- Email: [email protected]
GC-B system: A new regulator of adipogenesis
Peptides 31 (2010) 1906–1911
Contents lists available at ScienceDirect
Peptides journal homepage: www.elsevier.com/locate/peptides
CNP/GC-B system: A new regulator of adipogenesis Takeshi Katafuchi ∗ , David L. Garbers 1 , Joseph P. Albanesi University of Texas Southwestern Medical Center at Dallas, 6001 Forest Park Rd., Dallas, TX 75390, USA
a r t i c l e
i n f o
Article history: Received 9 December 2009 Received in revised form 24 June 2010 Accepted 25 June 2010 Available online 24 July 2010 Keywords: C-type natriuretic peptide Guanylyl cyclase-B cGMP Adipogenesis 3T3-L1 cell
a b s t r a c t Adipogenesis is regulated by a wide variety of compounds. An adipogenic cocktail containing insulin (INS), dexamethasone (DEX) and 3-isobutyl-1-methyl xanthine (IBMX) is routinely used to induce adipogenesis in 3T3-L1 preadipocytes, but the biochemical actions in adipogenesis of IBMX, a non-specific phosphodiesterase inhibitor, are not completely understood. In this study we show that C-type natriuretic peptide (CNP) is an endogenous adipogenesis regulator which can largely replace the function of IBMX. In 3T3-L1 preadipocytes, CNP potently elevated cGMP production through guanylyl cyclase-B (GC-B). Lipid droplets were evident in these cells upon stimulation with CNP for 12 days in the presence of INS and DEX, and their adiposity, evaluated by Oil Red O, was significantly higher than in cells stimulated with INS and DEX only. Membrane-permeable cGMP analogue also enhanced adiposity when cells were cultured together with INS and DEX, and KT5823, a non-specific cGMP-dependent kinase (cGK) inhibitor, suppressed the stimulatory effect of IBMX on adipogenesis, revealing that IBMX-stimulated adipogenesis is mediated through cGK. The enhancement of adiposity elicited by CNP was accompanied by increased mRNA levels of adipocyte-specific genes including those encoding peroxisome proliferatoractivated receptor gamma and glucose transporter 4. Interestingly, the mRNA level of CNP itself was markedly enhanced in 3T3-L1 cells upon stimulation with INS, DEX and IBMX, reaching a maximum at 8 h incubation with the cocktail. These observations suggest that the CNP/GC-B system participates in regulation of adipogenesis, particularly at an early stage in the process. © 2010 Elsevier Inc. All rights reserved.
1. Introduction Obesity is recognized as a major health problem in industrial countries, especially in the United States. It is generally accepted that controlling adipogenesis is one of the most important keys to overcoming obesity, and therefore vigorous studies have been performed to understand mechanisms of adipogenesis [7]. Many of these studies have employed the 3T3-L1 preadipocyte cell line. Upon stimulation of 3T3-L1 cells with an adipogenic cocktail containing insulin (INS), dexamethasone (DEX) and 3isobutyl-1-methyl xanthine (IBMX) for more than one week, these cells change their morphology from fibroblast-like to adipocytelike, and oil droplets accumulate in their cytoplasm. Stimulation of cells with INS and DEX is considered to reflect enhancement of insulin and glucocorticoid levels, respectively, that occur naturally in the systemic circulation. In 3T3-L1 cells, INS triggers a variety of processes, including activation of ERK and Akt/PKB
Abbreviations: CNP, C-type natriuretic peptide; ANP, atrial natriuretic peptide; GC-B, guanylyl cyclase-B; GC-A, guanylyl cyclase-A; INS, insulin; DEX, dexamethasone; IBMX, 3-isobutyl-1-methyl xanthine; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum. ∗ Corresponding author. Tel.: +1 214 645 6070; fax: +1 214 645 6124. E-mail address: [email protected] (T. Katafuchi). 1 Deceased. 0196-9781/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2010.06.025
pathways [8,19], both of which have been shown to be essential for adipogenesis in vivo [3,17]. DEX suppresses the expression of Pref-1, which inhibits preadipocytes from entering commitment to adipogenesis [2,16,23]. On the other hand, IBMX, a non-specific phosphodiesterase inhibitor, is totally artificial and its equivalent compound does not exist in the body. IBMX inhibits the activity of phosphodiesterases that catalyze degradation of cAMP and cGMP, and thereby increases cAMP and cGMP levels above those found in untreated cells. Numerous studies have been performed to elucidate the effects of cAMP on adipogenesis. These have demonstrated that activation of cAMP-dependent kinase (PKA) and the resulting activation of cAMP-responsive element binding proteins [11,20,24], as well as PKA-independent pathway such as activation of Epac [11,18], are important for promotion of adipogenesis. In contrast, few studies have been performed to establish the role of cGMP in adipogenesis. Guanylyl cyclase-B (GC-B) is a membrane-bound guanylyl cyclase that is specifically activated upon binding of C-type natriuretic peptide (CNP) [9]. GC-B is expressed abundantly in fibroblasts, and strongly stimulates their intracellular cGMP production [6]. However, the role of the CNP/GC-B system on adipogenesis has not yet been examined. We hypothesized that CNP enhances cGMP production in preadipocytes and stimulates adipogenesis in place of IBMX. In this report, we evaluated CNP-dependent enhancement of adipogenesis by measuring lipid
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
accumulation as well as adipocyte-specific gene levels. We also quantified CNP transcription levels in each stage of adipogenesis to understand how GC-B is activated during adipogenesis. 2. Materials and methods 2.1. Cell culture 3T3-L1 preadipocyte cells (ATCC) were cultured with Dulbecco’s modified eagle’s medium (DMEM, Gibco) containing a penicillin-streptomycin antibiotics cocktail (Gibco) and 10% heat-inactivated fetal bovine serum (FBS, Gemini). To induce adipogenesis, 3T3-L1 cells were cultured with DMEM containing 10% non-heat-inactivated FBS, 5 g/ml bovine INS (Sigma), 1 M DEX (Sigma), and a compound of interest such as 0.5 mM IBMX (Sigma), 0.5 mM IBMX plus 2 M KT5823 (Calbiochem), 0.5 mM 8-Br-cGMP (Sigma), 0.1 M CNP or 0.1 M ANP (Bachem). The medium was replaced daily. All experiments were performed using 3T3-L1 cells of less than five passages from the original vial obtained from ATCC. 2.2. Staining of adipocytes Cells were stained with Oil Red O lipid staining dye. 0.5% Oil Red O dissolved in 2-propanol was mixed with water at a ratio of 3:2 and filtered. Cells were washed with phosphate-buffered saline and 60% 2-propanol, and then stained with the Oil Red O staining solution. Following incubation at 37 ◦ C for 1 h, cells were washed with 60% 2-propanol and water. To evaluate adiposity, Oil Red O accumulated in oil droplets of adipocytes was recovered with 100% 2-propanol and the concentration of Oil Red O in the 2-propanol solution was estimated by measuring absorbance at 545 nm. Nonspecific staining was evaluated by staining cells grown with DMEM containing 10% non-heat-inactivated FBS. In these cells, no droplets were formed. 2.3. Real time PCR Total RNA was purified using RNeasy RNA purification kit. Following DNase treatment, RNA was reverse transcribed using MMLV reverse transcriptase (Invitrogen) to synthesize template cDNA. Two nanograms of cDNA was mixed with SYBR green Master Mix (Applied Biosystems) and the primer pair CTTCTCTGTGGGTGGCATGA and ACACGGCCAAGACATTGTTG for glucose transporter 4 (Glut4, GenBankTM accession number NM 009204); ATGCCAAAAATATCCCTGGTTTC and GGAGGCCAGCATCGTGTAGA for peroxisome proliferator-activated receptor-gamma 2 (PPAR␥2, GenBankTM accession number NM 011146); CATGAGCGGTCTGGGATGTT and TCCAGATGCTGGAGGCTGAT for CNP (GenBankTM accession number NM 010933); or TTCCAGCAGATGTGGATCAG and GAAAGGGTGTAAAACGCAGC for -actin (GenBankTM accession number NM 007393). Real time PCR was performed using Prism 7900HT (Applied Biosystems).
