Co-culture microorganisms with different initial proportions reveal the mechanism of chalcopyrite bioleaching coupling with microbial community succession

Bioresource Technology 223 (2017) 121–130

Contents lists available at ScienceDirect

Bioresource Technology journal homepage: www.elsevier.com/locate/biortech

Co-culture microorganisms with different initial proportions reveal the mechanism of chalcopyrite bioleaching coupling with microbial community succession Liyuan Ma a,b, Xingjie Wang a, Xue Feng a, Yili Liang a,b, Yunhua Xiao a,b, Xiaodong Hao a,b, Huaqun Yin a,b, Hongwei Liu a,b, Xueduan Liu a,b,⇑ a b

School of Minerals Processing and Bioengineering, Central South University, 410083, China Key Laboratory of Biometallurgy of Ministry of Education, 410083, China

h i g h l i g h t s

g r a p h i c a l a b s t r a c t


Effect of different initial microbial

proportions on CuFeS2 bioleaching was studied.
More sulfur oxidizers lead to higher Cu recovery than more ferrous oxidizers.
Succession of free and attached cells with different initial proportions was studied.
A model for CuFeS2 bioleaching was established coupling with community succession.

a r t i c l e

i n f o

Article history: Received 23 August 2016 Received in revised form 12 October 2016 Accepted 19 October 2016 Available online 21 October 2016 Keywords: Chalcopyrite bioleaching Initial proportions Microbial community succession Iron/sulfur metabolism

a b s t r a c t The effect of co-culture microorganisms with different initial proportions on chalcopyrite bioleaching was investigated. Communities were rebuilt by six typical strains isolated from the same habitat. The results indicated, by community with more sulfur oxidizers at both 30 and 40 °C, the final copper extraction rate was 19.8% and 6.5% higher, respectively, than that with more ferrous oxidizers. The variations of pH, redox potential, ferrous and copper ions in leachate also provided evidences that community with more sulfur oxidizers was more efficient. Community succession of free and attached cells revealed that initial proportions played decisive roles on community dynamics at 30 °C, while communities shared similar structures, not relevant to initial proportions at 40 °C. X-ray diffraction analysis confirmed different microbial functions on mineral surface. A mechanism model for chalcopyrite bioleaching was established coupling with community succession. This will provide theoretical basis for reconstructing an efficient community in industrial application. Ó 2016 Elsevier Ltd. All rights reserved.

1. Introduction The majority of copper reserves in the world are bound in the sulfide mineral chalcopyrite (CuFeS2). As an economical and envi⇑ Corresponding author at: School of Minerals Processing and Bioengineering, Central South University, 410083, China. E-mail address: [email protected] (X. Liu). http://dx.doi.org/10.1016/j.biortech.2016.10.056 0960-8524/Ó 2016 Elsevier Ltd. All rights reserved.

ronmental friendly method, chalcopyrite bioleaching continues attracting much attention because non-renewable mineral resources are exploited and depleted unceasingly (Panda et al., 2015). However, the dissolution of chalcopyrite in acid solution is an extremely slow process due to its high lattice energy (Klauber, 2003; Watling, 2013). As a result, the practical application of chalcopyrite bioleaching is limited.

122

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

Many considerable efforts have been devoted to enhance the bioleaching efficiency, including using photocatalysis to reduce ferric iron to ferrous iron as metabolic substrates (Zhou et al., 2015), controlling the redox potential to limit the formation of passivation layer (Córdoba et al., 2008; Zhao et al., 2015), or inventing new method using BACFOX bioreactor by the direct removal of surface passivation layer (Panda et al., 2013). At the same time, many researchers attempted to provide insight into the microbial community linked to different environmental stress during bioleaching (He et al., 2010; Watling et al., 2010). More than 40 types of bioleaching microbial species have been discovered in the leaching system (Edwards et al., 1999; Panda et al., 2015). According to their functional categories, acidophiles can be classified into ferrous oxidizer, sulfur oxidizer and ferrous/sulfur oxidizer (Méndez-García et al., 2015). Previous studies have demonstrated that the mixed cultures were more efficient than pure cultures on leaching performance (Li et al., 2014; Qiu et al., 2005). The dominant strains applied in different bioleaching systems were always differential owing to the differences of environmental pH, temperature and mineral properties. As a whole, it can be generally classified according to their functional categories, as Leptospirillum ferriphilum and Ferroplasma acidiphilum (ferrous oxidizer), Acidithiobacillus caldus and A. thiooxidans (sulfur oxidizer), A. ferrooxidans and Sulfobacillus thermosulfidooxidans (ferrous/sulfur oxidizer) (Chen et al., 2014; Gonzalez-Toril et al., 2003; ShahrabiFarahani et al., 2014). The synergistic function between different type strains was beneficial for better balancing iron and sulfur metabolism (Behera et al., 2011). However, the communities used in researches were either too simple by only one or two strains (Feng et al., 2016) or too complicated by natural samples (Liu et al., 2016). The former was not credible for industrial application, and the latter usually omit the functions of rare species that indeed existed in the community. Few researches have reported the effect of initial proportions of microorganisms isolated from the same habitat on chalcopyrite leaching. Breeding excellent strains and optimizing microbial structure were effective ways to improve the microbial function. As the dynamics of different oxidizers in a community was closely related to the process of chalcopyrite dissolution, it is meaningful to investigate the effect of different microbial proportions in a community on chalcopyrite bioleaching. Both the adsorption capacity of attached cells on mineral surface and the oxidative activity of free cells in leachate were critical to the leaching efficiency, so evaluating the free and attached microbial community succession was meaningful to reveal the mechanism of chalcopyrite bioleaching (Zeng et al., 2010). In the previous work, six strains isolated from different habitat have been combined and inoculated into chalcopyrite to access the leaching efficiency and microbial community structure roughly (Feng et al., 2015b). Herein, in order to eliminate the unexpected genetic divergence of strains from different localities, a microcosm by six typical strains isolated from the same habitat was reconstructed. The microcosm was used to reveal the mechanism of chalcopyrite bioleaching coupling with microbial community succession based on different initial microbial proportions. Considering that temperature variation displayed a great influence on microbial community (Ma et al., 2013), two temperature gradient was set at 30 °C and 40 °C.

