- Email: [email protected]
Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants
Gene 513 (2013) 118–127
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants Jian Song a, c, 1, Jing Liu b, 1, Manli Weng a, Yanyan Huang b, Lei Luo b, Pengxiu Cao a, Haiwei Sun b, c, Jie Liu d, Jinhong Zhao b, Dianqi Feng b,⁎, Bin Wang a,⁎ a
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 100101, China Taishan Branch of Shandong Academy of Forestry Sciences, Taian 271000, China Shandong Agricultural University, Taian 271018, China d Department of Bioengineering and Biotechnology, College of Chemical Engineering, Qingdao University of Science and Technology, Qingdao 266042, China b c
a r t i c l e
i n f o
Article history: Accepted 8 October 2012 Available online 29 October 2012 Keywords: Cold-tolerance gene of tree Galactinol synthase gene of Ammopiptanthus mongolicus (AmGS) Transgenic ligneous plant
a b s t r a c t A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Low temperature is one of the most common environmental stresses for plants and potentially causes severe loss to both agriculture and pomiculture. Adaptation to winter changes in a low temperature is a precondition for ligneous plant survival in temperate and boreal vegetation zones. Many plants can increase their cold-tolerance in response to low temperature conditions (Sage, 2002; Salvucci and Crafts-Brandner, 2004; Shinozaki and Yamaguchi-Shinozaki, 1996; Thomashow, 1998). The ligneous plants developed more effective strategies for cold adaptation than herbaceous plants, because ligneous plants have to live in the same place for their whole life-period. And changes in cold-tolerance gene expression in various plants were suggested to be associated with this process (Hughes and Dunn, 1996; Thomashow, 1999). Many genes related to cold-tolerance have been cloned from many kinds of plants, some were from ligneous plants (Cao et al., 2009; Gamboa et al., 2007; Guo et al., 2010; Lal et al., 2008; Liu et al., 2005, 2006; Welling and Palva, 2008), but only a few of them has been successfully transformed and expressed in ligneous plants. Considering the facts that the ligneous Abbreviations: AFLP, Amplified fragments length polymorphism; EB, Ethidium bromide; EC, Electrical conductivity; GS, Galactinol synthase; LT50, Semi-lethal temperature; ORF, Open reading frame; RACE, Rapid amplification of cDNA ends; REC, Relative electrical conductivity; TAIL-PCR, Thermal asymmetric interlaced PCR; TDF, Transcript-derived fragment. ⁎ Corresponding authors. Tel.: +86 10 64806544; fax: +86 10 64873428. E-mail address: [email protected] (B. Wang). 1 These authors contributed equally to this paper. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.10.058
plants have evolved cold-tolerance capacity in winter, together with similar lignified structures and winter adaptive mechanisms, it is more likely to find strong cold-tolerance gene from ligneous plants growing in temperate and arctic regions (Welling et al., 2002). It is believed that this kind of cold-tolerance gene should express more easily and effectively when transformed into ligneous plants. Previous research results indicated that cold-tolerance genes from fishes, insects and herbaceous plants have been successfully transformed and expressed in herbaceous plants, and the transgenic plants exhibited increased a cold-tolerance capacity (Fan et al., 2002; Huang et al., 1997; Wallis et al., 1997; Worrall et al., 1968). Only one paper (Cao et al., 2009) reported that a cold-tolerance gene AmEBP1 cloned from ligneous plant Ammopiptanthus mongolicus (A. mongolicus) was successfully transformed and expressed in herbaceous plant, Arabidopsis thaliana, but not in ligneous plant yet. Galactinol is the galactosyl donor for the synthesis of raffinose family oligosaccharides (RFOs) and its synthesis by galactinol synthase (GS) is the first committed step of the RFOs biosynthetic pathway. During cold acclimation, RFO accumulation was found in the frost-hardy plant, Ajuga reptans (Bachmann et al., 1994) and pine needles (Hinesley et al., 1992). GS genes are induced by a variety of stresses in both stress-sensitive and tolerant-plant species (Wang et al., 2009). Galactinol and raffinose scavenge hydroxyl radicals as a novel function to protect plant cells from oxidative damage caused by methylviologen (MV) treatment, salinity, or chilling. High intracellular levels of galactinol and raffinose in the transgenic Arabidopsis plants were correlated with increased tolerance to MV treatment and salinity or chilling stress (Nishizawa et al., 2008).
J. Song et al. / Gene 513 (2013) 118–127
GS genes are found in diverse plant species and associated with multiple developmental and environmental responses (Wang et al., 2009). For example, in common bugle (Ajuga reptans), two distinct cold inducible GS genes were transcribed in discrete locations (GS-1 in mesophyll cells and GS-2 in companion cells of the phloem) (Sprenger and Keller, 2000). Seven GS genes were identified in Arabidopsis thaliana, and AtGS3 was induced only during cold stress (Nishizawa et al., 2008; Taji et al., 2002). A. mongolicus is the only evergreen broadleaf shrub endemic to the Alashan desert, northwest sandy area of China and it can survive at − 30 °C or an even lower temperature in winter. It is believed that A. mongolicus is an important germplasm containing cold-tolerance genes (Fei et al., 1994; Jiang et al., 1999; Wei et al., 1999). Recently our laboratory identified some up-regulated factors from A. mongolicus tree induced by cold treatment (Fei et al., 2008), one of them has been cloned and named as AmEBP1 (Cao et al., 2009). The objective of this study is to clone another cold-tolerance gene from the cold-tolerance tree A. mongolicus and to express it in ligneous plants. 2. Materials and methods 2.1. Plant materials Seeds of A. mongolicus were germinated in soil at 25 °C with 14 h daylight conditions. After the seedlings had grown to the 12-leaf stage (about 6 weeks), the young plants were treated in 0 °C for 36 h. Then leaves collected from cold treated and untreated young plants were used for DNA and RNA preparations. 2.2. DNA and RNA preparation DNA was isolated from leaves of A. mongolicus as described by Liu et al. (2009a). Total RNA was extracted by guanidinium thiocyanate (GT) method as reported (Chomczynski and Sacchi, 1987). 2.3. Generation of cDNA and cDNA-AFLP analysis With total RNA isolated from A. mongolicus as template, double-strand cDNA was synthesized using the M-MLV cDNA Synthesis System (Promega) and following the provided protocol. The synthesized cDNA was then used as template for AFLP analysis. cDNA-AFLP analysis was performed according to the reported method (Vos et al., 1995). 2.4. RACE-PCR and the establishment of the full-length cDNA of the AmGS gene RACE-PCR was processed to obtain the 3′end and 5′end of the cDNA sequence of AmGS gene using the SmartRace kit (Clonetech). Four gene-specific primers (5′GSP, 5′NGSP, 3′GSP, 3′NGSP; Table 1) were used, which were developed based on the conserved nucleotide sequence of reported GS genes. The RACE-PCR products were analyzed on 1.2% (w/v) agarose gels, purified, and cloned into the pBS-T vector (Tiangen Biotech), and sequenced (Sunbiotech, Beijing). After the complete sequences of the 5′-end and the 3′-end were obtained, the full cDNA length of AmGS gene was established by assembling analysis. 2.5. Real time PCR Real time PCR was performed in expression pattern analysis of the AmGS gene after cold inducement and in molecular identification of the transgenic plants. The following primers were used to amplify the AmGS gene (forward primer: AmGS-RT-F, reverse primer: AmGS-RT-R; Table 1). The following primers were used to amplify the internal control gene AmActin (forward primer: AmActin-F, reverse primer: AmActin-R; Table 1). Real time PCR was performed with the Chromo4 Real Time PCR Instrument (MJ). The total volume of PCR is 20 μL, containing
119
Table 1 Primers used in this study. Primer
Sequences (5′–3′)
5′GSP ′´NGSP 3′GSP 3′NGSP AmGS-F AmGS-R AmGs-RT-F AmGs-RT-R AmActin-F AmActin-R AmGS-Chr-F AmGS-Chr-R AmGS-vector-F AmGS-vector-R
ATCTTGCTGTACTCCACAAACTCCCAA TGGTTCTCAGGTGGGTACACTGGCTCA TGTGGCGTCACCCTGAGAATGTTGA TGGAGGTACACTGGGAAAGAGGAGAAT TCA TGG CAC CTG ATA TCA CCA CCG CT TAT TAG GCA GCG GAT GGG GCG GGA A TGTGAAGAAGTGGTGGGACA CCCAAAACGAAAAGGAAATG GGTAACATTGTGCTCAGTGGTGG CTCGGCCTTGGAGATCCACATC CACTGAAATCATGGCACCTG CCCAAAACGAAAAGGAAATG GCTCTAGAGCCACTGAAATCATGGCACCTG ACGCGTCGACGTCGCCCAAAACGAAAAGGAAATG
2.0 μL 10× PCR buffer (final concentration of 2 mmol/L MgCl2), 0.5× SYBR-Green I deoxyribonucleoside triphosphates (Light Cycler DNA master SYBR Green I, Roche Molecular Biochemicals), 0.4 mmol/L dNTP, 1 U Taq DNA polymerase, 2.0 μL primers (final concentration of each primer:0.5 μmol/L), and 6 μL 20× diluted cDNA as template. The protocol of Real time PCR reactions was composed of an initial denaturation cycle (94 °C for 3 min); 39 amplification cycles including denaturation (94 °C for 45 s), annealing (60 °C for 1 min), and extension (72 °C for 2 min); together with a final extension cycle (72 °C for 10 min). After the completion of PCR amplification, a melting curve analysis was performed. The cycle number at which the amplification plot crosses a fixed threshold above baseline was defined as the threshold cycle (Ct). AmGS gene expression was normalized to the internal control gene AmActin given by the formula 2-ΔCt. ΔCt is the Ct of AmGS gene subtracted from the Ct of the AmActin gene. 2.6. Generation of the genomic sequence and promoter of AmGS gene Based on the complete cDNA sequence of AmGS gene, the complete genomic sequence of AmGS gene was obtained by PCR amplification using the Lar Taq polymerase (TaKaRa Biotechnology Co., Ltd. Dalian) with the follow primers (forward primer: AmGS-Chr-F, reverse primer: AmGS-Chr-R, Table 1). To obtain the promoter sequence of the AmGS gene, thermal asymmetric interlaced PCR (TAIL-PCR) was performed following the reported method (Liu et al., 2009a) with A. mongolicus genomic DNA as template. 2.7. Alignment, phylogenetic analysis and motif detection The amino acid sequences of GS metabolic enzymes in Arabidopsis, rice and maize were aligned using the ClustalW tool (http://www.ebi. ac.uk/ Tools/ clustalw2/index.html). The multiple alignments resulted in an unrooted distance tree using Neighbor-Joining algorithms of MEGA version 4 (Kumar et al., 2008). And the reliability of the tree was examined by bootstrap analyses (1000 replicates). 2.8. Photinia serrulata transformation Agrobacteriun-mediated transformation in Photinia serrulata was carried out according to our previous report (Liu et al., 2009a) with minor modifications. The brief procedure is as follows: For infection, the stemlets of young plants were immersed in Agrobacteriun suspension (OD600 value is around 0.4) containing kanamycin (30 mg/L) for 10 minutes. The infected stemlets were placed on differentiation medium (MS+6-BA 2.0 mg/L+NAA 0.1 mg/L) supplied with kanamycin (30 mg/L) and cultured for 6 days. Then they were transferred onto new MS medium supplied with kanamycin (50 mg/L) and growing until the plants reached the desired height. Regenerated kanamycin-resistant plants were transferred onto rooting medium (1/2 MS+NAA 0.3 mg/L) supplied with the same
120
J. Song et al. / Gene 513 (2013) 118–127
concentration of kanamycin. The obtained transgenic plants were propagated by cuttage. 2.9. Molecular characterization of the AmGS transgenic plants Molecular characterization of the AmGS transgenic plants includes PCR, Southern hybridization and RT-PCR analyses. 2.10. PCR identification In all of the PCR identifications, genomic DNA was extracted from leaves of young plants and amplified with primers AmGS-F and AmGS-R (Table 1). PCR reactions were performed in MJ-100 PCR machine (USA). The total volume of PCR reaction mixture was 25 μL containing 2.5 μL 10× PCR buffer, 30 ng of template DNA, 0.2 μmol/L of each primer set, 2 mmol/L MgCl2, 0.4 mmol/L dNTP, and 1 U Taq DNA polymerase. The reaction was performed at 94 °C for 4 min, and then subjected to 35 cycles of 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 1 min, plus a final extension at 72 °C for 5 min. The PCR products were then separated on 1% agarose gel and visualized by ethidium bromide (EB) staining. 2.11. Southern hybridization Southern hybridization was performed as described by Sambrook et al. (1989). 2.12. Cold-tolerance assay of transgenic Photinia serrulata plants Transgenic Photinia serrulata lines and the non-transformed Photinia serrulata plants were treated at 0 °C and −6 °C for 6, 12, 24 and 36 h respectively. Their cold-tolerances were observed and their survival rates were measured 2 days after the end of cold treatment. 2.13. Relative electrical conductivity determination Relative electrical conductivity (REC) of young leaves was determined after cold inducement according to the reported method (Liu et al., 2009b; Sukumaran and Weiser, 1972) with minor modifications. The main procedure is as follows: Plants were treated at 0 °C, − 4 °C, − 8 °C, −12 °C and −16 °C for 24 h, respectively. After cold treatment, three young leaves were collected from each line (as 3 repeats), washed with distilled water for three times. Water was absorbed with filter paper. From each leaf, 1 g of tissue was taken and put into a 50 mL flask, put in 4 °C overnight. The next morning, 30 mL ion-free water was added to each flask. Then, the flasks were put at room-temperature for 15 h. Then electrical conductivity (EC1) was measured with an electrical conductivity detector (Shanghai Kangyi, Model DDS-320). The flasks were set in boiling water for 15 min. After cooling down to room-temperature, electrical conductivity (EC2) was measured. The relative electrical conductivity (REC) was calculated as follows: REC = EC1/EC2× 100% (Liu et al., 2009b; Sukumaran and Weiser, 1972). 2.14. Determination of LT50 Semi lethal temperature (LT50) was calculated according to the formula LT50 = ln(1/a)/b (Gai, 2000) based on the REC data with the Logistic equation (y = k/(1 + a e −b x ). In the equation, y is the REC and x is the temperature for cold treatment. k, a, b are parameters, k is the maximum limiting value of y; b reflects the corresponding relationship between x and y; a represents the relative position of the curve to the origin. k, a and b were calculated by fitting REC curve with Logistic equation in DPS V7.05 software.