1907
serum-free DMEM. Succinylation mixture (succinic anhydrate:1,4dioxane:triethylamine = 1:20:5) was added to the solution and the reaction was incubated for 30 min at room temperature. Following evaporation by Speed-vac, the resulting pellets were dissolved with 90 mM sodium acetate (pH 6.2) solution, and aliquots were used for measurement of cGMP by radioimmunoassay as described previously [5]. 2.5. Measurement of lipolysis Lipolysis was evaluated by measurement of free glycerol release from differentiated 3T3-L1 adipocytes. Confluent cells cultured on 12-well plates were cultured with DMEM containing 10% FBS, 5 g/ml INS, 1 M DEX and 0.5 mM IBMX for 12 days. Then the cells were washed twice with serum- and phenol red-free DMEM containing 20 mM Hepes (pH 7.3) and culture with the same medium for 2 h in the absence or presence of 0.1 M ANP or CNP, or 0.5 mM 8-Br-cAMP. The glycerol content in the incubation media was measured using Free Glycerol Reagent (Sigma) according the manufacturer’s protocol. 2.6. Statistics Statistics were performed by ANOVA followed by Dunnet’s post hoc comparison. P < 0.05 was considered significant. 3. Results 3.1. 3T3-L1 cells express GC-B and elevate cGMP production upon stimulation with CNP Chrisman et al. [6] demonstrated that BALB/3T3 and NIH3T3 cells express high levels of GC-B, and that CNP potently stimulates cGMP production in these cells. We hypothesized that 3T3-L1, another murine fibroblast cell line, which is capable of differentiating into adipocytes, also expresses GC-B. To test this hypothesis, we stimulated these cells with CNP and atrial natriuretic peptide (ANP), which predominantly stimulates guanylyl cyclase-A (GC-A) rather than GC-B, and compared their potency. As shown in Fig. 1A, CNP is far more potent than ANP in elevating cGMP production in untreated 3T3-L1 cells. It is reasonable to assume that the cGMP produced in 3T3-L1 cells upon ANP treatment may also be due to activation of GC-B, because ANP is a partial agonist of this receptor [12]. Therefore, we conclude that the vast majority of membrane-bound GC in untreated 3T3-L1 cells is GC-B. On the other hand, the potency of ANP in elevating cGMP production in 3T3-L1 cells after treatment with adipogenic cocktail for 14 days was enhanced, and cGMP levels upon stimulation with 10−9 and 10−8 M ANP was slightly higher than those induced by CNP treatment, revealing that GC-A participates in elevation of cGMP upon stimulation with ANP in differentiated 3T3-L1 cells. 3.2. CNP predominantly enhances adiposity of 3T3-L1 cells in the presence of INS and DEX
2.4. Measurement of cGMP production Cells were cultured for 24 h with DMEM containing 0.5% FBS in 24-well culture plates. The medium was replaced with serumfree DMEM and cells were further cultured for 2 h. Following addition of 0.25 mM IBMX and 15-min incubation at 37 ◦ C, CNP or ANP was added to the incubation medium for 5 min. The incubation medium was then removed by aspiration, and 95% ethanol was added to each well. After one freeze–thaw cycle at −85 ◦ C, the ethanol was transferred to glass tubes and evaporated by Speed-vac. The resulting pellets were dissolved with
We next cultured 3T3-L1 cells for 12 days with adipogenesis medium containing INS and DEX in the absence or presence of IBMX, CNP, ANP and 8-Br-cGMP, a membrane-permeable cGMP analogue. In the absence of these stimulants, no adipocytes were formed (Fig. 2A). Upon stimulation with only INS and DEX, a small number of adipocytes were observed (Fig. 2B), indicating that INS and DEX are the minimum required compounds for promotion of adipogenesis in 3T3-L1 cells. In the presence of IBMX in addition to INS and DEX, which is a commonly used condition for induction of adipogenesis in 3T3-L1 cells, most 3T3-L1 cells became spherical in
1908
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
Fig. 1. Dose–response elevation of cGMP production in 3T3-L1 cells, 3T3-L1 cells before (A) or after (B) treatment with the adipogenic cocktail for 14 days were stimulated with CNP () or ANP (䊉) at the indicated concentrations for 5 min at 37 ◦ C. All data are shown as mean + SEM, N = 3. Note that in the absence of ANP or CNP, cGMP production was not detectable.
shape and contained numerous Oil Red O-stainable lipid droplets (Fig. 2C). When 3T3-L1 cells were cultured with CNP in the presence of INS and DEX, the number of Oil Red O-stained cells was significantly enhanced compared with those stimulated with INS and DEX alone (Fig. 2D). However, CNP did not stimulate adipogenesis in the absence of INS and DEX (data not shown). ANP also stimulated adipogenesis in the absence of INS and DEX, but the adiposity of differentiated adipocytes was lower than that of cells stimulated with CNP. This result is consistent with the potency of cGMP production by these peptides. 8-Br-cGMP, a membrane-permeable cGMP analogue, also increased the number of adipocytes (Fig. 2E), indicating that the effect of CNP on 3T3-L1 cell differentiation is mediated through a cGMP-dependent pathway. Quantification of Oil Red O staining of lipids in oil droplets of adipocytes (Fig. 2F), showed that cells cultured with INS, DEX and CNP accumulate approximately 2-fold more lipid than cells cultured with INS and DEX only. Fig. 2G shows the dose-dependence of enhancement of Oil Red O staining of 3T3-L1 cells by CNP. There is a reasonably close correlation between the concentrations of CNP that increases cell adiposity and those that elevate cGMP levels in these cells (compare with Fig. 1), further supporting the view that CNP influences 3T3-L1 cell differentiation by activating guanylyl cyclase activity. ANP also significantly increased cell adiposity (Fig. 2H), although the extent of increase was smaller than that elicited by CNP. It is likely that the effect of ANP is due to the fact that this peptide is a partial agonist of GC-B. We next treated cells with cGMP-dependent kinase (cGK) inhibitor KT5823, to investigate whether the enhancement of adiposity is mediated through a cGK-dependent pathway. As shown in Fig. 2I, adiposity in differentiated cells was significantly reduced when KT5823 was added to the adipogenesis cocktail containing INS, DEX and IBMX. Note that the enhancement of adiposity by CNP was difficult to observe when 3T3-L1 cells of more than five passages were used. 3.3. CNP significantly enhances mRNA levels of adipocyte-specific genes