trometry (ICP-AES, PS-6, Baird, USA), and mineralogical analysis was carried out by X-ray diffraction (XRD, D/Max 2500, Rigaku, Japan). The results showed that Fe (29.59%), Cu (30.74%), and S (25.73%) were the major elements, and the mineral sample mainly comprised of chalcopyrite. Six typical bioleaching strains, according to their different types of energy utilization, were used to rebuild four artificial co-culture systems based on different initial microbial proportions. They were A. ferrooxidans DX-m (GenBank accession No. KX694508), S. thermosulfidooxidans DX-m (KX694510), L. ferriphilum DX-m (KX694509), F. acidiphilum DX-m (KX694511), A. caldus DX-m (KX694512) and A. thiooxidans DX-m (KX694513), which were all isolated from the acid mine drainage of Dexing copper mine, China. The pure culture conditions of each strain were listed in Table 1. The 9K basal medium contains of the following ingredients (g/L): (NH4)2SO4 (3), K2HPO4 (0.5), KCl (0.1), Ca(NO3)2 (0.01), MgSO47H2O (0.5).

2. Materials and methods

2.3.2. Analysis of community succession in co-culture systems The leaching sample (5.0 mL) for each of the four groups was collected and centrifuged at 2000g for 2 min for separating supernatant from mineral precipitation. The supernatant containing free cells was transferred thoroughly. The bottom mineral sample was re-suspended using 25 mL fresh media. Then, 1 g of 0.2 mm glass beads was added and shaken on a vortexer for

2.1. Minerals and microorganisms The chalcopyrite used in this study was ground and sieved to less than 74 lm in particle diameter. Elemental composition was analyzed by inductively coupled plasma-atomic emission spec-

2.2. Bioleaching experiment To avoid external bacterial contamination, the mineral samples and 100 mL 9K medium were sterilized by autoclaving (Karan et al., 1996) at 110 °C for 40 min and 121 °C for 25 min, respectively. Then, they were mixed in 250 mL shake flasks after cooling down. Acid pre-leaching was introduced until the pH was stabilized at 2.0 (adjusted by 10% H2SO4). The chalcopyrite bioleaching experiments were conducted with initial cells density of 6  106 cells/mL and pulp density of 3% (w/v). According to their different types of energy utilization, A. ferrooxidans DX-m (ferrous and sulfur), S. thermosulfidooxidans DX-m (ferrous and sulfur), L. ferriphilum DX-m (only ferrous), F. acidiphilum DX-m (only ferrous), A. caldus DX-m (only sulfur) and A. thiooxidans DX-m (only sulfur) were classified to construct four microbial groups: I, 1:1:1:1:1:1; II, 10:10:1:1:1:1; III, 1:1:10:10:1:1; IV, 1:1:1:1:10:10 (cell amount). Considering temperature variation displayed a great influence on microbial community, the four co-culture groups and one abiotic control were incubated at 30 °C and 40 °C, respectively. All ten leaching reactions were undertaken on a rotary platform at 175 rpm for 42 days. During leaching process, distilled water and 9K medium were added periodically to compensate for the evaporation loss and sampling loss. All experiments were performed in triplicate with three flasks per treatment. 2.3. Analytical methods 2.3.1. Analysis of main chemical parameters The physicochemical parameters were measured during the chalcopyrite bioleaching. The supernatant was withdrawn every three days and was analyzed for the concentration of dissolved copper and ferrous iron using BCO spectrophotometry and byophenanthroline spectrophotometry, respectively. In addition, pH was measured by a digital pH meter (PHSJ-4A, Leici, Shanghai, China) and oxidation-redox potential (ORP) of leaching solution was measured by a platinum electrode (213-01, Leici, Shanghai, China) with an Ag/AgCl reference electrode (218, Leici, Shanghai, China). Residue samples were collected and weighed regularly for ICP-AES and copper extraction rate calculation, XRD analysis was carried out for detecting the mineral constituent.