2.15. Measurements of galactinol and raffinose contents Galactinol and raffinose were extracted and analyzed by HPLC as described by Hao et al. (2009). The content level was expressed by mg g −1 FW (fresh weight). Briefly as follows: Ten grams of fresh leaf tissue was ground to fine powder in liquid nitrogen and then homogenized with 10 mL of 80% (v/v) ethanol using a pre-cold mortar and pestle. The homogenate was set for 60 min at 80 °C and then centrifuged for 5 min at 10,000 g; the supernatant was extracted twice with 1 mL of 80% ethanol at 80 °C. The extracts were filtered through a 0.45 μm membrane, and then analyzed by high performance HPLC with Sigma products galactinol and raffinose as standards respectively. The significance of differences between data sets was evaluated by t test. Data analysis and calculation were carried out with Waters Millennium software.
3. Results 3.1. Cloning of the full length cDNA and analysis of the AmGS gene In order to obtain the genes that play protective role in cold conditions in A. mongolicus tree, we analyzed the differential expressed transcripts via cDNA-AFLP analysis. The transcript-derived fragments (TDFs) were identified in cold-induced leaves of A. mongolicus. Among them, a specific amplification fragment, TDF Am248766 was identified to be elevated in abundance after cold-treatment. Based on the sequence of TDF Am248766, RACE-PCR was carried out to obtain the full-length cDNA sequence of the corresponding gene. The generated fragment was 1249 bp in length with an open reading frame (ORF) of 987 bp flanked by 98 bp 5′-untranslated region (UTR) and 164 bp 3′-UTR. It was registered in GenBank with accession no. DQ519361, the corresponding cold-tolerance gene was named AmGolS, and briefly called AmGS (Fig. 1). The AmGS gene encoded protein was named AmGS with accession no. ABF66656. AmGS shows high identities to the homologies from herbaceous plants (Fig. 2). AmGS shows the highest identity (85%) with GmGS from Glycine max (accession no. AAM96867). Additionally, AmGS shows 74%, 73%, 68% identities to well-documented AtGS1, AtGS2 and AtGS3 from Arabidopsis thaliana (accession nos. BAB78530, BAB78531, BAB78532), respectively. AmGS contains 328-aa with an estimated molecular mass of 37.6 kDa and a PI of 5.26. Using the BLAST Network Service (NCBI, National Center for Biotechnology Information), it is revealed that AmGS comprises several domains including glycosyl transferase (Glycos_transf_2), glycosyl transferase family 8 (Glyco_transf_8), galactosyl transferase GMA12/MNN10 family (Glyco_transf_34) and UDP-glucose: Glycoprotein glucosyltransferase (UDP-g_GGTase) domains, as are found in its homologies. All the above suggested that AmGS may function as a cold-induced GS, which is important for A. mongolicus in cold accumulation.
3.2. Expression pattern analysis of AmGS gene under cold conditions by real-time RT-PCR In order to invest the expression of AmGS under cold stress conditions, real-time RT-PCR was carried out in 6-week-old axenic seedlings. As shown in Fig. 3A, the transcripts of AmGS started to increase from 12 h after cold stress, and became obvious 24 h after cold stress, and increased by 7 folds and stop increasing at the 48 h time-point. The result showed that it is a late-responsive gene, as AtGS3 in Arabidopsis (Taji et al., 2002). In addition, the expression pattern of AmGS in A. mongolicus was investigated when treated by drought, NaCl and a stress hormone ABA. As shown in Fig. 3B, AmGS was induced about 3, 4, and 5 folds increase respectively by drought, high salinity and ABA.
J. Song et al. / Gene 513 (2013) 118–127
121
Fig. 1. The coding sequence and its deduced amino acid sequence of the AmGS gene.
3.3. Genomic sequence and promoter sequence of AmGS gene
Fig. 2. Phylogenetic analysis of the reported GS proteins by using MEGA4 Neighbor-Joining. ArGS from Ajuga reptans (accession no. CAB51533), GmGS from Glycine max (accession no. AAM96867), MsGS from Medicago sativa (accession no. AAM97493), AtGS1, AtGS2, and AtGS3 from Arabidopsis thaliana (accession nos. BAB78530, BAB78531, BAB78532), BnGS from Brassica napus (accession no. AAD26116) and PsGS from Pisum sativum (accession no. CAB51130), respectively.
Genomic sequence of AmGS gene with 1637 nucleotides was obtained and registered in GenBank with the accession no. DQ519361. Comparison of the cDNA and genomic sequences showed that AmGS gene comprises 3 exons and 2 introns. And the amino acid sequence of AmGS showed high homology with that of GmGS (Glycine max, accession no. AAM96867) and MsGS (Medicago sativa, accession no. AAM97493) (Fig. 2). The promoter sequence with 487 nucleotides upstream to the start codon of AmGS gene (bankit 898227) was obtained by TAIL-PCR. The promoter sequence was analyzed for potential transcriptional regulatory elements and binding sites of various transcription factors using A Database of Plant Cis-acting Regulatory DNA Elements (PLACE) program. Several stress-associated elements were found (Table 2), such as DPBFCOREDCDC3, MYB2CONSENSUSAT, and MYCCONSENSUSAT. DPBFCOREDCDC3 is the binding site of a novel class of a Basic Region
122
J. Song et al. / Gene 513 (2013) 118–127
under the control of 35S promoter of cauliflower mosaic virus (Fig. 4). The generated plant expression vector was named pCAMBIA2300-AmGS (Fig. 4). Then pCAMBIA2300-AmGS was transformed into Agrobacterium strain LBA4404. The obtained Agrobacterium strain was named as LBA4404-pCAMBIA2300-AmGS, which was used to transform Photinia serrulata tree. 3.5. Photinia serrulata transformation experiments For functional identification purposes, the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated method. More than 30 transformants were obtained after kanamycin selection. Further PCR identification indicated that 22 of them gave PCR positive results. PCR identification result of partial transformants was shown in Fig. 5-A. After 3 times subculture (propagated by cottage) and molecular identification, two relative stable transgenic lines (R3 and R5) were obtained. 3.6. Molecular characterization of the transgenic plants Fig. 3. Transcriptional expression pattern of AmGS gene under various stresses determined by Real-time RT-PCR. Six-week-old Axenic seedlings were used as materials. A: Temporal expression of AmGS under old treatment (4 °C). B: Transcriptional expression pattern of AmGS under treatment of drought, NaCl and ABA, with seedlings treated by water as control.
Leucine Zipper Protein (bZIP) transcription factors, such as ABI5, DPBF-1 and DPBF-2 (Dc3 promoter-binding factor-1 and 2), which is associated with the stress hormone, ABA, and responses by regulation of downstream gene expression. MYB2CONSENSUSAT is the recognition and binding site of MYB transcription factors, and is found in the promoters of the dehydration-responsive gene RD22 and many other genes in Arabidopsis, thus regulates dehydration response and ABA signaling. MYCCONSENSUSAT site CANNTG (N= A/T/G/C) is the recognition and binding site of ICE1 (inducer of CBF expression) that regulates the transcription of CBF/DREB1 genes in cold conditions. It also exists in the cis-control region of numerous genes regulated by dehydration (Abe et al., 2003). 3.4. Construction of plant expression vector pCAMBIA2300-AmGS The coding region of AmGS gene was amplified from cDNA of A. mongolicus using the following two specific primer-pairs containing XbaI and SalI restriction sites: (forward primer: AmGS-vector-F, reverse primer: AmGS-vector-R; Table 1). The validated PCR fragment was inserted into corresponding restriction sites of the vector pCAMBIA2300 Table 2 Potential cis-acting elements and binding sites for transcription factors in the AmGS gene promoter. Abbreviation
Function
Sequence
Position
CBFHV (CBF) DPBFCOREDCDC3 (DPB) GT1GMSCAM4 (GT1)
Binding site of CBFs in barley Binding sites of bZIP associated with ABA response Regulation of pathogen- and salt-induced expression of SCaM-4 gene MYB recognition site in the promoters of the dehydration-responsive genes Dehydration and ABA response of RD22, bound by MYC Binding site of ICE1 in CBF3 promoter; MYC recognition site in the promoters of the dehydration-responsive gene
RYCGAC ACACNNG
−79 −380
GAAAAA
−370
YAACKG
−268 −319
CACATG
−380
CANNTG
−206 −380
MYB2CONSENSUSAT (MYB2) MYCATRD22 (MYC1) MYCCONSENSUSAT (MYC2)
K = G/T, N = A/C/G/T, Y = C/T.
