Closely spaced and divergent promoters for an aminoacyl-tRNA synthetase gene and a tRNA operon in Escherichia coli

J. Mol. Biol. (1990) 214, 845-864

Closely Spaced and Divergent Promoters for an AminoacyltRNA Synthetase Gene and a tRNA Operon in Escherichia coli Transcriptional Yves V. Brunt,

and Post-transcriptional and ala W H&he

Regulation of gZtX, vaZU

SanfaCon, Rock Breton

and Jacques Lapointel

Dipartement de Biochimie Faculte’ des Sciences et de GEnie Universite’ Lava1 Que’bec, Canada GIK 7P4 (Received 29 December 1989; accepted 26 March

1990)

The transcription of the gEtX gene encoding the glutamyl-tRNA synthetase and of the adjacent vallJ and ala W tRNA operons of Escherichia coli K-12 has been studied. The ala W operon containing two tRNA& g enes, is 800 base-pairs downstream from the gltX terminator and is transcribed from the same strand. The valU operon, containing three tRNAp$ and one tRNALyS nun (the wild-type allele of supN) genes, is adjacent to gltX and is transcribed from the opposite strand. Its only promoter is upstream from the gltX promoters. The gltX gene transcript is monocistronic and its transcription initiates at three promoters, Pl, P2 and P3. The transcripts from one or more of these promoters are processed by RNase E to generate two major species of gEtX mRNA, which are stable and whose relative abundance varies with growth conditions. The stability of g&X mRNA decreases in an RNase E- strain and its level increases with growth rate about three times more than that of the glutamyl-tRNA synthetase. The 5’ region of these mRNAs can adopt a stable secondary structure (close to the ribosome binding site) that is similar to the anticodon and part of the dihydroU stems and loops of tRNAG1”, and which might be involved in translational regulation of GluRS synthesis. The gZtX and vaEU promoters share the same AT-rich and bent upstream region, whose position coincides with the position of the upstream activating sequences of tRNA and rRNA promoters to which they are similar. This suggests that gltX and valU share transcriptional regulatory mechanisms.

1. Introduction

ratios [aminoacyl,-tRNA] to [aminoacyl,-tRNA synthetase] are in the range of about 1 to 15 for ten aminoacyl-tRNA synthetases studied (Jakubowski & Goldman, 1984). This fact may reflect differences in the catalytic eiliciencies of the members of this family of 20 synthetases and/or the presence in some of them of structural components conferring on them functions additional to that for which they are named, such as transcriptional regulation for the alanyl-tRNA synthetase (Putney & Schimmel, 1981), translational regulation for threonyl-tRNA synthetase (Springer et aE., 1986) or RNA splicing (Akins & Lambowitz, 1987; Herbert et al., 1988). The transcription of EF-Tu and tRNA genes is coupled in the tufB operon (Hudson et al., 1981). No case of coupled tRNA and aminoacyl-tRNA synthetase genes has been found, even though most of the aminoacyl-tRNA synthetase genes (GrunbergManago, 1987; Eriani et al., 1989; Gampel & Tzagoloff, 1989; Hartlein & Madern, 1987; Hartlein

Transfer RNAs, aminoacyl-tRNA synthetases and the elongation factor Tu (EF-Tug) are close partners in protein biosynthesis. Whereas equimolar amounts of tRNA and EF-Tu are found in Escherichia co&i (Furano, 1975; Neidhardt et al., 1977), the t Present address: Department of Developmental Biology, Beckman Center, Stanford University School of Medicine, Stanford, CA 943055427, U.S.A. $ Author to whom all correspondence should be addressed. $ Abbreviations used: EF, elongation factor; kb, lo3 bases or base-pairs; ONPG, Z-nitrophenyl-b,ngalactopyranoside; bp, base-pair(s); AMV, avian myeloblastosis virus; X-gal, 5-bromo-4-chloro-3-indolyl-B,D-galactopyranoside; p.f.u., plaque-forming units; ORF, open reading frame; UAS, upstream activating sequence; FIX, factor for inversion stimulation; DALA, &aminolevulinic acid. 0022-2836/90/160845&20$03.00/O

845

0 1990 Academic Press Limited

846

Y. V. Brun et ai

et aZ.; 1987a,b; Heck & Hatfield, 1988; Webster et al., 1984; Miller et al., 1987; Eriani et aE., 1990) and probably all tRNA genes of E. coli have been cloned and sequenced (Komine et al., 1990). Only three aminoacyl-tRNA synthetase genes remain to be cloned or sequenced in E. coli. cysS maps at 12 minutes on the linkage map in the same region as argU (dnaY), which is transcribed as a monocistronic message (Fournier & Ozeki, 1985). cysS is not encoded in the 2 kb of DNA downstream from argU, which contains a homologue of the phage 22 integrase gene transcribed towards argU (Lindsay et al., 1989). pro/3 maps at five minutes, counterclockwise from the rrnH operon (Fournier & Ozeki, 1985; Bachmann, 1987). There are two other tRNA genes in this region: aspV (Horiuchi et al., 1987) and thrW (Dalrymple & Mattics, 1986), which have been precisely positioned clockwise from rrnH at 5.5 and six minutes: respectively (Komine et al., 1990). Thus, neither cysS nor proS seem to be coupled to tRNA genes. To our knowledge, asps has been neither cloned nor mapped (Grunberg-Manago, 1987). There is one case, however, where the possibi1it.y of transcriptional coupling remains. The g&X gene encoding the glutamyl-tRNA synthetase and the supN mutant allele of the ZysV gene (tRNAb&) are cotransduced at 98% by bacteriophage Pl (Russel & Pittard, 1971; Uemura et al., 1985). Cloning and sequencing of the adjacent regions of the gltX gene revealed that the gltX gene and the vaZU operon containing genes for three identical tRNAp& and one tRNA& (the wild-type allele of supN) are adjacent and divergently transcribed (Brun et al., 1990, the accompanying paper). Also, the alaW operon previously undetected from genetic data and containing genes for two identical tRNA;!$,, was identified 08 kb downstream from the putative gltX rho-independent terminator and is transcribed from the same strand. The levels of the various aminoacyl-tRNA synthetases studied to date respond similarly to variations in growth rate of the cell. This “metabolic regulation” (Neidhardt et al., 1975) corresponds to a two- to threefold increase in enzyme level for each fivefold increase in the growth rate (Putney & Schimmel, 1981; Reeh et al., 1977). On the other hand, the synthetases respond differently to a starvation for their amino acid substrate (Neidhardt et al., 1975; Grunberg-Manago, 1987) and to relA mutations (Blumenthal et aZ., 1977). Detailed analysis of the structure and expression of a few genes encoding aminoacyl-tRNA synthetases has revealed a diversity of control mechanisms (GrunbergManago, 1987). Since tRNA genes also respond to metabolic regulation and to stringent control (Fournier & Ozeki, 1985), gZtX, vaZlJ and aZaW are probably subject to the same regulatory controls. Closely spaced divergent genes are often coordinately expressed (Beck & Warren, 1988) and it is possible that gltX and valU are transcriptionally coregulated and represent yet another regulatory mechanism for aminoaeyl-tRNA synthetase genes. Here, we report our analysis of the regulation of

g&X, vatU and ataW. The gZlX mRNA is monocistronic and transcribed from three promoters. The majority of the g&X mRNAs are probably the products of RNase E processing just upstream from a stem and loop structure similar to the E. coli tRNAGL” anticodon and part of the dihydroU stems and loops. The only valU promoter is divergent, from and adjacent to the upst,ream g&X promoter. The gltX and valU promoters share upstream activating sequences.

2. Materials and Methods (a) Ha~teriale Most of the materials are described in t,he accompany(ONPG) was obtained from Boehringer-Mannheim. Oligonucleotide %GCCTGTTGGGCTTGGCGCGAAGCG-3’ (oligo 2) w-as obtained from Guy Boileau (Departement de bioehimie, Universite de Montreal). Oligonucleotides (oligo 5’-GCTATAGCCCCGTCACGTAAAGC-3 3, 6-GGCCTTACGTTTAGAAAGATGCCG-3’ (oligo l), and 5’-GACTACATAAAGTAGTTGGTGGGTG-3’ (oligo 43, were synthesized using the Cyclone DNA Synthesizer from Biosearch, Inc.

ing paper. 2Nit’rophenyl-P,n-galactopyranoside

(b) Bacteria,1 strains, plasmids, phages, growth conditions and general techniques Bacterial st,rains, plaamids and Ml3 bacteriophages used in this work are listed in Table 1. LB medium (Ausubel et al.; 1989) was routinely used for growth and wes supplemented with 100 ,ug ampicilin/ml or 25 ng tetracycline/ml when necessary and with @20/b (w/v) maltose and 10 m-x-MgSO, (LBMM) for work with bacteriophage 1. Minimal A medium (Miller, 1972) suppiemented with 0.2% (w/v) glucose and amino a.cids (100 pg/ml) when necessary was used for slow growth conditions and to check auxotrophies of the strains used in this work. Lactose MacConkey medium (Silhavy et al.. 1984) was used for the selection of spontaneous gene fusions to la& and purification of lac+ clones. General cloning techniques were as described (Naniatis et al., 1982: Ausubel et al., 1989; Davis et al.: 1986). Evaluation of signal intensities on autoradiographs and photo negatives were done using the 1MKIIIC Automatic Recording Microdensitometer from Joyce, Loebl & Co. (c) DIVA sequencing DNA sequencing and DKA sequence analysis was done as described in the accompanying paper. (d) Purijcation

and

Zabelling

of probes

Oligonucleotides were purified by gel electrophoresis in 15% to 20% polyacrylamide gels with 8 M-urea in TBE buffer (Ausubel et aE., 1989). They were labelled using the 5’-end labelling kit from Boehringer-Ma,nnheim and t,he unincorporated (Y-~*P) was removed by elution through NACS Prepac columns (BRL) according to the manufaeturer’s instructions. Double-stranded DNA fragments used as probes for Northern hybridization were purified and labelled as described in the aecompa.nying paper. For purification of the 305 bp Sau3A fragment from pLQ7614 (construeted by cloning the 30% bp fragment containing the start of the

Regulation of gltX, in the BamHI site of pBS M13+) used for S, nuclease mapping, the plasmid was 1st digested by XaZI/EcoRI and the @3 kb fragment was purified. This fragment was digested with Xau3A and the 305 bp fragment was purified. It was then dephosphorylated and labelled at its 5’ end with the 5’.end labelling kit from Boehringer-Mannheim. After extraction with phenol/chloroform: it was separated from unincorporated nucleotides by chromatography through a Sephadex G-50 spun-column.

