- Email: [email protected]
RecQL cDNA; α form is expressed ubiquitously and β form specifically in the testis
Biochimica et Biophysica Acta 1443 (1998) 198^202
Short sequence-paper
Cloning of two isoforms of mouse DNA helicase Q1/RecQL cDNA; K form is expressed ubiquitously and L form speci¢cally in the testis Wen-Sheng Wang a; b , Masayuki Seki a , Tomoki Yamaoka b , Takahiko Seki a;b , Shusuke Tada 1;b , Toshiaki Katada b , Hirokazu Fujimoto c , Takemi Enomoto a; * a b
Department of Molecular Cell Biology, Faculty of Pharmaceutical Sciences, Tohoku University, Aoba, Aramaki, Aoba-ku, Sendai 980-8578, Japan Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113, Japan c Mitsubishi Kasei Institute of Life Sciences, Machida, Tokyo 194-8511, Japan Received 4 September 1998; accepted 24 September 1998
Abstract We cloned cDNAs encoding mouse homologues for the human DNA helicase Q1/RecQL (human helicase Q1) which has homology with the Escherichia coli RecQ protein and found that they encode two isoforms. The two isoforms are identical over the entire sequence except for the carboxyl terminal sequence spanning less than 30 amino acids. One of the two isoforms, K, contains a sequence, KKRK, in the carboxyl terminus, which is also contained in human helicase Q1 and was confirmed to function as the nuclear localization signal. The other form, L, does not contain such a sequence. Expression of mouse helicase Q1 mRNA is extremely and relatively high in the testis and the thymus, respectively. RT-PCR analysis revealed that helicase Q1K was expressed in all tissues tested and the L form was expressed only in the testis. A survey of expression of Q1K and Q1L mRNA in the testis after birth revealed that Q1K mRNA is expressed in all testes of mice aged from 7 days to 8 weeks, and the expression of Q1L mRNA begins 14 days after birth, corresponding to the appearance of cells in the pachytene stage. ß 1998 Elsevier Science B.V. All rights reserved. Keywords: DNA helicase Q1L; Mouse RecQL; Expression in the testis
We cloned a cDNA encoding DNA helicase Q1, which is a major DNA helicase in human cells, based on partial amino acid sequences determined with puri¢ed protein [1] and found that this protein is a human homologue to the Escherichia coli RecQ protein [2]. The same gene has also been cloned by others and designated as RECQL (RecQ-like) [3]. * Corresponding author. Fax: +81 (22) 217-6873; E-mail: [email protected] 1 Present address: Cancer Research Campaign, Chromosome Replication Research Group, Wellcome Trust Building, University of Dundee, Dundee DD1 4HN, UK.
In addition to DNA helicase Q1/RecQL, at least two other RECQ homologue genes exist in human cells, namely Bloom's syndrome gene (BLM) [4] and Werner's syndrome gene (WRN) [5]. In budding yeasts, there exists only one RECQ homologue gene, SGS1 [6,7]. Fission yeasts are also known to have a RECQ homologue gene, hus2+/rqh1+ [8,9]. The representative clinical manifestations of Bloom's syndrome (BS) due to the defect of the BLM gene are cancer predisposition, immunode¢ciency, and male infertility [10]. In the cells derived from BS patients, the interchanges between homologous chromosomes are increased and an abnormally
0167-4781 / 98 / $ ^ see front matter ß 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 8 ) 0 0 2 0 8 - 5
BBAEXP 91198 20-11-98
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
199
Fig. 1. Comparison of amino acid sequence between human DNA helicase Q1 and mouse DNA helicase Q1K, and between mouse DNA helicase Q1K and L. Seven conserved helicase motifs are underlined and numbered according to a previous paper [19]. Putative NLSs are boxed. Carboxyl terminal sequences di¡ering between mouse DNA helicase Q1K and L are double underlined.