The two transgenic lines R3 and R5 together with the nontransformed plants were identified by PCR, Southern hybridization and RT-PCR analyses,respectively. The experiments were repeated for other 2 times. The two transgenic lines gave positive results in PCR (Fig. 5-A), Southern hybridization (Fig. 5-B) and RT-PCR (Fig. 5-C). These results indicated that the AmGS gene has integrated into the genomic DNA sequence of the transgenic Photinia serrulata plants and expressed at least in transcriptional level. In order to know the differential expression of the AmGS gene in different tissues of the transgenic Photinia serrulata plants, RT-PCR analysis was carried out with materials from roots, stems and leaves. Results indicated that the AmGS gene expressed in roots, stems and leaves. The expression in leaves and stems is much stranger than that in roots (Fig. 6). The summary results obtained at different stages of the whole transformation process were shown in Fig. 7. 3.7. Cold-tolerance assay of transgenic Photinia serrulata plants The two transgenic lines, R3 and R5 together with the nontransformed plants, were subjected to cold-tolerance assay at 0 °C and − 6 °C for different hours (the 2 temperatures were determined from serial pre-assays,data were not shown here). Results were shown in Table 3 and Fig. 8, respectively, which indicated that the non-transformed Photinia serrulata plants were harmed slightly when treated at 0 °C for 6 h, and serious harmed when treated at 0 °C for 12 h, but the transgenic Photinia serrulata plants were not harmed until at 0 °C for 24 h. When treated with lower temperature, −6 °C, non-transformed Photinia serrulata plants were serious harmed when treated for 6 h, and died when treated for 12 h. While the transgenic Photinia serrulata plants were not harmed until treated for 12 h. These results strongly support that the expression of AmGS gene increases the cold-tolerance of the transgenic Photinia serrulata plants. 3.8. REC and LT50 determinations Fig. 9 showed the REC changes of the Photinia serrulata plants after cold treatment. Results indicated that after cold inducement, the REC level of all plants increased distinctly. But the increasing level of transgenic plants was obviously lower than that of control plants. Based on above REC data, the LT50 values were calculated, it is − 8.62 °C for non-transformed Photinia serrulata (CK), − 11.67 °C and −12.32 °C for the transgenic Photinia serrulata line R3 and R5, respectively.
J. Song et al. / Gene 513 (2013) 118–127
123
Fig. 4. Structure map of the plant expression framework of pCAMBIA2300-AmGS.
3.9. Measurements of galactinol and raffinose contents Plants of transgenic lines (R3 and R5) and the non-transformed control plants were treated at 4 °C for 24 h. Then set at normal conditions for 3 h for recovery. Leaves were collected and used as experimental materials for galactinol and raffinose content measurements. Results shown in Fig. 10 indicated that in normal conditions neither galactinol nor raffinose was detectable, but they were detected obviously in transgenic plants. That is resulted from the expression of the transformed AmGS gene; and that in cold-stress, there were low contents of endogenous galactinol and raffinose were found in untransformed control plants, but the levels were much lower than that of the transgenic plants. 4. Discussion GS is a key enzyme in the RFO biosynthetic pathway. This protein functions as galactosyl transferase, which catalyzes the key regulatory reaction utilizing UDP-galactose and myo-inositol as substrates to form galactinol and UDP. Galactinol is the galactosyl donor in the synthesis of raffinose and stachyose. GS genes have been identified as stress responsive genes in many plant species (Takanashi et al., 2008). In previous study, cold-tolerance genes have been cloned from microorganism, insect, fish and some herbaceous plants, some of them have been successfully transformed and expressed in some herbaceous plants (Fan et al., 2002; Huang et al., 1997; Wallis et al., 1997; Worrall et al., 1968). Regarding the cloning of cold-tolerance gene from ligneous plant and its successful transformation and expression in other ligneous
Fig. 5. Molecular identification of the transgenic plants. A: PCR identification. M. DNA marker (DL2000); CK1 (Positive control), pCAMBIA2300-AmGS; 1–8. Transgenic plants; CK2 (Negative control), non-transformed plant. Arrow indicates the specific PCR product. B: Southern hybridization. M. DNA marker (DL2000); 1. Positive control, pCAMBIA2300-AmGS; 2–9. Transgenic plants No. 1–8. C: RT-PCR analysis. 1. Transgenic line R3; 2. Transgenic line R5. R. Root; S. Stem; L. Leaf.
plant, it has only one report (Guo et al., 2009a). This paper reported the cloning of cold-tolerance AmGS gene from ligneous plant A. mongolicus tree and its successful expressed in transgenic Photinia serrulata tree. A. mongolicus, a kind of leguminous shrub coming from the Third Age. Now it is the only evergreen broadleaf shrub endemic to the Alashan desert, northwest sandy area of China. During the long history living in the cold conditions, A. mongolicus developed strong cold-tolerance ability and effective cold-tolerance strategies. It can survive at −30 °C or an even lower temperature in winter. Recently several papers reported the cloning of cold-tolerance genes from A. mongolicus. Liu et al. (2005, 2006) cloned a cold induced protein (CIP) gene and named it AmCIP, however, its functional identification by genetic transformation has not been reported; Cao et al. (2009) cloned the cold-tolerance gene AmEBP I and expressed it in Arabidopsis, but not in ligneous plants; Guo et al. (2010) cloned the promoter sequence of the AmCBL1 gene and expressed it in Nicotiana tabacum, but not in ligneous plants. This paper reports the cloning of AmGS gene and its promoter sequences, especially the successful expression of the AmGS gene in Photinia serrulata tree. Above results provide evidences in molecular level to support the previous ideal that A. mongolicus is an important and valuable cold-tolerance gene resource (Cao et al., 2009; Fei et al., 1994; Jiang et al., 1999; Wei et al., 1999). All of these will give great influence to the molecular research and strongly promote the study of cold-tolerance genes and the application in genetic improvement of ligneous plants. The location of Arabidopsis GS gene on chromosome 2 is adjacent to that of the gene encoding for the transcription factor ATMYB2, whose expression is induced by tolerant stress and treatment with ABA at the transcriptional level (Urao et al., 1993). Overexpression of transcription factors CBF3 (CBF: C-repeat binding factor) and CBF1 improves the tolerance to drought, high salinity and cold stresses (Jaglo-Ottosen et al.,
Fig. 6. Expression analysis by RT-PCR of AmGS gene in the transgenic lines. A: Agarose gel electrophoresis of the RT-PCR products, 1 and 2 are two repeat samples; B: Densitometry analysis of the RT-PCR products. R3: Transgenic line R3; R5: Transgenic line R5.
124
J. Song et al. / Gene 513 (2013) 118–127
Fig. 7. Summary results obtained in different stages during the transformation process. A. Agrobacterium infected stemlets were placed on differentiation medium; B. Adventitious buds were forming; C. Regenerated young plants; D. Propagation by cuttage; E. Roots are forming from young plants; F. Young plants were transferred into soil in greenhouse.
1998; Kasuga et al., 1999; Liu et al., 1998a,b), and causes accumulation of galactinol in the transgenic plants (Gilmour et al., 2000). It is noteworthy that promoter analysis of the AmGS gene indicates that several potential binding sites for CBF, MYB, MYC and bZIP transcription factors exist in the promoter of AmGS gene. As the CBF, MYB, MYC and bZIP transcription factors associate closely with dehydration and ABA responses, it was suggested that AmGS may play important protective role in other kind of stresses, in addition to cold stress. This is consistent with its up-regulation in stresses of cold, ABA and others (Fig. 3). Meanwhile, it is implicated that similar pathway about GS may be presented and activated during cold acclimation in ligneous perennial plants like that in herbaceous plant Arabidopsis thaliana (Taji et al., 2002). This result implies that ligneous plant and herbaceous plant may have some similar or commune mechanisms in their cold-tolerance response. Different gene forms were reported in plant GS gene family, for example, Arabidopsis contains 7 GS genes,among them, two were induced by drought, salt, or heat stress; one was induced by cold stress (Panikulangara et al., 2004; Taji et al., 2002). In A. mongolicus tree only one GS gene was reported, and it was induced by salt, cold stress, as Table 3 Cold-tolerance assay of the AmGS transgenic Photinia serrulata plants. Item of cold treatment
Temperature and time
Total plant number
Survival plant number
Survival rate (%)
Non-transformed plants
0 °C, 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h 0 °C 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h 0 °C, 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h
25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25
24 14 2 0 3 2 0 0 25 25 25 24 25 24 2 0 25 25 24 23 25 24 4 1
96 56 8 0 12 8 0 0 100 100 100 96 100 96 12 0 100 100 96 92 100 96 16 4
Non-transformed plants
AmGS transgenic line R3
AmGS transgenic line R3
AmGS transgenic line R5
AmGS transgenic line R5
well as the hormone ABA stress (Fig. 3). Are there other forms of GS gene in A. mongolicus tree? And do they differentially response to different kinds of stress? These questions are not known yet, which need to be elucidated in future study. Looking at the expression pattern of AmGS gene in different tissues, the transcript amount in stem and leave is much stronger than that in root (Fig. 6). It seems reasonable, because roots are buried in soil, the effect of cold treatment become weaker and delayed. Cold-tolerance assay provided direct data reflecting the cold-tolerance ability of plant. Experimental results indicated that in the same cold treatment conditions, the transgenic plants exhibited higher survival rate than non-transformed plants; and that resulting completely death of the transgenic plants needed longer treatment time or lower treatment temperature than those of the non-transformed plants (Table 3). Above results indicated that the cold-tolerance ability of the transgenic lines was enhanced. REC is an important physiological index reflecting the cellular function and cold-tolerance ability; cold-frozen conditions will lead REC level increase (Liu et al., 2009b; Sukumaran and Weiser, 1972; Wallis et al., 1997). In this experiment, REC determination results indicated that both transgenic lines and the non-transformed control line exhibited increased REC level after cold treatment, and that the lower the temperature, the higher the REC level increased (Fig. 9). That is to say the transgenic lines suffered much less damage than the non-transformed control line in cold stress conditions. It indirectly reflected that the cold-tolerance ability of the transgenic lines was improved to some extent, and the cold-tolerance was enhanced. LT50 is another important physiological index reflecting the cold-tolerance ability of plant, which was widely used to determine the cold-tolerance ability of plant recently in China, both in herbaceous plants and in ligneous plants (Guo et al., 2009b; Jiao and Gao, 2010; Liu et al., 2009b; Xu and Chen, 2008; Xu, et al., 2005). In this experiment, the obtained LT50 result of transgenic lines was obviously lower than that of non-transformed plant. This result indicates that the transgenic lines are of stronger cold-tolerance ability than that of non-transformed plants. Expression of AmGS gene in transgenic Photinia serrulata plants caused an increase in the transcript level (Figs. 3, 6) and the content levels of galactinol and raffinose under normal conditions (Fig. 10), which confer the cold-tolerance to transgenic Photinia serrulata plants. Further, the AmGS transcript level and the content levels of galactinol and raffinose increase significantly after cold inducement (Figs. 6, 10), which also offer stronger cold-tolerance to transgenic Photinia serrulata plants. Above results suggest that galactinol and raffinose act as osmoprotectants under cold stress conditions.