valU

gZtX coding region from pLQ7610

Strains, E. coli DH5a JMlOl AB347 JP1449 MC4100 C600 N3431 x3433 MC1061

plasmids Relevant

and alaW

(e) Preparation

Plasmids

PBS M13+ pLQ7611ANruI pMLB1069

pLQ7623

pLQ7623r

pLQ7623-15 pRS414 pGPVlOl6 pLQ7610 pLQ7614

M13mp18 M13mp19 /1RS45 I.RS45 : : GPVlOl6

synthesized

in viva

Total RNA was isolated from E. coli C600 grown either in LB broth supplemented with 02% glucose (rich medium, doubling time 30 min) or in minimal A medium (Miller, 1972) supplemented with 0.2% glucose and 100 pg threonine and leucine/ml, and 0.6% (w/v) potassium acetate (minimal medium, doubling time 160 min) by either of 2 methods. For isolation of large quantities of a combination of very pure total RNA minus tRNA,

Table 1 and Ml3 bacteriophages used genotype

@OdZacZAM15, e&Al, recA1, hsdRl’l(r-, m+), supE44, thi-1, /I-, gyrA, relA1, F-, A(lacZYAargE”)U169 supE, thi, A(&proAB), [F’, traD36, proAB, ZaclqZAMlB] thy-l, leuB6, thi-1, aroC4, lacZ4, ara-37, rpsL8, dm, supE44 thr-1, leuB6, gZtX351 (ts), thi-1; lacZ4, ara-37, rpsL8, I-, supE44 F-, araD139, A(ZacZYA-a~gF)U169, rpsL150, &Al, jIbB5301, deoC1 i ptsF25, rbsR F-, thi-1, t/w-l, ZeuB6, ZucYl, tonA21, supE44, IZacZ43, I-, reZA1, spoT1, thi-1, me-3071(ts) ZacZ43, A-, reZA1, spoT1, thi-1 A(lacIPOZYA)X74, g&U, galK, styA, araD139, A(ara, leu)7697, hsr-, hsm+, thi, A-

and phages

of RNA

Storable markers and description Amp’, carries the beginning of la& Amp’, pBR322 derivative, carries a 2 kb fragment containing gZtX Amp’, derivative of pMLB1034 in which a Hind111 site was inserted at the SmaI site, carries la& Amp’, pMLB1069 derivative, carries the 1.9 kb H&II fragment from pLQ7611 containing gZtX in the same orientation as la& Amp’, pMLB1069 derivative, carries the 1.9 kb H&c11 fragment from pLQ7611 containing gZtX in the orientation opposite of ZacZ Amp’, deletion derivative of pLQ7623, gZtX-la& translational fusion Amp’, la& protein fusion vector Amp’, pRS414 derivative, gltX-lacZ translational fusion Amp’, carries a 52 kb fragment containing gltX Amp’, pBS Ml3 + derivative, contains the 305 bp Sau3A fragment with the start of the gZtX coding region from pLQ7610 Ml3 derivative carrying a multiple cloning site at the beginning of la&, carries the beginning of ZacZ Same as M13mp18 but with the MCS in the opposite orientation imm21, ind+; contains the 5’terminal half of bla and the distal third of g&X iRS45 derivative carrying the gZtXla& translational form pGPV1016

Reference and/or origin Hanahan? 1985 Yanisch-Perron

et al., 1985

Russel & Pittard,

1971

Russel & Pittard,

1971

Silhavy et al., 1984 Appleyard, 1954 Goldblum & Apirion, 1981 Goldblum & Apirion, 1981 Casadaban & Cohen, 1980

Reference and/or origin Short et al., 1988 Breton et al., 1986 M. Berman Berman & Jackson, 1984 This work

This work

This work Simons et al., 1987 This work This work This work

Yanisch-Perron

et al., 1985

Yanisch-Perron

et al., 1985

Simons

et al., 1987

This work

Y. V. Brun at ai.

848

different methods was used (Taljanidisz et al., 1987; Chirgwin et al., 1979; Simpson, 1987). Cells were chilled on ice and were centrifuged for 15 min at 9,000 revs/min in a Sorval GS3 rotor at 4°C. The cell pellet was resuspended in 12 ml of lysis buffer (80 mivr-Tris . HCI (pH 75), 10 mM-Na,EDTA, 2 mM o-phenanthroline, 05% (w/v) SDS, 92 mg heparin/ml, 933 mg proteinase K/ml preincubated at 37°C for 1 h) and were incubated at 3’7°C for 20 min. Guanidinium isothiocyanate (7 g) and 70 ~1 of /l-mercaptoethanol were added and the solution was vortexed vigorously to help dissolve the guanidinium and to shear the chromosomal DNA. One volume of 1 g CsCl/ ml was added and the solution was layered onto a 72-m] cushion of 5.7 @&Cl, 100 rnM-Na,EDTA (pH 7.0) in a 45ml polyallomer Beckman Quick-Seal tube for ultracentrifugation at 150,000 g for 16 h at 20°C in a Beckman 50.2 Ti rotor. The RNA pellet was washed with 75% (v/v) cold ethanol and dried. It was then dissolved in 30 ml of 20 mivr-Tris’ HCl (pH 75), @I mg proteinase K/ml (preincubated 1 h at 37°C) and incubated for 1 h at 37°C. Extraction with phenol/chloroform was performed as described (Palmiter, 1974). After addition of 2 ml of 45 M-sodium acetate (pH 6.0) and 96 ml of ethanol, the RNA was precipitated overnight at -20°C. The pellet was washed with 75% ethanol and the dried pellet was resuspended in diethyl pyrocarbonate-treated water containing 0.1 y0 SDS. Small amounts of total RNA (with tRNA) were isolated by the adaptation to bacteria of a single-step method of mammalian RNA isolation (Chomczynski & Sacchi, 1987). Cells were grown to an absorbance at 550 nm of 0.5 in 10 ml of medium or as described, chilled on ice and centrifuged at 4°C. The cell pellet was resuspended in 95 ml of lysis buffer (4 M-guanidinium isothiocyanate, 25 m&r-sodium citrate (pH 7.0), 05% (v/v) N-lauroylsarcosine, 91 M-P-mercaptoethanol). The solution was extracted by adding successively 50 ~1 of 2 M-sodium acetate (pH 4.0), 9.5 ml of water-saturated nucleic acid grade phenol (BRL) and 91 ml of chloroform/isoamyl alcohol (49: 1, v/v) with vigorous shaking after each addition. The mixture was then vortexed for 10 s and chilled on ice for at least 15 min, after which it was centrifuged at 12,000 g for 20 min at 4°C. The aqueous phase was re-extracted twice in the same way and 1 vol. isopropanol was added to precipitate the RNA at -20°C for at least 1 h. The pellet was washed with 75 y0 ethanol, resuspended in 150 ~1 of lysis buffer and reprecipitated with isopropanol. The pellet was washed with 75% ethanol and the dried pellet was resuspended in diethyl pyrocarbonate-treated water containing 0.1 y0 SDS. (a Northern hybridization Separation of RNA under denaturing conditions was done by formaidehyde/agarose gel electrophoresis essentially as described by Fourney et al. (1988). Gels were prepared in Mops buffer (20 mivr-Mops, 50 mw-sodium acetate, 10 mM-Na,EDTA) containing 0.66 M-deionized formaldehyde and were run in the same buffer. After electrophoresis, the RNA was transferred to a High Bond N (Amersham) membrane by capillary action overnight without prior treatment of the gel. The membrane was pre-hybridized in 2 x SSC (SSC is 0.15 iv-Nacl, 0015 iw-t&odium citrate, pH 7) containing 0.25% (w/v) of Carnation Instant Skim Milk Powder (previously treated overnight with 1 y0 diethylpyrocarbonate and autoclaved, see Siegel & Bresnick, 1986) for at least 2 h at 68°C. The labeled probe (@I pg of 4 x IO8 cts mini pg-’ of the EcoRI fragment from pLQ7623) was heated to

95”C, chilled in ice and added directly to the pre-hybridization solution. After hybridization overnight, the membrane was washed 3 times for 10 min in 2 x SSC, 92% SDS at room temperature and twice for 30 min in @I xSSC, OZq/, SDS at 68°C. The membrane was then blotted dry and exposed with an intensifying screen at -70°C.

(g) S, n&ease

mapping

S, nuciease mapping was performed essentially as described for double-stranded probes by Berk & Sharp (1977). Total RNA (50 to 100 pg) was mixed with approx. 10,000 cts mm’ of radiolabelled probe and they were coprecipitated with ethanol. The pellet was resuspended in 30 to 50 ~1 of hybridization buffer (80% deionized formamide, 20 mnn-Hepes (pH 65), 94 M-Nacl) and the solution was heated for 10 min at 75°C before being rapidly transferred to a water-ba.th at the hybridization temperature (50°C for the gltX Sau3A probe). After at least 6 h (or overnight) of hybridization, 300 1.11 of ice-cold S, nuclease buffer (30 mlvr-sodium acetate (pH 46)! 1 mivr-%nSG,, 57; (v/v) glycerol containing 50 mM-Pu’acl, 200 units of S, nuclease) was added and the digestion was done at 25°C for 15 to 30 min. The reaction was stopped acet,ate. by addition of 50 ~1 of 4.0 M-ammonium 0.1 M-Na,EDTA followed by extraction with phenol/ chloroform. The nucleic acids were precipitated with ethanol after the addition of 5 pg of carrier tRNA, were resuspended in 10 ,uI of 80% formamide, 10 rnM-NaOH, 1 rnM-Na,EDTA, 0.025% bromophenol blue and 0.025% xylene cyanol, the mixture was heated at 95°C for 2 min and equal volumes were electrophoresed on 6 o/0polyacrylamide gels, containing 8 M-urea, in TBE buffer (Mania& et al., 1982) using the Macrophor System from Pharmacia. (h) Primer extension rrbapping and reverse transcriptase dideoxynucleotide sequencing of RNA For primer extension; labelled oligonucleotide (10 ng) added t,o 50 pg of tota, RNA in 11 ~1 of 130 miv-Tris HCl (pH 8.3) and the mixture was heated at 95°C for 5 min, rapidly transferred to the hybridization t, = temperature, t,- 125°C where 0.4(O/bGC) + 81,5-675/(length of primer) (Davis et aE.> 1986), and hybridized at this temperature for 3 to 10 h. Reverse transcriptase buffer (2 ~1 of 400 mM-KCl, lOQmiv-MgCl,, and I:25 rnivr of each of the 4 dNTPs) and 25 units (1 ~1) of avian myeloblastosis virus (AMV) reverse transcriptase were added to a final volume of 25 ~1 and the reaction was carried out at’ 43°C (or as indicated) for 1 h. The reaction was stopped by addition of 25 ~1 of 10 rnM-Na,EDTA (pH 8.0) and 5 ~1 of 3 M-sodium acetate (pH 7.0) and 10 ,uI of 100 ,ug RNase/ml was added. After 30 min digestion at room temperature, the mixture was extracted with phenol/chloroform, precipitated with ethanol and the pellet was resuspended in 10 ~1 of formamide/dye mix (80% formamide, 002% xylene cyanol, 0.5xTBE buffer). The products were run on sequencing gels as described for S, nuclease mapping. Sequencing of RNA was done essentially as described by Geliebter (1987) with slight, modifications. Labelled oligonucleotide (1 ,rd of 15 pmol/pl) and total RNA (50 pg in 10 ~1 of 250 m&r-KC], 10 rnM-Tris.HCl (pH 8.3)) were mixed and heated at 100°C for 3 min and hybridized for 1 h at f, or t,---5”C, where t, = 4(G+C)+2(A+T) (Suggs et al., 1981). To each ddNTP (1 pl of 1 m&r-ddATP, ddCTP or ddGTP or 2 mM-ddTTP) was added 3.3 ~1 of RT huger (24 mM-Tris HCl (pH 8.3), 16 miv-MgCl,! was