BBAEXP 91198 20-11-98
200
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
large number of sister chromatid exchanges (SCEs) are present [10]. Werner's syndrome (WS) patients prematurely develop a variety of the major age-related diseases such as arteriosclerosis, malignant neoplasms, melituria and cataracts [11]. In contrast to BLM and WRN, nothing is known about the function of helicase Q1 and no known disease has been assigned to chromosome 12q12 region, where the human helicase Q1 gene is located [1,12]. In this study, we cloned mouse helicase Q1 homologue genes with a view to realizing `knockout mouse' experiments. Complementary DNA fragments encoding mouse DNA helicase Q1 were isolated by the plaque-hybridization method using a mouse spermatocyte Vgt11 randomly primed cDNA library and cDNAs encoding the C-terminal region of mouse helicase Q1 were obtained by RT-PCR on total RNA prepared from testes as the template. Thus we obtained three di¡erent cDNAs of mouse helicase Q1 which were designated as K1, K2 and L. The nucleotide sequences have been deposited in DDBJ/EMBL/GenBank with accession numbers, AB017104 and AB017105 for Q1K and Q1L, respectively. The two cDNAs, K1 and K2, encode the same protein but have 3P untranslated regions of di¡erent length, which may be due to the usage of di¡erent poly A signals. In contrast, L encodes a distinct amino acid sequence di¡erent from that of Q1K in the carboxyl terminus from 620 aa to the terminus (Fig. 1). Human DNA helicase Q1/RecQL corresponds to mouse Q1K because of the conservation of the carboxyl terminus including a putative nuclear localization signal, KKRK (Fig. 1). Mouse Q1 cDNA K and L encode a 648 aa polypeptide with a molecular mass of 71 kDa and a 631 aa polypeptide of 69.4 kDa, respectively. The identities between human Q1 and mouse Q1K are 75.6% and 85.7% at the nucleotide and the amino acid level, respectively. Expression of Q1 mRNA in various mouse tissues was examined by Northern blotting. A high level of expression of Q1 mRNA was observed in the testis (Fig. 2A, lanes 9 and 11) and a relatively high level of expression was observed in the thymus of a 3-week-old mouse (Fig. 2A, lane 12). There was little expression of Q1 mRNA in other tissues if any. We were unable to detect Q1K and Q1L mRNA separately by Northern blotting. To detect the slightly
Fig. 2. Tissue distribution of mouse DNA helicase Q1 mRNA. (A) Northern blotting. Total RNA was prepared from various tissues of BALB/3T3 mice. Northern analysis was performed according to the Multiple Tissue Northern Blot manual (Clontech). Lane 1, brain; lane 2, heart; lane 3, kidney; lane 4, liver; lane 5, lung; lane 6, muscle; lane 7, ovary; lane 8, spleen; lane 9, testis; lane 10, thymus; lane 11, testis of 7-week-old mice; lane 12, thymus of 3-week-old mice. Ribosome 28S RNA was stained with ethidium bromide and L-actin mRNA was detected by Northern blotting. (B) RT-PCR. First strand cDNA was synthesized using NotI-(dT)18 according to the First-Strand cDNA Synthesis Kit instructions (Pharmacia Biotech). The primers used for detection of helicase Q1K and L mRNA by RT-PCR were as follows : K sense, CTGTATGTTCATGTCTGGGTC; K antisense, CTTGCTGACACACTTGGTAC ; L sense, CACAGCCGCCAATGTCTAGTG and L antisense, GACATAGCTTTAAAGCCATGG The primers used for detection of L-actin mRNA were sense, 5P-CCTAAGGCCAACCGTGAAAAG-3P and antisense, 5P-TCTTCATGGTGCTAGGAGCCA3P [20]. Lane 1, brain; lane 2, heart; lane 3, liver; lane 4, lung; lane 5, testis; lane 6, ovary; lane 7, thymus; lane 8, kidney; lane 9, spleen; lane 10, small intestine; lane 11, muscle; lane 12, pancreas.