J. Song et al. / Gene 513 (2013) 118–127
125
Fig. 8. Cold-tolerance assay of transgenic Photinia serrulata plants. Pictures were taken 3 days after recovery growth in normal growing conditions.
All above cold-tolerance assay results exhibited that the coldtolerance ability of transgenic Photinia serrulata tree was significantly improved, but the transgenic Photinia serrulata trees are still not as resistant as the A. mongolicus tree. This fact suggested that the cold-tolerance of A. mongolicus tree may also be controlled by some other genes, except for the AmGS gene. Acknowledgments
Fig. 9. Electrical conductivity changes of Photinia serrulata plants after exposure at different low temperatures for 24 h.
This study was partially supported by the Science and Technology Innovation Program of Chinese Academy of Sciences (grant no. 057310A151), the Key Research Project in Science and Technology of Shandong Provence (grant no. 2010GG10009008), and the State Key Project in Development of New Plant Varieties by Gene Transformation (grant no. 2009ZX08009-100B). Authors thank professors Xiude Xu
126
J. Song et al. / Gene 513 (2013) 118–127
Fig. 10. Measurements of galactinol (A) and raffinose (B) contents. CK. Untransformed control plants; R3. Transgenic line R3; R4. Transgenic line R4. 1. Normal growing conditions; 2. Cold stress at 4 °C for 24 h, and recovery at normal growing conditions for 3 h.
from Liaoning Academy of Agricultural Sciences and Tianlai Li from Shenyang Agricultural University for their help in the measurements of galactinol and raffinose contents. References Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K., 2003. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15, 63–78. Bachmann, M., Matile, P., Keller, F., 1994. Metabolism of the raffinose family oligosaccharides in leaves of Ajuga reptans L. Cold acclimation, translocation, sink to source transition: discovery of chain elongation enzyme. Plant Physiol. 105, 1335–1345. Cao, P.X., et al., 2009. Characterization of multiple cold induced genes from Ammopiptanthus mongolicus and functional analyses of gene AmEBP1. Plant Mol. Biol. 69, 529–539. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Fan, Y., Liu, B., Wang, H., Wang, S., Wang, J., 2002. Cloning of an antifreeze protein gene from carrot and its influence on cold tolerance in transgenic tobacco plant. Plant Cell Rep. 21, 296–301. Fei, Y.B., Sun, L.H., Huang, T., Shu, N.H., Gao, S.Q., Jian, L.C., 1994. Isolation and identification of antifreeze protein with high activity in Ammopiptanthus mongolicus. Acta Bot. Sin. 36, 649–650. Fei, Y.B., et al., 2008. Purification and structure analysis of antifreeze proteins from Ammopiptanthus mongolicus. Prep. Biochem. Biotechnol. 38 (2), 172–183. Gai, J.Y., 2000. Statistics for Experiments. China Agricultural Press, Beijing, pp. 56–59 (in Chinese). Gamboa, M.C., Rasmussen-Poblete, S., Valenzuela, P.D.T., Krauskopf, E., 2007. Isolation and characterization of a cDNA encoding a CBF transcription factor from E. globulus. Plant Physiol. Biochem. 45, 1–5. Gilmour, S.J., Sebolt, A.M., Salazar, M.P., Everard, J.D., Thomashow, M.F., 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124, 1854–1865. Guo, X.H., et al., 2009a. A ThCAP gene from Tamarix hispida confers cold tolerance in transgenic Populus (P. davidiana × P. bolleana). Biotechnol. Lett. 31, 1079–1087. Guo, W.D., Zhang, Z.Z., Jiang, X.W., Chen, M.G., Zheng, J.S., Chen, W.R., 2009b. Semi lethal temperature of fingered citron (Citrusmedica var sarcodactylis Swingle) under low temperature stress and evaluation on their cold resistance. Acta Horticult. Sin. 36, 81–86 (in Chinese with English abstract).
Guo, L.L., Yu, Y.H., Xia, X.L., Yin, W.L., 2010. Identification and functional characterization of the promoter of the calcium sensor gene CBL1 from the xerophyte of Ammopiptanthus mongolicus. BMC Plant Biol. 10, 18–34. Hao, J.H., Li, T.L., Meng, S.D., Zhao, B., Sun, L.P., 2009. Effects of night low temperature on sugar accumulation and sugar-metabolizing enzyme activities in melon fruit. Sci. Agric. Sin. 42, 3592–3599. Hinesley, L.E., Pharr, D.M., Snelling, L.K., Funderburk, S.R., 1992. Foliar raffinose and sucrose in four conifer species: relationship to seasonal temperature. J. Am. Soc. Hortic. Sci. 117, 852–855. Huang, Y.F., Wang, Q.Y., Fu, G.R., Zhao, X.X., Yang, Z.X., 1997. Expression of antifreeze protein gene (afp) in tomato. Chin. Biochem. J. 13, 418–419 (in Chinese with English abstract). Hughes, M.A., Dunn, M.A., 1996. The molecular biology of plant acclimation to low temperature. J. Exp. Bot. 47, 291–305. Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., Thomashow, M.F., 1998. Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280, 104–106. Jiang, Y., Wei, L.B., Fei, Y.B., Shu, N.H., Gao, S.Q., 1999. Purification and identification of AFPs in Ammopiptanthus mongolicus. Acta Bot. Sin. 41, 967–971. Jiao, K.B., Gao, Q.Y., 2010. Study on the semi lethal temperature for the roots of grafted grape. Heilongjiang Agric. Sci. 3, 67–68 (in Chinese with English abstract). Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., Shinozaki, K., 1999. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stressinducible transcription factor. Nat. Biotechnol. 17, 287–291. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologistcentric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lal, S., Gulyani, V., Khurana, P., 2008. Overexpression of HVA1 gene from barley generates tolerance to salinity and water stress in transgenic mulberry (Morus indica). Transgenic Res. 17, 651–663. Liu, J.J., Krenz, D.C., Galvez, A.F., Lumen, B.O., 1998a. Galactinol synthase (GolS): increased enzyme activity and levels of mRNA due to cold and desiccation. Plant Sci. 134, 11–20. Liu, Q., et al., 1998b. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in droughtand low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 1391–1406. Liu, M.Q., Shen, X., Yin, W.L., Lu, C.F., 2005. Functional analysis of cold-inducible cDNA clones in the legume Ammopiptanthus mongolicus. Cryoletters 26, 213–222. Liu, M.Q., Lu, C.F., Shen, X., Yin, W.L., 2006. Characterization and function analysis of a cold-induced AmCIP gene encoding a dehydrin-like protein in Ammopiptanthus mongolicus. Mitochondrion 17, 342–349. Liu, J., et al., 2009a. Establishment of the efficient transformation system for AmGS gene transforming into Photinia serrulata tree. J. Shandong Agric. Univ. 40, 191–194. Liu, J., Xiang, D.Y., Chen, J.B., Zhan, W., 2009b. Determination of the LT50 of three Eucalyptus seedling with electrical conductivity method and Logistic equation. Guangxi For. Sci. 38, 75–79 (in Chinese with English abstract). Nishizawa, A., Yabuta, Y., Shigeoka, S., 2008. Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol. 147, 1251–1263. Panikulangara, T.J., Eggers-Schumacher, G., Wunderlich, M., Stransky, H., Scho¨ffl, F., 2004. Galactinol synthase1. A novel heat shock factor target gene responsible for heat-Induced synthesis of raffinose family oligosaccharides in Arabidopsis. Plant Physiol. 136, 3148–3158. Sage, R.F., 2002. Variation in the kcat of Rubiscoin C3 and C4 plants and some implications for photosynthetic performance at high and low temperature. J. Exp. Bot. 53, 609–620. Salvucci, M.E., Crafts-Brandner, S.J., 2004. Relationship between the heat tolerance of photosynthesis and the thermal stability of Rubiscoactivase in plants from contrasting thermal environments. Plant Physiol. 134, 1460–1470. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, New York, pp. 9.31–9.58. Shinozaki, K., Yamaguchi-Shinozaki, K., 1996. Molecular responses to drought and cold stress. Curr. Opin. Biotechnol. 7, 161–167. Sprenger, N., Keller, F., 2000. Allocation of raffiose family oligosaccharides to transport and storage pools in Ajuga repants: the role of two distinct galactinol synthases. Plant J. 21, 249–258. Sukumaran, N.P., Weiser, C.J., 1972. An excised leaflet test for evaluating potato frost tolerance. Hortic. Sci. 1972, 467–468. Taji, T., et al., 2002. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana. Plant J. 29, 417–426. Takanashi, K., et al., 2008. Galactinol synthase gene of Coptis japonica is involved in berberine tolerance. Biosci. Biotechnol. Biochem. 72, 398–405. Thomashow, M.F., 1998. Role of cold-responsive genes in plant freezing tolerance. Plant Physiol. 118, 1–8. Thomashow, M.F., 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 571–599. Urao, T., Yamaguchi-Shinozaki, K., Urao, S., Shinozaki, K., 1993. An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5, 1529–1539. Vos, P., et al., 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. Wallis, J.G., Wave, H.Y., Guerra, D.J., 1997. Expression of a synthetic antifreeze protein in potato reduces electrolyte release at freezing temperature. Plant Mol. Biol. 35, 323–330. Wang, Z., et al., 2009. A WRKY transcription factor participates in dehydration tolerance in Boea hygrometrica by binding to the W-box elements of the galactinol synthase (BhGolS1) promoter. Planta 230, 1155–1166.
J. Song et al. / Gene 513 (2013) 118–127 Wei, L.B., Jiang, Y., Shu, N.H., Gao, S.Q., Fei, Y.B., 1999. Biological characterization of heat-stable antifreeze proteins from leaves of Ammopiptanthus mongolicus. Acta Bot. Sin. 41, 837–841. Welling, A., Palva, E.T., 2008. Involvement of CBF transcription factors in winter hardiness in birch. Plant Physiol. 147, 1199–1211. Welling, A., Moritz, T., Palva, E.T., Junttila, O., 2002. Independent activation of cold acclimation by low temperature and short photoperiod in hybrid aspen. Plant Physiol. 129, 1633–1641.
127
Worrall, D., et al., 1968. A carrot leucine-rich-repeat protein that inhibits ice recrystallization. Science 282, 115–117. Xu, Y., Chen, F.D., 2008. The LT50 and cold tolerance adaptability of chrythemumsan during a natural drop in temperature. Acta Horticult. Sin. 35, 559–564 (in Chinese with English abstract). Xu, K., Xia, Y.P., Xu, B.Y., Lin, T., Yang, X., 2005. Measurement of cold tolerance based on REC and the Logistic equation in Camellia hiemalis ‘Shishi Gashira’. Acta Horticult. Sin. 32, 145–150 (in Chinese with English abstract).