ment of Glut4 and PPAR␥2 mRNA levels when substituted for IBMX. An increase in mRNA levels was also evident upon addition of 8Br-cGMP to INS and DEX. 3.4. CNP mRNA level is transiently elevated at an early stage of adipogenesis In view of the above results indicating a role for CNP in adipogenesis, we hypothesized that CNP may act as an autocrine/paracrine factor during a particular stage of adipogenesis. To test this hypothesis, we measured mRNA levels of CNP in 3T3-L1 cells treated with INS, DEX and IBMX for 0 h, 3 h, 8 h, 24 h, 3 days, 7 days and 12 days [14]. It is generally considered that adipogenesis occurs in three stages. During the first 24 h there is enhanced synthesis of CCAAT enhancer binding protein (C/EBP)- and ␦, which are regulators of gene transcription for the subsequent, intermediate stage. In the intermediate stage (1–3 days) there is increased synthesis of PPAR␥ and C/EBP␣, which regulates genes that are essential for adipocyte function. Finally, in the late stage, proteins essential for energy storage (e.g., Glut4, aP2, perilipin) are induced, and cells are functional adipocytes with evident lipid droplets. As shown in Fig. 4, mRNA levels reached a maximum 8 h after treatment with the adipogenic cocktail. Therefore, it is likely that CNP exerts its effects as an autocrine/paracrine factor primarily at the early stage. 3.5. Neither ANP nor CNP enhanced lipolysis in differentiated 3T3-L1 cells We next evaluated the effects of ANP and CNP on lipolysis in 3T3-L1 adipocytes. As shown in Fig. 5, neither ANP nor CNP elevated free glycerol level in the medium of differentiated 3T3-L1 cells, whereas 8-Br-cAMP, a membrane-permeable cAMP analogue, potently enhanced its level. These facts suggest that effect of natriuretic peptides on lipolysis is quite small, at least on 3T3-L1 adipocytes. 4. Discussion
To confirm that CNP triggers an adipogenesis program in 3T3L1 cells, we measured the effect of CNP (in the presence of INS and DEX) on mRNA levels of two adipogenesis markers, Glut4 and PPAR␥2. As shown in Fig. 3, treatment with INS and DEX alone enhanced the mRNA levels of Glut4 and PPAR␥ by approximately 5–10-fold. Addition of IBMX nearly doubled these mRNA levels, and greatly enhanced the conversion of 3T3-L1 cells from a fibroblastlike morphology to a more spherical adipocyte-like morphology. Interestingly, CNP showed similar, though slightly lower, enhance-
In this study, we demonstrated that the CNP/GC-B system is an important natural regulator of adipogenesis, and may function as an autocrine/paracrine factor in early adipogenesis for enhancement of adiposity in 3T3-L1 cells. Recent reports have indicated that cGMP-dependent signaling plays a role in the promotion of adipogenesis. Haas et al. [10] clearly showed that nitric oxide/cGKI signaling was responsible for the regulation of brown adipocyte differentiation among several cGMP-dependent signaling systems,
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
1909
Fig. 3. Enhancement of adipocyte-specific genes. Copy numbers of PPAR␥2 and Glut4 mRNAs were measured in cDNA synthesized from RNA of differentiated 3T3L1 cells cultured with the indicated compounds using the real time PCR system. The copy number of each gene was normalized to that of -actin. All data are shown as mean + SEM. N = 3. *P < 0.05, **P < 0.01.
Fig. 4. Time-course of CNP mRNA levels during differentiation of 3T3-L1 cells. 3T3L1 cells were cultured with DMEM plus non-heat-inactivated FBS in the absence or presence of INS, DEX and IBMX for the indicated times. RNAs were then purified from the cells and copy numbers of CNP were measured using the real time PCR system as described above. Each CNP mRNA level was normalized to that of -actin, and the amounts shown in the figure represent (raw data) × 104 . All data are shown as mean + SEM. Asterisks indicate significant difference to “Time = 0”. N = 3. *P < 0.05, **P < 0.01.
by using cGK-I-deficient brown adipocyte progenitor cells. Zhang et al. [25] showed that sildenafil, a phosphodiesterase 5-specific inhibitor, which specifically blocks cGMP degradation, as well as a membrane-permeable cGMP analogue promotes adipogenesis in 3T3-L1 cells through a PKG pathway, but they did not identify
Fig. 2. Representative images of differentiated 3T3-L1 cells stained with Oil Red O and measurement of their adiposity. Cells were cultured with DMEM plus non-heat-inactivated FBS with no addition (A), or together with INS and DEX (B), INS, DEX and IBMX (C), INS, DEX and CNP (D) or INS, DEX and 8-Br-cGMP (E). The cells were then stained with Oil Red O and photographed. (F) Adiposity of differentiated cells cultured with DMEM plus non-heat-inactivated FBS in the absence or presence of indicated compounds. (G) Dose-dependent enhancement of adiposity by CNP. (H) Comparison of adipogenic effect between CNP and ANP. 3T3-L1 cells were cultured in the presence of INS and DEX only (ID), INS and DEX plus 10−7 M
CNP (CNP7) and INS and DEX plus 10−7 M ANP (ANP7). (I) Effect of cGK inhibitor on IBMX-induced adipogenesis. 3T3-L1 cells were cultured in the presence of INS, DEX and IBMX (IBMX) or INS, DEX, IBMX plus KT5823 (+KT). To quantify adiposity, the cells stained with Oil Red O were washed with 60% 2-propanol, and then Oil Red O sticking to oil droplets of adipocytes was recovered with 100% 2-propanol for measurement of OD545 . The concentration of Oil Red O in each well was normalized to DNA content, N = 3. All data are shown as mean + SEM. *P < 0.05, **P < 0.01, ***P < 0.001.
1910
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
by type II cGK [4]. It is noteworthy in this context that C/EBP associates with Ca2+ -activated cAMP response element binding protein to synergistically activate the fos promoter in neuronal and osteogenic cells [4]. In conclusion, we discovered that cGMP produced by the CNP/GC-B system enhances adiposity in 3T3-L1 cells, and we raised the possibility that this system, together with cGK and C/EBP, regulates early events in adipogenesis. Acknowledgment The authors are grateful to Dionne Ware for secretarial assistances. This work was supported by Grant DK073120 from the National Institutes of Health.
Fig. 5. Effect of CNP on lipolysis. Differentiated 3T3-L1 adipocytes were further cultured in serum- and phenol red-free DMEM in the absence (none) or presence of ANP (ANP8; 10−8 M ANP, ANP7; 10−7 M ANP), CNP (CNP8; 10−8 M CNP, CNP7; 10−7 M CNP) or 0.5 mM 8-Br-cAMP (cAMP). Following 2 h-incubation, the incubation media were recovered, and their glycerol contents were measured.