Regulation

?f gltX,

8 mM-dithiothreitol, 0.4 mm-dATP, 0.4 mM-dCTP, @4 mm-dTTP, 0.8 mM-dGTP, 100 pg actinomycin D/ml) containing 2 units of AMV reverse transcriptase and 2 ~1 of hybridization mixture. The reaction was performed at 50°C for 45 min as well as a reaction without any ddNTP and was stopped by addition of 2 ~1 of @3 o/0 bromophenol blue, @3% xylene cyan01 in 100% formamide. The products were run on sequencing gels as described for S, nuclease mapping. (i) Construction of gltX-1acZ translational fusions A gltX-lad translational fusion containing only gZtXp3 was constructed in wivo as follows. The 1.9 kb HincII fragment from pLQ761 lANru1 was cloned into the filledin Hind111 site of pMLB1069. Plasmids with the insert in both orientations (pLQ7623 and pLQ7623r) were purified and used to transform strain MLB4100. The resulting clones were then streaked at high density on lactose MacConkey medium with ampicillin and the plates were incubated at 37°C for 5 days (Berman & Jackson, 1984). Approximately 70 Zac+ papillae appeared with MLB4100 (pLQ7623) and none with MLB4100 (pLQ7623r). Twenty Zac+ clones from MLB4100 (pLQ7623) were purified twice on lactose MacConkey medium and were analysed by restriction digestion of their plasmid DNA and SDS/ polyacrylamide gel electrophoresis of crude protein extracts (Silhavy et al., 1984) A gltX-1acZ protein fusion containing all of the gltX promoters and the upstream vaZU promoter was constructed by cloning the 1.3 kb PvuII fragment from pLQ7610 containing the 1st 8 nucleotides of valUcl and the 1st 1016 nucleotides of gltX in the SrnaI site of pRS414 (obtained from R. W. Simons, Department of Microbiology, University of California, Los Angeles; Simons et al., 1987). This generates an in-frame protein fusion between gltX and lacZ provided the insert is in the right orientation. Transformants were selected at 30°C to obviate the deleterious effects of the strong gltX and valU promoter(s) on plasmid stability (Stueber & Bujard, 1982; Y. Brun, unpublished observations). Equivalent amounts of bright and pale blue transformants were obtained on X-gal. Four colonies of each kind were purified twice by streaking on X-gal and their plasmids were purified. The structure of the plasmids was verified by digestion with CZaI to determine the orientation of the insert. Bright blue colonies were the result of a g&X-ZacZ fusion and pale blue colonies were the result of a “vaZU-2acZ fusion”. In the case of the latter fusion, the ,5-galactosidase activity is probably due to the large amount of ualli-1acZ mRNA transcribed by the strong valU promoter, which permits some translation even though there is no Shine-Dalgarno sequence. The gZtX-ZacZ fusion plasmid pGPVlOl6 was transformed in JP1449 and did not complement the gZtX thermosensitive mutation. The fusion was transferred to 1RS45. Strain JMlOl harbouring pGPV1016 was infected with iRS45 as described by Simons et al. (1987) and a plate lysate was prepared. Phage (10,000 p.f.u.) were plated on LE392 on X-gal and blue plaques were purified twice on X-gal. DNA was prepared from one of the recombinant phages (IRS4 : : GPV1016) and its structure was verified by digestion with EcoRI. Plate stocks of phages were prepared as described by Silhavy et al. (1984). Lysogenizations with phages carrying the fusions were done by infecting bacteria at low multiplicity of infection (@1 to @5 phage/bacteria) to optimize obtention of monolysogens (Plumbridge & S611, 1989). Cells were grown overnight in LBMM medium, resuspended in 10 mM-MgSO,, and 10 ~1 were added to lo7 phages in a

valU

849

and alaW

total volume of 15 to 20 ~1. Phages were preadsorbed for i5 min at 3O”C, 1 ml of LBMM was added and incubation was done overnight at 30°C without aeration. Cells were plated on LBMM X-gal and the palest blue colonies were purified twice by streaking on LBMM X-gal. Several independent stable lysogens were tested for p-galactosidase activity. Values varied as multiples of the lowest value that was considered to come from monolysogens. (j ) Enzyme assays Glutamyl-tRNA synthetase activity was determined as described (Sanfapon et al., 1983). B-Galactosidase activity was determined as described by Miller (1972) and is given as “Miller units” per Ah5,, unit of bacteria.

3. Results (a) Ribosome-binding site for gltX The UAAGG sequence seven nucleotides upstream from the initiator codon of the gltX structural gene (Breton et al., 1986) is complementary to the last five nucleotides at the 3’ end of 16 S rRNA (Steitz, 1979). Analysis with the Perceptron algorithm (Storm0 et al., 1982) of the 100 nucleotides surrounding this sequence gives a value of + 15, indicating an efficient translational initiation site. Recently, it has been proposed that nucleotides +4 to +21 downstream from AUG codons could interact with the first 16 nucleotides from the 5’ terminus of 16 S rRNA through a mechanism analogous to the Shine-Dalgarno interaction with the 3’ end of the 16 S rRNA (Petersen et aE.> 1988). The start of the gltX gene coding region has one string of six nucleotides (AAACTC, position + 11 to + 16) and two strings of five nucleotides (TCAAA, position + 8 to + 12, and CTTCA, positions + 18 to +22) complementary to the end of 16 S rRNA (Fig. 1).

(b) Transcription

of gltX

The gltX gene is directly followed by a structure typical of a rho-independent terminator (Breton et al., 1986). In Northern hybridization with a g&X probe, only one signal is visible, comigrating with 16 S RNA (Fig. 2). A control lane including commercially obtained ribosomal RNA ensured that the signal is not due to cross-hybridization between 16 S RNA and the gEtX probe. Thus, the gltX transcript has a length of about 1540 bp, which is consistent with initiation around -70 relative to the AUG and termination at the rho-independent terminator. The relative increase of the gltX transcript from minimal to rich medium was evaluated by microdensitometry scanning of the autoradiograph in Figure 2 (increase of about 1.2). This value was corrected for rRNA ratio (rRNA represents 81 o/o of the total RNA and roughly 95% of our total RNA minus tRNA, see Ingraham et aZ., 1983) used as an internal standard, which was also measured by microdensitjometry scanning of a negative of the gel

850

Y. v. Brun

-288 CRGGTG~RGCTGAGCTRATCRC~C~C~~T~T~TGGRGTCGCfllTRTRGGGflGflG CTCCRCGAGRGGGTCGRCTiR~Tii?TGGGGGCGflCflCRC&~G&~~ * -10 volu

et al

L&/p 9.5 -

7.5 q

-228 TTCRARRTGRGTCRRCGCRTTTTCTRRRGARRGflflflTTGTTCGTTCGTCGTRflRTTTflRGCflRG RflG~~C~GRTTTCTTTAACRtlGCRflGCflGCRTTTflRflTTCGTTC -35 -35

P2

-35 Sau3A -168

-10 -10

*t(S)

4.4

/&II

=

RT~RTCGCRRRRCRGACCGTG~RATiR~GRRRR~~G~G~~R TRCTAGCGTTTTGTCTGGCACRRCGCGTTRARCRGTTGCTTTTGTTRTTRCGCRTTCCRT

23S* **** -108

(4)

-35

P3

-iO

+ (3b)

***

(3

GARRCCCGRACTACR~RRTCRGGCGGGRGTGR[IRTCGCCCRCTTRflTTTT CTTTGGGCTTGRTGTRRCTCCTTRGTCCGCCCTCRCTflTCTTflTflGCGGGTGflRTTflRflR

+I -++* (1) RBS g/ix TCCAGGRTTTGCCGGTTGTCGGCRTCTTTCTRRRCGTRRGGCCRTTTCflTGflRflflTCRRR RGGTCCTARRCGGCCRRCRGCCGTRGRRRGATTTGC~GGTRRflGTRCTTTTRGTTT * (ZL,

-48

2.4 *

16s

-

!.4 -

+13 RCTCGCTTCGCGCCRAGCCCRRCRGGCTRTCTGCRCGTTGGCGGCGCGCGTRCTGCTCTT +73 TRCTCCTGGCTTTTTGCRCGTRRCCRCGGCGGTGRGTTCGTGCTGCGTflTTGRRGRCRCC Sau3A +I33

GRTCiTGRGCGTTCCACGCCGGRRGCTRTCGRRGCCRTTRT

Figure 1. Sequence of the gltX-valV regulatory region. Asterisks indicate the 5’ end points of the transcripts as determined by S, nuclease mapping for g&X and by RNA sequencing of the primary transcript’ for vaZU. Plus signs (+) indicate the hard stops seen in primer extension experiments that, are not seen in S, nuclease mapping experiments except in an RNase E- strain. The signals are identified (between parentheses) for cross-reference to Figs 3, 4 and 7. The - 10 and -35 hexamers of the g&X and of the valU promoters and the gltX ribosome-binding site (RBS) are boxed. The start of the gltX coding region and of the valUa tRNA are underlined. Arrows identify inverted repeats. The 2 oligonucleotides used in primer extension experiments are underlined by a heavy line. The grey boxes identify vaZU upstream sequences similar to FTS-binding sites. The sequence is numbered with the 1st nucleotide of the g&X coding portion as + 1.

used for the Northern transfer (about twice as much in M as in R lane, result not shown). Thus the gltX mRNA increases 25-fold relative to the rRNA. We then did S, nuclease protection experiments to map the 5’ end of the gltX mRNA using the 305 bp Xau3A fragment going from - 169 to + 136 relative to the start of the gltX coding region as a probe. The signal that can be seen in every well in Figure 4 at 305 bp is not due to protection of the entire probe fragment by a mRNA, since it can be seen in a control reaction including purified tRNA instead of total RNA (Fig. 3, lanes 7 and 15) and in reactions done at 37°C for 45 minutes or at 45°C for 20 minutes where all the other signals have disappeared (results not shown). Also, this signal decreases as the amount of RNA is increased (Fig. 3, compare lanes 3, 4 and 5). If this signal had been due to the probe being completely protected

0.6 -

0.4-

0.3-

Figure 2. Northern hybridization of a g&X probe to E. coli total RNA. Molecular weight markers (lanes 2 and 3) are indicated on the left side. Lane 1 contains commercially available 16 S and 23 S RNA. Total E. coli RNA was isolated from cells grown in minimal medium (M) or rich medium (R) and apparently equal quantities (5 pgj were loaded on the formaldehyde gel. Quantification of the transcripts and rRNA was done by microdensitometry scanning of the autoradiograph and of the photographic negative of the gel.

by mRNA it should have increased in these sonditions. The two strong signals identified as 2 and 3 in Figure 3 represent the majority of gZtX mRNA 5’ ends and their relative intensity varies with growth conditions (Fig. 3, compare lanes 3 and 11). The precise position of the g&X mRNA 5’ ends was determined by primer extension with an oligonucleotide complementary to positions + 16 to + 39 of the gltX coding region and with an oligonucleotide complementary to positions -29 to -6 upstream from the gltX coding region (this oligonucleotide disrupts the stem and loop structure upstream from gltX when it hybridizes to the mRNA). Figure 4 shows t,he primer extension products run along with a plasmid DNA sequencing

Regulation of gltX, Rich SI (units) Time

valU

and alaW

medium

Minimal

medium

200

200

200

0

200

200

200

200

0

(min)

15

15

30

15

15

15

15

30

I5

(pg)

50

100

50

50

t

50

100

50

50

t

II

12

13

14

I5

RNA

I

2

3456

78

9

IO

200 15

ZEI271269-

234-

194-

162-

l43-

Figure 3. S, nuclease mapping of gZtX mRNA isolated from cells grown in minimal or rich medium. Molecular weight markers (lanes 1, 2; 8, 9 and 10) are indicated on the left side. All S, nuclease digestions were done at 25°C. Reaction conditions are indicated above the wells. t indicates reactions where tRNA was used instead of total E. coli RNA. Numbers on the left side are for cross-reference to Figs 1, 4 and 7.

reaction using the same oligonucleotide as primer. The position of the reverse transcriptase stops corresponds very well with the positions assigned to the S, signals using molecular weight standards. The sites have been identified in Figure 1 by asterisks. These sites were also confirmed by RNA sequencing with two different oligonucleotide primers (see Fig. 4(c) for one of them).

