Cloning of opioid receptors in common carp (Cyprinus carpio L.) and their involvement in regulation of stress and immune response

Brain, Behavior, and Immunity 23 (2009) 257–266

Contents lists available at ScienceDirect

Brain, Behavior, and Immunity journal homepage: www.elsevier.com/locate/ybrbi

Cloning of opioid receptors in common carp (Cyprinus carpio L.) and their involvement in regulation of stress and immune response Magdalena Chadzinska a,b, Trudi Hermsen a, Huub F.J. Savelkoul a, B.M. Lidy Verburg-van Kemenade a,* a b

Cell Biology & Immunology Group, Wageningen University, Marijkeweg 40, P.O. Box 338, 6700 AH Wageningen, The Netherlands Department of Evolutionary Immunobiology, Jagiellonian University, R. Ingardena 6, PL30-060 Krakow, Poland

a r t i c l e

i n f o

Article history: Received 17 July 2008 Received in revised form 9 October 2008 Accepted 9 October 2008 Available online 17 October 2008 Keywords: Opioid Opioid receptor Carp Phagocyte Inflammation Stress

a b s t r a c t In mammals opiate alkaloids and endogenous opioid peptides exert their physiological and pharmacological actions through opioid receptors (MOR, DOR and KOR) expressed not only on neuroendocrine cells but also on leukocytes. Therefore, opioids can modulate the immune response. We cloned and sequenced all three classical opioid receptors (MOR, DOR and KOR) in common carp, and studied changes in their expression during stress and immune responses. Messenger RNA of opioid receptors was constitutively expressed in brain areas, specially in the preoptic nucleus NPO (homologous to mammalian hypothalamus). After exposure to prolonged restraint stress, mRNA levels of MOR and DOR decreased in the NPO and in the head kidney. Increased expression of all studied opioid receptors was observed in the pituitary pars distalis (containing ACTH-producing cells). In immune organs, constitutive but lower expression of opioid receptor genes was observed. During in vivo zymosan-induced peritonitis or after in vitro LPS-induced stimulation, when pro-inflammatory functions are activated, expression of the OR genes in leukocytes was concomitantly up-regulated. Additionally, specific agonists of opioid receptors especially reduced leukocyte migratory properties, manifested by reduced chemotaxis and down-regulated expression of chemokine receptors. Our data indicate an evolutionary conserved role for the opioid system in maintaining a dynamic equilibrium while coping with stress and/or infection. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Opioids exert their physiological and pharmacological actions through opioid receptors (OR). They have been classified into three types of classical opioid receptors: MOR (l, mu, oprm), DOR (d, delta, oprd), KOR (j, kappa, oprk) and based on their binding affinities they may be further divided in several subtypes (Kieffer and Gaveriaux-Ruff, 2002). MOR mediates effects of morphine and endomorphins, while b-endorphin interacts with both MOR and DOR. The major endogenous cognate ligands for DOR are leu- and metenkephalin, while dynorphin is the selective agonist for KOR (Przewlocki and Przewlocka, 2005). An additional non-classical receptor with high homology to the opioid receptors: ORL-1 (opioid receptor like), has also been cloned, and nociceptin/orphanin FQ is its selective ligand (Przewlocki and Przewlocka, 2005). All opioid receptors are members of the G-protein-coupled receptor superfamily (GPCR). Lower vertebrates also regulate various responses through the opioid system and recently non-mammalian opioid receptors have been identified (e.g. Alvarez et al., 2006; Barrallo et al., 2000; Jozefowski and Plytycz, 1997).

* Corresponding author. Fax: +31 317482718. E-mail address: [email protected] (B.M. Lidy Verburg-van Kemenade). 0889-1591/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.bbi.2008.10.003

In mammals, endogenous opioid peptides are know to be elevated by both acute and chronic stress, and play an important role in attenuating and terminating the stress response (Drolet et al., 2001). Moreover, central administration of nocyceptin/orphanin FQ activates the stress axis trough ORL-1 receptor-mediated upregulation of the corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) mRNA and stimulation of corticosterone release in rats (Devine et al., 2001). Also in fish stress increases bendorphin levels in plasma (Sumpter et al., 1985; van den Burg et al., 2005). The intriguing observation that antimicrobial peptides e.g. ekelytin originate from opioid prohormones, gave rise to the hypothesis that the opioid system arose as part of the immunomodulatory system, and that its analgesic properties developed later, when pain became an alerting process (Salzet, 2001; Stefano and Salzet, 1999). Moreover, specific opioid receptors are expressed on mammalian and non-mammalian immunocytes (e.g. Jozefowski and Plytycz, 1997; Makman, 1994; Ignatowski and Bidlack 1998; Sharp et al., 1997). Initially, DOR mRNA was identified in simian peripheral blood mononuclear cells (Chuang et al., 1994), then in human T-, B-, and monocyte cell lines, in murine lymphocytic cell lines (Gaveriaux et al., 1995) and murine lymph node and splenocytes (Sharp et al., 1997). Transcripts for MOR have been identified in rat peritoneal macrophages and in human and

258

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

simian peripheral blood mononuclear cells (Sedqi et al., 1995), in human monocytes, granulocytes and CD4+ T-cells (Chuang et al., 1995). KOR mRNA was also detected in human and monkey peripheral blood lymphocytes and in immature thymic CD4-,CD8- T-cells (Chuang et al., 1994). Additionally, synthesis of opioid pro-hormones and release of opioid peptides was not only found in the neuroendocrine tissue but also in leukocytes (Brack et al., 2004; Machelska, 2007; Stein et al., 2003). Furthermore, opioids modulate the immune response. They regulate the innate response through influence on macrophage and neutrophilic granulocyte functions: phagocytosis, respiratory burst, nitric oxide (NO) and cytokine production (Eisenstein and Hilburger, 1998; Rogers and Peterson, 2003). Moreover, opioids influence specific immunity by decreasing antibody production, lymphocyte proliferation and apoptosis (Eisenstein and Hilburger, 1998). Data indicating opioid effects on the immune response of fish are limited. Both in vitro and in vivo effects of b-endorphin were described (Faisal et al., 1989; Singh and Rai, 2008; Watanuki et al., 1999, 2000). We previously showed, that morphine down-regulated gene expression of the proinflammatory cytokines: IL-1b, TNF-a, as well as the chemokines CXCa, CXCb and iNOS in LPSstimulated head kidney phagocytes of carp (Chadzinska et al., in press). Recently, we developed and characterized an inflammation model for carp (Chadzinska et al., 2008), which enables us to study in vivo effects of opioids. We found that morphine injected together with a pro-inflammatory agent, considerably reduced the numbers of inflammatory leukocytes in several fish species (Chadzinska et al., 1997, 1999, 2000, in press). We recently showed, that this decreased number of peritoneal leukocytes in morphine treated animals is substantiating due to a reduction of chemokine and chemokine receptor expression, and hypothesized heterologous desensitisation of chemoattractant receptors (Chadzinska and Plytycz 2004; Chadzinska et al., in press). In order to establish that these effects can indeed be generated via interaction with specific opioid receptors expressed on leukocytes, we now cloned and characterised the classical opioid receptors in common carp (Cyprinus carpio) and determined their tissue distribution and regulation in vivo during stress or zymosan-induced peritonitis. To determine if immune stimuli may directly affect their expression, the receptor profiles were also determined after in vitro LPS stimulation of phagocytes. Subsequently the implications of receptor function for leukocyte migration and chemokine receptor expression were addressed. 2. Methods 2.1. Animals Young individuals of common carp Cyprinus carpio L. (50–60 g b.w.), from the Department of Immunology, Polish Academy of Science, Golysz, Poland (R7W) and ‘‘De Haar Vissen” facility in Wageningen (R3R8) were reared at 20 °C in recirculating tap water (Irnazarow, 1995). All in vivo experiments were conducted according to license No. 16/OP/2001 from the Local Ethical Committee. 2.2. Identification and characterisation of carp opioid receptor genes We screened the Ensembl zebrafish genome database for MOR, DOR and KOR genes with sequences of mammalian opioid receptor genes, using the BLAST (basic local alignment search tool) algorithm. These genes were incorporated in separate multiple sequence alignments, using CLUSTALW (Chenna et al., 2003) and primers were designed in regions of high amino acid identity. Par-