the signaling molecules that activate cGMP-dependent signaling. Our results suggest that CNP may be an endogenous regulator of cGMP-dependent signaling for promotion of adipogenesis, serving, at least in part, the function played in vitro by the phosphodiesterase inhibitor, IBMX. Recent investigations have revealed that ANP reduces adiposity in mature adipocytes by activating hormone-sensitive lipase (HSL) at least in human and rat [13,15,21]. In contrast, our work demonstrates that CNP (together with INS and DEX) enhances adiposity, as shown both by lipid accumulation and by increased levels of adipogenesis marker genes (Figs. 2 and 3). These observations suggest that the CNP/cGMP system regulates different biological events than those of the ANP/cGMP system. As shown Fig. 1, CNP stimulated cGMP production in 3T3-L1 cells with a potency much higher than that of ANP before treatment with the adipogenic cocktail, while the potency of ANP to cGMP production was almost similar to that of CNP in 3T3-L1 cells after a 14 day treatment with the adipogenic cocktail. This enhanced sensitivity of cGMP production to ANP in differentiated adipocytes was also reported by Sengenes et al. [21] and Nishikimi et al. [15,21]. Furthermore, CNP mRNA level was transiently enhanced and reached a maximum when cells were cultured with the adipogenic cocktail for 8 h (Fig. 4). Based on these data, we suggest that the CNP/cGMP system regulates biological events especially in the early stage of adipogenesis to enhance adiposity in 3T3-L1 cells, whereas the ANP/cGMP system regulates events in mature adipocytes such as activation of HSL. Our data shown in Fig. 5 reveal that lipolysis was not significantly enhanced upon stimulation with ANP or CNP in adipocytes differentiated from the murine cell line 3T3-L1, which is consistent with the data by Sengenes et al. [22] that natriuretic peptide-dependent lipolysis occurred in primate adipocytes, but not in adipocytes of other mammals including rodents. However, Nishikimi et al. [15] observed ANP-dependent lipolysis in differentiated adipocytes derived from rat preadipocyte cell line. These facts suggest that natriuretic peptide-dependent lipolysis in rodent adipocytes may occur under certain conditions. Several lines of evidence suggest that CNP-mediated enhancement of cGMP-dependent signaling is tightly regulated to control early stage of adipogenesis. First, levels of CNP itself are transiently increased in the early adipogenesis (Fig. 4). Second, expression of Kruppel-like transcription factor 4, which regulates expression of cGK, is also elevated in early adipogenesis [1]. Finally, C/EBP, which is synthesized during early adipogenesis and is required for subsequent stages of adipocyte differentiation, can be activated
References [1] Birsoy K, Chen Z, Friedman J. Transcriptional regulation of adipogenesis by KLF4. Cell Metab 2008;7:339–47. [2] Boney CM, Fiedorek Jr FT, Paul SR, Gruppuso PA. Regulation of preadipocyte factor-1 gene expression during 3T3-L1 cell differentiation. Endocrinology 1996;137:2923–8. [3] Bost F, Aouadi M, Caron L, Even P, Belmonte N, Prot M, et al. The extracellular signal-regulated kinase isoform ERK1 is specifically required for in vitro and in vivo adipogenesis. Diabetes 2005;54:402–11. [4] Chen Y, Zhuang S, Cassenaer S, Casteel DE, Gudi T, Boss GR, et al. Synergism between calcium and cyclic GMP in cyclic AMP response element-dependent transcriptional regulation requires cooperation between CREB and C/EBP-beta. Mol Cell Biol 2003;23:4066–82. [5] Chrisman TD, Garbers DL. Reciprocal antagonism coordinates C-type natriuretic peptide and mitogen-signaling pathways in fibroblasts. J Biol Chem 1999;274:4293–9. [6] Chrisman TD, Schulz S, Potter LR, Garbers DL. Seminal plasma factors that cause large elevations in cellular cyclic GMP are C-type natriuretic peptides. J Biol Chem 1993;268:3698–703. [7] Friedman JM. Modern science versus the stigma of obesity. Nat Med 2004;10:563–9. [8] Gagnon A, Chen CS, Sorisky A. Activation of protein kinase B and induction of adipogenesis by insulin in 3T3-L1 preadipocytes: contribution of phosphoinositide-3,4,5-trisphosphate versus phosphoinositide-3,4bisphosphate. Diabetes 1999;48:691–8. [9] Garbers DL, Chrisman TD, Wiegn P, Katafuchi T, Albanesi JP, Bielinski V, et al. Membrane guanylyl cyclase receptors: an update. Trends Endocrinol Metab 2006;17:251–8. [10] Haas B, Mayer P, Jennissen K, Scholz D, Diaz MB, Bloch W, et al. Protein kinase G controls brown fat cell differentiation and mitochondrial biogenesis. Sci Signal 2009;2:ra78. [11] Karamitri A, Shore AM, Docherty K, Speakman JR, Lomax MA. Combinatorial Transcription factor regulation of the cyclic AMP-response element on the Pgc1{alpha} Promoter in white 3T3-L1 and brown HIB-1B preadipocytes. J Biol Chem 2009;284:20738–52. [12] Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, et al. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 1991;252:120–3. [13] Langin D, Dicker A, Tavernier G, Hoffstedt J, Mairal A, Ryden M, et al. Adipocyte lipases and defect of lipolysis in human obesity. Diabetes 2005;54:3190–7. [14] MacDougald OA, Lane MD. Transcriptional regulation of gene expression during adipocyte differentiation. Annu Rev Biochem 1995;64:345–73. [15] Nishikimi T, Iemura-Inaba C, Akimoto K, Ishikawa K, Koshikawa S, Matsuoka H. Stimulatory and Inhibitory regulation of lipolysis by the NPR-A/cGMP/PKG and NPR-C/G(i) pathways in rat cultured adipocytes. Regul Pept 2009;153:56–63. [16] Pantoja C, Huff JT, Yamamoto KR. Glucocorticoid signaling defines a novel commitment state during adipogenesis in vitro. Mol Biol Cell 2008;19:4032–41. [17] Peng XD, Xu PZ, Chen ML, Hahn-Windgassen A, Skeen J, Jacobs J, et al. Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev 2003;17:1352–65. [18] Petersen RK, Madsen L, Pedersen LM, Hallenborg P, Hagland H, Viste K, et al. Cyclic AMP (cAMP)-mediated stimulation of adipocyte differentiation requires the synergistic action of Epac- and cAMP-dependent protein kinase-dependent processes. Mol Cell Biol 2008;28:3804–16. [19] Prusty D, Park BH, Davis KE, Farmer SR. Activation of MEK/ERK signaling promotes adipogenesis by enhancing peroxisome proliferator-activated receptor gamma (PPARgamma) and C/EBPalpha gene expression during the differentiation of 3T3-L1 preadipocytes. J Biol Chem 2002;277:46226–32. [20] Reusch JE, Colton LA, Klemm DJ. CREB activation induces adipogenesis in 3T3-L1 cells. Mol Cell Biol 2000;20:1008–20. [21] Sengenes C, Bouloumie A, Hauner H, Berlan M, Busse R, Lafontan M, et al. Involvement of a cGMP-dependent pathway in the natriuretic peptidemediated hormone-sensitive lipase phosphorylation in human adipocytes. J Biol Chem 2003;278:48617–26.
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911 [22] Sengenes C, Zakaroff-Girard A, Moulin A, Berlan M, Bouloumie A, Lafontan M, et al. Natriuretic peptide-dependent lipolysis in fat cells is a primate specificity. Am J Physiol Regul Integr Comp Physiol 2002;283:R257–65. [23] Smas CM, Chen L, Zhao L, Latasa MJ, Sul HS. Transcriptional repression of pref1 by glucocorticoids promotes 3T3-L1 adipocyte differentiation. J Biol Chem 1999;274:12632–41.
1911
[24] Zhang JW, Klemm DJ, Vinson C, Lane MD. Role of CREB in transcriptional regulation of CCAAT/enhancer-binding protein beta gene during adipogenesis. J Biol Chem 2004;279:4471–8. [25] Zhang X, Ji J, Yan G, Wu J, Sun X, Shen J, et al. Sildenafil promotes adipogenesis through a PKG pathway. Biochem Biophys Res Commun 2010;396: 1054–9.