(c) A stable stem and loop near the ribosome-binding site of gltX The intensity of signals 1 and 3B in Figure 4(a) is much stronger in primer extension experiments than in S, mapping experiments, where they are almost absent. Since S1 mapping is known to be quantitative (Williams & Mason, 1985), we

Y. V. Brun

852

et a!.

Oiigo. A

C

G

(0) Figure 4. Primer to Pigs oligo 2 done at and the Primer

T

A

P

C

2

I G

T

0

0

B

P

(b)

extension analysis of g&X mRNA. Hard reverse transcriptase st’ops are numbered for cross-reference 1, 3 and 7. (a) A plasmid DNA sequencing reaction (A,C,G,T) was done using the same oligonucleotide primer, (GCCTGTTGGGCTTGGCGCGAAGCG), as for the primer extension reaction (P). (b) The primer extension was 37 “C or at 60°C. Lines joining (a) and (b) identify corresponding signals. (e) RNA sequencing reaction (A,C,G,T) same reaction done without dideoxynucleotides were done with oligo I (GGCCTTACGTTTAGAAAGATGCCG). extension reactions were done under the same conditions with oligo 2 and no dideoxynucleotides (I?).

Regulation of gltX,

valU

and alaW

” u ” 0 c

S.-It

C-G C-G G-C 112 C-G R-U c R G G SIC

853

R

‘A

c

c

R c

9 s RNR

A C

G-C G-U C-G O-C G-C U-R

0 ” C

R -3’ RNA 1

”0” 00”G-C C-G C-G G-C gttx S’Ac””AA0””uUIC cR00R]U ”au-R***RGS

1 ppd!rm4wuuG~

U G R

U-R C-G G-C G-C C u - R’ C-G u u R-U U-A G-C - cuu--

R

gttx

R

G

U G

Figure 5. Secondary structure of the gZtX mRNA and its sequence similarities to the antieodon and dihydroU stems and loops of tRNAG’“. The ribosome-binding site (RBS) and the AUG of gZtX are underlined. The end points of reverse transcriptase primer extension at the base of the structure are identified by asterisks. Sequence similarities are boxed.

G 0

G-C C-G U-G C-G A-U G-C U-A C-G

nRnR

T,

0

gene

32

1 --ffiRGL,,GCG,%WRII;CCRG

R

R-U G-C U-R R-U U-R C-G - CRCC--

RR

U U G

0 U G-C C-G

111 1 -+cuuR~~U~~~C~~GGRW~

suspected that the difference might be due to artifacts of the primer extension method. The possibility that signals 1 and 3B in Figure 4(a) are due to secondary structures of the mRNA causing premature stops of the reverse transcriptase (Tuerk et al., 1988) was tested by doing the primer extension reaction at 37 “C and 50 “C expecting a decrease in the stop signal intensity caused by thermal destabilization of the secondary structures. Figure 4(b) shows that such is the case for signal 1, whose intensity decreases significantly more than the other signals. This strongly suggests the existence of a stable stem and loop close to the ribosome-binding site of gZtX mRNA (see Fig. 5). Furthermore, the precise position of signal 1 in primer extension experiments depends on the exact conditions of the reaction (concentration of dNTP, amount of reverse transcriptase, presence of actinomycin D; results not shown) and on the purity of the mRNA as indicated by the difference between Figure 4(a) (RNA isolated by a single step method) and Figure 4(b) and (c) (RNA purified through a CsCl cushion), whereas the position of the other signals remains unchanged. Just upstream from the position of signal 1 lies a stem and loop structure (energy -6 kcal/mol found by the Fold program (Devereux et al., 1984): 1 cal = 4184 J), which is similar to the anticodon and part of the dihydroU stems and loops of E. coli tRNAG’” (Fig. 5) and to RNase E processing sites (Fig. 6). The case for signal 4B is harder to explain, since its decrease is proportional to the decrease in signals 2 and 3. This signal could be due to a secondary structure different from that mentioned above with an energy of - 14.1 kcal/mol found by the Fold program (results not shown) but its position corresponds to the middle of the stem, which does not correspond to the position expected for pausing of the reverse transcriptase relative to the structure.

R U

UCUWCURRRTGUAflGGCCRuUUCRUG-3’

y

:

- ,wcuuucuRflflc~cwu~gltx

rnRNR

Figure 6. Comparison of previously identified RNase E processing sites for RNA 1, 9 S precursor RNA and phage T4 gene 32 mRNA and adjacent sequences with putative RNase recognition sites of gZtX 5’ untranslated mRNA. For RNA 1, 9 S precursor RNA and phage T4 gene 32 mRNA, cleavage sites are indicated by arrows. For gZtX mRNA, 5’ ends are indicated by arrows. The putative RNase E recognition sites are boxed (adapted from Mudd et al., 1988).

Also, the reaction conditions do not affect its position. So it is probably not due to a secondary structure. It is probable that this signal is due to a transcript initiated at this position but which terminates between the position of the oligonucleotide primer ( + 39) and the Sau3A site from the S1 probe (+ 136). This is consistent with the fact that it is only apparent in primer extension mapping and that its intensity is not affected by the temperature of the reaction. (d) A gltX

promoter

is present

downstream

from PI and P2 It was difficult to attribute signals 2 and 3 (Figs 1, 3, 4 and 7) to transcription initiation from P3. Since the g&X mRNA sequence adjacent to these 5’ ends is similar to RNase E recognition sites (see Fig. 6, Table 3 and Discussion), the possibility remained that signals 2 and 3 were due to processing of signals originating only from the upstream Pl and/or P2 promoter(s). To verify that a promoter was present downstream from Pl and P2, we placed the la& gene under the control of the putative P3 promoter region. The H&c11 fragment from pLQ7611ANruI containing only the putative P3 promoter region

854

Y. B. Brun

N3431 (me-)

et ai.

----

IV3433 (me+)

118

Figure 7. Effect of RNase E on gZtX transcription. S, mapping was done on RNA isolated from isogenic RSase Ii: _ and REase E- (ts) strains grown at 43°C for various amounts of time as indicated over the wells [in min). Plumbers on the left-hand side of the gel are for cross-reference to Figs 2, 3 and 4. M indicates molecular weight markers.

(since HincII cuts downstream from the Pl and P2 -35 hexamers, see Fig. 1) was inserted at the filledin Hind111 site in front of the la& gene in plasmid pMLB1069. We verified that the new upstream sequence coming from pMLB1069 does not provide new -35 hexamers to the remaining portion of PI and P2. Plasmids pLQ7623 and pLQ7623r were then transformed into MC4100 and spontaneous

events permitting the expression of P-galactosidase activit,y were selected by t,he appearance of red papillae on lactose MacConkey medium. This seleetion was possible even though the lacy gene is not present in the MC4100 strain. Lac+ papillae could be obtained only with pLQ7623. Stable lacf colonies were purified from the lac+ papillae and the protein and DNA content of some of the lac+ recombinants

Regulation

P3

of gltX,

ATG

valU

glfX

P3

TAA

ATG

855

and alaW

Term.

I

Codon 49 of g/fx

Codon 9 of IOCZ

o

b

Figure 8. Structure of gZtX-la& protein fusions constructed in vivo. (Top) Structure of plasmid pLQ7623 insert. (Center) Structure of plasmid pLQ7623-15 obtained by spontaneous deletion of the region indicated herein. (Bottom) Sequence of the gZtX-la& junction that contains part of the coding portion of ORF62.

was determined, showing that the putative P3 promoter and the 48 first codons of gltX are still present, while the remainder of the structural gene and the terminator have been deleted, leaving about 60 bp from the end of the H&c11 fragment. These 62 nucleotides are part of the coding region of ORE’62 (see the accompanying paper). Codon 9 of 1acZ is in frame with the gltX gene and there are no stop codons between these two genes (Fig. 8). Plasmid pLQ7623-15 was transformed into AB347 and the fl-galactosidase activity from this translational fusion was shown to be 4000 Miller units in LB medium (average of 4 independent measure-

was analysed. Spontaneous deletions of different size were evident from the decreasing size of the hybrid proteins and of the H&c11 fragments from

the plasmids (the original 2800 bp fragment is now from 2650 to 950 bp in size: Sanfagon, 1985). The decrease observed in the size of the H&c11 fragment was reflected by a corresponding decrease in the size of the fusion protein (Sanfapon, 1985). Plasmid pLQ7623-15 was chosen for further studies, since it bears one of the largest deletions. This plasmid does not complement the temperature-sensitive mutation of the gltX gene when used to transform strain JP1449. The DNA sequence of the fusion junction

Table 2 Comparison Promoter (signal no.)?

of promoter

7 Refers to Figs 2 and 3. $ Start sites are underlined. capital letters. 0 Harley & Reynolds, 1987. 11Lindahl & Zengel, 1986. 1 Fournier 8: Ozeki, 1985.