123

L. Ma et al. / Bioresource Technology 223 (2017) 121–130 Table 1 Culture media of six strains used in present study. Species

Strains

Energy type

A. ferrooxidans S. thermosulfidooxidans L. ferriphilum F. acidiphilum A. caldus A. thiooxidans

DX-m DX-m DX-m DX-m DX-m DX-m

Ferrous and sulfur oxidizer Ferrous and sulfur oxidizer Ferrous oxidizer Ferrous oxidizer Sulfur oxidizer Sulfur oxidizer

Growth requirements Media (g/L)

5 min according to the reported procedures (Feng et al., 2016). The above process was repeated once until no more cells could be counted under microscope. As a result, all attached cells were eluted in the collected supernatant. Cell density was monitored by hemocytometry with a Neubauer chamber hemocytometer, and then, supernatants containing free and attached cells were centrifuged at 12,000g for 10 min for cells collection. Subsequently, the genomic DNA was extracted using the TIANampÒ Bacteria DNA kit (Tiangen Biotech Co. Ltd., Beijing, China). The quality of DNA was examined with 1.0% (w/v) agarose gel electrophoresis and a NanoDropÒ ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, USA). DNA concentration was estimated with the QubitÒ 2.0 Flurometer applying the dsDNA HS Assay (Life Technologies, Invitrogen, Germany). Real-time quantification polymerase chain reaction (RT-qPCR) was used to analyze the population dynamics during the bioleaching process. The primers of six species were designed by using Primer Premier 5.0 and synthesized by BioSune Biotech Co. Ltd. (Shanghai, China). Details of primers were summarized in Table 2. To ensure the specificity of primers, the quality of the amplified DNA fragments stained by ethidium bromide was checked through 1.5% agarose gel electrophoresis and purified using QIAquick-spin PCR purification kit (Qiagen, Hilden, Germany). Then, DNA sequencing was conducted by BioSune and BLAST analysis was executed in GenBank (http://www.ncbi.nlm.nih.gov/BLAST/). Before RT-qPCR, the conventional PCR products were diluted serially from 104 to 1010 copies/mL to construct standard curves for each strain. The RT-qPCR was carried out with iCycler iQ Real-time PCR detection system (Bio-Rad Laboratories Inc., Hercules, USA). The reactions were performed under the following procedures: initial 3 min denaturation at 95 °C, and then 40 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s. After the completion of each run, melting curves for the amplicons were measured by raising the temperature 0.5 °C from 59 to 99 °C. The negative controls were also designed and all tests were conducted in triplicate.

9K + FeSO47H2O 9K + FeSO47H2O 9K + FeSO47H2O 9K + FeSO47H2O 9K + S (10) 9K + S (10)

(22.4) + S (5) (22.4) + S (5) + yeast extract (0.2) (44.7) (44.7) + yeast extract (0.1)

pH

Temp (°C)

2.0 1.6 1.6 1.0 2.0 2.0

30 45 40 45 45 30

2.4. Data analysis RT-qPCR data was analyzed using iCycler MyiQ software v1.0 (Bio-Rad). Copy numbers of each conserved gene were quantified from the six standard curves, which generated from known concentrations of PCR products. The correlation coefficients for the standard curves for each gene were greater than 0.995, and PCR amplification efficiencies were between 88.0% and 110%. According to total cell number and percentage of each type of strain, cell number of each strain was calculated, respectively. All experiments were performed at least three times. Each data point and error bar represented the mean and standard deviation, respectively. Statistical analysis was performed using the Student’s t-test by the program SPSS 17.0 (SPSS Inc., Chicago, USA). Detrended correspondence analysis (DCA) was conducted by Canoco 4.5. 3. Results and discussion 3.1. Bioleaching of chalcopyrite by co-culture microorganisms with different initial proportions at 30 °C The sulfur oxidizer accounted for 33.3%, 8.3%, 8.3% and 83.3% of overall microorganisms in group I, II, III and IV, respectively. In group III, the dominant strain was the ferrous oxidizer, which accounted for 83.3%. It meant that the relative abundance of sulfur oxidizer in the four groups was IV > I > II > III. According to the copper concentration (Fig. 1a), four phases were divided as strain adaptive-growing phase (SAG, 0–6th d), rapidly increasing phase (RIC, 6–18th d), slowly increasing phase (SIC, 18–33th d), stationary phase (STA, 33–42th d). 3.1.1. Main physicochemical parameters in leachate The variations of physicochemical parameters during chalcopyrite bioleaching at 30 °C showed that the four experimental groups with different initial microbial proportions promoted the leaching

Table 2 The designed primers used in this study for RT-qPCR. Target species

Primer names

Primer sequences (50 -30 )

Amplicon length (bp)

A. ferrooxidans

rus-S rus-A DoxA-S DoxA-A forB-S forB-A coDH-S coDH-A soxX1-S soxX1-A Sqr-S Sqr-A

ACAAGGGATTCGGTCATAGTTT CCGTCGGATGCCAGGTAAA CCCAGACACCTACGGCAACTT ACATCTTCCACGGTCACAACG GAGTATGCGATTCCGACACCA TGGCTCAAGGGATTCAAGGTA TTGAGGGACGAACTTGGTTTA CAGGGTCATTGCTTTCTATTGTT CAGTATTCCACCCATCAACG ACTCCACCTGGCAAGACAT GCTCGGCAGCCTCAATAC GGTCGGACGGTGGTTACTG

153

S. thermosulfidooxidans L. ferriphilum F. acidiphilum A. caldus A. thiooxidans

267 99 168 114 136

124

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

Fig. 1. Variation (mean ± SD) of pH, ORP, concentration of ferrous and copper ions during chalcopyrite bioleaching at 30 °C (a-copper ions, b-ferrous ions, c-ORP and d-pH).