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Cloning of galactinol synthase gene from Ammopiptanthus mongolicus and its expression in transgenic Photinia serrulata plants Jian Song a, c, 1, Jing Liu b, 1, Manli Weng a, Yanyan Huang b, Lei Luo b, Pengxiu Cao a, Haiwei Sun b, c, Jie Liu d, Jinhong Zhao b, Dianqi Feng b,⁎, Bin Wang a,⁎ a
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 100101, China Taishan Branch of Shandong Academy of Forestry Sciences, Taian 271000, China Shandong Agricultural University, Taian 271018, China d Department of Bioengineering and Biotechnology, College of Chemical Engineering, Qingdao University of Science and Technology, Qingdao 266042, China b c
a r t i c l e
i n f o
Article history: Accepted 8 October 2012 Available online 29 October 2012 Keywords: Cold-tolerance gene of tree Galactinol synthase gene of Ammopiptanthus mongolicus (AmGS) Transgenic ligneous plant
a b s t r a c t A cold induced galactinol synthase gene (AmGS) and its promoter sequence were identified and cloned from the cold-tolerant tree Ammopiptanthus mongolicus by using cDNA-AFLP, RACE-PCR and TAIL-PCR strategies combined with its expression pattern analysis after cold inducing treatment. Accession number of the AmGS gene in GenBank is DQ519361. The open reading frame (ORF) region of the AmGS gene is 987 nucleotides encoding for 328 amino acid residues and a stop codon. The genomic DNA sequence of AmGS gene contains 3 exons and 2 introns. Moreover, a variety of temporal gene expression patterns of AmGS was detected, which revealed the up-regulation of AmGS gene in stresses of cold, ABA and others. Then the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated transformation, and the transgenic plants exhibited higher cold-tolerance comparing with non-transformed plants. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Low temperature is one of the most common environmental stresses for plants and potentially causes severe loss to both agriculture and pomiculture. Adaptation to winter changes in a low temperature is a precondition for ligneous plant survival in temperate and boreal vegetation zones. Many plants can increase their cold-tolerance in response to low temperature conditions (Sage, 2002; Salvucci and Crafts-Brandner, 2004; Shinozaki and Yamaguchi-Shinozaki, 1996; Thomashow, 1998). The ligneous plants developed more effective strategies for cold adaptation than herbaceous plants, because ligneous plants have to live in the same place for their whole life-period. And changes in cold-tolerance gene expression in various plants were suggested to be associated with this process (Hughes and Dunn, 1996; Thomashow, 1999). Many genes related to cold-tolerance have been cloned from many kinds of plants, some were from ligneous plants (Cao et al., 2009; Gamboa et al., 2007; Guo et al., 2010; Lal et al., 2008; Liu et al., 2005, 2006; Welling and Palva, 2008), but only a few of them has been successfully transformed and expressed in ligneous plants. Considering the facts that the ligneous Abbreviations: AFLP, Amplified fragments length polymorphism; EB, Ethidium bromide; EC, Electrical conductivity; GS, Galactinol synthase; LT50, Semi-lethal temperature; ORF, Open reading frame; RACE, Rapid amplification of cDNA ends; REC, Relative electrical conductivity; TAIL-PCR, Thermal asymmetric interlaced PCR; TDF, Transcript-derived fragment. ⁎ Corresponding authors. Tel.: +86 10 64806544; fax: +86 10 64873428. E-mail address: [email protected] (B. Wang). 1 These authors contributed equally to this paper. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2012.10.058
plants have evolved cold-tolerance capacity in winter, together with similar lignified structures and winter adaptive mechanisms, it is more likely to find strong cold-tolerance gene from ligneous plants growing in temperate and arctic regions (Welling et al., 2002). It is believed that this kind of cold-tolerance gene should express more easily and effectively when transformed into ligneous plants. Previous research results indicated that cold-tolerance genes from fishes, insects and herbaceous plants have been successfully transformed and expressed in herbaceous plants, and the transgenic plants exhibited increased a cold-tolerance capacity (Fan et al., 2002; Huang et al., 1997; Wallis et al., 1997; Worrall et al., 1968). Only one paper (Cao et al., 2009) reported that a cold-tolerance gene AmEBP1 cloned from ligneous plant Ammopiptanthus mongolicus (A. mongolicus) was successfully transformed and expressed in herbaceous plant, Arabidopsis thaliana, but not in ligneous plant yet. Galactinol is the galactosyl donor for the synthesis of raffinose family oligosaccharides (RFOs) and its synthesis by galactinol synthase (GS) is the first committed step of the RFOs biosynthetic pathway. During cold acclimation, RFO accumulation was found in the frost-hardy plant, Ajuga reptans (Bachmann et al., 1994) and pine needles (Hinesley et al., 1992). GS genes are induced by a variety of stresses in both stress-sensitive and tolerant-plant species (Wang et al., 2009). Galactinol and raffinose scavenge hydroxyl radicals as a novel function to protect plant cells from oxidative damage caused by methylviologen (MV) treatment, salinity, or chilling. High intracellular levels of galactinol and raffinose in the transgenic Arabidopsis plants were correlated with increased tolerance to MV treatment and salinity or chilling stress (Nishizawa et al., 2008).
J. Song et al. / Gene 513 (2013) 118–127
GS genes are found in diverse plant species and associated with multiple developmental and environmental responses (Wang et al., 2009). For example, in common bugle (Ajuga reptans), two distinct cold inducible GS genes were transcribed in discrete locations (GS-1 in mesophyll cells and GS-2 in companion cells of the phloem) (Sprenger and Keller, 2000). Seven GS genes were identified in Arabidopsis thaliana, and AtGS3 was induced only during cold stress (Nishizawa et al., 2008; Taji et al., 2002). A. mongolicus is the only evergreen broadleaf shrub endemic to the Alashan desert, northwest sandy area of China and it can survive at − 30 °C or an even lower temperature in winter. It is believed that A. mongolicus is an important germplasm containing cold-tolerance genes (Fei et al., 1994; Jiang et al., 1999; Wei et al., 1999). Recently our laboratory identified some up-regulated factors from A. mongolicus tree induced by cold treatment (Fei et al., 2008), one of them has been cloned and named as AmEBP1 (Cao et al., 2009). The objective of this study is to clone another cold-tolerance gene from the cold-tolerance tree A. mongolicus and to express it in ligneous plants. 2. Materials and methods 2.1. Plant materials Seeds of A. mongolicus were germinated in soil at 25 °C with 14 h daylight conditions. After the seedlings had grown to the 12-leaf stage (about 6 weeks), the young plants were treated in 0 °C for 36 h. Then leaves collected from cold treated and untreated young plants were used for DNA and RNA preparations. 2.2. DNA and RNA preparation DNA was isolated from leaves of A. mongolicus as described by Liu et al. (2009a). Total RNA was extracted by guanidinium thiocyanate (GT) method as reported (Chomczynski and Sacchi, 1987). 2.3. Generation of cDNA and cDNA-AFLP analysis With total RNA isolated from A. mongolicus as template, double-strand cDNA was synthesized using the M-MLV cDNA Synthesis System (Promega) and following the provided protocol. The synthesized cDNA was then used as template for AFLP analysis. cDNA-AFLP analysis was performed according to the reported method (Vos et al., 1995). 2.4. RACE-PCR and the establishment of the full-length cDNA of the AmGS gene RACE-PCR was processed to obtain the 3′end and 5′end of the cDNA sequence of AmGS gene using the SmartRace kit (Clonetech). Four gene-specific primers (5′GSP, 5′NGSP, 3′GSP, 3′NGSP; Table 1) were used, which were developed based on the conserved nucleotide sequence of reported GS genes. The RACE-PCR products were analyzed on 1.2% (w/v) agarose gels, purified, and cloned into the pBS-T vector (Tiangen Biotech), and sequenced (Sunbiotech, Beijing). After the complete sequences of the 5′-end and the 3′-end were obtained, the full cDNA length of AmGS gene was established by assembling analysis. 2.5. Real time PCR Real time PCR was performed in expression pattern analysis of the AmGS gene after cold inducement and in molecular identification of the transgenic plants. The following primers were used to amplify the AmGS gene (forward primer: AmGS-RT-F, reverse primer: AmGS-RT-R; Table 1). The following primers were used to amplify the internal control gene AmActin (forward primer: AmActin-F, reverse primer: AmActin-R; Table 1). Real time PCR was performed with the Chromo4 Real Time PCR Instrument (MJ). The total volume of PCR is 20 μL, containing
119
Table 1 Primers used in this study. Primer
Sequences (5′–3′)
5′GSP ′´NGSP 3′GSP 3′NGSP AmGS-F AmGS-R AmGs-RT-F AmGs-RT-R AmActin-F AmActin-R AmGS-Chr-F AmGS-Chr-R AmGS-vector-F AmGS-vector-R
ATCTTGCTGTACTCCACAAACTCCCAA TGGTTCTCAGGTGGGTACACTGGCTCA TGTGGCGTCACCCTGAGAATGTTGA TGGAGGTACACTGGGAAAGAGGAGAAT TCA TGG CAC CTG ATA TCA CCA CCG CT TAT TAG GCA GCG GAT GGG GCG GGA A TGTGAAGAAGTGGTGGGACA CCCAAAACGAAAAGGAAATG GGTAACATTGTGCTCAGTGGTGG CTCGGCCTTGGAGATCCACATC CACTGAAATCATGGCACCTG CCCAAAACGAAAAGGAAATG GCTCTAGAGCCACTGAAATCATGGCACCTG ACGCGTCGACGTCGCCCAAAACGAAAAGGAAATG
2.0 μL 10× PCR buffer (final concentration of 2 mmol/L MgCl2), 0.5× SYBR-Green I deoxyribonucleoside triphosphates (Light Cycler DNA master SYBR Green I, Roche Molecular Biochemicals), 0.4 mmol/L dNTP, 1 U Taq DNA polymerase, 2.0 μL primers (final concentration of each primer:0.5 μmol/L), and 6 μL 20× diluted cDNA as template. The protocol of Real time PCR reactions was composed of an initial denaturation cycle (94 °C for 3 min); 39 amplification cycles including denaturation (94 °C for 45 s), annealing (60 °C for 1 min), and extension (72 °C for 2 min); together with a final extension cycle (72 °C for 10 min). After the completion of PCR amplification, a melting curve analysis was performed. The cycle number at which the amplification plot crosses a fixed threshold above baseline was defined as the threshold cycle (Ct). AmGS gene expression was normalized to the internal control gene AmActin given by the formula 2-ΔCt. ΔCt is the Ct of AmGS gene subtracted from the Ct of the AmActin gene. 2.6. Generation of the genomic sequence and promoter of AmGS gene Based on the complete cDNA sequence of AmGS gene, the complete genomic sequence of AmGS gene was obtained by PCR amplification using the Lar Taq polymerase (TaKaRa Biotechnology Co., Ltd. Dalian) with the follow primers (forward primer: AmGS-Chr-F, reverse primer: AmGS-Chr-R, Table 1). To obtain the promoter sequence of the AmGS gene, thermal asymmetric interlaced PCR (TAIL-PCR) was performed following the reported method (Liu et al., 2009a) with A. mongolicus genomic DNA as template. 2.7. Alignment, phylogenetic analysis and motif detection The amino acid sequences of GS metabolic enzymes in Arabidopsis, rice and maize were aligned using the ClustalW tool (http://www.ebi. ac.uk/ Tools/ clustalw2/index.html). The multiple alignments resulted in an unrooted distance tree using Neighbor-Joining algorithms of MEGA version 4 (Kumar et al., 2008). And the reliability of the tree was examined by bootstrap analyses (1000 replicates). 2.8. Photinia serrulata transformation Agrobacteriun-mediated transformation in Photinia serrulata was carried out according to our previous report (Liu et al., 2009a) with minor modifications. The brief procedure is as follows: For infection, the stemlets of young plants were immersed in Agrobacteriun suspension (OD600 value is around 0.4) containing kanamycin (30 mg/L) for 10 minutes. The infected stemlets were placed on differentiation medium (MS+6-BA 2.0 mg/L+NAA 0.1 mg/L) supplied with kanamycin (30 mg/L) and cultured for 6 days. Then they were transferred onto new MS medium supplied with kanamycin (50 mg/L) and growing until the plants reached the desired height. Regenerated kanamycin-resistant plants were transferred onto rooting medium (1/2 MS+NAA 0.3 mg/L) supplied with the same
120
J. Song et al. / Gene 513 (2013) 118–127
concentration of kanamycin. The obtained transgenic plants were propagated by cuttage. 2.9. Molecular characterization of the AmGS transgenic plants Molecular characterization of the AmGS transgenic plants includes PCR, Southern hybridization and RT-PCR analyses. 2.10. PCR identification In all of the PCR identifications, genomic DNA was extracted from leaves of young plants and amplified with primers AmGS-F and AmGS-R (Table 1). PCR reactions were performed in MJ-100 PCR machine (USA). The total volume of PCR reaction mixture was 25 μL containing 2.5 μL 10× PCR buffer, 30 ng of template DNA, 0.2 μmol/L of each primer set, 2 mmol/L MgCl2, 0.4 mmol/L dNTP, and 1 U Taq DNA polymerase. The reaction was performed at 94 °C for 4 min, and then subjected to 35 cycles of 94 °C for 45 s, 55 °C for 45 s, and 72 °C for 1 min, plus a final extension at 72 °C for 5 min. The PCR products were then separated on 1% agarose gel and visualized by ethidium bromide (EB) staining. 2.11. Southern hybridization Southern hybridization was performed as described by Sambrook et al. (1989). 2.12. Cold-tolerance assay of transgenic Photinia serrulata plants Transgenic Photinia serrulata lines and the non-transformed Photinia serrulata plants were treated at 0 °C and −6 °C for 6, 12, 24 and 36 h respectively. Their cold-tolerances were observed and their survival rates were measured 2 days after the end of cold treatment. 2.13. Relative electrical conductivity determination Relative electrical conductivity (REC) of young leaves was determined after cold inducement according to the reported method (Liu et al., 2009b; Sukumaran and Weiser, 1972) with minor modifications. The main procedure is as follows: Plants were treated at 0 °C, − 4 °C, − 8 °C, −12 °C and −16 °C for 24 h, respectively. After cold treatment, three young leaves were collected from each line (as 3 repeats), washed with distilled water for three times. Water was absorbed with filter paper. From each leaf, 1 g of tissue was taken and put into a 50 mL flask, put in 4 °C overnight. The next morning, 30 mL ion-free water was added to each flask. Then, the flasks were put at room-temperature for 15 h. Then electrical conductivity (EC1) was measured with an electrical conductivity detector (Shanghai Kangyi, Model DDS-320). The flasks were set in boiling water for 15 min. After cooling down to room-temperature, electrical conductivity (EC2) was measured. The relative electrical conductivity (REC) was calculated as follows: REC = EC1/EC2× 100% (Liu et al., 2009b; Sukumaran and Weiser, 1972). 2.14. Determination of LT50 Semi lethal temperature (LT50) was calculated according to the formula LT50 = ln(1/a)/b (Gai, 2000) based on the REC data with the Logistic equation (y = k/(1 + a e −b x ). In the equation, y is the REC and x is the temperature for cold treatment. k, a, b are parameters, k is the maximum limiting value of y; b reflects the corresponding relationship between x and y; a represents the relative position of the curve to the origin. k, a and b were calculated by fitting REC curve with Logistic equation in DPS V7.05 software.