Start sit&

gcgtaaggt

AATTTGTCAACGAAAAC aATAAT ACGAAAACAATAATGCGTAaggT AATCAGGCGGGAGTGA TAgAAT TATAAT 17 & lbp GGCCGGAATAACTCCC TATAAT

agaaacccg

T CATTTTGAACTCTCCC CATTCGGGCGGAATTCA

Nucleotides

similar

region

-10

Spacer

-35

GTTGc g c YltXPl (5) tTTGtCA YltXP2 (4) aTTGAg g YltXP3 (3) prom. c0ns.p TTGACA TTGT CA rm Pl cons.ll Discriminator r-proteins11 VCLlUp GTTGAC t GTTGACA ala Wp tRNA cons.1 GTTGACA

sequences in the gltX

TATAAT TATgAT TATAAT

atCgCCC&ttaattt 7+lbp GCGCCACCA NCN k/c)C(g/c)CC GCGaCtCca GCcgCCCgtca GCGCCCC

to the consensus stringent

discriminator

are in

Y. V. Brun

856

minutes. At 35 minutes there is a transient increase in signals 2, 4 and 5, which decrease afterwards. There is also a marked increase in degradation products (signals 1 and below), whose importance relative to the total g&X mRNA signals increases considerably through time. These changes are not seen in the RNase E+ strain, in which all signals decrease through time.

Table 3 Sequence similarities between RNase E recognition sites and the putative RNase E recognition sites of gltX mRNA Recognition sequencet

mRNA 9Sa 9Sb RNA1 T4 gene 32

Correspondence with consensus lO/lO 4/10 lo/lo 5/10

Consensus

ACAGAAUUUG AUCAAAUAAA AC AGUAUUUG UGCGAAUUAU A AC AG$JUUG

gEtX signal 3 gZtX signal 2

AC UUAAmU CCAGGAUUUG

7/10 s/10

(f) Transcription

t The nucleotide 3’ to the RNase E cleavage site is underlined. For gZtX, the 1st nucleotide of the mRNA is underlined.

ments), indicating that there is an active promoter in vivo downstream from the HincII site. In order to verify the importance of regions upstream from HincII, i.e. promoters Pl and P2, we constructed a translational fusion containing all the gltX promoters and the upstream valU promoter (see Materials and Methods). The activity of the fusions was measured for pGPVlOl6 and for the same g&X-la& fusion harboured by a il vector monolysogenized in MC10611 (Table 4). (e) S, mapping of gitX mRlNA

in an RNase

E-

strain

Isogenic RNase E+ and RNase E- strains from overnight cultures at 30°C were inoculated at an A 550 of 0.05 in LB medium and grown at 30°C in an air shaker (generation time about 30 min) until an A 550 of 92 was reached. At this point, cultures were transferred to a 43°C water-bath. Cell samples were taken at 0 minutes (just before the shift), 15 minutes, 30 minutes and 60 minutes after the temperature shift, chilled in an ice-bath, centrifuged and total RNA was extracted by the rapid singlestep method. S1 nuclease protection using the 5’ end-labelled gltX 305 bp Sau3A fragment probe was then performed with 50 pg of RNA for each time point. Some changes appear in the RNase E- strain after transfer at 43°C that are not seen in the RNase E+ strain (Fig. 7). First, signal 3b appears in the RNase E- strain at 15 minutes and increases relative to the total gltX mRNA signals at 30 and 60

Activity

et al

of the va!IJ and alaW Gperons

The initiation of transcription site for the v&U operon was determined by RNA sequencing using oligonucleotide 4 complementary to positions 1528 to 1552 (Fig. 5 of the accompanying paper) in the intergenic region between valUor and vaEU/I in order to detect only the primary transcript. The sequence on the autoradiograph shown is hard to read due to multiple stops of the reverse transcriptase caused by the extensive seeondary structure of this region (Fig. 9(c)). Overexposed and underexposed autoradiograph of the same gel (not shown) permitted us to read the sequence over the whole region with only a few ambiguities (indicated by asterisks in Fig. 9), indicating that it is indeed the primary transcript of the valU operon that is read. The site of initiation of transcription of ala W was determined by the same method using oligonucleotide 3 complementary to positions 4302 to 4280 (Fig. 8 of the accompanying paper). Since the oligonueleotide used in this experiment lies upstream from the first t,RNA and there are no secondary structures in this region, the sequence is clear at all positions (Fig. 9). It is surprising that the valU and alaW primary transcripts can be detected at all, since the E. coli C600 strain from which the RNA was extracted is not deficient in RNases (Appleyard, 1954).

4. Discussion (a) Nature

of the gltX,

valU and alaW transcripts;

The length of the gltX transcript observed in Northern hybridization experiments under fast and slow growth conditions (1.5 kb transcript compared to l-4 kb for the g&X coding region) indicates that the gltX mRNA is monocistronic under these conditions. Overexposure did not reveal transcripts other than that seen in Figure 2, except for a smear under the g&X signal probably due to degradation of the g&X mRNA (not shown). Thus the gltX mRRA

Table of gltX-1acZ fusions

Strain/fusion

gltX promoter(s)

AB347/pLQ7623-15 MC1061/pGPV1016 ~‘IC106l/lRS45 : : GPV1016

P3 PI, P2 and P3 PI; P2 and P3

&Gal. activity (Miller units) 4000 14,000 245

Regulation A

C

G

T

of gltX,

valU

and alaW

857

0

T G

T G T C G c*

\

c* c*

A

C’

-G

T

0

M

C’ A C T A A

-C

I

A G T T G A G

C* G A G T C’ G

/

A C c* C’

T C T C G T G G

.c* c* C C C A

A

G*

G

C

s

C G

(b)

C

A

A A G C T A c c .G*

(a)

Figure 9. RNA sequencing of the putative primary transcript of valU and alaW. (a) For the valU primary transcript, an RNA dideoxynucleotide sequencing reaction was done (A,C,G,T) using oligo 4 and run together with the product of the same reaction without dideoxynucleotides (0). The readable sequence from this and underexposed and overexposed versions of this gel (not shown) is indicated on both sides of the autoradiograph. The asterisks indicate regions where sequence was unreadable due to secondary structures of the RNA. (b) Indications for aZaW (sequence done with oligo 3) are the same except that - indicates a well with no reaction product and M indicates a molecular weight marker.

most probably terminates at the putative rho-independent terminator located just downstream from the gltX stop codon (Breton et al., 1986) and termination at this site is very efficient, i.e. almost 100%. It is probably not cotranscribed with the down-

stream ORB’62 (see Pig. 8 of the accompanying paper) unless there is processing of a cotranscript. This implies that if ORB’62 is transcribed, it is probably so by initiation at the putative promoter identified upstream from it (accompanying paper).

858

Y. v. Brun

It is possible also that, under certain growth eonditions, the g2tX terminator is less efficient and permits cotranscription of ORF62. The aZaW tRNA operon is situated 08 kb downstream from gltX (accompanying paper) and analysis of gltX transcription shows that gltX and alaW are not cotranscribed. The nZaW site of transcription initiation has been mapped by primer extension. It corresponds to the position expected from a extremely similar to the consensus sequence sequence for tRNA promoters (12/13 matches with a 17 bp spacer, see Table 2). Following the - 10 is a GC-rich hexamer of the alaW promoter sequence similar to the so-called stringent discriminator sequence believed to be involved in the stringent response (Fournier & Ozeki, 1985; Travers, 1984: 5/7, Table 2). There is also an AT-rich sequence upstream from the promoter. An inverted repeat overlaps the promoter as has been seen for almost all tRPI;A promoters (Fournier & Ozeki, 1985). Immediately downstream from the last tRNA in the operon is a putative rho-independent terminator that is probably the site of transcription termination for alaW. It is directly followed by a putative promoter for ORF167 (accompanying paper). The valU transcription initiation site was also mapped by primer extension. The site of initiation agrees very well with the predicted position from the putative vaEU promoter (12/13 matches with a 16 bp spacer). Inverted repeats are found overlapping this promoter, which has a GC-rich sequence downstream from the - 10 hexamer with five out of seven matches to the stringent discriminator (Table 2). The primary transcript’ of vaZU probably extends through the whole valU operon’s four tRNA genes (valUa, valU/I, valUy and lysV, see the accompanying paper) terminating at the putative rho-independent terminator located immediately downstream from the last tRNA gene of the operon (see Fig. 5 of the accompanying paper). One interesting and uncommon feature for tRNA genes is seen for both val U and ala W. We were able to detect substantial levels of their primary transcripts in wild-type cells (Fig. 9). This is usually not the case. Transcripts of tRNA genes with immature 5’ ends can not be isolated from wild-type E. co&. tRNA precursors can accumulate when cells harbour multicopy plasmids containing tRNA genes or when abnormal (mutant) precursors are present, causing a slower rate of processing (King & Schlessinger, 1987; King et al,, 1986). Primary transcripts are also observed in RNase-deficient strains (e.g. in the case of thrli; Hudson et al., 1981). one tRNA gene has been shown to However, generate a relatively stable primary transcript having a functional significance in wild-type cells (Nomura et al.? 1987). Transcription of the ZeuX gene (encoding a minor species of leucine-specific tRNA; Nomura & Ishihama, 1988) is under stringent and growth rate-dependent control but the level of mature tRNA remains constant under various growth conditions. The level of primary transcript varies with growth rate and it is

et ai

presumed that in the case of beuX, processing :s limiting and keeps the level of mature tRNA constant. A primary transcript for the PI promoter of pheV was also detected by S1 mapping of RNA isolated from a wild-type strain for R(Nases but, t,he functional significance of this observation ha,s not been studied further (Caillet et al., 1985). The fact that alaW and valU primary transcripts can be detected in a wild-type E. coli strain may have a functional significance. We hsve shown ‘that the gltX mRNA is probably processed and that g&X and valU transcription could be coupled (see section (b), below). Tt is strange, however; that this has been observed for two tRNA operons with no obvious relationship other than being adjacent t’o gltX. Alternatively, it may be that our method of RNA isolation and the fact that the CsCl cushion ultracentrifugation eliminates tRNAs (Chirgwin et al., 1979); permitting visualization of primary tra,nscripts by primer extension. Indeed, our method is derived from a method that permitted the identification of polyadenylated prokaryotic mRNA et al., 1987). (Taljanidisz (b) Transcription

of gltX

The gZtX mRNA proximal 5’ ends are by far the most abundant in the two media tested. This does not correlate well with the strength expected from the degree of similarity of the promoter sequences with the consensus E. coli promoter sequence (Table 2). The P3 promoter is close to consensus but its -10 hexamer is separated by 14 bp and 24 bp, respectively, from the 5’ ends corresponding t,o signals 2 and 3; a situation that is clearly suboptimal (Harley & Reynolds, 1987). On the basis of their better similarity to the consensus sequence, promoters Pl and P2 should be the strongest of the three. These considerations suggested the possibility that only Pl and P2 are transcribed, and that signals 2 and 3 are the result of processing of transcripts initiating from the distal promoters. This would mean that the primary transcripts are processed very rapidly and that the mature mRNA is very stable. However, the construction of g&Xla& protein fusions indicates that P3 is a strong promoter. The fact that, we could construct g&Xla& protein fusions lacking PI and P2 in a JacY deletion strain by in viva selection of spontaneous fusions indicates that there is a very strong promoter downstream from P2. Data from gene fusions also indicate tha,t the region upstream from P3 is important for optimum strength of gltX t.ranStrains harbouring the pGPV1016 scription. plasmid with gltX-la& protein fusions containing all the gltX promoters and the valU promoter have t*hree- to fourfold more /3-galactosidase activity than strains harbouring pLQ7623-15 (Table 4). Also, the GPV1016 fusion generates only about 16-fold less /3-galact,osidase activit,y than pLQ7623-15 when present at one copy per cell in ,? monolysogens (Table 4) although pBR322-derived vectors are present at more than 25 (Ausubel et al., 1989) and