process differentially (Fig. 1). Compared with group I, II and III, copper concentration of group IV which containing maximum sulfur oxidizer increased to the stable level of 5536 ± 208 mg/L at day 18 firstly, followed by group I (5380 ± 209 mg/L), II (4118 ± 337 mg/L) and III (3264 ± 217 mg/L). The slower increment of copper concentration in the SIC phase may be caused by the formation of jarosite (Pradhan et al., 2008), a candidate for the passivation layer accumulated on the mineral surface inhibiting mineral’s further oxidation. The evidence suggests that the community with more sulfur oxidizers was a better combination for chalcopyrite bioleaching than that with more ferrous oxidizers. Compared with the abiotic control, the ferrous concentration of four experimental groups decreased sharply after day 9, and finally tended to zero. The ferrous oxidative ability of group I, II and IV showed similar tendencies. It’s worth mentioning that the ferrous concentration of group III was always marginally superior to the other groups, which indicated that more introduced ferrous oxidizers could yield more Fe from the mineral. It was generally accepted that ferric ions as oxidants were effective for oxidizing chalcopyrite but ferrous ions contributed to the leaching only as a substrate for iron oxidizer. It was well known that the ORP was partially correlated to the proportion of Fe3+/Fe2+ species, and had a close connection with the efficiency of chalcopyrite bioleaching (Sandström et al., 2005). In present work, ferrous concentration decreased from 509 to 529 mg/L at day 9 to zero at day 18, during which, the ORP in group I and IV increased from 360 and 365 mV to 571 and 583 mV, respectively, while group II and III followed the tendency, yet, the change delayed for 3 and 6 days. The variation of ORP in RIC phase was in accordance with the conclusion that redox potential should be controlled at appropriate range from 380 to

680 mV (vs. Ag/AgCl) to enhance chalcopyrite bioleaching (Panda et al., 2013), and lower ORP was propitious to chalcopyrite bioleaching (Sandström et al., 2005). Thereafter, the ORP in four groups continuously increased to 680 mV in the SIC phase, indicating that iron started to precipitate and inhibit the copper dissolution. Although the group with more sulfur oxidizers could not reduce the ORP significantly, it speeded up the rising process and improved the leaching efficiency. The pH value of the leachate from the abiotic control increased to 3.0 in the first 15 days and subsequently maintained at around 2.9 until the end of leaching. However, the pH value of the group I and IV showed a modest increase before day 9, and then, decreased and stabilized at 1.3 finally. In contrast, the pH of group II and III firstly increased to 3.0 at day 9, subsequently, they declined to 1.4 approximatively. An initial increase in pH can be attributed to the consumption of protons by acid leaching and ferrous oxidation, especially in group II and III, and the subsequent decrease was due to the acid producer of sulfur oxidizer and the jarosite accumulation. As a result, it could be summarized that a group with more sulfur oxidizers can generate more acid, which promotes the bioleaching process of chalcopyrite. All the observations of pH, ORP, concentration of ferrous and copper ions demonstrated that more sulfur oxidizers in the coculture system accelerated the dissolution of chalcopyrite. 3.1.2. Microbial community succession The composition and structure of free cells in four communities cultivated at 30 °C changed obviously during the bioleaching period (Fig. 2a–d, left columns of each time point). Characteristic shades represented the cell density and columns displayed the strain amount at each time point. As expected, group IV

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

125

Fig. 2. The microbial community succession of free and attached cells in four groups constructed by different initial proportions at 30 °C and their detrended correspondence analysis (DCA) results (a-group I, b-group II, c-group III, d-group IV, e-DCA of community succession of free cells and f-DCA of community succession of attached cells, characteristic shades in a–d represented the cell density and columns displayed the strain amount at each time point. The left column represented the free cells and the right one represented the attached cells).

maintained the maximum microbial density with 6.4  108 cells/ mL, approximately 14% higher than that of the other three groups. At the beginning 12 days, A. caldus increased dramatically in group I and IV after inoculation, and L. ferriphilum subsequently occupied a certain proportion (<50%). It has been suggested that A. caldus in leachate might indirectly contribute to sulfide mineral oxidation by generating acidity (Tupikina et al., 2013). However, after the SAG phase, A. ferrooxidans in group II became the dominant species, particularly at day 18 and day 24, increased to 2.0  2.9  108 cells/mL. Interestingly, in group III, A. ferrooxidans, L. ferriphilum, F. acidiphilum, A. caldus, and A. thiooxidans occupied a certain position until the end of RIC phase. The relative abundance of L. ferriphilum in group II and III increased to 88.7% and 88.2% at day 36, respectively. The community fluctuation of group III was caused by interspecific competitions (Mikesková et al., 2012), leading this group which containing maximal ferrous oxidizer to poor copper extraction.

In the SAG phase, when microorganisms colonized to mineral surface, the production of extracellular polymeric substances accelerated the bioleaching process of sulfide ores (Florian et al., 2011). In the SIC phase, the formation of passivation layer prevented further bio-oxidation. Both of biofilm and passivation layer lead to different growth environment and chemical reactions in solution and mineral surface. As a result, the attached microbial succession was markedly different from the free cells. As shown in Fig. 2a–d (right columns of each time point), maximum microbial population on mineral surface was achieved at day 18, compared to free cells at day 30. S. thermosulfidooxidans preferentially attached to mineral surface at day 6 and day 12 significantly, after which, the occupation of A. ferrooxidans increased slightly in group II and III. Then, the dominant strain was alternatively L. ferriphilum and A. caldus in four groups. A shift in abundance of these two strains was reported in the same system (Watling et al., 2013), as their synergistic bioleaching mechanism.