tial cDNA sequences were obtained from a kZAP cDNA library of carp brain. By RACE (rapid amplification of cDNA ends; Invitrogen, Carlsbad, CA, USA) the corresponding full length sequences were obtained. PCR was carried out as previously described (Huising et al., 2004) and sequences were determined from both strands. 2.3. Bioinformatics Sequences were retrieved from Swissprot, EMBL and GenBank databases using SRS and/or BLAST (basic local alignment search tool), (Altschul et al., 1997). Multiple sequence alignments were carried out using CLUSTALW (Chenna et al., 2003). Calculation of pairwise amino acid identities was carried out using the SIM ALIGNMENT tool (Huang and Miller, 1991). Phylogenetic trees were constructed on the basis of amino acid differences (p-distance) using the neighbour-joining algorithm with the Poissoncorrection for evolutionary distance in MEGA Version 3.0 (Kumar et al., 2004). Reliability of the trees was assessed by bootstrapping, using 1000 bootstrap replications. 2.4. In vivo study 2.4.1. Stress experiment Prolonged restraint (24 h) was given by netting the fish and suspending the nets with the fish in the tanks (Huising et al., 2004). After 24 h, the experimental group was transferred all at once to a tank with 0.2 g/l TMS, resulting in rapid (<1 min) and deep anaesthesia prior to blood sampling and killing. A control group was housed in an identical tank but left undisturbed. Control fish were sampled following rapid netting and anaesthesia, immediately before sampling of the experimental group. 2.4.2. Zymosan-induced peritonitis The animals were i.p. injected with freshly prepared zymosan A (2 mg/ml, 1 ml/50 g b.w., Sigma, Z) in sterile PBS (280 mOsM). At selected time points animals were sacrificed and their peritoneal cavities were lavaged with 1 ml of ice cold PBS. Peritoneal leukocytes were frozen in liquid nitrogen. The head kidney was surgically removed and immediately frozen in liquid nitrogen. Samples were stored at 80 °C. 2.5. Cell isolation and in vitro culture Animals were anaesthetized with 0.2 g/l tricaine methane sulphonate buffered with 0.4 g/l NaHCO3. Fish were bled through puncture of the caudal vein using a heparinised syringe. Head kidney cell suspensions were obtained by passing the tissue through a 50 lm nylon mesh with carp RPMI (RPMI 1640, Invitrogen, Carlsbad, CA); adjusted to carp osmolarity (270 mOsm/kg) and containing 10 IU/ml heparin (Leo Pharmaceutical Products Ltd., Weesp, The Netherlands) and washed once. This cell suspension was layered on a discontinuous Percoll (Amersham Biosciences, Piscataway, NJ) gradient (1.020, 1.070 and 1.083 g cm3) and centrifuged for 30 min at 800g with the brake disengaged. Cells at 1.070 g cm3 and 1.083 g cm3 were collected, washed, and seeded at 5  106 cells per well (in a volume of 900 ll) in a 24-well cell culture plate at 27 °C, 5% CO2 in cRPMI (carp RPMI supplemented with 0.5% (v/v) pooled carp serum, 1% L-glutamine (Merck, Whitehouse Station, NJ), 200 nM 2-mercaptoethanol (Bio-Rad, Hercules, CA), 1% (v/v) penicillin G (Sigma–Aldrich, St. Louis, MO), and 1% (v/v) streptomycin sulphate (Sigma–Aldrich, St. Louis, MO). Cells were incubated 4 h with lipopolysaccharide (LPS, 30 lg/ ml, E. coli serotype O55: B5, Sigma–Aldrich, St. Louis, MO) and different concentration of selective opioids (108–1010 M): deltorphine II (D), endomorphine 2 (E2), U50,488H or with culture medium (control, CR).

259

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

2.6. Migratory assay 2.6.1. Chemoattractant To check migratory properties of carp leukocytes, the supernatants from PMA-stimulated carp leukocytes, which contain CXCa and CXCb chemokines were used as chemoattractant (Huising et al., 2003). Briefly, head kidney phagocytes were cultured for 4 h in cRPMI++ medium and were stimulated with 0.1 lg/ml PMA at 27 °C at 5% CO2 (sup+). Unstimulated controls were included (sup). PMA was washed away thoroughly (5 times) with complete carp RPMI and cells were cultured over night without additional stimulation in cRPMI++ medium. Supernatants were harvested and stored at 20 °C. 2.6.2. Chemotaxis assays Leukocyte migration was analyzed in a 48-well microchemotaxis chamber (Neuro Probe, Inc., Maryland, US). The lower wells of the apparatus were filled with either sup or sup+ samples. The lower part of the chamber was covered with a nitrocellulose filter (Nucleopore membrane, Neuro Probe Inc., Maryland, US), with 5 lm pore sizes. The upper wells were loaded with leukocyte suspensions (2  106/ml), that had been incubated with either opioid agonist (108 M) or with culture medium (controls, C). Chambers were incubated for 3 h at 27 °C. After incubation, the filters were fixed and hematoxylin-stained as described previously (Chadzinska et al., 1999). The cells migrating through the filter were counted in three randomly chosen high-power fields (400), and the average number of cells was determined. Results were expressed as a chemotaxis index (CI), i.e. number of migrated cells/random migration, defined as the number of untreated cells that migrated towards sup. 2.7. RNA isolation RNA was isolated using RNeasy Mini Kit (Qiagen, Valencia, CA) following manufacturer’s protocol. Final elution was carried out in 30 ll of nuclease-free water, to maximize the concentration of RNA. RNA concentrations were measured by spectrophotometry and integrity was ensured by analysis on a 1% agarose gel before proceeding with cDNA synthesis. 2.8. DNase treatment and first strand cDNA synthesis For each sample a non-RT (non-reverse transcriptase) control was included. Two microliter of 10 DNase I reaction buffer and 2 ll DNase I (Invitrogen) was added to 2 lg total RNA and incubated for 15 min at room temperature. DNase I was inactivated with 25 mM EDTA (2 ll, 65°C, 10 min). To each sample, 2 ll random primers and 2 ll 10 mM dNTP mix were added, and the mix was incubated for 5 min at 65 °C and followed by a 1 min incubation on ice. After incubation, to each sample 8 ll 5 First Strand buffer, 2 ll 0.1 M dithiothreitol (DTT) and 2 ll RNase inhibitor were added. To 19 ll from each sample (but not to the non-RT controls) 1 ll Super Script III RNase H-Reverse Transcriptase (RT, Invitrogen) was added and reagents were incubated for 5 min at 25 °C,