expressed mRNA and to discriminate Q1K mRNA from Q1L mRNA, we performed RT-PCR on total RNA prepared from various tissues. The results indicated that Q1K mRNA was expressed in all tissues examined but that Q1L mRNA was expressed only in the testis (Fig. 2B). The latter fact probably explains why we could not isolate a cDNA encoding human helicase Q1L using a cDNA library derived from KB cells [1]. To determine at which stage of spermatogenesis
BBAEXP 91198 20-11-98
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
cells express higher levels of Q1 mRNA, we fractionated spermatogenic cells and measured the Q1 mRNA content of the fractionated cells. We also measured the contents of three additional mRNAs for Ldh-3, Zfp38, and Hsc70t as markers. The expression of Ldh-3 mRNA begins from the midpachytene stage and continues during the subsequent stages of spermatid di¡erentiation [13,14]. The level of Zfp38 mRNA increases before pachytene and decreases after meiosis II [15]. On the other hand, Hsc70t mRNA is expressed only after meiosis II, speci¢cally in spermatids [16]. Spermatogenic cells were fractionated by centrifugal eluatriation. Fraction 1 contained the smallest size population corresponding to late spermatids and cytoplasmic fragments, and fraction 2 contained mainly elongated spermatids. Fraction 3 contained mostly round spermatids and fraction 4 contained multinucleated spermatids and early pachytene spermatocytes. Fractions 5 and 6 contained late pachytene spermatocytes as the major cell population. As
Fig. 3. Expression of mouse DNA helicase Q1 mRNA in fractionated spermatogenic cells. To separate spermatogenic cells from the testes of sexually mature ICR mice, decapsulated testes were treated by the two-step method using collagenase and trypsin [21]. Resultant spermatogenic cells were subjected to centrifugal eluatriation using a Beckman JE-6 eluatriator [22] and separated into six fractions. Lanes 1^6 correspond to fractions 1^6, respectively. Probes, Ldh-3, Hsc70t, and Zfp38, were used for checking the cell population in each fraction. Northern blotting was performed as described in the legend for Fig. 2.
201
Fig. 4. Expression of mouse DNA helicase Q1 in the testis during postnatal development. (A) Northern Blotting. Total RNA was prepared from testes from mice of the indicated age. Northern blotting was performed as described in the legend for Fig. 2. The amount of 28S rRNA and L-actin mRNA are also indicated. (B) RT-PCR. RT-PCR was performed on the total RNA prepared from testes from mice of the indicated age as described in the legend for Fig. 2.
shown in Fig. 3, Q1 mRNA was highly expressed in the cells of fractions 4, 5, and 6. This expression pattern is similar to those of Ldh-3 and Zfp38 but not to that of Hsc70t, indicating that the expression of Q1 mRNA increases at pachytene and decreases after completion of meiosis II. We examined the changes in the level of Q1 mRNA in the testis during postnatal development by Northern blotting because spermatogenesis occurs fairly synchronously in the testis after birth. Most spermatogenic cells in mice younger than 14 days are spermatogonia and early spermatocytes at the leptotene and zygotene stages [17]. Spermatocytes at the pachytene stage ¢rst appear in the testis of 14-day-old mice, then rapidly accumulate up to 17 days after birth. In 3-week-old mice, the majority of spermatogenic cells are pachytene spermatocytes. As shown in Fig. 4A, the levels of Q1 mRNA in the testis from 7-, 10-, 12-, 14-day-old mice were relatively low, but increased considerably in the testis from 17-day-old mice and very high levels of expression were observed in the testis from 4-, 5-, and 7-week-old mice. Fig. 4B indicates the results of RT-PCR. Q1K
BBAEXP 91198 20-11-98
202
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
mRNA was expressed in all the testis from mice of various ages, indicating the expression of the mRNA in cells other than spermatogenic cells and/or spermatogonia. On the other hand, the expression of Q1L mRNA was ¢rst detected at 14 days after birth, indicating that the expression of Q1L mRNA begins at the pachytene stage. In this study, we have shown that mouse helicase Q1L is expressed speci¢cally in the testis at speci¢c stages during spermatogenesis, indicating that Q1L plays important roles in the meiotic process, which are distinct from those of ubiquitously expressed Q1K. However, the function of human helicase Q1 is still unknown. In order to study the functions of helicase Q1 further, we are now trying to make helicase Q1-knockout cells using a chicken B cell line, DT40 [18], and Q1 knockout mice. We would like to thank Dr. Toshiaki Nose for providing the mouse spermatocyte cDNA library. This work was supported by Grants-in-Aid for Scienti¢c Research, for Scienti¢c Research on Priority Areas, and for JSPS Fellows from The Ministry of Education, Science, Sports and Culture of Japan and the Mitsubishi Foundation. References [1] M. Seki, H. Miyazawa, S. Tada, J. Yanagisawa, T. Yamaoka, S. Hoshino, K. Ozawa, T. Eki, M. Nogami, K. Okumura, H. Taguchi, F. Hanaoka, T. Enomoto, Nucleic Acids Res. 22 (1994) 4566^4573. [2] K. Nakayama, N. Irino, H. Nakayama, Mol. Gen. Genet. 200 (1985) 266^271. [3] K.L. Puranam, P.J. Blackshear, J. Biol. Chem. 269 (1994) 29838^29845.