126

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

It has been demonstrated that the attached A. caldus could utilize the reduced inorganic sulfur compounds (RISCs) accumulated on mineral surface as energy sources (Wang et al., 2014). It was also reported that L. ferriphilum had a higher adaptability than A. ferrooxidans under the high ORP and low pH conditions (Xia et al., 2009). DCA was used to examine the overall variation of the free and attached microbial communities among four groups (Fig. 2e and f). The succession trends in proportion of free cells and attached cells were similar. It was noticed that samples at different time points in the same groups clustered together significantly, and the distance between samples in group III and group IV was short. As expected, microbial community structure changed greatly under different initial microbial proportions. In summary, more A. caldus in group caused a higher leaching efficiency. 3.1.3. The XRD analysis of solid residues The extremophiles performed their ferrous- and sulfuroxidation with competition and cooperation based on their functional categories. Consistently, the physicochemical parameters were changed both in solution and residues. The result of XRD analysis (30 °C, Table 3) showed that jarosite accounted for 17.4% ± 0.4% and 25.3% ± 0.3% in residues of group III and IV respectively, at day 18. The abundant jarosite caused obstructions in transferring nutrients from minerals to microorganisms. Therefore, copper concentration in group IV after day 18 increased very slowly while copper extraction rate in group III increased continuously at a relatively high rate. In addition, attached cells of A. caldus can promote chalcopyrite dissolution by removing the passivation layer formed by S0 (Dopson and Lindstrom, 1999). Therefore, only 3.8% of sulfur was detected in group IV which containing more sulfur oxidizers, compared to 8.6% in group III at day 18. Due to the accumulation of jarosite and S0, the chalcopyrite bioleaching went to SIC phase. 3.2. Bioleaching of chalcopyrite by co-culture microorganisms with different initial proportions at 40 °C The procedure of chalcopyrite bioleaching at 40 °C was also divided into strain adaptive-growing phase (SAG, 0–6th d), rapidly increasing phase (RIC, 6–15th d), slowly increasing phase (SIC, 15– 27th d), stationary phase (STA, 27–42th d) based on copper concentration (Fig. 3a). 3.2.1. Main physicochemical parameters in leachate Bioleaching characteristics of co-culture microorganisms with different initial proportions incubated at 40 °C were shown in Fig. 3. The variation of pH, ORP, concentration of ferrous and copper ions of four groups during the bioleaching procedure showed similar tendencies and was not related to the initial proportions. Overall, more sulfur oxidizers resulted in more dissolved copper ions, lower pH, together with faster Fe2+ oxidation

and rapid increase in ORP. Differences among the four experiments appeared in the RIC phase. During this period, the concentration of dissolved copper at day 9 was 4171 ± 14 mg/L, 3419 ± 47 mg/L, 2860 ± 24 mg/L and 5194 ± 219 mg/L in group I, II, III and IV, achieved the maximum difference. After the RIC phase, the difference of copper concentration among four groups became small and insignificant. The variations of other physicochemical parameters were consistent with copper dissolution process. As a consequence, higher soluble copper concentration was observed in higher sulfur oxidizer proportions, analogously to the aforementioned results at 30 °C. 3.2.2. Microbial community succession The microbial communities at 40 °C (Fig. 4a–d) were composed of the thermotolerant microorganism L. ferriphilum and the moderate thermophiles A. caldus, S. thermosulfidooxidans and F. acidiphilum. The mesophilic microorganisms, A. thiooxidans and A. ferrooxidans were not detected. Different from the conditions at 30 °C, the free cell density (shown by the characteristic shades) and community structure of each group at 40 °C (Fig. 4a–d, left columns of each time point) were almost the same. The absolute dominant strain in SAT and RIC phase was A. caldus, which continuously contributed over 70% to the microbial communities at day 18. Then, the proportion of A. caldus was gradually reduced by the ferrous oxidizer L. ferriphilum. As the accumulation of metabolites, the facultative heterotrophic bacteria of S. thermosulfidooxidans and F. acidiphilum maintained certain proportions at STA phase. Similarly, other studies also noted that Ferroplasma assisted in catalyzing metal sulfide oxidation at low pH by removing the accumulating organic products, such as exudates and cell lysates in the leachate (Naoko and Barrie, 2004). It is well known that the attached microorganisms produce extracellular polymeric substances (EPS) of heterogeneous composition that anchor the colonies in the form of biofilms on the mineral surface. Biofilms provide a protective microenvironment against a possibly inhospitable bulk-solution composition or other dynamic forces such as solution flows or abrasion (Shiers et al., 2016). Similarly to the conditions at 30 °C, the community succession of free and attached cells was different. As shown in Fig. 4a–d (right columns of each time point), the dominant strains on mineral surface changed apparently along with the bioleaching process as follows: F. acidiphilum, A. caldus, L. ferriphilum and S. thermosulfidooxidans. It was well agreed with the previous report that F. acidiphilum preferred to attach to mineral surface, particularly at the early stage (Wang et al., 2014). One of the reasons that A. caldus occupied high percentage on mineral surface was the accumulation of S0 after ferrous ions were released to solution. Another reason was that pre-colonization of F. acidiphilum could initiate attachment of A. caldus (Florian et al., 2011; Noël et al., 2010). At the end of bioleaching, the final composition and structure of four microbial communities were similar, including two collaborative species of A. caldus (sulfur oxidizer)