then spun briefly and incubated 30–60 min at 50 °C. Reactions were inactivated 15 min at 70 °C. Samples were set at 100 ll with demineralized water and stored at 20 °C until future use. 2.9. Real-time quantitative PCR PRIMER EXPRESS software (Applied Biosystems) was used to design primers for use in real-time quantitative PCR. Carp-specific primers (50 –30 ) for opioid receptors: MOR, DOR, KOR and chemokine receptors: CXCR1 and CXCR2 were used. The 40S ribosomal protein s11 gene served as an internal standard (Accession numbers and primer sequences are listed in Table 1). For RQ-PCR 5 ll cDNA and forward and reverse primers (5 lM each) were added to 12.5 ll Quantitect Sybr Green PCR Master Mix (Qiagen). Final volume was brought to 25 ll with demineralized water. RQ-PCR (15 min at 95 °C, 40 cycles of 15 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C followed by 1 min at 60 °C) was carried out with a Rotorgene 2000 realtime cycler (Corbett Research, Sydney, Australia). Following each run, melt curves were collected by detecting fluorescence from 60 to 90 °C at 1 °C intervals. Constitutive expression of opioid receptors was determined in various organs and tissues of four individual adult carp, and rendered as a ratio of target gene vs. reference gene (40S ribosomal protein s11 gene) calculated with the Pfaffl method (Pfaffl, 2001), according to the following equation:

ratio ¼ ðEreference ÞCt reference =ðEtarget ÞCt target where E is the amplification efficiency and Ct is the number of PCR cycles needed for the signal to exceed a predetermined threshold value. Expression following stimulation was rendered as a ratio of target gene vs. reference gene (40S ribosomal protein s11 gene) relative to expression in unstimulated control samples according to the following equation: ðcontrol-sampleÞ

ratio ¼ ðEtarget ÞDCt targetðcontrol-sampleÞ =ðEreference ÞDCt reference

2.10. Statistical analysis Data were expressed as mean ± standard deviation (SD) and significance of differences was determined using ANOVA with post hoc Tukey’s test. 3. Results 3.1. Cloning and characteristics of carp opioid receptors The full-length cDNA sequences of the classical opioid receptors, containing the complete coding strands were obtained. The MOR gene (oprm, Accession No. FM177147) comprises 1152 nucleotides, and encodes a protein of 383 amino acids (Fig. 1A). The DOR gene (oprd, Accession No. FM177148) contains an open reading frame of 1121 nucleotides, and encodes a protein of 373 amino acids (Fig. 1B), while the KOR (oprk, Accession No. FM177146)

Table 1 Primers used for gene expression studies. Gene

Sense (50 –30 )

Antisense (50 –30 )

Accession Nos.

40S MOR DOR KOR CXCR1 CXCR2

CCGTGGGTGACATCGTTACA TGGTGGTGGTGGCGGTTTT CCAACAGCAGCCTCAATCCT TGGTTTTGTGGCTCCTCTCCTC GCAAATTGGTTAGCCTGGTGA TATGTGCAAACTGATTTCAGGCTTAC

TCAGGACATTGAACCTCACTGTCT GCAGGAGGGAGTTGGGAAT TCTGAAGGGCACAAACTGACAC GCGTCTCAGGTTGCGGTCTT AGGCGACTCCACTGCACAA GCACACACTATACCAACCAGATGG

AB012087 FM177147 FM177148 FM177146 AB010468 AB010713

260

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

A

B

C

Fig. 1. Multiple amino acid sequence alignment of vertebrate opioid receptor sequences, including carp; MOR (A), DOR (B), KOR (C). Identical residues in all receptors are marked with (), conserved residues with (:) and similar residues with (.). The seven potential transmembrane domains (TMS) characteristic for G protein-coupled receptors are shaded. EL—extracellular loops; IL—intracellular loops. Accession numbers are as in Fig. 2.

sequence is 1134 nucleotides long and encodes 377 amino acid protein (Fig. 1C). The predicted amino acid identity of these receptors is 67.8% between MOR and DOR, 66.2% between MOR and KOR and 66.4% between DOR and KOR. They show very high (MOR 92.7%, DOR 92.2%, KOR 94.7) identity to zebrafish OR genes, and relatively high (71–82%) sequence identity to the tetrapod OR sequences (Fig. 1). Inter-species comparison of the protein domains reveals the highest sequence identity in the intracellular loops (IL) and transmembrane domains (TMS). In the extracellular loops (EL) the sequence identity between species is lower (except EL I), and the amino- and carboxy-terminal domains constitute the most variable regions.