Contents lists available at ScienceDirect
Peptides journal homepage: www.elsevier.com/locate/peptides
CNP/GC-B system: A new regulator of adipogenesis Takeshi Katafuchi ∗ , David L. Garbers 1 , Joseph P. Albanesi University of Texas Southwestern Medical Center at Dallas, 6001 Forest Park Rd., Dallas, TX 75390, USA
a r t i c l e
i n f o
Article history: Received 9 December 2009 Received in revised form 24 June 2010 Accepted 25 June 2010 Available online 24 July 2010 Keywords: C-type natriuretic peptide Guanylyl cyclase-B cGMP Adipogenesis 3T3-L1 cell
a b s t r a c t Adipogenesis is regulated by a wide variety of compounds. An adipogenic cocktail containing insulin (INS), dexamethasone (DEX) and 3-isobutyl-1-methyl xanthine (IBMX) is routinely used to induce adipogenesis in 3T3-L1 preadipocytes, but the biochemical actions in adipogenesis of IBMX, a non-specific phosphodiesterase inhibitor, are not completely understood. In this study we show that C-type natriuretic peptide (CNP) is an endogenous adipogenesis regulator which can largely replace the function of IBMX. In 3T3-L1 preadipocytes, CNP potently elevated cGMP production through guanylyl cyclase-B (GC-B). Lipid droplets were evident in these cells upon stimulation with CNP for 12 days in the presence of INS and DEX, and their adiposity, evaluated by Oil Red O, was significantly higher than in cells stimulated with INS and DEX only. Membrane-permeable cGMP analogue also enhanced adiposity when cells were cultured together with INS and DEX, and KT5823, a non-specific cGMP-dependent kinase (cGK) inhibitor, suppressed the stimulatory effect of IBMX on adipogenesis, revealing that IBMX-stimulated adipogenesis is mediated through cGK. The enhancement of adiposity elicited by CNP was accompanied by increased mRNA levels of adipocyte-specific genes including those encoding peroxisome proliferatoractivated receptor gamma and glucose transporter 4. Interestingly, the mRNA level of CNP itself was markedly enhanced in 3T3-L1 cells upon stimulation with INS, DEX and IBMX, reaching a maximum at 8 h incubation with the cocktail. These observations suggest that the CNP/GC-B system participates in regulation of adipogenesis, particularly at an early stage in the process. © 2010 Elsevier Inc. All rights reserved.
1. Introduction Obesity is recognized as a major health problem in industrial countries, especially in the United States. It is generally accepted that controlling adipogenesis is one of the most important keys to overcoming obesity, and therefore vigorous studies have been performed to understand mechanisms of adipogenesis [7]. Many of these studies have employed the 3T3-L1 preadipocyte cell line. Upon stimulation of 3T3-L1 cells with an adipogenic cocktail containing insulin (INS), dexamethasone (DEX) and 3isobutyl-1-methyl xanthine (IBMX) for more than one week, these cells change their morphology from fibroblast-like to adipocytelike, and oil droplets accumulate in their cytoplasm. Stimulation of cells with INS and DEX is considered to reflect enhancement of insulin and glucocorticoid levels, respectively, that occur naturally in the systemic circulation. In 3T3-L1 cells, INS triggers a variety of processes, including activation of ERK and Akt/PKB
Abbreviations: CNP, C-type natriuretic peptide; ANP, atrial natriuretic peptide; GC-B, guanylyl cyclase-B; GC-A, guanylyl cyclase-A; INS, insulin; DEX, dexamethasone; IBMX, 3-isobutyl-1-methyl xanthine; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum. ∗ Corresponding author. Tel.: +1 214 645 6070; fax: +1 214 645 6124. E-mail address: [email protected] (T. Katafuchi). 1 Deceased. 0196-9781/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2010.06.025
pathways [8,19], both of which have been shown to be essential for adipogenesis in vivo [3,17]. DEX suppresses the expression of Pref-1, which inhibits preadipocytes from entering commitment to adipogenesis [2,16,23]. On the other hand, IBMX, a non-specific phosphodiesterase inhibitor, is totally artificial and its equivalent compound does not exist in the body. IBMX inhibits the activity of phosphodiesterases that catalyze degradation of cAMP and cGMP, and thereby increases cAMP and cGMP levels above those found in untreated cells. Numerous studies have been performed to elucidate the effects of cAMP on adipogenesis. These have demonstrated that activation of cAMP-dependent kinase (PKA) and the resulting activation of cAMP-responsive element binding proteins [11,20,24], as well as PKA-independent pathway such as activation of Epac [11,18], are important for promotion of adipogenesis. In contrast, few studies have been performed to establish the role of cGMP in adipogenesis. Guanylyl cyclase-B (GC-B) is a membrane-bound guanylyl cyclase that is specifically activated upon binding of C-type natriuretic peptide (CNP) [9]. GC-B is expressed abundantly in fibroblasts, and strongly stimulates their intracellular cGMP production [6]. However, the role of the CNP/GC-B system on adipogenesis has not yet been examined. We hypothesized that CNP enhances cGMP production in preadipocytes and stimulates adipogenesis in place of IBMX. In this report, we evaluated CNP-dependent enhancement of adipogenesis by measuring lipid
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
accumulation as well as adipocyte-specific gene levels. We also quantified CNP transcription levels in each stage of adipogenesis to understand how GC-B is activated during adipogenesis. 2. Materials and methods 2.1. Cell culture 3T3-L1 preadipocyte cells (ATCC) were cultured with Dulbecco’s modified eagle’s medium (DMEM, Gibco) containing a penicillin-streptomycin antibiotics cocktail (Gibco) and 10% heat-inactivated fetal bovine serum (FBS, Gemini). To induce adipogenesis, 3T3-L1 cells were cultured with DMEM containing 10% non-heat-inactivated FBS, 5 g/ml bovine INS (Sigma), 1 M DEX (Sigma), and a compound of interest such as 0.5 mM IBMX (Sigma), 0.5 mM IBMX plus 2 M KT5823 (Calbiochem), 0.5 mM 8-Br-cGMP (Sigma), 0.1 M CNP or 0.1 M ANP (Bachem). The medium was replaced daily. All experiments were performed using 3T3-L1 cells of less than five passages from the original vial obtained from ATCC. 2.2. Staining of adipocytes Cells were stained with Oil Red O lipid staining dye. 0.5% Oil Red O dissolved in 2-propanol was mixed with water at a ratio of 3:2 and filtered. Cells were washed with phosphate-buffered saline and 60% 2-propanol, and then stained with the Oil Red O staining solution. Following incubation at 37 ◦ C for 1 h, cells were washed with 60% 2-propanol and water. To evaluate adiposity, Oil Red O accumulated in oil droplets of adipocytes was recovered with 100% 2-propanol and the concentration of Oil Red O in the 2-propanol solution was estimated by measuring absorbance at 545 nm. Nonspecific staining was evaluated by staining cells grown with DMEM containing 10% non-heat-inactivated FBS. In these cells, no droplets were formed. 2.3. Real time PCR Total RNA was purified using RNeasy RNA purification kit. Following DNase treatment, RNA was reverse transcribed using MMLV reverse transcriptase (Invitrogen) to synthesize template cDNA. Two nanograms of cDNA was mixed with SYBR green Master Mix (Applied Biosystems) and the primer pair CTTCTCTGTGGGTGGCATGA and ACACGGCCAAGACATTGTTG for glucose transporter 4 (Glut4, GenBankTM accession number NM 009204); ATGCCAAAAATATCCCTGGTTTC and GGAGGCCAGCATCGTGTAGA for peroxisome proliferator-activated receptor-gamma 2 (PPAR␥2, GenBankTM accession number NM 011146); CATGAGCGGTCTGGGATGTT and TCCAGATGCTGGAGGCTGAT for CNP (GenBankTM accession number NM 010933); or TTCCAGCAGATGTGGATCAG and GAAAGGGTGTAAAACGCAGC for -actin (GenBankTM accession number NM 007393). Real time PCR was performed using Prism 7900HT (Applied Biosystems).