[4] N.A. Ellis, J. Groden, T.-Z. Ye, J. Straughen, D.J. Lennon, S. Ciocci, M. Proytcheva, J. German, Cell 83 (1995) 655^ 666. [5] C.-E. Yu, J. Oshima, Y.-H. Fu, E.M. Wijsman, F. Hisama, R. Alish, S. Nakura, J. Matthews, T. Miki, S. Ouais, G.M. Martin, J. Mulligan, G.D. Schellenberg, Science 272 (1996) 258^262. [6] S. Ganglo¡, J.P. McDonald, C. Bendixen, L. Arthur, R. Rothtein, Mol. Cell. Biol. 14 (1994) 8391^8398. [7] A.M. Romeo, S. Kle¡, R. Sternglanz, GenBank accession number L07870, 1992. [8] E. Stewart, C.R. Chapman, F. Al-Khodairy, A.M. Carr, T. Enoch, EMBO J. 16 (1997) 2682^2692. [9] J.M. Murray, H.D. Lindsay, C.A. Munday, A.M. Carr, Mol. Cell. Biol. 17 (1977) 6868^6875. [10] J. German, Medicine 72 (1993) 393^406. [11] C.J. Epstein, G.M. Martin, A.L. Schultz, A.G. Motulsky, Medicine 45 (1966) 177^222. [12] K.L. Puranam, E. Kennington, S.N. Sait, T.B. Shows, J.M. Rochelle, M.F. Seldin, P.J. Blackshear, Genomics 26 (1995) 595^598. [13] H. Fujimoto, R.P. Erickson, S. Tone, Mol. Reprod. Dev. 1 (1988) 27^34. [14] K. Thomas, J. Del Mazo, P. Eversole, A. Bellve, Y. Hiraoka, S.S. Li, M. Simon, Development 109 (1990) 483^493. [15] T. Noce, Y. Fujiwara, M. Sezaki, H. Fujimoto, T. Higashinakagawa, Dev. Biol. 153 (1992) 356^367. [16] M. Matsumoto, H. Fujimoto, Biochem. Biophys. Res. Commun. 166 (1990) 43^49. [17] A.R. Bellve, J.C. Cavicchia, C.F. Millette, D.A. O'Brien, Y.M.M. Bhatnagar, J. Cell Biol. 74 (1977) 68^85. [18] O. Bezzubova, A. Silbergleit, Y. Yamaguchi-Iwai, S. Takeda, J.M. Buerstedde, Cell 89 (1997) 185^193. [19] A.E. Gorbalenya, E.V. Koonin, A.P. Donchenko, V.M. Blinov, Nucleic Acids Res. 17 (1989) 4713^4730. [20] Y.S. Li, K. Hayakawa, R.R. Hardy, J. Exp. Med. 178 (1993) 951^960. [21] H. Fujimoto, R.P. Erickson, Biochem. Biophys. Res. Commun. 108 (1982) 1369^1375. [22] M.L. Meistrich, P.K. Trostle, M. Frapart, R.P. Erickson, Dev. Biol. 60 (1977) 428^441.