Regulation qf gltX, valU and alaW up to 50 copies per cell (Silhavy et al., 1984). It is evident from the S1 and primer extension analysis that there is at least one and probably two gltX promoters upstream from P3. As is shown in Figure 6, the region adjacent to the 5’ ends of the gltX mRNA corresponding to signals 2 and 3 is very similar to RNase E processing sites. These sites have always been found to be followed by a stem and loop structure (Mudd et al., 1988). A decameric consensus RNase recognition sequence has been proposed (Tomcsanyi & Apirion, 1985). The sequences surrounding the position of signals 2 and 3 of gltX are very similar to this consensus sequence (8 out of 10 matches for signal 2, and 7 out of 10 for signal 3; see Table 3), even more so than the 9 S precursor of 5 S rRNA cleavage site 9 Sb (4/10) and the phage T4 gene 32 mRNA cleavage site (S/10). The position of signal 2 agrees perfectly with the predicted RNase E cleavage site, whereas the position of signal 3 is only one nucleotide downstream. The position of the putative RNase E processing site in gltX mRNA with respect to the stem and loop structure also agrees very well with the other RNase E processing sites. In this respect, the putative RNase E recognition sequence for g&X signal 2 is very close to the stem and loop structure, as is the case for other RNase E recognition sequences (Fig. 6). RNase processing of mRNA transcripts has been shown to affect mRNA stability in a number of cases (Brawerman, 1987; Nilsson et al.? 1988). In most cases, mRNAs are cleaved at their 3’ end, resulting in a decreased stability and degradation in the 3’ to 5’ direction. Some cases of RNase cleavage in the 5’ untranslated regions resulting in decreased stability of the mRNA are known. The mRNAs for the RNase III, the polynucleotide phosphorylase and the fip’ subunits of RNA polymerase are processed at their 5’ end, resulting in a marked decrease in stability (Portier et al., 1987; Bardwell et al., 1989). Conversely, cleavage of the T4 gene 32 mRNA by RNase E increases its stability but decreases that of the upstream mRNA (Mudd et aE., 1988). If the putative RNase E recognition sites of g&X mRNA are indeed cleaved by this enzyme, the effect might be to stabilize the gZtX mRNA. Indeed, the structure of the 5’ untranslated mRNA leaders of the gZtX and T4 gene 32 mRNAs are very similar with mRNA 5’ ends just upstream from a stem and loop structure itself situated a few tens of base-pairs upstream from the initiation codon. It has been shown that the synthesis of a number of proteins was drastically reduced in an RNase E strain (Gitelman & Apirion, 1980). Inactivation of the RNase E from a strain thermosensitive for this enzyme increases the amount of degradation products of gZtX mRNA (Fig. 7). A signal also appears at position 3b, which would be a perfect start site for P3, being situated 8 bp downstream from the - 10 hexamer instead of 14 bp for signal 3. No case of transcripts initiating I4 bp from its promoter is known in 263 itemized promoters (Harley & Reynolds, 1987). It is thus

quite probable that signals 2 and 3 are due to RNase E processing products of g&X mRNA initiated at the upstream Pl, P2 and P3 promoters. These RNase E products are probably very stable, since they represent the majority of gltX mRNA in steady-state growth (Figs 2 and 3). The strength of the gZtX mRNA signal (Figs 2, 3 and 4) probably reflects its high steady-state level in the cell, which may be due to both a high rate of synthesis and relatively long half-life. The decay rates of mRNA species in E. coli can differ by as much as 50-fold (Nilsson et al., 1984; Pedersen et al., 1978). Structural determinants at either ends of mRNAs appear to contribute substantially to this stability (Kennell, 1986). The gZtX mRNA is probably stabilized by the stable hairpin at its 5’ end and its strong rho-independent terminator. The absence of increase of the upstream transcripts except for the P3 transcript could be explained by the fact that these mRNAs are relatively unstable. This would also explain why the signals from promoters predicted to be strong from their sequence (Pl and P2) seem so weak. Signal 3b, which appears when the RNase E is inactivated, is very strong in primer extension experiments (Fig. 4) but is not seen in S, nuclease mapping of RNA from wild-type strains or from the RNase E- strain grown at permissive temperature. This suggests that an abundant message initiated at this site from promoter P3 either terminates between the position of the oligonucleotide primer (+ 39 of the gltX coding region) and that of the Sau3A probe 5’ end (+136 of the g&X coding region) or is cleaved between these positions. There is, however, no indication from the sequence of this 100 bp region for the presence of secondary structures that might be involved in either of these mechanisms. Experiments are in progress to determine the significance of this observation. It is probable that signals 2 and 3 are the result of RNase E processing of transcripts from promoters Pl, P2 and/or P3. The high level of /?-galactosidase activity generated by gltX-1acZ fusion harboured by pLQ7623-15 even in the absence of Pl-P2 is explained by the presence of P3, which is close to consensus and probably promotes initiation at site 3b situated 8 bp from the P3 - 10 hexamer. Steric hindrance should prevent transcription from occurring simultaneously from any combination of Pl, P2 and P3, since RNA polymerase is known to protect DNA from -50 to +20 relative to the site of transcriptional initiation (Bujard et al., 1987; Metzger et al., 1989). Removal of Pl and P2 might permit P3 to be expressed optimally. These data indicate that gltX has three promoters, identified as Pl, P2 and P3 in Figure 4. (c) Common

upstream

activating

sequences

for

gltX and valU The sequence downstream from the - 10 hexamer of gltXp3 is similar to the stringent discriminator sequence of ribosomal proteins (5 out of 6, see

860

Y. v. Brun

Table 2). tRNA genes respond to t’he stringent control and the valU promoter also has its discriminator sequence (5 out of 7; see Table 2). Secondary RNA polvmerase binding sites and AT-rich blocks (consensus ATTTTTCT, centred at -50 and - 70 from the site of initiation; see Travers, 1984) are also found in the region separating the gltX and vaZU promoters. Both the discriminator and the upstream activating sequences play a role in stringent control and metabolic regulation (Baracchini & Bremer, 1988; Travers et al., 1986). Furthermore, upstream activating sequences (CAS) positioned roughly -40 to - 130 from tqfB (van Delft et al., 1987; Vijgenboom 8: Bosch, 1988), tyrT (Lamond & Travers, 1983) and rrnB Pl (Gourse et al., 1986: and see Fig. 11) have been shown to be essential for optimum strength of these promoters and are believed to be important for the strength of most stable RNA promoters (Jinks-Robertson & Nomura, 1987; Bauer et al., 1988; Bossi & Smith, 1984). The DP\‘A in the UAS region is known to be bent (Gourse et al.; 1986; Bauer et al., 1988; Bossi & Smith, 1984) and these UAS can probably function in both orient,ations (Travers, 1984). Nilsson et al. (1990) have shown that the FIX (factor for inversion stimulation) protein binds to the UAS regions of tufB, tyrT and rrnB PI, and stimulates in vitro transcription of tufB by facilitating binding of RNA polymerase to the promoter (Fig. 11). Thev showed also that activation of tufB transcriptron after growth shift-up is dependent on the UAS and FIS. The same kind of transient burst in transcription during growth shift-up has been described for rrnB (Lukacsovich et al., 1987). FIS is also involved in site-specific recombination by stimulating a conformational change manifest,ed by DNA bending in a &s-acting recombinat’ional enhancer sequence (Hiibner & Arber, 1989). Another DNA-bending protein, the integration host factor, has been proposed to be involved in transcriptional regulation (Santero et al., 1989). Interestingly, there is a 90% (19/21) similarity between position - 19 to +2 of the ualli promoter and of the consensus sequence of the extensively conserved rRXA operons Pl promoters (Lindahl & Zengel, 1986). The same type of extensive similarity has been found between the rrn Pl - 10 region and the trmA promoter. The trmA gene is regulat,ed like stable RNA genes in a number of conditions (K. B. Esberg, C. E. D. Gustafsson & 0. R. Bjork, personal communication). This kind of similarit,y is not found in any other tRNA gene promoter, except for thrU, which is the first tRNA following the tufB promoter (62 yz& similarity with rRNA PI in the same region). This region of similarity cont,ains the stringent discriminator sequence of rRNA operons. There is also a lo/14 similarity between regions centred at - 50 of val c:’ and rr. Pl Because the FIS protein binds to the UAS sequences of tyrT, tufB and rrnB PI, we tried to align the region of their promoters to t.hat of valU up to about -100 (Fig. 10). The only gaps int’roduced were to align the - 35 and - 10 hexamers of the promoters, since

et al.

Figure 10. (a) Aiignment of the promoter regions ~OI valli, rrnB PI, tyrT and tufR. The -35 and - 10 hexamers and the transcription initiation sites are underlined. In t,he consensus sequence (cons), capital let’ters indicate an identity in the 4 positions and small ietters indica,te 3 identities. (b) Similarity of the regions at -70 and -50 to the FIS-binding site consensus (Hiibner & Arber; 1989). Identities are underlined. (c) Similarity of the second FIS-binding site of tufB (- 118 to - 131) to a sequence upstream from vail’ and to t’he FIS-binding site consensus. Identities between the tufB and ,call;: sequences are indicated by vertical lines and identities to the FE-binding site are underlined.

the spacer was not, the same length in all cases. The alignment reveals striking similarities in five segments between these four promoters. From - 19 to + 1 i 80 y. (I S/20) of the positions contain at least three identical nucleotides. This region includes the discriminator sequence, which has been discussed. From -46 to -57 there is 83% (10/l 2) occurrence of three identical nucleotides and from - 65 to - 83, there is 58% (1 l/19) occurrence of three identical nucleotides. The overall total is 52% (43/82) occurrence of three identical nucleot,ides from -83 to i-2. The two regions of similarity upstream from the promoters are AT-rich and are centred around -50 and -70. Regions of this type have been proposed to be involved in the strength of stable RNA promoters (Travers, 1984) and their position corresponds to the position of the UAS of ~0, tu@ and rrnB P1 (see Figs 10 and 11). FIS binds Taot~he same region (Fig. ll), and sequences similar to the FIS binding site consensus (Hiibner & Arber, 1989) can be found in the highly similar regions centred at

Regulation

-98 --

-40-35

-10 -+

-98

of gltX,

+jTT +50

-76

No cOmDlex

+50

valU

and alaW

861

aminoacyl-tRNA synthetases have to respond similarly to growth conditions strongly suggest that their transcription is coupled, at least for growth shift-up. We have indicated in Figure 1 the regions with respect to valUp corresponding to the proposed position of the FIS-binding sites. Binding of FIS to these two regions could stimulate transcription initiation at valUp by facilitating binding of the RNA polymerase. It could also stimulate transcription of the gltX promoters by the same mechanism. FIS binding to the putative site in the Pl-P2 region would prevent binding of RNA polymerase to these promoters, thereby activating the potentially strong gltXp3 promoter (as suggested by gltX-1acZ fusions lacking Pl-P2). (d) Metabolic

Figure 11. Position of the upstream activating sequences and FIS-binding sites of tufB, tyrT, rrnB Pl and valU. Sites of transcription correspond to the beginning of the arrows. The UASs are indicated over the line representing the sequence and the FIS-binding regions are indicated under. The start of the gltX coding region is indicated by a wide arrow. The proposed FIS-binding site corresponding to the 4 genes is indicated. H, Upstream activating sequence; q , FIS-binding sites; q , no FIS binding.