The neighbour-joining phylogenetic tree for opioid receptor proteins (Fig. 2) resulted in a predicted cluster for MOR, DOR and KOR on separate branches together with their mammalian orthologues. Within the MOR, DOR and KOR branch, teleost and tetrapod proteins form separate clades. 3.2. Constitutive expression of opioid receptor genes in brain and immune organs The expression of opioid receptors was determined in various organs and tissues of carp. As expected, all studied opioid receptors (MOR, DOR and KOR) showed high constitutive expression in brain,

261

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

56 53

Cavia porcellus MOR Rattus norvegicus MOR Mus musculus MOR

39

Bos taurus MOR 99

39

Sus scrofa MOR Macaca mulatta MOR

79

MOR

Homo sapiens MOR

43 64

Pan troglodytes MOR Taricha granulose MOR

100 99

Rana pipiens MOR Danio rerio MOR Cyprinus carpio MOR

98 73 63

100

Catostomus commersoni MOR Danio rerio DOR Cyprinus carpio DOR

30

Taricha granulose DOR

35 73

Rana pipiens DOR Danio rerio DOR1b

63

94 65

Rattus norvegicus DOR

DOR

Mus musculus DOR Macaca mulatta DOR

100

Homo sapiens DOR

49 75

Sus scrofa DOR

100

Danio rerio KOR Cyprinus carpio KOR

97

Taricha granulose KOR Rana pipiens KOR

93 66 69

90

Rattus norvegicus KOR Mus musculus KOR

KOR

Cavia porcellus KOR Homo sapiens KOR

100

Bos taurus KOR

43 61

Sus scrofa KOR Xenopus laevis KOR Ciona intestinalis KOR

Fig. 2. Phylogenetic tree of the vertebrate opioid receptors (MOR, DOR and KOR). Mammalian and non-mammalian orthologues have been identified to date. The tree was generated with MEGA version 3.1. software. Full length amino acid sequences were used and the newly cloned carp sequences are shaded. Numbers at branch nodes represent the confidence level of 1000 bootstraps. Accession numbers are as follows: guinea pig (Cavia porcellus) MOR: AAN86027.1, rat (Rattus norvegicus) MOR: AAA41630.1, mouse (Mus musculus) MOR: AAL55581.1, cow (Bos taurus) MOR: AAB49477.2, pig (Sus scrofa) MOR: AAM77351.1, rhesus macaque (Macaca mulatta) MOR: AAF97249.2, human (Homo sapiens) MOR: AAS00462.1, common chimpanzee (Pan troglodytes) MOR: AAV74327.1, rough-skinned newt (Taricha granulose) MOR: AAV28689.1, leopard frog (Rana pipiens) MOR: AAQ09991.1, zebrafish (Danio rerio) MOR: AAK01143.1, common carp (Cyprinus carpio) MOR: FM177147, white sucker (Castostomus commersoni) MOR: CAA71843.1, zebrafish (Danio rerio) DOR: CAA04862.1, common carp (Cyprinus carpio) DOR: FM177148, rough-skinned newt (Taricha granulose) DOR: AAV28690.1, leopard frog (Rana pipiens) DOR: AAQ09992.1, zebrafish (Danio rerio) DOR1b: AAP86771.1, rat (Rattus norvegicus) DOR: AAA19939.1, mouse (Mus musculus) DOR: AAA37520.1, rhesus macaque (Macaca mulatta) DOR: XP_001113252.1, human (Homo sapiens) DOR: AAA83426.1, pig (Sus scrofa) DOR: AAB39694.1, zebrafish (Danio rerio) KOR: AAG60607.1, common carp (Cyprinus carpio) KOR: FM177146, rough-skinned newt (Taricha granulose) KOR: AAU15126.1, leopard frog (Rana pipiens) KOR: ABY82593.1, rat (Rattus norvegicus) KOR: AAA41495.1, mouse (Mus musculus) KOR: AAA39363.1, guinea pig (Cavia porcellus) KOR: AAA67171.1, human (Homo sapiens) KOR: AAA63906.1, cow (Bos taurus) KOR: AAI12562.1, pig (Sus scrofa) KOR: AAL34312.1, African clawed frog (Xenopus laevis) KOR: AAP35234.1, sea squirt (Ciona intestinalis) KOR: AAP91736.1.

specially in the nucleus preopticus region of the hypothalamus (NPO), (Fig. 3A). A much lower constitutive expression of opioid receptors was observed in all systemic immune organs, including thymus, spleen, kidney, and head kidney (the anatomical equivalent of the mammalian adrenal gland, that moreover in fish is a major systemic immune and haematopoitic organ), as well as in peritoneal leukocytes and peripheral blood leukocytes (Fig. 3B). The gut and gills, that constitute the major mucosal surface of the fish, also expressed opioid receptors (data not shown). Except for peripheral blood leukocytes, the MOR gene showed the highest constitutive expression in immune-related tissues compared to DOR and KOR.

3.3. Stress response regulates expression of opioid receptor genes Significant down-regulation of MOR gene expression was observed in the brain and NPO region after a prolonged restraint stress, while in the pars distalis (PD) of the pituitary, expression of the MOR gene was higher in stressed fish than in control animals. In the pars intermedia (PI), expression of the MOR gene was slightly, but not significantly decreased in stressed animals (Fig. 4). Increased expression of the DOR gene was observed in the PD after stress, while it was down-regulated both in NPO and in the head kidney. Significant up-regulation of KOR gene expression was measured in brain and PD, of stressed animals (Fig. 4).

262

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

0.7

A

0.6

CONSTITUTIVE EXPRESSION

0.3 0.2 0.1 0 BRAIN 0.009

PD

PI

HYP

B

MOR

0.007

DOR

0.005

KOR

0.003 0.001 0 KID

HK

TH

SP

PBL

PTL

Fig. 3. Constitutive mRNA expression of opioid receptor (MOR, DOR and KOR) in the brain areas (A) and immune-releated organs/cells (B). Expression was determined by quantitative real time PCR and plotted relative to the expression of 40S ribosomal protein s11 gene. Bars represent the average expression in organs or tissues obtained from four individual carp. HP, hypothalamus; PD, pars distalis; PI, pars intermedia; KID, kidney; HK, head kidney; TH, thymus; SP, spleen; PBL, peripheral blood leukocytes; PTL, peritoneal leukocytes.

Fig. 4. Opioid receptor mRNA expression (MOR, DOR and KOR) in stress axis organs of fish that underwent 24 h restraint stress. cDNA of five individual fish was used as template for quantitative real time PCR. Messenger RNA expression is shown as xfold increase compared to control animals, standardized for the housekeeping gene 40S ribosomal protein s11. HP, hypothalamus; PD, pars distalis; PI, pars intermedia; HK, head kidney. Averages and SD are given. *p < 0.05, **p < 0.01 (A). Representative RQ-PCR graphs of 40S ribosomal protein s11 (40S) and MOR gene expression in brain of control and stressed fish (B).