2.15. Measurements of galactinol and raffinose contents Galactinol and raffinose were extracted and analyzed by HPLC as described by Hao et al. (2009). The content level was expressed by mg g −1 FW (fresh weight). Briefly as follows: Ten grams of fresh leaf tissue was ground to fine powder in liquid nitrogen and then homogenized with 10 mL of 80% (v/v) ethanol using a pre-cold mortar and pestle. The homogenate was set for 60 min at 80 °C and then centrifuged for 5 min at 10,000 g; the supernatant was extracted twice with 1 mL of 80% ethanol at 80 °C. The extracts were filtered through a 0.45 μm membrane, and then analyzed by high performance HPLC with Sigma products galactinol and raffinose as standards respectively. The significance of differences between data sets was evaluated by t test. Data analysis and calculation were carried out with Waters Millennium software.
3. Results 3.1. Cloning of the full length cDNA and analysis of the AmGS gene In order to obtain the genes that play protective role in cold conditions in A. mongolicus tree, we analyzed the differential expressed transcripts via cDNA-AFLP analysis. The transcript-derived fragments (TDFs) were identified in cold-induced leaves of A. mongolicus. Among them, a specific amplification fragment, TDF Am248766 was identified to be elevated in abundance after cold-treatment. Based on the sequence of TDF Am248766, RACE-PCR was carried out to obtain the full-length cDNA sequence of the corresponding gene. The generated fragment was 1249 bp in length with an open reading frame (ORF) of 987 bp flanked by 98 bp 5′-untranslated region (UTR) and 164 bp 3′-UTR. It was registered in GenBank with accession no. DQ519361, the corresponding cold-tolerance gene was named AmGolS, and briefly called AmGS (Fig. 1). The AmGS gene encoded protein was named AmGS with accession no. ABF66656. AmGS shows high identities to the homologies from herbaceous plants (Fig. 2). AmGS shows the highest identity (85%) with GmGS from Glycine max (accession no. AAM96867). Additionally, AmGS shows 74%, 73%, 68% identities to well-documented AtGS1, AtGS2 and AtGS3 from Arabidopsis thaliana (accession nos. BAB78530, BAB78531, BAB78532), respectively. AmGS contains 328-aa with an estimated molecular mass of 37.6 kDa and a PI of 5.26. Using the BLAST Network Service (NCBI, National Center for Biotechnology Information), it is revealed that AmGS comprises several domains including glycosyl transferase (Glycos_transf_2), glycosyl transferase family 8 (Glyco_transf_8), galactosyl transferase GMA12/MNN10 family (Glyco_transf_34) and UDP-glucose: Glycoprotein glucosyltransferase (UDP-g_GGTase) domains, as are found in its homologies. All the above suggested that AmGS may function as a cold-induced GS, which is important for A. mongolicus in cold accumulation.
3.2. Expression pattern analysis of AmGS gene under cold conditions by real-time RT-PCR In order to invest the expression of AmGS under cold stress conditions, real-time RT-PCR was carried out in 6-week-old axenic seedlings. As shown in Fig. 3A, the transcripts of AmGS started to increase from 12 h after cold stress, and became obvious 24 h after cold stress, and increased by 7 folds and stop increasing at the 48 h time-point. The result showed that it is a late-responsive gene, as AtGS3 in Arabidopsis (Taji et al., 2002). In addition, the expression pattern of AmGS in A. mongolicus was investigated when treated by drought, NaCl and a stress hormone ABA. As shown in Fig. 3B, AmGS was induced about 3, 4, and 5 folds increase respectively by drought, high salinity and ABA.
J. Song et al. / Gene 513 (2013) 118–127
121
Fig. 1. The coding sequence and its deduced amino acid sequence of the AmGS gene.
3.3. Genomic sequence and promoter sequence of AmGS gene
Fig. 2. Phylogenetic analysis of the reported GS proteins by using MEGA4 Neighbor-Joining. ArGS from Ajuga reptans (accession no. CAB51533), GmGS from Glycine max (accession no. AAM96867), MsGS from Medicago sativa (accession no. AAM97493), AtGS1, AtGS2, and AtGS3 from Arabidopsis thaliana (accession nos. BAB78530, BAB78531, BAB78532), BnGS from Brassica napus (accession no. AAD26116) and PsGS from Pisum sativum (accession no. CAB51130), respectively.
Genomic sequence of AmGS gene with 1637 nucleotides was obtained and registered in GenBank with the accession no. DQ519361. Comparison of the cDNA and genomic sequences showed that AmGS gene comprises 3 exons and 2 introns. And the amino acid sequence of AmGS showed high homology with that of GmGS (Glycine max, accession no. AAM96867) and MsGS (Medicago sativa, accession no. AAM97493) (Fig. 2). The promoter sequence with 487 nucleotides upstream to the start codon of AmGS gene (bankit 898227) was obtained by TAIL-PCR. The promoter sequence was analyzed for potential transcriptional regulatory elements and binding sites of various transcription factors using A Database of Plant Cis-acting Regulatory DNA Elements (PLACE) program. Several stress-associated elements were found (Table 2), such as DPBFCOREDCDC3, MYB2CONSENSUSAT, and MYCCONSENSUSAT. DPBFCOREDCDC3 is the binding site of a novel class of a Basic Region
122
J. Song et al. / Gene 513 (2013) 118–127
under the control of 35S promoter of cauliflower mosaic virus (Fig. 4). The generated plant expression vector was named pCAMBIA2300-AmGS (Fig. 4). Then pCAMBIA2300-AmGS was transformed into Agrobacterium strain LBA4404. The obtained Agrobacterium strain was named as LBA4404-pCAMBIA2300-AmGS, which was used to transform Photinia serrulata tree. 3.5. Photinia serrulata transformation experiments For functional identification purposes, the AmGS gene was transformed into Photinia serrulata tree by Agrobacterium-mediated method. More than 30 transformants were obtained after kanamycin selection. Further PCR identification indicated that 22 of them gave PCR positive results. PCR identification result of partial transformants was shown in Fig. 5-A. After 3 times subculture (propagated by cottage) and molecular identification, two relative stable transgenic lines (R3 and R5) were obtained. 3.6. Molecular characterization of the transgenic plants Fig. 3. Transcriptional expression pattern of AmGS gene under various stresses determined by Real-time RT-PCR. Six-week-old Axenic seedlings were used as materials. A: Temporal expression of AmGS under old treatment (4 °C). B: Transcriptional expression pattern of AmGS under treatment of drought, NaCl and ABA, with seedlings treated by water as control.
Leucine Zipper Protein (bZIP) transcription factors, such as ABI5, DPBF-1 and DPBF-2 (Dc3 promoter-binding factor-1 and 2), which is associated with the stress hormone, ABA, and responses by regulation of downstream gene expression. MYB2CONSENSUSAT is the recognition and binding site of MYB transcription factors, and is found in the promoters of the dehydration-responsive gene RD22 and many other genes in Arabidopsis, thus regulates dehydration response and ABA signaling. MYCCONSENSUSAT site CANNTG (N= A/T/G/C) is the recognition and binding site of ICE1 (inducer of CBF expression) that regulates the transcription of CBF/DREB1 genes in cold conditions. It also exists in the cis-control region of numerous genes regulated by dehydration (Abe et al., 2003). 3.4. Construction of plant expression vector pCAMBIA2300-AmGS The coding region of AmGS gene was amplified from cDNA of A. mongolicus using the following two specific primer-pairs containing XbaI and SalI restriction sites: (forward primer: AmGS-vector-F, reverse primer: AmGS-vector-R; Table 1). The validated PCR fragment was inserted into corresponding restriction sites of the vector pCAMBIA2300 Table 2 Potential cis-acting elements and binding sites for transcription factors in the AmGS gene promoter. Abbreviation
Function
Sequence
Position
CBFHV (CBF) DPBFCOREDCDC3 (DPB) GT1GMSCAM4 (GT1)
Binding site of CBFs in barley Binding sites of bZIP associated with ABA response Regulation of pathogen- and salt-induced expression of SCaM-4 gene MYB recognition site in the promoters of the dehydration-responsive genes Dehydration and ABA response of RD22, bound by MYC Binding site of ICE1 in CBF3 promoter; MYC recognition site in the promoters of the dehydration-responsive gene
RYCGAC ACACNNG
−79 −380
GAAAAA
−370
YAACKG
−268 −319
CACATG
−380
CANNTG
−206 −380
MYB2CONSENSUSAT (MYB2) MYCATRD22 (MYC1) MYCCONSENSUSAT (MYC2)
K = G/T, N = A/C/G/T, Y = C/T.
