olins, P.O., 1993. Efficient generation of infectious recombinant baculovirus by site-specific transposonmediated insertion of foreign genes into a baculovirus genome propagate in Escherichia coli. J. Virol. 67, 4566–4579. Lung, O., Westenberg, M., Vlak, J.M., Zuidema, D., Blissard, G.W., 2002. Pseudotyping Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV): F proteins from group II NPVs are functionally analogous to AcMNPV GP64. J. Virol. 76, 5729–5736. McIntosh, A.H., Ignoffo, C.M., 1983. Characterization of 5 cell lines established from species of Heliothis. Appl. Entomol. Zool. 18, 262– 269. Merrington, C.L., Kitts, P.A., King, L.A., Possee, R.D., 1996. An Autographa californica nucleopolyhedrovirus lef-2 mutant: consequences for DNA replication and very late gene expression. Virology 217, 338–348. Munoz, D., Castillejo, J.I., Caballero, P., 1998. Naturally occurring deletion mutants are parasitic genotypes in a wild-type nucleopolyhedrovirus population of spodoptera exigua. Appl. Environ. Microbiol. 64, 4372–4377. Munoz, D., Murillo, R., Krell, P.J., Vlak, J.M., Caballero, P., 1999. Four genotypic variants of a Spodoptera exigua nucleopolyhedrovirus (SeSP2) are distinguishable by a hypervariable genomic region. Virus Res. 59, 61–74. O’Reilly, D.R., Miller, L.K., Luckow, V.A., 1992. Baculovirus Expression Vectors: A Laboratory Manual. W.H. Freeman and Company, Printed in the United States of America, 117–123 pp. Pijlman, G.P., Dortmans, J.F.M., Vermeesch, A.M.G., Martens, D.E., Yang, K., Goldbach, R.W., Vlak, J.M., 2002. Pivotal role of the non-hr origin of DNA replication in the genesis of defective interfering baculoviruses. J. Virol. 76, 5605–5611. Russell, R.M., Robertson, J.L., Savin, N.E., 1997. POLO: a new computer programme for probit analysis. Bull. Entomol. Soc. Am. 23, 209–213. Smith, I.R., Crook, N.E., 1988. In vivo isolation of baculovirus genotypes. Virology 166, 240–244. Summers, M.D., Smith, G.E., 1978. Baculovirus structural polypeptides. Virology 84, 390–402. Sun, X.L., Zhang, G.Y., Zhang, Z.X., Hu, Z.H., Vlak, J.M., Arif, B.M., 1998. In vivo cloning of Helicoverpa armigera single nucleocapsid nuclear polyhedrosis virus genotypes. Virol. Sinica 13, 83–88. Van Lent, J.W.M., Groenen, J.T.M., Klingge-Roode, E.C., Rohrmann, G.F., Zuidema, D., Vlak, J.M., 1990. Localization of the 34 kDa polyhedron envelope protein in Spodoptera frugiperda cells infected with Autographa californica nuclear polyhedrosis virus. Arch. Virol. 111, 103–114. Zhang, G., Zhang, Y., Ge, L., Shan, Z., 1981. The production and application of the nuclear polyhedrosis virus of Heliothis armigera (Hubei) in biological control. Acta Phytophylacica Sinica 8, 235–240.