3.4. Immune response affects expression of opioid receptor genes 3.4.1. Expression of opioid receptor genes in vivo during zymosaninduced peritonitis Opioid receptor mRNA levels in peritoneal leukocytes and head kidney were determined during the first week of zymosan-induced peritonitis. In peritoneal leukocytes, MOR expression was signifi-

cantly up-regulated at 6 h after injection (Fig. 5A1), while the modest up-regulation of the DOR and KOR genes at 6 and 168 h of inflammation was non-significant (Fig. 5B1 and 5C1). Increased expression of the MOR gene was observed in the head kidney from 1 to 7 day after zymosan injection (Fig. 5A2). DOR gene expression was already considerably up-regulated at 6 h,

DOR

MOR

PTL 6 5 4 3 2 1 0

A1

0h

10 B1 8 6 4 2 0 0h

HK

*

6h

6h

24h

24h

48h

48h

96h

96h

168h

168h

KOR

C1 12 10 8 6 4 2 0

10 8 6 4 2 0 25 20 15 10 5 0 3

A2

* **

0h

6h

24h

48h

** 96h

B2

168h

** **

0h

6h

24h

48h

96h

168h

24h

48h

96h

168h

C2

2 1 0h

6h

24h

48h

96h

168h

0

**

0h 6h Time after zymosan injection (h)

Fig. 5. Opioid receptor mRNA expression (MOR (A), DOR (B), KOR (C)) in peritoneal leukocytes (PTL, panel 1) or head kidney (HK, panel 2) during zymosan (2 mg/ml, 0.5 ml/ 50 g b.w.) induced peritonitis. cDNA of n = 4–9 fish was used as template for quantitative real time PCR. Messenger RNA expression is shown as x-fold increase compared to control animals (set at 1, represented by the dotted line), standardized for the housekeeping gene 40S ribosomal protein s11. Averages and SD are given. *p < 0.05, **p < 0.01. Note the scale differences.

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

remained modestly but not significantly increased up to 96 h, to be followed by a strong up-regulation at 168 h of inflammation (Fig. 5B2). Expression of the KOR gene was not significantly up-regulated in peritoneal leukocytes, while it was down-regulated in the head kidney at 6 h of peritonitis (Fig. 5C2). 3.4.2. Expression of opioid receptor genes in vitro in LPS-stimulated carp phagocytes Expression of all studied opioid receptor genes increased significantly 2 h after in vitro LPS stimulation of head kidney leukocytes (Fig. 6). DOR gene expression was significantly down-regulated 24 h after stimulation (Fig. 6B), while KOR gene expression was strongly down-regulated 4 and 24 h after LPS-treatment (Fig. 6C). 3.5. Agonists of opioid receptors affect leukocyte chemotaxis Cells treated with 108 M deltorphine II, endomorphin 2 or U50, 488H showed 20–30% reduction of migration towards supernatant of PMA-stimulated phagocytes (sup+) (Fig. 7A). Endomorphin 2 and U50,488H at 1010 M significantly downregulated gene expression of CXCR1 to 72%, 71% and 65% of control, respectively (Fig. 7B), while 108 M of deltorphine II reduced expression of both chemokine receptor genes to 60% of control (Fig. 7B and C).

263

4. Discussion Expression of opioid receptors on leukocytes apparently is an evolutionary conserved phenomenon. The present study describes opioid receptors and their expression on leukocytes of common carp. Moreover, we show regulation of OR expression under stress conditions and during an immune response, indicating opioid-induced changes of migratory properties of fish leukocytes. We sequenced three classical opioid receptors (MOR, DOR and KOR) in carp (1). Partial sequences of opioid receptor-like genes have been reported in diverse vertebrate phyla (Li et al., 1996a,b), but cloning the full-length cDNA of opioid receptors in teleosts has only been achieved for zebrafish (Danio rerio, MOR– ZFOR2, KOR–ZFOR3, DOR: ZFOR1 and ZFOR4), (Alvarez et al., 2006; Barrallo et al., 1998a,b, 2000; Rodriguez et al., 2000) and MOR for white sucker (Catostomus commersoni, CCMOR), (Darlison et al., 1997). As expected the degree of homology between carp opioid receptors, zebrafish and mammalian OR is not uniform along the sequence: it is higher in the transmembrane domains and the intracellular loops, and lower in the extracellular loops, as well as in the amino- and carboxyl-terminus. The high degree of identity in the intracellular loops indicates conserved activation of opioid receptors through pertussis-toxin sensitive Gi–G0-proteins and inhibition of adenylate cyclase and modulation of

Fig. 6. Opioid receptor mRNA expression (MOR (A), DOR (B), KOR (C)) in head kidney phagocytes after in-vitro stimulation with 30 lg/ml LPS. cDNA of four individual stimulation experiments was used as template for quantitative real time PCR (each with four replicates). Messenger RNA expression data is shown as x-fold increase compared to non-stimulated control cells (set at 1, represented by the dotted line), standardized for the housekeeping gene 40S ribosomal protein s11. Averages and SD are given. *p < 0.05, **p < 0.01. Note the scale differences (panel 1). Representative RQ-PCR graphs of 40S ribosomal protein s11 (40S) and opioid receptor gene expression in control and 2 h LPS-stimulated cells (panel 2).

264

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

2.5

A

CI

2.0

**

1.5

* **

1.0 0.5 0

CXCR1

4

sup-

sup+

B

3 2 1

*

*

**

-8

-10

-8

-10

-8

0 -10

CXCR2

4

-8

-10

C

3 2

*

1 0 -10

-8

-10

-8

log 10 (M) Control

Endomorphin 2

Deltrophine II

U50,488H

Fig. 7. In vitro effect of endomorphin 2, deltorphin II or U50,488H (4 h, 108 M for chemotaxis, 108 M and 1010 M for gene expression) on head kidney phagocyte activity. (A) Cell migration towards: supernatants of unstimulated phagocytes (sup) or PMA-stimulated phagocytes (sup+). Results expressed as a chemotaxis index (CI), i.e number of migrated cells/random migration, defined as the number of untreated cells that migrated towards sup. (B) CXCR1 gene expression (C) CXCR2 gene expression in LPS-stimulated (4 h, 30 lg/ml l) head kidney phagocytes. cDNA of four individual stimulation experiments was used as template for quantitative real time PCR (each with four replicates). Messenger RNA expression data is shown as x-fold increase compared to control cells (set at 1, represented by the dotted line), standardized for the housekeeping gene 40S ribosomal protein s11. Averages and SD are given. *p < 0.05, **p < 0.01.