BBAEXP 91198 20-11-98
Short sequence-paper
Cloning of two isoforms of mouse DNA helicase Q1/RecQL cDNA; K form is expressed ubiquitously and L form speci¢cally in the testis Wen-Sheng Wang a; b , Masayuki Seki a , Tomoki Yamaoka b , Takahiko Seki a;b , Shusuke Tada 1;b , Toshiaki Katada b , Hirokazu Fujimoto c , Takemi Enomoto a; * a b
Department of Molecular Cell Biology, Faculty of Pharmaceutical Sciences, Tohoku University, Aoba, Aramaki, Aoba-ku, Sendai 980-8578, Japan Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, University of Tokyo, Tokyo 113, Japan c Mitsubishi Kasei Institute of Life Sciences, Machida, Tokyo 194-8511, Japan Received 4 September 1998; accepted 24 September 1998
Abstract We cloned cDNAs encoding mouse homologues for the human DNA helicase Q1/RecQL (human helicase Q1) which has homology with the Escherichia coli RecQ protein and found that they encode two isoforms. The two isoforms are identical over the entire sequence except for the carboxyl terminal sequence spanning less than 30 amino acids. One of the two isoforms, K, contains a sequence, KKRK, in the carboxyl terminus, which is also contained in human helicase Q1 and was confirmed to function as the nuclear localization signal. The other form, L, does not contain such a sequence. Expression of mouse helicase Q1 mRNA is extremely and relatively high in the testis and the thymus, respectively. RT-PCR analysis revealed that helicase Q1K was expressed in all tissues tested and the L form was expressed only in the testis. A survey of expression of Q1K and Q1L mRNA in the testis after birth revealed that Q1K mRNA is expressed in all testes of mice aged from 7 days to 8 weeks, and the expression of Q1L mRNA begins 14 days after birth, corresponding to the appearance of cells in the pachytene stage. ß 1998 Elsevier Science B.V. All rights reserved. Keywords: DNA helicase Q1L; Mouse RecQL; Expression in the testis
We cloned a cDNA encoding DNA helicase Q1, which is a major DNA helicase in human cells, based on partial amino acid sequences determined with puri¢ed protein [1] and found that this protein is a human homologue to the Escherichia coli RecQ protein [2]. The same gene has also been cloned by others and designated as RECQL (RecQ-like) [3]. * Corresponding author. Fax: +81 (22) 217-6873; E-mail: [email protected] 1 Present address: Cancer Research Campaign, Chromosome Replication Research Group, Wellcome Trust Building, University of Dundee, Dundee DD1 4HN, UK.
In addition to DNA helicase Q1/RecQL, at least two other RECQ homologue genes exist in human cells, namely Bloom's syndrome gene (BLM) [4] and Werner's syndrome gene (WRN) [5]. In budding yeasts, there exists only one RECQ homologue gene, SGS1 [6,7]. Fission yeasts are also known to have a RECQ homologue gene, hus2+/rqh1+ [8,9]. The representative clinical manifestations of Bloom's syndrome (BS) due to the defect of the BLM gene are cancer predisposition, immunode¢ciency, and male infertility [10]. In the cells derived from BS patients, the interchanges between homologous chromosomes are increased and an abnormally
0167-4781 / 98 / $ ^ see front matter ß 1998 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 9 8 ) 0 0 2 0 8 - 5
BBAEXP 91198 20-11-98
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
199
Fig. 1. Comparison of amino acid sequence between human DNA helicase Q1 and mouse DNA helicase Q1K, and between mouse DNA helicase Q1K and L. Seven conserved helicase motifs are underlined and numbered according to a previous paper [19]. Putative NLSs are boxed. Carboxyl terminal sequences di¡ering between mouse DNA helicase Q1K and L are double underlined.