Table 3 The XRD analysis of solid residues from group III (more ferrous oxidizers) and IV (more sulfur oxidizers). Temp (°C)

30

Community groups

III IV

40

III IV

Time (day)

The content of components in residues (%) Chalcopyrite

Jarosite

Sulfur

Quartz

Others

18 33 18 33

71.4 ± 1.2 67.0 ± 0.8 66.8 ± 0.7 65.4 ± 1.0

17.4 ± 0.4 27.9 ± 0.5 25.3 ± 0.3 30.1 ± 0.9

8.6 ± 0.2 – 3.8 ± 0.1 –

2.2 ± 0.1 4.8 ± 0.2 4.0 ± 0.1 4.4 ± 0.1

0.4 ± 0.1 0.3 ± 0.1 0.1 ± 0.1 0.1 ± 0.1

15 27 15 27

70.3 ± 1.5 60.9 ± 0.6 68.3 ± 0.7 60.0 ± 0.9

18.3 ± 0.3 31.3 ± 0.5 21.4 ± 0.2 32.1 ± 0.2

6 ± 0.2 – 2.8 ± 0.1 –

3.8 ± 0.2 6.3 ± 0.3 1.6 ± 0.1 7.6 ± 0.2

1.6 ± 0.5 1.5 ± 0.5 5.9 ± 0.3 0.3 ± 0.2

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

127

Fig. 3. Variation (mean ± SD) of pH, ORP, concentration of ferrous and copper ions during chalcopyrite bioleaching at 40 °C (a-copper ions, b-ferrous ions, c-ORP and d-pH).

and L. ferriphilum (ferrous oxidizer) and one facultative heterotrophic bacteria of S. thermosulfidooxidans, and kept relative equilibrium with each other. In summary, the succession of microbial communities at 40 °C was not related to initial proportions of microorganisms. However, a community with more sulfur oxidizers was conducive to acid production, intensifying the acid leaching and eliminating the inhibition of jarosite and sulfur. Therefore, the co-culture microorganisms with more sulfur oxidizers at initial proportions promoted the process of chalcopyrite bioleaching. The results of DCA revealed the major factor for community succession was microenvironment (e.g. pH, ORP, and ion concentrations), and was not related to the initial proportions of ferrous and sulfur oxidizers (Fig. 4e and f). The samples at the same time point clustered together, for example, after the adaptive-growing phase, the RIC and SIC phase of day 12, day 18 and day 24 in the four groups clustered together, the STA phase of day 30, day 36 and day 42 in the four groups clustered together. The result coincided with the previous study (Zhang et al., 2015), indicating microbial community structure changed greatly along the bioleaching process. 3.2.3. The XRD analysis of solid residues The result of XRD analysis (40 °C, Table 3) showed that the difference between group III and group IV was exhibited at day 15, with the sulfur content of 6% ± 0.2% and 2.8% ± 0.1%. However, after the SIC phase, the content of chalcopyrite was 60.9% ± 0.6% and 60.0% ± 0.9%, and jarosite content was 31.3% ± 0.5% and 32.1% ± 0.2%, in group III and group IV, respectively. Jarosite was the main factor that inhibited further copper dissolution.

3.3. A model for effects of co-culture microorganisms with different initial proportions on chalcopyrite bioleaching To interpret the effects of co-culture microorganisms with different initial proportions on chalcopyrite bioleaching, a mechanism model was established coupling with the community succession (Fig. 5). Results supported the direct mechanism of chalcopyrite bio-oxidation in initial bioleaching (Eqs. (1)), as the ORP was invariant while the copper concentration was increased significant compared with the control group in the SAG phase. Microorganisms with better adsorbabilities, such as S. thermosulfidooxidans at 30 °C and F. acidiphilum at 40 °C accelerated the process.

2CuFeS2 þ 17=2O2 þ 2Hþ ¼ 2Cu2þ þ 2Fe3þ þ H2 O þ 4SO2 4

ð1Þ

Then, chalcopyrite was probably dissolved by the ferric ions (Eq. (2)) and proton attack (Eq. (5)), which was generally accepted as indirect mechanism (Feng et al., 2015a). During this period, iron oxidizer and sulfur oxidizer cooperated to release Fe and S from the minerals, which can be subsequently oxidized by microorganisms to generate ferric sulfate (Eq. (3)) and sulfuric acid (Eq. (6)). 3.3.1. Iron metabolism The advance in microbial recovery would be accompanied by an advance in the resumption of mineral sulfide oxidation by ferric ions. Iron oxidizers, which transferred Fe2+ to Fe3+, had a beneficial effect on chalcopyrite dissolution (Wang et al., 2014). Compared to the condition at 30 °C, more iron oxidizers were detected at 40 °C, which could give a well explanation to that more copper ions were dissolved at 40 °C in the SAG phase. Ferrous iron concentration was

128

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

Fig. 4. The microbial community succession of free and attached cells in four groups constructed by different initial proportions at 40 °C and their detrended correspondence analysis (DCA) results (a-group I, b-group II, c-group III, d-group IV, e-DCA of community succession of free cells and f-DCA of community succession of attached cells, characteristic shades in a–d represented the cell density and columns displayed the strain amount at each time point. The left column represented the free cells and the right one represented the attached cells).