The two transgenic lines R3 and R5 together with the nontransformed plants were identified by PCR, Southern hybridization and RT-PCR analyses,respectively. The experiments were repeated for other 2 times. The two transgenic lines gave positive results in PCR (Fig. 5-A), Southern hybridization (Fig. 5-B) and RT-PCR (Fig. 5-C). These results indicated that the AmGS gene has integrated into the genomic DNA sequence of the transgenic Photinia serrulata plants and expressed at least in transcriptional level. In order to know the differential expression of the AmGS gene in different tissues of the transgenic Photinia serrulata plants, RT-PCR analysis was carried out with materials from roots, stems and leaves. Results indicated that the AmGS gene expressed in roots, stems and leaves. The expression in leaves and stems is much stranger than that in roots (Fig. 6). The summary results obtained at different stages of the whole transformation process were shown in Fig. 7. 3.7. Cold-tolerance assay of transgenic Photinia serrulata plants The two transgenic lines, R3 and R5 together with the nontransformed plants, were subjected to cold-tolerance assay at 0 °C and − 6 °C for different hours (the 2 temperatures were determined from serial pre-assays,data were not shown here). Results were shown in Table 3 and Fig. 8, respectively, which indicated that the non-transformed Photinia serrulata plants were harmed slightly when treated at 0 °C for 6 h, and serious harmed when treated at 0 °C for 12 h, but the transgenic Photinia serrulata plants were not harmed until at 0 °C for 24 h. When treated with lower temperature, −6 °C, non-transformed Photinia serrulata plants were serious harmed when treated for 6 h, and died when treated for 12 h. While the transgenic Photinia serrulata plants were not harmed until treated for 12 h. These results strongly support that the expression of AmGS gene increases the cold-tolerance of the transgenic Photinia serrulata plants. 3.8. REC and LT50 determinations Fig. 9 showed the REC changes of the Photinia serrulata plants after cold treatment. Results indicated that after cold inducement, the REC level of all plants increased distinctly. But the increasing level of transgenic plants was obviously lower than that of control plants. Based on above REC data, the LT50 values were calculated, it is − 8.62 °C for non-transformed Photinia serrulata (CK), − 11.67 °C and −12.32 °C for the transgenic Photinia serrulata line R3 and R5, respectively.
J. Song et al. / Gene 513 (2013) 118–127
123
Fig. 4. Structure map of the plant expression framework of pCAMBIA2300-AmGS.
3.9. Measurements of galactinol and raffinose contents Plants of transgenic lines (R3 and R5) and the non-transformed control plants were treated at 4 °C for 24 h. Then set at normal conditions for 3 h for recovery. Leaves were collected and used as experimental materials for galactinol and raffinose content measurements. Results shown in Fig. 10 indicated that in normal conditions neither galactinol nor raffinose was detectable, but they were detected obviously in transgenic plants. That is resulted from the expression of the transformed AmGS gene; and that in cold-stress, there were low contents of endogenous galactinol and raffinose were found in untransformed control plants, but the levels were much lower than that of the transgenic plants. 4. Discussion GS is a key enzyme in the RFO biosynthetic pathway. This protein functions as galactosyl transferase, which catalyzes the key regulatory reaction utilizing UDP-galactose and myo-inositol as substrates to form galactinol and UDP. Galactinol is the galactosyl donor in the synthesis of raffinose and stachyose. GS genes have been identified as stress responsive genes in many plant species (Takanashi et al., 2008). In previous study, cold-tolerance genes have been cloned from microorganism, insect, fish and some herbaceous plants, some of them have been successfully transformed and expressed in some herbaceous plants (Fan et al., 2002; Huang et al., 1997; Wallis et al., 1997; Worrall et al., 1968). Regarding the cloning of cold-tolerance gene from ligneous plant and its successful transformation and expression in other ligneous
Fig. 5. Molecular identification of the transgenic plants. A: PCR identification. M. DNA marker (DL2000); CK1 (Positive control), pCAMBIA2300-AmGS; 1–8. Transgenic plants; CK2 (Negative control), non-transformed plant. Arrow indicates the specific PCR product. B: Southern hybridization. M. DNA marker (DL2000); 1. Positive control, pCAMBIA2300-AmGS; 2–9. Transgenic plants No. 1–8. C: RT-PCR analysis. 1. Transgenic line R3; 2. Transgenic line R5. R. Root; S. Stem; L. Leaf.
plant, it has only one report (Guo et al., 2009a). This paper reported the cloning of cold-tolerance AmGS gene from ligneous plant A. mongolicus tree and its successful expressed in transgenic Photinia serrulata tree. A. mongolicus, a kind of leguminous shrub coming from the Third Age. Now it is the only evergreen broadleaf shrub endemic to the Alashan desert, northwest sandy area of China. During the long history living in the cold conditions, A. mongolicus developed strong cold-tolerance ability and effective cold-tolerance strategies. It can survive at −30 °C or an even lower temperature in winter. Recently several papers reported the cloning of cold-tolerance genes from A. mongolicus. Liu et al. (2005, 2006) cloned a cold induced protein (CIP) gene and named it AmCIP, however, its functional identification by genetic transformation has not been reported; Cao et al. (2009) cloned the cold-tolerance gene AmEBP I and expressed it in Arabidopsis, but not in ligneous plants; Guo et al. (2010) cloned the promoter sequence of the AmCBL1 gene and expressed it in Nicotiana tabacum, but not in ligneous plants. This paper reports the cloning of AmGS gene and its promoter sequences, especially the successful expression of the AmGS gene in Photinia serrulata tree. Above results provide evidences in molecular level to support the previous ideal that A. mongolicus is an important and valuable cold-tolerance gene resource (Cao et al., 2009; Fei et al., 1994; Jiang et al., 1999; Wei et al., 1999). All of these will give great influence to the molecular research and strongly promote the study of cold-tolerance genes and the application in genetic improvement of ligneous plants. The location of Arabidopsis GS gene on chromosome 2 is adjacent to that of the gene encoding for the transcription factor ATMYB2, whose expression is induced by tolerant stress and treatment with ABA at the transcriptional level (Urao et al., 1993). Overexpression of transcription factors CBF3 (CBF: C-repeat binding factor) and CBF1 improves the tolerance to drought, high salinity and cold stresses (Jaglo-Ottosen et al.,
Fig. 6. Expression analysis by RT-PCR of AmGS gene in the transgenic lines. A: Agarose gel electrophoresis of the RT-PCR products, 1 and 2 are two repeat samples; B: Densitometry analysis of the RT-PCR products. R3: Transgenic line R3; R5: Transgenic line R5.
124
J. Song et al. / Gene 513 (2013) 118–127
Fig. 7. Summary results obtained in different stages during the transformation process. A. Agrobacterium infected stemlets were placed on differentiation medium; B. Adventitious buds were forming; C. Regenerated young plants; D. Propagation by cuttage; E. Roots are forming from young plants; F. Young plants were transferred into soil in greenhouse.
1998; Kasuga et al., 1999; Liu et al., 1998a,b), and causes accumulation of galactinol in the transgenic plants (Gilmour et al., 2000). It is noteworthy that promoter analysis of the AmGS gene indicates that several potential binding sites for CBF, MYB, MYC and bZIP transcription factors exist in the promoter of AmGS gene. As the CBF, MYB, MYC and bZIP transcription factors associate closely with dehydration and ABA responses, it was suggested that AmGS may play important protective role in other kind of stresses, in addition to cold stress. This is consistent with its up-regulation in stresses of cold, ABA and others (Fig. 3). Meanwhile, it is implicated that similar pathway about GS may be presented and activated during cold acclimation in ligneous perennial plants like that in herbaceous plant Arabidopsis thaliana (Taji et al., 2002). This result implies that ligneous plant and herbaceous plant may have some similar or commune mechanisms in their cold-tolerance response. Different gene forms were reported in plant GS gene family, for example, Arabidopsis contains 7 GS genes,among them, two were induced by drought, salt, or heat stress; one was induced by cold stress (Panikulangara et al., 2004; Taji et al., 2002). In A. mongolicus tree only one GS gene was reported, and it was induced by salt, cold stress, as Table 3 Cold-tolerance assay of the AmGS transgenic Photinia serrulata plants. Item of cold treatment
Temperature and time
Total plant number
Survival plant number
Survival rate (%)
Non-transformed plants
0 °C, 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h 0 °C 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h 0 °C, 4 h 0 °C, 12 h 0 °C, 24 h 0 °C, 36 h −6 °C, 4 h −6 °C, 12 h −6 °C, 24 h −6 °C, 36 h
25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25 25
24 14 2 0 3 2 0 0 25 25 25 24 25 24 2 0 25 25 24 23 25 24 4 1
96 56 8 0 12 8 0 0 100 100 100 96 100 96 12 0 100 100 96 92 100 96 16 4
Non-transformed plants
AmGS transgenic line R3
AmGS transgenic line R3
AmGS transgenic line R5
AmGS transgenic line R5
well as the hormone ABA stress (Fig. 3). Are there other forms of GS gene in A. mongolicus tree? And do they differentially response to different kinds of stress? These questions are not known yet, which need to be elucidated in future study. Looking at the expression pattern of AmGS gene in different tissues, the transcript amount in stem and leave is much stronger than that in root (Fig. 6). It seems reasonable, because roots are buried in soil, the effect of cold treatment become weaker and delayed. Cold-tolerance assay provided direct data reflecting the cold-tolerance ability of plant. Experimental results indicated that in the same cold treatment conditions, the transgenic plants exhibited higher survival rate than non-transformed plants; and that resulting completely death of the transgenic plants needed longer treatment time or lower treatment temperature than those of the non-transformed plants (Table 3). Above results indicated that the cold-tolerance ability of the transgenic lines was enhanced. REC is an important physiological index reflecting the cellular function and cold-tolerance ability; cold-frozen conditions will lead REC level increase (Liu et al., 2009b; Sukumaran and Weiser, 1972; Wallis et al., 1997). In this experiment, REC determination results indicated that both transgenic lines and the non-transformed control line exhibited increased REC level after cold treatment, and that the lower the temperature, the higher the REC level increased (Fig. 9). That is to say the transgenic lines suffered much less damage than the non-transformed control line in cold stress conditions. It indirectly reflected that the cold-tolerance ability of the transgenic lines was improved to some extent, and the cold-tolerance was enhanced. LT50 is another important physiological index reflecting the cold-tolerance ability of plant, which was widely used to determine the cold-tolerance ability of plant recently in China, both in herbaceous plants and in ligneous plants (Guo et al., 2009b; Jiao and Gao, 2010; Liu et al., 2009b; Xu and Chen, 2008; Xu, et al., 2005). In this experiment, the obtained LT50 result of transgenic lines was obviously lower than that of non-transformed plant. This result indicates that the transgenic lines are of stronger cold-tolerance ability than that of non-transformed plants. Expression of AmGS gene in transgenic Photinia serrulata plants caused an increase in the transcript level (Figs. 3, 6) and the content levels of galactinol and raffinose under normal conditions (Fig. 10), which confer the cold-tolerance to transgenic Photinia serrulata plants. Further, the AmGS transcript level and the content levels of galactinol and raffinose increase significantly after cold inducement (Figs. 6, 10), which also offer stronger cold-tolerance to transgenic Photinia serrulata plants. Above results suggest that galactinol and raffinose act as osmoprotectants under cold stress conditions.