BBAEXP 91198 20-11-98
200
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
large number of sister chromatid exchanges (SCEs) are present [10]. Werner's syndrome (WS) patients prematurely develop a variety of the major age-related diseases such as arteriosclerosis, malignant neoplasms, melituria and cataracts [11]. In contrast to BLM and WRN, nothing is known about the function of helicase Q1 and no known disease has been assigned to chromosome 12q12 region, where the human helicase Q1 gene is located [1,12]. In this study, we cloned mouse helicase Q1 homologue genes with a view to realizing `knockout mouse' experiments. Complementary DNA fragments encoding mouse DNA helicase Q1 were isolated by the plaque-hybridization method using a mouse spermatocyte Vgt11 randomly primed cDNA library and cDNAs encoding the C-terminal region of mouse helicase Q1 were obtained by RT-PCR on total RNA prepared from testes as the template. Thus we obtained three di¡erent cDNAs of mouse helicase Q1 which were designated as K1, K2 and L. The nucleotide sequences have been deposited in DDBJ/EMBL/GenBank with accession numbers, AB017104 and AB017105 for Q1K and Q1L, respectively. The two cDNAs, K1 and K2, encode the same protein but have 3P untranslated regions of di¡erent length, which may be due to the usage of di¡erent poly A signals. In contrast, L encodes a distinct amino acid sequence di¡erent from that of Q1K in the carboxyl terminus from 620 aa to the terminus (Fig. 1). Human DNA helicase Q1/RecQL corresponds to mouse Q1K because of the conservation of the carboxyl terminus including a putative nuclear localization signal, KKRK (Fig. 1). Mouse Q1 cDNA K and L encode a 648 aa polypeptide with a molecular mass of 71 kDa and a 631 aa polypeptide of 69.4 kDa, respectively. The identities between human Q1 and mouse Q1K are 75.6% and 85.7% at the nucleotide and the amino acid level, respectively. Expression of Q1 mRNA in various mouse tissues was examined by Northern blotting. A high level of expression of Q1 mRNA was observed in the testis (Fig. 2A, lanes 9 and 11) and a relatively high level of expression was observed in the thymus of a 3-week-old mouse (Fig. 2A, lane 12). There was little expression of Q1 mRNA in other tissues if any. We were unable to detect Q1K and Q1L mRNA separately by Northern blotting. To detect the slightly
Fig. 2. Tissue distribution of mouse DNA helicase Q1 mRNA. (A) Northern blotting. Total RNA was prepared from various tissues of BALB/3T3 mice. Northern analysis was performed according to the Multiple Tissue Northern Blot manual (Clontech). Lane 1, brain; lane 2, heart; lane 3, kidney; lane 4, liver; lane 5, lung; lane 6, muscle; lane 7, ovary; lane 8, spleen; lane 9, testis; lane 10, thymus; lane 11, testis of 7-week-old mice; lane 12, thymus of 3-week-old mice. Ribosome 28S RNA was stained with ethidium bromide and L-actin mRNA was detected by Northern blotting. (B) RT-PCR. First strand cDNA was synthesized using NotI-(dT)18 according to the First-Strand cDNA Synthesis Kit instructions (Pharmacia Biotech). The primers used for detection of helicase Q1K and L mRNA by RT-PCR were as follows : K sense, CTGTATGTTCATGTCTGGGTC; K antisense, CTTGCTGACACACTTGGTAC ; L sense, CACAGCCGCCAATGTCTAGTG and L antisense, GACATAGCTTTAAAGCCATGG The primers used for detection of L-actin mRNA were sense, 5P-CCTAAGGCCAACCGTGAAAAG-3P and antisense, 5P-TCTTCATGGTGCTAGGAGCCA3P [20]. Lane 1, brain; lane 2, heart; lane 3, liver; lane 4, lung; lane 5, testis; lane 6, ovary; lane 7, thymus; lane 8, kidney; lane 9, spleen; lane 10, small intestine; lane 11, muscle; lane 12, pancreas.