firstly increased in SAG phase owing to the dissolution of chalcopyrite as Eqs. (2) and (5). Then, the ferrous ions formed in the leaching reaction were oxidized (Eq. (3)) by A. ferrooxidans in earlier stage and L. ferriphilum in the later stage at 30 °C, while the ions were oxidized by F. acidiphilum in the earlier stage and L. ferriphilum in the later stage at 40 °C, along with S. thermosulfidooxidans. Stepped into the SIC phase, more jarosite yield in residues as Eq. (4), inhibiting the copper further dissolution. The reactions are illustrated as follows:

CuFeS2 þ 4Fe3þ ¼ Cu2þ þ 2S0 þ 5Fe2þ

ð2Þ

4Fe2þ þ O2 þ 4Hþ ¼ 4Fe3þ þ 2H2 O

ð3Þ

3.3.2. Sulfur metabolism As a result of Eqs. (2) and (5), amount of ferrous irons were released into the leachate while element sulfur accumulated on the mineral surface. Consistently, A. caldus dominated the community of group IV with 3.8% sulfur, while L. ferriphilum was dominant species in group III with 8.6% sulfur accumulated at 30 °C. However, higher temperature accelerated the mineral dissolving and ferrous oxidation process, causing A. caldus dominated both free and attached communities at day 12. Then, sulfur was efficiently utilized as described in Eqs. (6) and (7). In the later stage, instead of A. caldus, the attached communities at 40 °C were occupied by S. thermosulfidooxidans, which was adapted to the environment of organic accumulation.

þ þ 3Fe3þ þ 2SO2 4 þ 6H2 O þ K ¼ KFe3 ðSO4 Þ2 ðOHÞ6 þ 6H

ð4Þ

CuFeS2 þ 4Hþ þ O2 ¼ Cu2þ þ 2S0 þ Fe2þ þ 2H2 O

ð5Þ

129

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

Fig. 5. A mechanism model for chalcopyrite bioleaching coupling with the community succession (SAG-strain adaptive-growing phase, RIC-rapidly increasing phase, SICslowly increasing phase, STA-stationary phase. The serial number ①–⑦ represented the Eqs. (1)–(7)).

Table 4 Copper content, residues weight and copper extraction rate at 30 °C and 40 °C. Experiment group

Group Group Group Group

I II III IV

30 °C

40 °C

Copper content (%)

Residues weight (g)

Copper extraction rate (%)

Copper content (%)

Residues weight (g)

Copper extraction rate (%)

12.73 16.02 16.85 11.38

1.90 1.94 1.98 1.91

73.77 66.30 63.82 76.43

11.73 12.02 12.76 10.96

1.86 1.93 1.91 1.82

76.34 74.84 73.57 78.37

þ 2S0 þ 3O2 þ 2H2 O ¼ 2SO2 4 þ 4H

ð6Þ

þ Sx Ony þ O2 þ H2 O ! 2SO2 4 þH

ð7Þ

3.3.3. Bioleaching efficiency The copper content (%) and weight (g) of the residues after bioleaching were monitored, based on which, the copper extraction rate was calculated (Table 4). The final copper extraction at 30 °C were 73.77% in group I, 66.30% in group II, 63.82% in group III and 76.43% in group IV with statistically significance (p < 0.01). Compared with the abiotic control (33.52%) by 42 days, copper extraction efficiency of four experimental groups at 40 °C were much higher, which were 76.34%, 74.84%, 73.57% and 78.37%, respectively. The copper extraction rate was accelerated obviously by increasing the temperature from 30 to 40 °C, which was agreed with the point that temperature accelerated the bioleaching of Ni, Zn and Co by altering the composition of inoculations (Halinen et al., 2009). As a result, the synergistic function among different type strains was beneficial for better balancing iron and sulfur metabolism, and the final copper extraction rate by community with more sulfur oxidizers was 19.8% and 6.5% higher at both 30 °C and 40 °C, respectively, than that with more ferrous oxidizers. 4. Conclusions Chalcopyrite bioleaching based on different initial microbial proportions was investigated. More sulfur oxidizers in community

accelerated the chalcopyrite dissolution rate, which resulted in lower pH, higher cell density, and shortening the period before ORP rising process. Copper extraction was more efficient in group with more sulfur oxidizers at both 30 and 40 °C, than that with more ferrous oxidizers. Community succession of free and attached cells coincided with their ferrous and sulfur oxidizing actions on chalcopyrite dissolution mechanism, which was further supported by the XRD analysis of solid residues. The result was desirable for improving chalcopyrite bioleaching in industrial application.

Acknowledgements This work was supported by the National Natural Science Foundation of China (NSFC 31570113, 51504298 and 51604308) and Fundamental Research Funds for the Central Universities of Central South University (2016zzts110).

References Behera, S., Panda, P., Singh, S., Pradhan, N., Sukla, L., Mishra, B., 2011. Study on reaction mechanism of bioleaching of nickel and cobalt from lateritic chromite overburdens. Int. Biodeterior. Biodegrad. 65 (7), 1035–1042. Córdoba, E., Munoz, J., Blázquez, M., González, F., Ballester, A., 2008. Leaching of chalcopyrite with ferric ion. Part IV: the role of redox potential in the presence of mesophilic and thermophilic bacteria. Hydrometallurgy 93 (3), 106–115. Chen, L., Hu, M., Huang, L., Hua, Z., Kuang, J., Li, S., Shu, W., 2014. Comparative metagenomic and metatranscriptomic analyses of microbial communities in acid mine drainage. ISME J. 9 (7), 1579–1592. Dopson, M., Lindstrom, E.B., 1999. Potential role of thiobacillus caldus in arsenopyrite bioleaching. Appl. Environ. Microbiol. 65 (1), 36–40.