1907
serum-free DMEM. Succinylation mixture (succinic anhydrate:1,4dioxane:triethylamine = 1:20:5) was added to the solution and the reaction was incubated for 30 min at room temperature. Following evaporation by Speed-vac, the resulting pellets were dissolved with 90 mM sodium acetate (pH 6.2) solution, and aliquots were used for measurement of cGMP by radioimmunoassay as described previously [5]. 2.5. Measurement of lipolysis Lipolysis was evaluated by measurement of free glycerol release from differentiated 3T3-L1 adipocytes. Confluent cells cultured on 12-well plates were cultured with DMEM containing 10% FBS, 5 g/ml INS, 1 M DEX and 0.5 mM IBMX for 12 days. Then the cells were washed twice with serum- and phenol red-free DMEM containing 20 mM Hepes (pH 7.3) and culture with the same medium for 2 h in the absence or presence of 0.1 M ANP or CNP, or 0.5 mM 8-Br-cAMP. The glycerol content in the incubation media was measured using Free Glycerol Reagent (Sigma) according the manufacturer’s protocol. 2.6. Statistics Statistics were performed by ANOVA followed by Dunnet’s post hoc comparison. P < 0.05 was considered significant. 3. Results 3.1. 3T3-L1 cells express GC-B and elevate cGMP production upon stimulation with CNP Chrisman et al. [6] demonstrated that BALB/3T3 and NIH3T3 cells express high levels of GC-B, and that CNP potently stimulates cGMP production in these cells. We hypothesized that 3T3-L1, another murine fibroblast cell line, which is capable of differentiating into adipocytes, also expresses GC-B. To test this hypothesis, we stimulated these cells with CNP and atrial natriuretic peptide (ANP), which predominantly stimulates guanylyl cyclase-A (GC-A) rather than GC-B, and compared their potency. As shown in Fig. 1A, CNP is far more potent than ANP in elevating cGMP production in untreated 3T3-L1 cells. It is reasonable to assume that the cGMP produced in 3T3-L1 cells upon ANP treatment may also be due to activation of GC-B, because ANP is a partial agonist of this receptor [12]. Therefore, we conclude that the vast majority of membrane-bound GC in untreated 3T3-L1 cells is GC-B. On the other hand, the potency of ANP in elevating cGMP production in 3T3-L1 cells after treatment with adipogenic cocktail for 14 days was enhanced, and cGMP levels upon stimulation with 10−9 and 10−8 M ANP was slightly higher than those induced by CNP treatment, revealing that GC-A participates in elevation of cGMP upon stimulation with ANP in differentiated 3T3-L1 cells. 3.2. CNP predominantly enhances adiposity of 3T3-L1 cells in the presence of INS and DEX
2.4. Measurement of cGMP production Cells were cultured for 24 h with DMEM containing 0.5% FBS in 24-well culture plates. The medium was replaced with serumfree DMEM and cells were further cultured for 2 h. Following addition of 0.25 mM IBMX and 15-min incubation at 37 ◦ C, CNP or ANP was added to the incubation medium for 5 min. The incubation medium was then removed by aspiration, and 95% ethanol was added to each well. After one freeze–thaw cycle at −85 ◦ C, the ethanol was transferred to glass tubes and evaporated by Speed-vac. The resulting pellets were dissolved with
We next cultured 3T3-L1 cells for 12 days with adipogenesis medium containing INS and DEX in the absence or presence of IBMX, CNP, ANP and 8-Br-cGMP, a membrane-permeable cGMP analogue. In the absence of these stimulants, no adipocytes were formed (Fig. 2A). Upon stimulation with only INS and DEX, a small number of adipocytes were observed (Fig. 2B), indicating that INS and DEX are the minimum required compounds for promotion of adipogenesis in 3T3-L1 cells. In the presence of IBMX in addition to INS and DEX, which is a commonly used condition for induction of adipogenesis in 3T3-L1 cells, most 3T3-L1 cells became spherical in
1908
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
Fig. 1. Dose–response elevation of cGMP production in 3T3-L1 cells, 3T3-L1 cells before (A) or after (B) treatment with the adipogenic cocktail for 14 days were stimulated with CNP () or ANP (䊉) at the indicated concentrations for 5 min at 37 ◦ C. All data are shown as mean + SEM, N = 3. Note that in the absence of ANP or CNP, cGMP production was not detectable.
shape and contained numerous Oil Red O-stainable lipid droplets (Fig. 2C). When 3T3-L1 cells were cultured with CNP in the presence of INS and DEX, the number of Oil Red O-stained cells was significantly enhanced compared with those stimulated with INS and DEX alone (Fig. 2D). However, CNP did not stimulate adipogenesis in the absence of INS and DEX (data not shown). ANP also stimulated adipogenesis in the absence of INS and DEX, but the adiposity of differentiated adipocytes was lower than that of cells stimulated with CNP. This result is consistent with the potency of cGMP production by these peptides. 8-Br-cGMP, a membrane-permeable cGMP analogue, also increased the number of adipocytes (Fig. 2E), indicating that the effect of CNP on 3T3-L1 cell differentiation is mediated through a cGMP-dependent pathway. Quantification of Oil Red O staining of lipids in oil droplets of adipocytes (Fig. 2F), showed that cells cultured with INS, DEX and CNP accumulate approximately 2-fold more lipid than cells cultured with INS and DEX only. Fig. 2G shows the dose-dependence of enhancement of Oil Red O staining of 3T3-L1 cells by CNP. There is a reasonably close correlation between the concentrations of CNP that increases cell adiposity and those that elevate cGMP levels in these cells (compare with Fig. 1), further supporting the view that CNP influences 3T3-L1 cell differentiation by activating guanylyl cyclase activity. ANP also significantly increased cell adiposity (Fig. 2H), although the extent of increase was smaller than that elicited by CNP. It is likely that the effect of ANP is due to the fact that this peptide is a partial agonist of GC-B. We next treated cells with cGMP-dependent kinase (cGK) inhibitor KT5823, to investigate whether the enhancement of adiposity is mediated through a cGK-dependent pathway. As shown in Fig. 2I, adiposity in differentiated cells was significantly reduced when KT5823 was added to the adipogenesis cocktail containing INS, DEX and IBMX. Note that the enhancement of adiposity by CNP was difficult to observe when 3T3-L1 cells of more than five passages were used. 3.3. CNP significantly enhances mRNA levels of adipocyte-specific genes