expressed mRNA and to discriminate Q1K mRNA from Q1L mRNA, we performed RT-PCR on total RNA prepared from various tissues. The results indicated that Q1K mRNA was expressed in all tissues examined but that Q1L mRNA was expressed only in the testis (Fig. 2B). The latter fact probably explains why we could not isolate a cDNA encoding human helicase Q1L using a cDNA library derived from KB cells [1]. To determine at which stage of spermatogenesis
BBAEXP 91198 20-11-98
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
cells express higher levels of Q1 mRNA, we fractionated spermatogenic cells and measured the Q1 mRNA content of the fractionated cells. We also measured the contents of three additional mRNAs for Ldh-3, Zfp38, and Hsc70t as markers. The expression of Ldh-3 mRNA begins from the midpachytene stage and continues during the subsequent stages of spermatid di¡erentiation [13,14]. The level of Zfp38 mRNA increases before pachytene and decreases after meiosis II [15]. On the other hand, Hsc70t mRNA is expressed only after meiosis II, speci¢cally in spermatids [16]. Spermatogenic cells were fractionated by centrifugal eluatriation. Fraction 1 contained the smallest size population corresponding to late spermatids and cytoplasmic fragments, and fraction 2 contained mainly elongated spermatids. Fraction 3 contained mostly round spermatids and fraction 4 contained multinucleated spermatids and early pachytene spermatocytes. Fractions 5 and 6 contained late pachytene spermatocytes as the major cell population. As
Fig. 3. Expression of mouse DNA helicase Q1 mRNA in fractionated spermatogenic cells. To separate spermatogenic cells from the testes of sexually mature ICR mice, decapsulated testes were treated by the two-step method using collagenase and trypsin [21]. Resultant spermatogenic cells were subjected to centrifugal eluatriation using a Beckman JE-6 eluatriator [22] and separated into six fractions. Lanes 1^6 correspond to fractions 1^6, respectively. Probes, Ldh-3, Hsc70t, and Zfp38, were used for checking the cell population in each fraction. Northern blotting was performed as described in the legend for Fig. 2.
201
Fig. 4. Expression of mouse DNA helicase Q1 in the testis during postnatal development. (A) Northern Blotting. Total RNA was prepared from testes from mice of the indicated age. Northern blotting was performed as described in the legend for Fig. 2. The amount of 28S rRNA and L-actin mRNA are also indicated. (B) RT-PCR. RT-PCR was performed on the total RNA prepared from testes from mice of the indicated age as described in the legend for Fig. 2.
shown in Fig. 3, Q1 mRNA was highly expressed in the cells of fractions 4, 5, and 6. This expression pattern is similar to those of Ldh-3 and Zfp38 but not to that of Hsc70t, indicating that the expression of Q1 mRNA increases at pachytene and decreases after completion of meiosis II. We examined the changes in the level of Q1 mRNA in the testis during postnatal development by Northern blotting because spermatogenesis occurs fairly synchronously in the testis after birth. Most spermatogenic cells in mice younger than 14 days are spermatogonia and early spermatocytes at the leptotene and zygotene stages [17]. Spermatocytes at the pachytene stage ¢rst appear in the testis of 14-day-old mice, then rapidly accumulate up to 17 days after birth. In 3-week-old mice, the majority of spermatogenic cells are pachytene spermatocytes. As shown in Fig. 4A, the levels of Q1 mRNA in the testis from 7-, 10-, 12-, 14-day-old mice were relatively low, but increased considerably in the testis from 17-day-old mice and very high levels of expression were observed in the testis from 4-, 5-, and 7-week-old mice. Fig. 4B indicates the results of RT-PCR. Q1K
BBAEXP 91198 20-11-98
202
W.-S. Wang et al. / Biochimica et Biophysica Acta 1443 (1998) 198^202
mRNA was expressed in all the testis from mice of various ages, indicating the expression of the mRNA in cells other than spermatogenic cells and/or spermatogonia. On the other hand, the expression of Q1L mRNA was ¢rst detected at 14 days after birth, indicating that the expression of Q1L mRNA begins at the pachytene stage. In this study, we have shown that mouse helicase Q1L is expressed speci¢cally in the testis at speci¢c stages during spermatogenesis, indicating that Q1L plays important roles in the meiotic process, which are distinct from those of ubiquitously expressed Q1K. However, the function of human helicase Q1 is still unknown. In order to study the functions of helicase Q1 further, we are now trying to make helicase Q1-knockout cells using a chicken B cell line, DT40 [18], and Q1 knockout mice. We would like to thank Dr. Toshiaki Nose for providing the mouse spermatocyte cDNA library. This work was supported by Grants-in-Aid for Scienti¢c Research, for Scienti¢c Research on Priority Areas, and for JSPS Fellows from The Ministry of Education, Science, Sports and Culture of Japan and the Mitsubishi Foundation. References [1] M. Seki, H. Miyazawa, S. Tada, J. Yanagisawa, T. Yamaoka, S. Hoshino, K. Ozawa, T. Eki, M. Nogami, K. Okumura, H. Taguchi, F. Hanaoka, T. Enomoto, Nucleic Acids Res. 22 (1994) 4566^4573. [2] K. Nakayama, N. Irino, H. Nakayama, Mol. Gen. Genet. 200 (1985) 266^271. [3] K.L. Puranam, P.J. Blackshear, J. Biol. Chem. 269 (1994) 29838^29845.