calcium and potassium conductance (Martin-Kleiner et al., 2006). The extracellular loops, determining ligand binding (Chaturvedi et al., 2000), have a lower degree of sequence similarity which represents a different ligand selectivity and/or affinity profile of piscine opioid receptors, adapted to their species-specific opioid ligands. Despite extensive molecular and biochemical analysis of mammalian opioid binding sites, the specific epitopes involved are still under debate (Kane et al., 2006). We focused our study on regulation of OR expression in those brain areas involved in the stress response (nucleus preopticus area of the hypothalamus, the pars distalis and pars intermedia of the pituitary) and to the head kidney, which is the analog of the mammalian adrenal glands (Fig. 3). After exposure to prolonged restraint stress, the high levels of MOR and DOR mRNA in the NPO decreased, while expression of all studied opioid receptors increased in the pars distalis, but not in the pars intermedia of the pituitary (Fig. 4). This increase in OR expression during stress is shown to be accompanied by increased gene expression of POMC

in the NPO and in both hypothalamic areas (Metz et al., 2004) and with release of N-acetylated b-endorphin to the blood plasma (van den Burg et al., 2005). Interestingly in stressed animals, DOR gene expression was down-regulated in the head kidney (Fig. 4), which in teleost fish is both an endocrine and an immune hematopoietic organ (Flik et al., 2006). These data validate the involvement of the opioid system in regulation of stress reactions in lower vertebrates. Furthermore, endogeonous opioids (primarily b-endorphin) released during stressful stimuli, can interact with peripheral opioid receptors to inhibit nociception in inflamed tissue (e.g. Brack et al., 2004). We now found constitutive expression of opioid receptor genes not only in brain structures, but also in immune-related organs, thereby corroborating a potential immune function for these receptors. Additionally, both in vitro (LPS-stimulation) and in vivo (zymosan-induced peritonitis) immune-stimulation transiently increased expression of the OR genes in phagocytes. During peritonitis MOR and DOR gene expression was first observed in the focus of inflammation, and later in the head kidney (Fig. 5A), while expression of KOR was down-regulated in the head kidney. This suggests a differential function for MOR and DOR versus KOR during an immune response. These data are in accordance to our previous results, where zymosan-induced peritonitis up-regulated MOR, but down-regulated the KOR genes in inflammatory leukocytes (macrophages and neutrophilic granulocytes) of Swiss mice (Chadzinska et al., 2005b). Additionally, to date there are several reports showing that either IL-4 or TNF-a induces the expression of MOR in human neutrophils, T-cells and dendritic cells, as well as Jurkat T cells, and Raji B cells (Kraus et al., 2006; Borner et al., 2004, 2007), whereas IFN-c inhibits the IL-4-, but not the TNF-ainducible transcription of MOR in immunocytes (Kraus et al., 2006). Interestingly, in the inflammatory models for mice and rats macrophages and granulocytes synthesized and released opioid peptides (Brack et al., 2004; Machelska and Stein, 2006; Machelska, 2007; Chadzinska et al., 2003, 2005a,b). Furthermore, in vitro, recombinant carp IL-1b stimulates the release of N-acetylated bendorphin from the pituitary gland (Metz et al., 2006). Possibly the opioid system is involved in induction of local antinociception during inflammation (Stein et al., 2003). It moreover participates in controlling leukocyte recruitment to the focus of inflammation. Morphine was found to attenuate leukocyte rolling and sticking during inflammation in both arterioles and venules via nitric oxide production (Ni et al., 2000). In rats, chronic morphine enhanced IL1b- or LPS-, but not FMLP, induced leukocyte-endothelial adhesion by suppressing the negative feedback on the immune system mediated by IL1b’s modulatory actions on the stress axis (House et al., 2001; Ocasio et al., 2004). Opioids can also affect leukocyte migration due to cross-talk of the opioid and chemokine receptors (Szabo and Rogers, 2001). The latter was evidenced during peritonitis by morphine-induced inhibition of leukocyte accumulation in mice and fish (Chadzinska et al., 1999, 2000, in press). These results corroborate our recent findings in carp of a concomitant and substantial reduction of chemotaxis-related ligands and receptors (Chadzinska et al., in press). Although we realize that selectivity and affinity of carp receptors to specific mammalian MOR, DOR and KOR agonists may differ, we did find that they reduced in vitro migration of fish leukocytes towards chemokines. They moreover, down-regulated the expression of chemokine receptor genes (Fig. 7). Previously we observed that morphine, the agonist for MOR3, can also bind with lower affinity to DOR and KOR and decreased migration of carp leukocytes towards chemokines and complement-derived chemoattractants (C3a/C5a). Furthermore, it reduced expression of chemokine receptor genes (Chadzinska et al., in press). Moreover, both morphine and deltorphine II, but not U50,488H, decreased chemotaxis of goldfish leukocytes (Chadzinska and

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

Plytycz, 2004). Surprisingly, in the present experiments the KOR agonist U50,488H also reduced the migratory properties of carp leukocytes, which may reflect difference in species and/or incubation time. Intriguingly, chemokine receptors and opioid receptors, which both belong to GPCR family of receptors, possess the capacity to form heterodimers (Gomes et al., 2001) and cross-regulate receptor function through the process of heterologous desensitization: when activation of one type of GPCR (e.g. the opioid receptor) may result in phosphorylation and inactivation of the other GPCR (e.g. a chemokine receptor), (Szabo and Rogers, 2001). We infer that the now observed opioid-induced reduction of the migration of leukocytes towards chemokines results from this process. Further studies towards intracellular phosphorylation of chemokine and opioid receptors should clarify this issue. The present work contributes to our understanding of the regulation of the neuroendocrine and immune responses in carp by sequencing their opioid receptors, till now an important missing piece of the ‘‘puzzle”. We now give evidence for regulated expression of opioid receptor genes during stress and the immune response in carp. Our results substantiate an evolutionary conserved role of the opioid system in maintaining a dynamic equilibrium while coping with stress and/or infection. Acknowledgments We thank the Institute of Ichthyobiology and Aquaculture, Polish Academy of Science in Golysz, Poland for providing carp. We also thank Ms. Ellen Stolte for performing the stress experiments and Dr. Karen M. Leon-Kloosterziel for technical assistance and advice. This study was supported by research grants: FP-6-2002-Human Resources and Mobility-5-number 024034 (MC). References Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402. Alvarez, F.A., Rodriguez-Martin, I., Gonzalez-Nunez, V., de Velasco, E.M., Gonzalez Sarmiento, R., Rodriguez, R.E., 2006. New kappa opioid receptor from zebrafish Danio rerio. Neurosci. Lett. 405, 94–99. Barrallo, A., Gonzalez-Sarmiento, R., Alvar, F., Rodriguez, R.E., 2000. ZFOR2, a new opioid receptor-like gene from the teleost zebrafish (Danio rerio). Brain Res. Mol. Brain Res. 84, 1–6. Barrallo, A., Gonzalez-Sarmiento, R., Porteros, A., Garcia-Isidoro, M., Rodriguez, R.E., 1998a. Cloning, molecular characterization, and distribution of a gene homologous to delta opioid receptor from zebrafish (Danio rerio). Biochem. Biophys. Res. Commun. 245, 544–548. Barrallo, A., Malvar, F.G., Gonzalez, R., Rodriguez, R.E., Traynor, J.R., 1998b. Cloning and characterization of a delta opioid receptor from zebrafish. Biochem. Soc. Trans. 26, S360. Borner, C., Kraus, J., Schroder, H., Ammer, H., Hollt, V., 2004. Transcriptional regulation of the human mu-opioid receptor gene by interleukin-6. Mol. Pharmacol. 66, 1719–1726. Borner, C., Stumm, R., Hollt, V., Kraus, J., 2007. Comparative analysis of mu-opioid receptor expression in immune and neuronal cells. J. Neuroimmunol. 188, 56– 63. Brack, A., Rittner, H.L., Machelska, H., Shaqura, M., Mousa, S.A., Labuz, D., Zollner, C., Schafer, M., Stein, C., 2004. Endogenous peripheral antinociception in early inflammation is not limited by the number of opioid-containing leukocytes but by opioid receptor expression. Pain 108, 67–75. Chadzinska, M., Jozefowski, S., Bigaj, J., Plytycz, B., 1997. Morphine modulation of thioglycollate-elicited peritoneal inflammation in the goldfish, Carassius auratus. Arch. Immunol. Ther. Exp. (Warsz) 45, 321–327. Chadzinska, M., Kolaczkowska, E., Seljelid, R., Plytycz, B., 1999. Morphine modulation of peritoneal inflammation in Atlantic salmon and CB6 mice. J. Leukoc. Biol. 65, 590–596. Chadzinska, M., Leon-Kloosterziel, K.M., Plytycz, B., Verburg-van Kemenade, B.M.L., 2008. In vivo kinetics of cytokine expression during peritonitis in carp: evidence for innate and alternative macrophage polarization. Dev. Comp. Immunol. 32, 509–518. Chadzinska, M., Plytycz, B., 2004. Differential migratory properties of mouse, fish, and frog leukocytes treated with agonists of opioid receptors. Dev. Comp. Immunol. 28, 949–958. Chadzinska, M., Savelkoul, H.F.J., Verburg-van Kemenade, B.M.L., 2008. Morphine affects the inflammatory response in carp by impairment of leukocyte migration. Dev. Comp. Immunol., in press.