ment of Glut4 and PPAR␥2 mRNA levels when substituted for IBMX. An increase in mRNA levels was also evident upon addition of 8Br-cGMP to INS and DEX. 3.4. CNP mRNA level is transiently elevated at an early stage of adipogenesis In view of the above results indicating a role for CNP in adipogenesis, we hypothesized that CNP may act as an autocrine/paracrine factor during a particular stage of adipogenesis. To test this hypothesis, we measured mRNA levels of CNP in 3T3-L1 cells treated with INS, DEX and IBMX for 0 h, 3 h, 8 h, 24 h, 3 days, 7 days and 12 days [14]. It is generally considered that adipogenesis occurs in three stages. During the first 24 h there is enhanced synthesis of CCAAT enhancer binding protein (C/EBP)- and ␦, which are regulators of gene transcription for the subsequent, intermediate stage. In the intermediate stage (1–3 days) there is increased synthesis of PPAR␥ and C/EBP␣, which regulates genes that are essential for adipocyte function. Finally, in the late stage, proteins essential for energy storage (e.g., Glut4, aP2, perilipin) are induced, and cells are functional adipocytes with evident lipid droplets. As shown in Fig. 4, mRNA levels reached a maximum 8 h after treatment with the adipogenic cocktail. Therefore, it is likely that CNP exerts its effects as an autocrine/paracrine factor primarily at the early stage. 3.5. Neither ANP nor CNP enhanced lipolysis in differentiated 3T3-L1 cells We next evaluated the effects of ANP and CNP on lipolysis in 3T3-L1 adipocytes. As shown in Fig. 5, neither ANP nor CNP elevated free glycerol level in the medium of differentiated 3T3-L1 cells, whereas 8-Br-cAMP, a membrane-permeable cAMP analogue, potently enhanced its level. These facts suggest that effect of natriuretic peptides on lipolysis is quite small, at least on 3T3-L1 adipocytes. 4. Discussion
To confirm that CNP triggers an adipogenesis program in 3T3L1 cells, we measured the effect of CNP (in the presence of INS and DEX) on mRNA levels of two adipogenesis markers, Glut4 and PPAR␥2. As shown in Fig. 3, treatment with INS and DEX alone enhanced the mRNA levels of Glut4 and PPAR␥ by approximately 5–10-fold. Addition of IBMX nearly doubled these mRNA levels, and greatly enhanced the conversion of 3T3-L1 cells from a fibroblastlike morphology to a more spherical adipocyte-like morphology. Interestingly, CNP showed similar, though slightly lower, enhance-
In this study, we demonstrated that the CNP/GC-B system is an important natural regulator of adipogenesis, and may function as an autocrine/paracrine factor in early adipogenesis for enhancement of adiposity in 3T3-L1 cells. Recent reports have indicated that cGMP-dependent signaling plays a role in the promotion of adipogenesis. Haas et al. [10] clearly showed that nitric oxide/cGKI signaling was responsible for the regulation of brown adipocyte differentiation among several cGMP-dependent signaling systems,
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
1909
Fig. 3. Enhancement of adipocyte-specific genes. Copy numbers of PPAR␥2 and Glut4 mRNAs were measured in cDNA synthesized from RNA of differentiated 3T3L1 cells cultured with the indicated compounds using the real time PCR system. The copy number of each gene was normalized to that of -actin. All data are shown as mean + SEM. N = 3. *P < 0.05, **P < 0.01.
Fig. 4. Time-course of CNP mRNA levels during differentiation of 3T3-L1 cells. 3T3L1 cells were cultured with DMEM plus non-heat-inactivated FBS in the absence or presence of INS, DEX and IBMX for the indicated times. RNAs were then purified from the cells and copy numbers of CNP were measured using the real time PCR system as described above. Each CNP mRNA level was normalized to that of -actin, and the amounts shown in the figure represent (raw data) × 104 . All data are shown as mean + SEM. Asterisks indicate significant difference to “Time = 0”. N = 3. *P < 0.05, **P < 0.01.
by using cGK-I-deficient brown adipocyte progenitor cells. Zhang et al. [25] showed that sildenafil, a phosphodiesterase 5-specific inhibitor, which specifically blocks cGMP degradation, as well as a membrane-permeable cGMP analogue promotes adipogenesis in 3T3-L1 cells through a PKG pathway, but they did not identify
Fig. 2. Representative images of differentiated 3T3-L1 cells stained with Oil Red O and measurement of their adiposity. Cells were cultured with DMEM plus non-heat-inactivated FBS with no addition (A), or together with INS and DEX (B), INS, DEX and IBMX (C), INS, DEX and CNP (D) or INS, DEX and 8-Br-cGMP (E). The cells were then stained with Oil Red O and photographed. (F) Adiposity of differentiated cells cultured with DMEM plus non-heat-inactivated FBS in the absence or presence of indicated compounds. (G) Dose-dependent enhancement of adiposity by CNP. (H) Comparison of adipogenic effect between CNP and ANP. 3T3-L1 cells were cultured in the presence of INS and DEX only (ID), INS and DEX plus 10−7 M
CNP (CNP7) and INS and DEX plus 10−7 M ANP (ANP7). (I) Effect of cGK inhibitor on IBMX-induced adipogenesis. 3T3-L1 cells were cultured in the presence of INS, DEX and IBMX (IBMX) or INS, DEX, IBMX plus KT5823 (+KT). To quantify adiposity, the cells stained with Oil Red O were washed with 60% 2-propanol, and then Oil Red O sticking to oil droplets of adipocytes was recovered with 100% 2-propanol for measurement of OD545 . The concentration of Oil Red O in each well was normalized to DNA content, N = 3. All data are shown as mean + SEM. *P < 0.05, **P < 0.01, ***P < 0.001.
1910
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911
by type II cGK [4]. It is noteworthy in this context that C/EBP associates with Ca2+ -activated cAMP response element binding protein to synergistically activate the fos promoter in neuronal and osteogenic cells [4]. In conclusion, we discovered that cGMP produced by the CNP/GC-B system enhances adiposity in 3T3-L1 cells, and we raised the possibility that this system, together with cGK and C/EBP, regulates early events in adipogenesis. Acknowledgment The authors are grateful to Dionne Ware for secretarial assistances. This work was supported by Grant DK073120 from the National Institutes of Health.
Fig. 5. Effect of CNP on lipolysis. Differentiated 3T3-L1 adipocytes were further cultured in serum- and phenol red-free DMEM in the absence (none) or presence of ANP (ANP8; 10−8 M ANP, ANP7; 10−7 M ANP), CNP (CNP8; 10−8 M CNP, CNP7; 10−7 M CNP) or 0.5 mM 8-Br-cAMP (cAMP). Following 2 h-incubation, the incubation media were recovered, and their glycerol contents were measured.