-50 and -70 (Fig. 10). Since another FIS-binding site has been identified from - 118 to - 131 of tufB, it seems that the -48 to - 81 region could indeed contain two binding sites, since it is twice as long as the former. Figure 11 shows the UAS and FISbinding regions of tyrT, tufB and rrnB Pl together with the regions similar to FIX binding sites. The position of these regions corresponds perfectly. This strongly suggests that the regions of similarity we have identified around -50 and -70 are involved in the regulation of stable RNA promoters. In the case of tyrT, there is no FIS binding to a fragment from -76 to +50, indicating that the second site shown in Figure 10 might not be recognized by FIS. From the similarity to the sequences known to bind FIS, it seems highly probable that there is an FIX-binding site at least from - 77 to - 63 of valU. There is also a strong region of similarity between the second FIS-binding site of’ tufB ( - 118 to - 131) -106 to - 120 of vaZU (13/17; see with positions Fig. 10) and both these sequences are similar to FIS-binding sites. Analysis of the DNA in the gltXvalU regulatory region with the ViewDNA program (Tung & Harvey, 1986) indicates that it is bent (not shown). The facts that gltX and valU are closely spaced and divergent, that their promoters share the same upstream region and that tRNAs and

regulation

The substantial increase in gZtX mRNA when the cells are grown in rich medium relative to minimal medium (Figs 2 and 3) indicates that transcriptional control is a major mechanism for the metabolic regulation of GluRS level. It also suggests the need for a burst of gltX transcription during growth shiftup as alluded to in the preceding section. The role of transcriptional control was shown for the metabolic regulation of tryptophanyl-tRNA and valyl-tRNA synthetases (Reeh et al., 1977; Hall & Yanofsky, 1981). The increase of gZtX mRNA observed is higher than that of rRNA used here as a natural internal standard. In similar conditions, the level of GluRS increases 2.5fold (McKeever & Neidhardt, 1976), which is lower than the increase observed with ribosomes in the same conditions (GrunbergNanago, 1987). So, the g&X mRNA level increase is higher than that of rRNA; whereas that of the GluRS is lower than that of the ribosomes. A similar observation was reported for E. coli glutaminyltRNA synthetase (Cheung et al., 1985). Growth control of rRNA synthesis in E. coli appears to be the same as stringent control: both being mediated by the action of ppGpp on the transcription from promoters containing a GC-rich discriminat,or region immediately downstream from the - 10 consensus sequence (Travers, 1987; Baracchini & Bremer, 1988). The presence of a stem and loop similar to the tRNAG1” anticodon region adjacent to the gltX ribosome binding site (Fig. 5) and the RNase E processing of gZtX mRNA suggest that mechanisms other than stringent/metabolic control of gltX transcription contribute to the metabolic regulation of GluRS biosynthesis. The gZtX mRNA is probably stabilized by RNase E processing. Also, the GluRS or other proteins having tRNAG*” or Glu-tRNAG’” as a substrate (see conclusion) could bind to the tRNAG1”-like structure on the gltX mRNA. Indeed, this situation is analogous to that reported for the translational control of the threonyl-tRNA synthetase biosynthesis gene, where the translational operator near the thrS mRNA ribosomal binding site is similar to the anticodon stem and loop of two tRNATh’ isoacceptors (Springer et al., 1986). The distance of the

862

Y. V. Bun

tRNA”‘“-like secondary structure from the AAGG of the ribosome-binding site is 12 nucleotides, which is similar to that observed between translational operators and adjacent ribosome-binding sites of E. coli thrX gene (Springer et al., 1986) and Lll r-protein operon (Cole & Nomura, 1987). Translational control appears to be the main mechanism for metabolic regulation of Ll 1 r-protein operon regulation, since its loss due to a mutation disrupting the secondary structure of the translational operator is accompanied by the loss of the growth-rate dependency of its expression (Cole & Nomura, 1987). Although the Lll operon has a promoter with a GCrich discriminator sequence, the stringent control of its expression is also mediated by translational control (Cole 8; Nomura, 1987). The use of mutants altered in the transcriptional regulatory re ion of gZtX (Fig, 1 and Table 2) and in the tRNA %lu -like hairpin should reveal the contribution of transcriptional and of post-transcriptional control to the metabolic regulation of GluRS biosynthesis. (e) General discussion The presence of three promoters, of RNase E processing sites and of a tRNAG1”-like stem and loop for gltX and its possible co-ordinate regulation with vallJ suggests that g&X is subject to a very complex regulation. What could be the reason for such a complex regulation for the biosynthesis of an aminoacyl-tRNA synthetase? GluRS participates in processes other than proIt has been shown that tein biosynthesis. Glu-tRISAG1” is a precursor for the synthesis of acid (DALA), the universal &aminolevulinic precursor of porphyrins, in the chloroplasts of higher plants (Sehiin et al., 1986) and in a number of bacteria (O’Neil et al., 1988). This is also the case in E. coli where the enzymic activity lacking in a hemA(DALA auxotrophic) strain is that of glutamyl-tRNA dehydrogenase (Avissar & Beale, 1989). This strain has a GluRS-specific activity that is reduced twofold relative to an isogenic hemA+ strain. This could be due to co-ordinate regulation of the enzymes involved in DALA synthesis resulting in a lower cellular content of the GluRS when the dehydrogenase is not produced or a lower rate of its synthesis in the presence of exogenous DALA, which has to be supplemented in the medium of D$LA auxotrophs (Avissar & Beale, 1989). Since the possession of a UUC glutamate anticodon by the tRNAG’” could be a requirement the Glu-tRNA dehydrogenase reaction for (Schneegurt’ & Beale, 1988), it is possible that the dehydrogenase interacts with the anticodon as is the case for the GluRS (Kern & Lapointe, 1979; Kisselev, 1985). It is thus possible that the dehydrogenase interacts with the tRNAGIU-like stem and loop of t,he gltX mRNA. The hemA genes of E. coli and S. typhimurium have been cloned and sequenced, and they probably encode the Glu-tRNA dehydrogenase (Drolet et al.; 1989; Elliott, 1989). Downstream from the hemA

et al.

genes is the prf’ gene encoding the peptide ebain release factor 1 (RFl) and the two are cotranscribed at least in X. typhimurium (Elliott: 1989). fn S. typhimurium, there is a loo-fold greater demand of supplementing DALA to restore wild-type growth of hemA mutants in rich medium relative to minimal medium, probably reflecting a higher heme demand in fast, growth conditions (Elliott & Roth, 1989). All this suggests that protein synthesis and porphyrin synthesis could be co-ordinately regulated by tRNAG1” and Glu-tRNAG1” synthesis (Schneegurt & Beale, 1988). We thank M. Orunberg-Manago for encouragement, for stimulating discussions and for welcoming one of us (Y.B.) in her laboratory, where part of this work was done during a Collaboration France-Q&bee. 3. Caillet, P. Regnier, S. Laberge, C. Thermes, C. Portier, M. Uzan and D. Apirion are thanked for helpful discussions, F. Binette for help with the RNA isolation, L. Turgeon for help with the microdensitometer scanner, M. Rouleau for excellent technical assistance, C. Lemieux for synthesizing the oligonucleotides, M. Berman and R. W. Simons for the gift of plasmids. We thank M. Springer and J. Plumbridge for help and suggestions with the construction and use of gene fusions and for very stimulating discussions. We thank L. Bosch for very stimulating discussions and for communicating his result,s before publication. Y .B. and H.S. were predoctoral fellows from NSERC, R.B. from FCAR. This work was supported by grant $-9597 from the National Sciences and Engineering Research Couneii of Canada, grant E&-1700 from the “Fonds FCAR du Gouvernement dn Quebec” to J.L. and grant 20-01-05-85 from the Minis&e des Relations Internationales and the Ministere de 1’Enseignement Superieur et de la Science du Quebec.

References Akins, R. A. & Lambowitz, A. M. (1987). CeEE, SO, 331-345. Appleyard, R. K. (1954). Genetics, 39, 440-452. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D., Seidman, J. G., Smith, J. A. & Struhl: K. (1989). Editors of Current Protocols in Molecular Biology. John Wiley & Sons, New York. Avissar, Y. J. & Beale, S. I. (1989). d. Bacterioi. 171, 2919-2924. Bachmann, B. J. (1987). In Escherichia coli and Salmonella typhimurium, Cellular and Notecular Biology (Neidhardt, F.? ed.), pp. 807-876, ABM, Washington, DC. Baracchini, E. 8r Bremer, H. (1988). J. Biol. Chem. 263, 2597-2602. Bardwell, J. C. A., Regnier, P.; Chen, S.-M., Nakamura, Y., Grunberg-Manago, M. & Court, D. L. (1989). EMBO J. 8; 3401-3407. Bauer, B. F., Kar, E. G., Elford, R. M. & Holmes, W. M. (1988). Gene, 63, 1233134. Beck, C. F. & Warren, A. J. (1988). Mierobiol. Rev. 52, 318-326. Berk, A. J. & Sharp, P. A. (1977). Cell, 12, 733-739. Berman, M. L. & Jackson, D. E. (I 984). J. Baeteriol. 159; 750-756. Blumenthal, R. M., Lemaux, G. P.; Neidhardt, F. 6. %r Dennis, P. P. (19’77). Mol. Gen. Gene& 149, 291-296. Bossi, L. & Smith, D. (1984). CeEZ,39, 643-652. Brawerman, G. (1987). Cell, 48, 5-6.