265

Chadzinska, M., Scislowska-Czarnecka, A., Pierzchala-Koziec, K., Plytycz, B., 2005a. Met-enkephalin involvement in morphine-modulated peritonitis in swiss mice. Mediators Inflamm. 2005, 112–117. Chadzinska, M., Scislowska-Czarnecka, A., Pierzchala-Koziec, K., Plytycz, B., 2003. Inflammation-induced alternations in local and central Met-enkephalin in mice. Pol. J. Pharmacol. 55, 467–470. Chadzinska, M., Scislowska-Czarnecka, A., Plytycz, B., 2000. Inhibitory effects of morphine on some inflammation-related parameters in the goldfish Carassius auratus L.. Fish Shellfish Immunol. 10, 531–542. Chadzinska, M., Starowicz, K., Scislowska-Czarnecka, A., Bilecki, W., PierzchalaKoziec, K., Przewlocki, R., Przewlocka, B., Plytycz, B., 2005b. Morphine-induced changes in the activity of proopiomelanocortin and prodynorphin systems in zymosan-induced peritonitis in mice. Immunol. Lett. 101, 185–192. Chaturvedi, K., Christoffers, K.H., Singh, K., Howells, R.D., 2000. Structure and regulation of opioid receptors. Biopolymers 55, 334–346. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., Thompson, J.D., 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 31, 3497–3500. Chuang, L.F., Chuang, T.K., Killam Jr., K.F., Chuang, A.J., Kung, H.F., Yu, L., Chuang, R.Y., 1994. Delta opioid receptor gene expression in lymphocytes. Biochem. Biophys. Res. Commun. 202, 1291–1299. Chuang, L.F., Chuang, T.K., Killam Jr., K.F., Qiu, Q., Wang, X.R., Lin, J.J., Kung, H.F., Sheng, W., Chao, C., Yu, L., Chuang, R.Y., 1995. Expression of kappa opioid receptors in human and monkey lymphocytes. Biochem. Biophys. Res. Commun. 209, 1003–1010. Darlison, M.G., Greten, F.R., Harvey, R.J., Kreienkamp, H.J., Stuhmer, T., Zwiers, H., Lederis, K., Richter, D., 1997. Opioid receptors from a lower vertebrate (Catostomus commersoni): sequence, pharmacology, coupling to a G-proteingated inward-rectifying potassium channel (GIRK1), and evolution. Proc. Natl. Acad. Sci. USA 94, 8214–8219. Devine, D.P., Watson, S.J., Akil, H., 2001. Orphanin FQ regulates neuroendocrine function of the limbic-hypothalamic-pituitary-adrenal axis. Neuroscience 102, 1369–1387. Drolet, G., Dumont, E.C., Gosselin, I., Kinkead, R., Laforest, S., Trottier, J.F., 2001. Role of endogenous opioid system in the regulation of the stress response. Prog. Neuropsychopharmacol. Biol. Psychiatry 25, 729–741. Eisenstein, T.K., Hilburger, M.E., 1998. Opioid modulation of immune responses: effects on phagocyte and lymphoid cell populations. J. Neuroimmunol. 83, 36– 44. Faisal, M., Chiappelli, F., Ahmed, I.I., Cooper, E.L., Weiner, H., 1989. Social confrontation ‘‘stress” in aggressive fish is associated with an endogenous opioid-mediated suppression of proliferative response to mitogens and nonspecific cytotoxicity. Brain Behav. Immun. 3, 223–233. Flik, G., Klaren, P.H., van den Burg, E.H., Metz, J.R., Huising, M.O., 2006. CRF and stress in fish. Gen. Comp. Endocrinol. 146, 36–44. Gaveriaux, C., Peluso, J., Simonin, F., Laforet, J., Kieffer, B., 1995. Identification of kappa- and delta-opioid receptor transcripts in immune cells. FEBS Lett. 369, 272–276. Gomes, I., Jordan, B.A., Gupta, A., Rios, C., Trapaidze, N., Devi, L.A., 2001. G protein coupled receptor dimerization: implications in modulating receptor function. J. Mol. Med. 79, 226–242. House, S.D., Mao, X., Wu, G., Espinelli, D., Li, W.X., Chang, S.L., 2001. Chronic morphine potentiates the inflammatory response by disrupting interleukin1bmodulation of the hypothalamic-pituitary-adrenal axis. J Neuroimmunol. 118, 277–285. Huang, X., Miller, W., 1991. A time-efficient, linear-space local similarity algorithm. Adv. App. Math. 12, 337–357. Huising, M.O., Metz, J.R., van Schooten, C., Taverne-Thiele, A.J., Hermsen, T., Verburg-van Kemenade, B.M., Flik, G., 2004. Structural characterisation of a cyprinid (Cyprinus carpio L.) CRH, CRH-BP and CRH-R1, and the role of these proteins in the acute stress response. J. Mol. Endocrinol. 32, 627–648. Huising, M.O., Stolte, E., Flik, G., Savelkoul, H.F., Verburg-van Kemenade, B.M., 2003. CXC chemokines and leukocyte chemotaxis in common carp (Cyprinus carpio L.). Dev. Comp. Immunol. 27, 875–888. Ignatowski, T.A., Bidlack, J.M., 1998. Detection of kappa opioid receptors on mouse thymocyte phenotypic subpopulations as assessed by flow cytometry. J Pharmacol Exp Ther. 266, 1678–1683. Irnazarow, I., 1995. Genetic variability of Polish and Hungarian carp lines. Aquaculture 129, 215–219. Jozefowski, S., Plytycz, B., 1997. Characterization of opiate binding sites on the goldfish (Carassius auratus L.) pronephric leukocytes. Pol. J. Pharmacol. 49, 229– 237. Kane, B.E., Svensson, B., Ferguson, D.M., 2006. Molecular recognition of opioid receptor ligands. AAPS J. 8, E126–137. Kieffer, B.L., Gaveriaux-Ruff, C., 2002. Exploring the opioid system by gene knockout. Prog. Neurobiol. 66, 285–306. Kraus, J., Borner, C., Lendeckel, U., Hollt, V., 2006. Interferon-gamma down-regulates transcription of the mu-opioid receptor gene in neuronal and immune cells. J. Neuroimmunol. 181, 13–18. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Li, X., Keith, D.E., Evans, C.J., 1996a. Mu opioid receptor-like sequences are present throughout vertebrate evolution. J. Mol. Evol. 43, 179–184. Li, X., Keith, D.E., Evans, C.J., 1996b. Multiple opioid receptor-like genes are identified in diverse vertebrate phyla. FEBS Lett. 397, 25–29.