J. Song et al. / Gene 513 (2013) 118–127
125
Fig. 8. Cold-tolerance assay of transgenic Photinia serrulata plants. Pictures were taken 3 days after recovery growth in normal growing conditions.
All above cold-tolerance assay results exhibited that the coldtolerance ability of transgenic Photinia serrulata tree was significantly improved, but the transgenic Photinia serrulata trees are still not as resistant as the A. mongolicus tree. This fact suggested that the cold-tolerance of A. mongolicus tree may also be controlled by some other genes, except for the AmGS gene. Acknowledgments
Fig. 9. Electrical conductivity changes of Photinia serrulata plants after exposure at different low temperatures for 24 h.
This study was partially supported by the Science and Technology Innovation Program of Chinese Academy of Sciences (grant no. 057310A151), the Key Research Project in Science and Technology of Shandong Provence (grant no. 2010GG10009008), and the State Key Project in Development of New Plant Varieties by Gene Transformation (grant no. 2009ZX08009-100B). Authors thank professors Xiude Xu
126
J. Song et al. / Gene 513 (2013) 118–127
Fig. 10. Measurements of galactinol (A) and raffinose (B) contents. CK. Untransformed control plants; R3. Transgenic line R3; R4. Transgenic line R4. 1. Normal growing conditions; 2. Cold stress at 4 °C for 24 h, and recovery at normal growing conditions for 3 h.
from Liaoning Academy of Agricultural Sciences and Tianlai Li from Shenyang Agricultural University for their help in the measurements of galactinol and raffinose contents. References Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K., 2003. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell 15, 63–78. Bachmann, M., Matile, P., Keller, F., 1994. Metabolism of the raffinose family oligosaccharides in leaves of Ajuga reptans L. Cold acclimation, translocation, sink to source transition: discovery of chain elongation enzyme. Plant Physiol. 105, 1335–1345. Cao, P.X., et al., 2009. Characterization of multiple cold induced genes from Ammopiptanthus mongolicus and functional analyses of gene AmEBP1. Plant Mol. Biol. 69, 529–539. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Fan, Y., Liu, B., Wang, H., Wang, S., Wang, J., 2002. Cloning of an antifreeze protein gene from carrot and its influence on cold tolerance in transgenic tobacco plant. Plant Cell Rep. 21, 296–301. Fei, Y.B., Sun, L.H., Huang, T., Shu, N.H., Gao, S.Q., Jian, L.C., 1994. Isolation and identification of antifreeze protein with high activity in Ammopiptanthus mongolicus. Acta Bot. Sin. 36, 649–650. Fei, Y.B., et al., 2008. Purification and structure analysis of antifreeze proteins from Ammopiptanthus mongolicus. Prep. Biochem. Biotechnol. 38 (2), 172–183. Gai, J.Y., 2000. Statistics for Experiments. China Agricultural Press, Beijing, pp. 56–59 (in Chinese). Gamboa, M.C., Rasmussen-Poblete, S., Valenzuela, P.D.T., Krauskopf, E., 2007. Isolation and characterization of a cDNA encoding a CBF transcription factor from E. globulus. Plant Physiol. Biochem. 45, 1–5. Gilmour, S.J., Sebolt, A.M., Salazar, M.P., Everard, J.D., Thomashow, M.F., 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124, 1854–1865. Guo, X.H., et al., 2009a. A ThCAP gene from Tamarix hispida confers cold tolerance in transgenic Populus (P. davidiana × P. bolleana). Biotechnol. Lett. 31, 1079–1087. Guo, W.D., Zhang, Z.Z., Jiang, X.W., Chen, M.G., Zheng, J.S., Chen, W.R., 2009b. Semi lethal temperature of fingered citron (Citrusmedica var sarcodactylis Swingle) under low temperature stress and evaluation on their cold resistance. Acta Horticult. Sin. 36, 81–86 (in Chinese with English abstract).
Guo, L.L., Yu, Y.H., Xia, X.L., Yin, W.L., 2010. Identification and functional characterization of the promoter of the calcium sensor gene CBL1 from the xerophyte of Ammopiptanthus mongolicus. BMC Plant Biol. 10, 18–34. Hao, J.H., Li, T.L., Meng, S.D., Zhao, B., Sun, L.P., 2009. Effects of night low temperature on sugar accumulation and sugar-metabolizing enzyme activities in melon fruit. Sci. Agric. Sin. 42, 3592–3599. Hinesley, L.E., Pharr, D.M., Snelling, L.K., Funderburk, S.R., 1992. Foliar raffinose and sucrose in four conifer species: relationship to seasonal temperature. J. Am. Soc. Hortic. Sci. 117, 852–855. Huang, Y.F., Wang, Q.Y., Fu, G.R., Zhao, X.X., Yang, Z.X., 1997. Expression of antifreeze protein gene (afp) in tomato. Chin. Biochem. J. 13, 418–419 (in Chinese with English abstract). Hughes, M.A., Dunn, M.A., 1996. The molecular biology of plant acclimation to low temperature. J. Exp. Bot. 47, 291–305. Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., Thomashow, M.F., 1998. Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280, 104–106. Jiang, Y., Wei, L.B., Fei, Y.B., Shu, N.H., Gao, S.Q., 1999. Purification and identification of AFPs in Ammopiptanthus mongolicus. Acta Bot. Sin. 41, 967–971. Jiao, K.B., Gao, Q.Y., 2010. Study on the semi lethal temperature for the roots of grafted grape. Heilongjiang Agric. Sci. 3, 67–68 (in Chinese with English abstract). Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., Shinozaki, K., 1999. Improving plant drought, salt, and freezing tolerance by gene transfer of a single stressinducible transcription factor. Nat. Biotechnol. 17, 287–291. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologistcentric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299–306. Lal, S., Gulyani, V., Khurana, P., 2008. Overexpression of HVA1 gene from barley generates tolerance to salinity and water stress in transgenic mulberry (Morus indica). Transgenic Res. 17, 651–663. Liu, J.J., Krenz, D.C., Galvez, A.F., Lumen, B.O., 1998a. Galactinol synthase (GolS): increased enzyme activity and levels of mRNA due to cold and desiccation. Plant Sci. 134, 11–20. Liu, Q., et al., 1998b. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in droughtand low-temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 1391–1406. Liu, M.Q., Shen, X., Yin, W.L., Lu, C.F., 2005. Functional analysis of cold-inducible cDNA clones in the legume Ammopiptanthus mongolicus. Cryoletters 26, 213–222. Liu, M.Q., Lu, C.F., Shen, X., Yin, W.L., 2006. Characterization and function analysis of a cold-induced AmCIP gene encoding a dehydrin-like protein in Ammopiptanthus mongolicus. Mitochondrion 17, 342–349. Liu, J., et al., 2009a. Establishment of the efficient transformation system for AmGS gene transforming into Photinia serrulata tree. J. Shandong Agric. Univ. 40, 191–194. Liu, J., Xiang, D.Y., Chen, J.B., Zhan, W., 2009b. Determination of the LT50 of three Eucalyptus seedling with electrical conductivity method and Logistic equation. Guangxi For. Sci. 38, 75–79 (in Chinese with English abstract). Nishizawa, A., Yabuta, Y., Shigeoka, S., 2008. Galactinol and raffinose constitute a novel function to protect plants from oxidative damage. Plant Physiol. 147, 1251–1263. Panikulangara, T.J., Eggers-Schumacher, G., Wunderlich, M., Stransky, H., Scho¨ffl, F., 2004. Galactinol synthase1. A novel heat shock factor target gene responsible for heat-Induced synthesis of raffinose family oligosaccharides in Arabidopsis. Plant Physiol. 136, 3148–3158. Sage, R.F., 2002. Variation in the kcat of Rubiscoin C3 and C4 plants and some implications for photosynthetic performance at high and low temperature. J. Exp. Bot. 53, 609–620. Salvucci, M.E., Crafts-Brandner, S.J., 2004. Relationship between the heat tolerance of photosynthesis and the thermal stability of Rubiscoactivase in plants from contrasting thermal environments. Plant Physiol. 134, 1460–1470. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning, A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, New York, pp. 9.31–9.58. Shinozaki, K., Yamaguchi-Shinozaki, K., 1996. Molecular responses to drought and cold stress. Curr. Opin. Biotechnol. 7, 161–167. Sprenger, N., Keller, F., 2000. Allocation of raffiose family oligosaccharides to transport and storage pools in Ajuga repants: the role of two distinct galactinol synthases. Plant J. 21, 249–258. Sukumaran, N.P., Weiser, C.J., 1972. An excised leaflet test for evaluating potato frost tolerance. Hortic. Sci. 1972, 467–468. Taji, T., et al., 2002. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana. Plant J. 29, 417–426. Takanashi, K., et al., 2008. Galactinol synthase gene of Coptis japonica is involved in berberine tolerance. Biosci. Biotechnol. Biochem. 72, 398–405. Thomashow, M.F., 1998. Role of cold-responsive genes in plant freezing tolerance. Plant Physiol. 118, 1–8. Thomashow, M.F., 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 571–599. Urao, T., Yamaguchi-Shinozaki, K., Urao, S., Shinozaki, K., 1993. An Arabidopsis myb homolog is induced by dehydration stress and its gene product binds to the conserved MYB recognition sequence. Plant Cell 5, 1529–1539. Vos, P., et al., 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 23, 4407–4414. Wallis, J.G., Wave, H.Y., Guerra, D.J., 1997. Expression of a synthetic antifreeze protein in potato reduces electrolyte release at freezing temperature. Plant Mol. Biol. 35, 323–330. Wang, Z., et al., 2009. A WRKY transcription factor participates in dehydration tolerance in Boea hygrometrica by binding to the W-box elements of the galactinol synthase (BhGolS1) promoter. Planta 230, 1155–1166.
J. Song et al. / Gene 513 (2013) 118–127 Wei, L.B., Jiang, Y., Shu, N.H., Gao, S.Q., Fei, Y.B., 1999. Biological characterization of heat-stable antifreeze proteins from leaves of Ammopiptanthus mongolicus. Acta Bot. Sin. 41, 837–841. Welling, A., Palva, E.T., 2008. Involvement of CBF transcription factors in winter hardiness in birch. Plant Physiol. 147, 1199–1211. Welling, A., Moritz, T., Palva, E.T., Junttila, O., 2002. Independent activation of cold acclimation by low temperature and short photoperiod in hybrid aspen. Plant Physiol. 129, 1633–1641.
127
Worrall, D., et al., 1968. A carrot leucine-rich-repeat protein that inhibits ice recrystallization. Science 282, 115–117. Xu, Y., Chen, F.D., 2008. The LT50 and cold tolerance adaptability of chrythemumsan during a natural drop in temperature. Acta Horticult. Sin. 35, 559–564 (in Chinese with English abstract). Xu, K., Xia, Y.P., Xu, B.Y., Lin, T., Yang, X., 2005. Measurement of cold tolerance based on REC and the Logistic equation in Camellia hiemalis ‘Shishi Gashira’. Acta Horticult. Sin. 32, 145–150 (in Chinese with English abstract).