[4] N.A. Ellis, J. Groden, T.-Z. Ye, J. Straughen, D.J. Lennon, S. Ciocci, M. Proytcheva, J. German, Cell 83 (1995) 655^ 666. [5] C.-E. Yu, J. Oshima, Y.-H. Fu, E.M. Wijsman, F. Hisama, R. Alish, S. Nakura, J. Matthews, T. Miki, S. Ouais, G.M. Martin, J. Mulligan, G.D. Schellenberg, Science 272 (1996) 258^262. [6] S. Ganglo¡, J.P. McDonald, C. Bendixen, L. Arthur, R. Rothtein, Mol. Cell. Biol. 14 (1994) 8391^8398. [7] A.M. Romeo, S. Kle¡, R. Sternglanz, GenBank accession number L07870, 1992. [8] E. Stewart, C.R. Chapman, F. Al-Khodairy, A.M. Carr, T. Enoch, EMBO J. 16 (1997) 2682^2692. [9] J.M. Murray, H.D. Lindsay, C.A. Munday, A.M. Carr, Mol. Cell. Biol. 17 (1977) 6868^6875. [10] J. German, Medicine 72 (1993) 393^406. [11] C.J. Epstein, G.M. Martin, A.L. Schultz, A.G. Motulsky, Medicine 45 (1966) 177^222. [12] K.L. Puranam, E. Kennington, S.N. Sait, T.B. Shows, J.M. Rochelle, M.F. Seldin, P.J. Blackshear, Genomics 26 (1995) 595^598. [13] H. Fujimoto, R.P. Erickson, S. Tone, Mol. Reprod. Dev. 1 (1988) 27^34. [14] K. Thomas, J. Del Mazo, P. Eversole, A. Bellve, Y. Hiraoka, S.S. Li, M. Simon, Development 109 (1990) 483^493. [15] T. Noce, Y. Fujiwara, M. Sezaki, H. Fujimoto, T. Higashinakagawa, Dev. Biol. 153 (1992) 356^367. [16] M. Matsumoto, H. Fujimoto, Biochem. Biophys. Res. Commun. 166 (1990) 43^49. [17] A.R. Bellve, J.C. Cavicchia, C.F. Millette, D.A. O'Brien, Y.M.M. Bhatnagar, J. Cell Biol. 74 (1977) 68^85. [18] O. Bezzubova, A. Silbergleit, Y. Yamaguchi-Iwai, S. Takeda, J.M. Buerstedde, Cell 89 (1997) 185^193. [19] A.E. Gorbalenya, E.V. Koonin, A.P. Donchenko, V.M. Blinov, Nucleic Acids Res. 17 (1989) 4713^4730. [20] Y.S. Li, K. Hayakawa, R.R. Hardy, J. Exp. Med. 178 (1993) 951^960. [21] H. Fujimoto, R.P. Erickson, Biochem. Biophys. Res. Commun. 108 (1982) 1369^1375. [22] M.L. Meistrich, P.K. Trostle, M. Frapart, R.P. Erickson, Dev. Biol. 60 (1977) 428^441.
BBAEXP 91198 20-11-98