the signaling molecules that activate cGMP-dependent signaling. Our results suggest that CNP may be an endogenous regulator of cGMP-dependent signaling for promotion of adipogenesis, serving, at least in part, the function played in vitro by the phosphodiesterase inhibitor, IBMX. Recent investigations have revealed that ANP reduces adiposity in mature adipocytes by activating hormone-sensitive lipase (HSL) at least in human and rat [13,15,21]. In contrast, our work demonstrates that CNP (together with INS and DEX) enhances adiposity, as shown both by lipid accumulation and by increased levels of adipogenesis marker genes (Figs. 2 and 3). These observations suggest that the CNP/cGMP system regulates different biological events than those of the ANP/cGMP system. As shown Fig. 1, CNP stimulated cGMP production in 3T3-L1 cells with a potency much higher than that of ANP before treatment with the adipogenic cocktail, while the potency of ANP to cGMP production was almost similar to that of CNP in 3T3-L1 cells after a 14 day treatment with the adipogenic cocktail. This enhanced sensitivity of cGMP production to ANP in differentiated adipocytes was also reported by Sengenes et al. [21] and Nishikimi et al. [15,21]. Furthermore, CNP mRNA level was transiently enhanced and reached a maximum when cells were cultured with the adipogenic cocktail for 8 h (Fig. 4). Based on these data, we suggest that the CNP/cGMP system regulates biological events especially in the early stage of adipogenesis to enhance adiposity in 3T3-L1 cells, whereas the ANP/cGMP system regulates events in mature adipocytes such as activation of HSL. Our data shown in Fig. 5 reveal that lipolysis was not significantly enhanced upon stimulation with ANP or CNP in adipocytes differentiated from the murine cell line 3T3-L1, which is consistent with the data by Sengenes et al. [22] that natriuretic peptide-dependent lipolysis occurred in primate adipocytes, but not in adipocytes of other mammals including rodents. However, Nishikimi et al. [15] observed ANP-dependent lipolysis in differentiated adipocytes derived from rat preadipocyte cell line. These facts suggest that natriuretic peptide-dependent lipolysis in rodent adipocytes may occur under certain conditions. Several lines of evidence suggest that CNP-mediated enhancement of cGMP-dependent signaling is tightly regulated to control early stage of adipogenesis. First, levels of CNP itself are transiently increased in the early adipogenesis (Fig. 4). Second, expression of Kruppel-like transcription factor 4, which regulates expression of cGK, is also elevated in early adipogenesis [1]. Finally, C/EBP, which is synthesized during early adipogenesis and is required for subsequent stages of adipocyte differentiation, can be activated
References [1] Birsoy K, Chen Z, Friedman J. Transcriptional regulation of adipogenesis by KLF4. Cell Metab 2008;7:339–47. [2] Boney CM, Fiedorek Jr FT, Paul SR, Gruppuso PA. Regulation of preadipocyte factor-1 gene expression during 3T3-L1 cell differentiation. Endocrinology 1996;137:2923–8. [3] Bost F, Aouadi M, Caron L, Even P, Belmonte N, Prot M, et al. The extracellular signal-regulated kinase isoform ERK1 is specifically required for in vitro and in vivo adipogenesis. Diabetes 2005;54:402–11. [4] Chen Y, Zhuang S, Cassenaer S, Casteel DE, Gudi T, Boss GR, et al. Synergism between calcium and cyclic GMP in cyclic AMP response element-dependent transcriptional regulation requires cooperation between CREB and C/EBP-beta. Mol Cell Biol 2003;23:4066–82. [5] Chrisman TD, Garbers DL. Reciprocal antagonism coordinates C-type natriuretic peptide and mitogen-signaling pathways in fibroblasts. J Biol Chem 1999;274:4293–9. [6] Chrisman TD, Schulz S, Potter LR, Garbers DL. Seminal plasma factors that cause large elevations in cellular cyclic GMP are C-type natriuretic peptides. J Biol Chem 1993;268:3698–703. [7] Friedman JM. Modern science versus the stigma of obesity. Nat Med 2004;10:563–9. [8] Gagnon A, Chen CS, Sorisky A. Activation of protein kinase B and induction of adipogenesis by insulin in 3T3-L1 preadipocytes: contribution of phosphoinositide-3,4,5-trisphosphate versus phosphoinositide-3,4bisphosphate. Diabetes 1999;48:691–8. [9] Garbers DL, Chrisman TD, Wiegn P, Katafuchi T, Albanesi JP, Bielinski V, et al. Membrane guanylyl cyclase receptors: an update. Trends Endocrinol Metab 2006;17:251–8. [10] Haas B, Mayer P, Jennissen K, Scholz D, Diaz MB, Bloch W, et al. Protein kinase G controls brown fat cell differentiation and mitochondrial biogenesis. Sci Signal 2009;2:ra78. [11] Karamitri A, Shore AM, Docherty K, Speakman JR, Lomax MA. Combinatorial Transcription factor regulation of the cyclic AMP-response element on the Pgc1{alpha} Promoter in white 3T3-L1 and brown HIB-1B preadipocytes. J Biol Chem 2009;284:20738–52. [12] Koller KJ, Lowe DG, Bennett GL, Minamino N, Kangawa K, Matsuo H, et al. Selective activation of the B natriuretic peptide receptor by C-type natriuretic peptide (CNP). Science 1991;252:120–3. [13] Langin D, Dicker A, Tavernier G, Hoffstedt J, Mairal A, Ryden M, et al. Adipocyte lipases and defect of lipolysis in human obesity. Diabetes 2005;54:3190–7. [14] MacDougald OA, Lane MD. Transcriptional regulation of gene expression during adipocyte differentiation. Annu Rev Biochem 1995;64:345–73. [15] Nishikimi T, Iemura-Inaba C, Akimoto K, Ishikawa K, Koshikawa S, Matsuoka H. Stimulatory and Inhibitory regulation of lipolysis by the NPR-A/cGMP/PKG and NPR-C/G(i) pathways in rat cultured adipocytes. Regul Pept 2009;153:56–63. [16] Pantoja C, Huff JT, Yamamoto KR. Glucocorticoid signaling defines a novel commitment state during adipogenesis in vitro. Mol Biol Cell 2008;19:4032–41. [17] Peng XD, Xu PZ, Chen ML, Hahn-Windgassen A, Skeen J, Jacobs J, et al. Dwarfism, impaired skin development, skeletal muscle atrophy, delayed bone development, and impeded adipogenesis in mice lacking Akt1 and Akt2. Genes Dev 2003;17:1352–65. [18] Petersen RK, Madsen L, Pedersen LM, Hallenborg P, Hagland H, Viste K, et al. Cyclic AMP (cAMP)-mediated stimulation of adipocyte differentiation requires the synergistic action of Epac- and cAMP-dependent protein kinase-dependent processes. Mol Cell Biol 2008;28:3804–16. [19] Prusty D, Park BH, Davis KE, Farmer SR. Activation of MEK/ERK signaling promotes adipogenesis by enhancing peroxisome proliferator-activated receptor gamma (PPARgamma) and C/EBPalpha gene expression during the differentiation of 3T3-L1 preadipocytes. J Biol Chem 2002;277:46226–32. [20] Reusch JE, Colton LA, Klemm DJ. CREB activation induces adipogenesis in 3T3-L1 cells. Mol Cell Biol 2000;20:1008–20. [21] Sengenes C, Bouloumie A, Hauner H, Berlan M, Busse R, Lafontan M, et al. Involvement of a cGMP-dependent pathway in the natriuretic peptidemediated hormone-sensitive lipase phosphorylation in human adipocytes. J Biol Chem 2003;278:48617–26.
T. Katafuchi et al. / Peptides 31 (2010) 1906–1911 [22] Sengenes C, Zakaroff-Girard A, Moulin A, Berlan M, Bouloumie A, Lafontan M, et al. Natriuretic peptide-dependent lipolysis in fat cells is a primate specificity. Am J Physiol Regul Integr Comp Physiol 2002;283:R257–65. [23] Smas CM, Chen L, Zhao L, Latasa MJ, Sul HS. Transcriptional repression of pref1 by glucocorticoids promotes 3T3-L1 adipocyte differentiation. J Biol Chem 1999;274:12632–41.
1911
[24] Zhang JW, Klemm DJ, Vinson C, Lane MD. Role of CREB in transcriptional regulation of CCAAT/enhancer-binding protein beta gene during adipogenesis. J Biol Chem 2004;279:4471–8. [25] Zhang X, Ji J, Yan G, Wu J, Sun X, Shen J, et al. Sildenafil promotes adipogenesis through a PKG pathway. Biochem Biophys Res Commun 2010;396: 1054–9.