266

M. Chadzinska et al. / Brain, Behavior, and Immunity 23 (2009) 257–266

Machelska, H., Stein, C., 2006. Leukocyte-derived opioid peptides and inhibition of pain. J. Neuroimmunol. Pharmacol. 1, 90–97. Machelska, H., 2007. Targeting of opioid-producing leukocytes for pain control. Neuropeptides 41, 355–363. Makman, M.H., 1994. Morphine receptors in immunocytes and neurons. Adv. Neuroimmunol. 4, 69–82. Martin-Kleiner, I., Balog, T., Gabrilovac, J., 2006. Signal transduction induced by opioids in immune cells: a review. Neuroimmunomodulation 13, 1–7. Metz, J.R., Huising, M.O., Leon, K., Verburg-van Kemenade, B.M., Flik, G., 2006. Central and peripheral interleukin-1beta and interleukin-1 receptor I expression and their role in the acute stress response of common carp, Cyprinus carpio L.. J. Endocrinol. 191, 25–35. Metz, J.R., Huising, M.O., Meek, J., Taverne-Thiele, A.J., Wendelaar Bonga, S.E., Flik, G., 2004. Localization, expression and control of adrenocorticotropic hormone in the nucleus preopticus and pituitary gland of common carp (Cyprinus carpio L.). J. Endocrinol 182, 23–31. Ni, X., Gritman, K.R., Eisenstein, T.K., Adler, M.W., Arfors, K.E., Tuma, R.F., 2000. Morphine attenuates leukocyte/endothelial interactions. Micrvasc. Res. 60, 121–130. Ocasio, F.M., Jiang, Y., Steven, D.H., Chang, S.L., 2004. Chronic morphine accelerates the progression of lipopolysaccharide-induced sepsis to septic shock. J. Neuroimmunol. 149, 90–100. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 29, e45. Przewlocki, R., Przewlocka, B., 2005. Opioids in neuropathic pain. Curr. Pharm. Des. 11, 3013–3025. Rodriguez, R.E., Barrallo, A., Garcia-Malvar, F., McFadyen, I.J., Gonzalez-Sarmiento, R., Traynor, J.R., 2000. Characterization of ZFOR1, a putative delta-opioid receptor from the teleost zebrafish (Danio rerio). Neurosci. Lett. 288, 207–210. Rogers, T.J., Peterson, P.K., 2003. Opioid G protein-coupled receptors: signals at the crossroads of inflammation. Trends Immunol. 24, 116–121.

Salzet, M., 2001. Neuroimmunology of opioids from invertebrates to human. Neuro. Endocrinol. Lett. 22, 467–474. Sedqi, M., Roy, S., Ramakrishnan, S., Elde, R., Loh, H.H., 1995. Complementary DNA cloning of a l-opioid receptor from rat peritoneal macrophages. Biochem. Res. Commun. 209, 563–574. Sharp, B.M., Shahabi, N., McKean, D., Li, M.D., McAllen, K., 1997. Detection of basal levels and induction of delta opioid receptor mRNA in murine splenocytes. J. Neuroimmunol. 78, 198–202. Singh, R., Rai, U., 2008. Beta-Endorphin regulates diverse functions of splenic phagocytes through different opioid receptors in freshwater fish Channa punctatus (Bloch): an in vitro study. Dev. Comp. Immunol. 32, 330–338. Stefano, G.B., Salzet, M., 1999. Invertebrate opioid precursors: evolutionary conservation and the significance of enzymatic processing. Int. Rev. Cytol. 187, 261–286. Stein, C., Schafer, M., Machelska, H., 2003. Attacking pain at its source. new perspectives on opioids. Nat. Med. 9, 1003–1008. Sumpter, J.P., Pickering, A.D., Pottinger, T.G., 1985. Stress-induced elevation of plasma alpha-MSH and endorphin in brown trout, Salmo trutta L.. Gen. Comp. Endocrinol. 59, 257–265. Szabo, I., Rogers, T.J., 2001. Crosstalk between chemokine and opioid receptors results in downmodulation of cell migration. Adv. Exp. Med. Biol. 493, 75–79. van den Burg, E.H., Metz, J.R., Spanings, F.A., Wendelaar Bonga, S.E., Flik, G., 2005. Plasma alpha-MSH and acetylated beta-endorphin levels following stress vary according to CRH sensitivity of the pituitary melanotropes in common carp, Cyprinus carpio. Gen. Comp. Endocrinol. 140, 210–221. Watanuki, H., Gushiken, Y., Takahashi, A., Yasuda, A., Sakai, M., 2000. In vitro modulation of fish phagocytic cells by beta-endorphin. Fish Shellfish Immunol. 10, 203–212. Watanuki, N., Takahashi, A., Yasuda, A., Sakai, M., 1999. Kidney leucocytes of rainbow trout, Oncorhynchus mykiss, are activated by intraperitoneal injection of beta-endorphin. Vet. Immunol. Immunopathol. 71, 89–97.