Regulation

qf gltX,

Breton, R., Sanfagon, H., Papayannopoulos, I., Biemann, K. & Lapointe, J. (1986). J. Biol. Chem. 261, 10610-10617. Brun, Y. V., Breton, R., Lanouette, P. & Lapointe, J. (1990). J. Mol. Biol. 214, 825-843. Bujard, H., Brunner, M., Deuschle, U., Kammerer, W. & Knaus, R. (1987). In RNA Polymerase and the (Reznikoff, W. S., et al., Regulation of Transcription eds), pp. 95-103, Elsevier Science Publishing Co., Inc., New York. Caillet, J., Plumbridge, J. A. & Springer, M. (1985). Nucl. Acids Res. 13, 3699-3710. Casadaban, M. J. & Cohen, S. N. (1980). J. Mol. Biol. 138, 179-207. Cheung, A Y., Watson, L. & Sail, D. (1985). J. Bacterial. 161; 212-218. Chirgwin, J. M.; Przybyla, A. E., MacDonald, R. J. & Rutter, W. I. (1979). Biochemistry, 18, 5294-5299. Chomczynski, P. & Sacchi, N. (1987). Anal. Biochem. 162, 156-159. Cole, J. R. & Nomura, M. (1987). In Molecular Biology of tRNA: New Perspectives (Inouye, M. & Dudock; B. S., eds), pp. 371-379, Academic Press, New York. Dalrymple, B. 85 Mattics, J. S. (1986). Biochem. Int. 13, 547-553. Davis, L. G., Dibner, M. D. & Battey, J. F. (1986). Basic Methods in Molecular Biology, Elsevier Science Publishing Co., New York. Devereux, I., Haeberli, P. & Smithies, 0. (1984). Nucl. Acids Res. 13, 387-395. Drolet, M., PBloquin, L.; Echelard, Y., Cousineau, L. & Sasarman, A. (1989). Mol. Gen. Genet. 216, 347-352. Elliott, T. (1989). J. Bacterial. 171, 3948-3960. Elliott, T. & Roth, J. R. (1989). Mol. Gen. Genet. 216, 303-314. Eriani. G.: Dirheimer, G. & Gangloff, J. (1989). Nucl. Acids Res. 17, 5725-5736. Fourney, R. M., Miyakoshi, J.; Day, R. S., III & Peterson, M. (1988). Focus, 10(l), 5-7. Fournier, M. J. & Ozeki, H. (1985). Microbial. Rev. 49, 379-397.

Furano, A. V. (1975). Proc. Nat. Acad. Sci., U.S.A. 72, 4780-4784. Gampel, A. & Tzagoloff, A. (1989). Proc. Nat. Acad. Sci., U.S.A.

86, 6023-6027.

Geliebter, J. (1987). Focus, 9, 5-8. Gitelman, D. R. & Apirion, D. (1980). Biochem. Biophys. Res. Commun. 96, 1063-1070. 146, Goldblum, K. & Apirion, D. (1981). J. Bacterial. 128-132. Gourse, R. L., de Boer, H. A. & Nomura, M. (1986). Cell, 44, 197-205. Grunberg-Manago, M. (1987). In Escherichia coli and Salmonella typhimurium Cellular and Molecular (Neidhardt, F., ed.); pp. 1386-1409, ASM, Biology Washington, DC. Hall, C. V. & Yanofsky, C. (1981). J. Bacterial. 148, 941-949. Hanahan, D. (1985). In DNA Cloning (Glover; D. M., ed.), pp. 109-135, IRL Press, Oxford, Washington DC. Harley, C. B. & Reynolds, R. P. (1987). Nucl. Acids Res. 15, 2343-2361. Hgrtlein, M. & Madern, D. (1987). Nucl. Acids Res. 15, 10199-10210. H&-tlein, M., Madern, D. & Leberman, R. (1987a). Nucl. Acids Res. 15, 1005-1017. H&rtlein, M., Frank, R. & Madern, D. (1987b). Nucl. Acids Res. 15, 9081-9082.

valU and alaW

863

Heck, J. D. & Hatfield, G. W. (1988). J. Biol. Chem. 263, 868-877. Herbert, C. J., Labouesse, M., Desjardins, G. & Slonimski, P. P. (1988). EMBO J. 7, 473-483. Horiuchi, T., Nagasawa, T., Takano, K. & Sekiguchi, M. (1987). Mol. Gen. Genet. 206, 356-357. Hiibner, P. & Arber, W. (1989). EMBO J. 8, 577-585. Hudson, L., Rossi, J. & Landy, A. (1981). Nature (London), 294, 422-427. Ingraham, J. L., Maaloe, 0. 85Neidhardt, F. C. (1983). In Growth of the Bacterial Cell, p. 12, Sinauer Associates Inc., Sunderland, MA. Jakubowski, H. & Goldman, E. (1984). J. Bacterial. 158, 769-776. Jinks-Robertson, S. & Nomura, M. (1987). In Escherichia coli and Salmonella typhimurium Cellular and Biology (Neidhardt, Molecular F., ed.), pp. 1358-1385, ASM, Washington, DC. Kennell, D. E. (1986). In Maximizing Gene Expression (Reznikoff, W. & Gold, L., eds), pp. 101-142, Butterworth, London. Kern, D. & Lapointe, J. (1979). Biochemistry, 18, 5819-5826. King, T. & Schlessinger, D. (1987). In Escherichia coli and Salmonella typhimurium Cellular and Molecular Biology (Neidhardt, F., ed.); pp. 703-718, ASM, Washington, DC. King, T. C., Siderskmukh, R. & Schlessinger, D. (1986). Microbial. Rev. 50, 428-451, Kisselev, L. (1985). Progr. Nucl. Acid Res. Mol. Biol. 32, 237-266. Komine, Y., Adachi, T., Inokuchi, H. & Ozeki, H. (1990). J. Mol. Biol. 212, 579-598. Lamond, A. I. & Travers, A. A. (1983). Nature (London), 305, 248-250. Lindahl, L. & Zengel, J. M. (1986). Annu. Rev. Genet. 20, 297-326. Lindsey, D. F., Mullin, D. A. & Walker, J. R. (1989). J. Bacterial 171, 6197-6205. Lukacsovich, T., Boros, I. 8: Venetianer, P. (1987). J. Bacterial. 169, 272-277. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). A Laboratory Manual; Cold Molecular Cloning: Spring Harbor Laboratory Press, Cold Spring Harbor, NY. McKeever, W. G. & Neidhardt; F. C. (1976). J. Bacterial. 126, 634-645. Metzger, W., Schickor, P. & Heumann, H. (1989). EMBO

J. 8; 2745-2754.

Miller, J. H. (1972). Experiments in Molecular Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Miller K. W.; Bouvier, J., Stragier, P. & Wu, H. C. (i987). J. Biol. Chem. 262 7391-7397. Mudd, E. A., Prentki, P., Belin, D. & Krisch, H. M. (1988). EMBO J. 7, 3601-3607. Neidhardt, F. C., Parker, J. & McKeever, W. G. (1975). Annu. Rev. Microbial. 29, 215-250. Neidhardt, F. C., Bloch, P. L.; Pedersen, S. & Reeh, S. (1977). J. Bacterial. 129, 378-387. Nilsson, G., Belasco, J. G., Cohen, S. N. & von Gabain; A. (1984). Nature (London), 312, 75-77. Nilsson, G., Lundberg, U. & von Gabain, A. (1988). EMBO

J. 7, 2269-2275.

Nilsson, L., Vanet, A., Vijgenboom, E. & Bosch, L. (1990). EMBO J. 9, 727-734. A. (1988). EMBO J. 7, Nomura, T. & Ishihama, 3539-3545.

Y. V. Bran

,I’omura, T.; Fujita, N. & Ishihama. A. (1987). ,I. Xol. Biol. 1197, 659-670. G‘Keil, 6;. P.; Peterson, I>. M.: dchiin. A,. Chen, M.-W. & Still, D. (1988). J. Ka&?%ol. 170, 3810-3816. Palmiter. R D. (1974). Riochemistry, 13, 360663615. Pedersen, S.: Reeh; S. & Friesen. J. D. (1978). Mol. Cen. Genet. 166, 329-336. Petersen, Q. B., Stockwell, P. A. & Hill; D. F. (1988). EMBO J. 7, 3957-3962. Plumbridge, J. & Ml, D. (1989). Mol. Ge~z. Genet. 216,

113-119. Portier. C.. Dondon, L., Grunberg-Manago, ,&I. & Regnier, P. (1987). E&fBO J. 6; 2166-2170. Putney. S. I). & Schimmel. P. (1981). Ratwe (London). 291: 632-635. Reeh, S., Pedersen, S. 8: Xeidhardt, F. C. (1977). J. Bacterial. 129, 702-706. Russell, R. R. B. & Pittard, A. ,J. (1971). J. Bacterial. 108; 790-798. Sanfagon, H. (1985). Ph.D. thesis, Universite Laval. Sanfaqon, H., Levasseur. S., Roy, P. H. & Lapointe, J. (1983). Gene, 22, 175-180. Sant,ero. E., Hoover, T.. Keener. tJ. & Kustu, S. (1989). Proc. Nat. dead. Sci., C!.S.A. 86, 7346-7350. Schneegurt, M. A. & Beak. S. 1. (1988). Plant Physiol. 86, 497-504. Schiin. A.. Krupp, G., Gough, S.. Berry-Lowe, S., Kannangara, C. G. $ Ml, D. (1986). Nature ilondon). 322, 281-284. Short; J. M.. Fernandez, J. M., Sorge.
et a&.

steitz.

J. A. (1979). In Biologicai i2egu2ation :~v.d Deveiopmerd (Goldberger, R. F., ed.), vol. 1. pp. 349-399, Pienum Press, Eew York. Stormo, C. D., Schneider. T. D.. Gold. L. $ Ehreneucht, A. (1982). Nucl. Acids Res. 10, 2997-3011. Ytrreber, D. & Bujard. H. (1982). EMBO J. 1, L399-1404. Suggs, S. V.? Hirose, T., Miyake, T., Kawashima, E. H.. Johnson, M. J., Itakura, K. & Wallace: R. H. (1981). ICN-UCLA Symp. Xol. Cell. Biol. 23, 683. Taljanidisz, J., Karnik, P. & Sarkar, ?rT. (1987). J. Xol. Biol. 193, 507-515. Tomcsanyi, T. $ Apirion, I). (1985). J. Mol. Riol. 185,

713-720. Travers, A. A. (1984). Xuc:. Acids i2es. 12, 2605-26l8. Travers. A. A. (1987). CRC Crit. Rw. Kiochnr. 22. 181-219. Travers. A. A., Lamond, 9. I. $ Weeks. J. R. (1936). J, &foi. Biol. 189. 251-255. Tuerk, C., Gauss, P., Thermes. C.. Groebe, D. R., Gayle, M., Guild, N., Stormo, G., D’Aubenton-Carafa, Y.. Uhlenbeck. i?. C., Tinoco. I., Brodg, E. N. & Gold. L. (1988). Proc. Zat. Acad. Sci., I:.S.d. 85, 1364-I 368. Tung, C. S. $ Harvey. S. C. (1986). Nucl. Acids Rps. 14. 381-387. L’emura, H., Thorbjarnardottir, S.? Gamulin, V.. Yam); J., Andresson, 0. S.. Soll. D. & Eggertsson. G. (1985). J. Bacterial. 163, 1288-1289. van i)elft; J. H. 11.. Marifion, B., Schmidt, 13. S. k Roach. L. (198s). Nucl. Acids f&s. 15. 9515-9530. h.ijgenboorn; E. & Bosch, L. (1988). ,liucl. gc;ds Re.q, 16.

10183-10197. Webster, T.. Tsai. H.; K&a, M., Ma,ekie. G. & Schimmel, P. (1984). Science, 226, 1315-1317. Williams. J. G. Ps Mason. P. J. (1985). In ll’uclelc dcid Hybridization, a Practical dpp,roach (Hames. B. D. B Higgins, S. J.. eds), pp. 139-160. IRL Press, Oxford. Yanisch-Perron, C. Vieira. J. & Messing, J. (1985). Gene, 33. 103-119