130

L. Ma et al. / Bioresource Technology 223 (2017) 121–130

Edwards, K.J., Gihring, T.M., Banfield, J.F., 1999. Seasonal variations in microbial populations and environmental conditions in an extreme acid mine drainage environment. Appl. Environ. Microbiol. 65 (8), 3627–3632. Feng, S., Yang, H., Wang, W., 2015a. Insights into the enhancement mechanism coupled with adapted adsorption behavior from mineralogical aspects in bioleaching of copper-bearing sulfide ore by Acidithiobacillus sp. RSC Adv. 5 (119), 98057–98066. Feng, S., Yang, H., Wang, W., 2016. Insights to the effects of free cells on community structure of attached cells and chalcopyrite bioleaching during different stages. Bioresour. Technol. 200, 186–193. Feng, X., Ma, L.Y., Deng, Y., Chen, A.J., Zou, K., Liang, Y.L., Qiu, G.Z., Liu, X.D., 2015b. Different leaching efficiency and microbial community structure variation in chalcopyrite bioleaching process based on different initial microbe proportions. Adv. Mater. Res., 431–435 Trans Tech Publ.. Florian, B., Noël, N., Thyssen, C., Felschau, I., Sand, W., 2011. Some quantitative data on bacterial attachment to pyrite. Miner. Eng. 24 (11), 1132–1138. Gonzalez-Toril, E., Llobet-Brossa, E., Casamayor, E., Amann, R., Amils, R., 2003. Microbial ecology of an extreme acidic environment, the Tinto River. Appl. Environ. Microbiol. 69 (8), 4853–4865. Halinen, A.-K., Rahunen, N., Kaksonen, A.H., Puhakka, J.A., 2009. Heap bioleaching of a complex sulfide ore: Part II. Effect of temperature on base metal extraction and bacterial compositions. Hydrometallurgy 98 (1), 101–107. He, Z., Gao, F., Zhao, J., Hu, Y., Qiu, G., 2010. Insights into the dynamics of bacterial communities during chalcopyrite bioleaching. FEMS Microbiol. Ecol. 74 (1), 155–164. Karan, G., Natarajan, K., Modak, J., 1996. Estimation of mineral-adhered biomass of Thiobacillus ferrooxidans by protein assay—some problems and remedies. Hydrometallurgy 42 (2), 169–175. Klauber, C., 2003. Fracture-induced reconstruction of a chalcopyrite (CuFeS2) surface. Surf. Interface Anal. 35 (5), 415–428. Li, S., Zhong, H., Hu, Y., Zhao, J., He, Z., Gu, G., 2014. Bioleaching of a low-grade nickel–copper sulfide by mixture of four thermophiles. Bioresour. Technol. 153, 300–306. Liu, X., Chen, B., Chen, J., Zhang, M., Wen, J., Wang, D., Ruan, R., 2016. Spatial variation of microbial community structure in the Zijinshan commercial copper heap bioleaching plant. Miner. Eng. 94, 76–82. Méndez-García, C., Peláez, A.I., Mesa, V., Sánchez, J., Golyshina, O.V., Ferrer, M., 2015. Microbial diversity and metabolic networks in acid mine drainage habitats. Front. Microbiol. 6, 475. Ma, Z., Wen, X., Zhao, F., Xia, Y., Huang, X., Waite, D., Guan, J., 2013. Effect of temperature variation on membrane fouling and microbial community structure in membrane bioreactor. Bioresour. Technol. 133, 462–468. Mikesková, H., Novotny´, C., Svobodová, K., 2012. Interspecific interactions in mixed microbial cultures in a biodegradation perspective. Appl. Microbiol. Biotechnol. 95 (4), 861–870. Naoko, O., Barrie, J.D., 2004. Biooxidation of pyrite by defined mixed cultures of moderately thermophilic acidophiles in pH-controlled bioreactors: significance of microbial interactions. Biotechnol. Bioeng. 87 (5), 574–583. Noël, N., Florian, B., Sand, W., 2010. AFM & EFM study on attachment of acidophilic leaching organisms. Hydrometallurgy 104 (3), 370–375. Panda, S., Akcil, A., Pradhan, N., Deveci, H., 2015. Current scenario of chalcopyrite bioleaching: a review on the recent advances to its heap-leach technology. Bioresour. Technol. 196, 694–706.

Panda, S., Parhi, P., Nayak, B., Pradhan, N., Mohapatra, U., Sukla, L., 2013. Two step meso-acidophilic bioleaching of chalcopyrite containing ball mill spillage and removal of the surface passivation layer. Bioresour. Technol. 130, 332–338. Pradhan, N., Nathsarma, K., Rao, K.S., Sukla, L., Mishra, B., 2008. Heap bioleaching of chalcopyrite: a review. Miner. Eng. 21 (5), 355–365. Qiu, M., Xiong, S., Zhang, W., Wang, G., 2005. A comparison of bioleaching of chalcopyrite using pure culture or a mixed culture. Miner. Eng. 18 (9), 987–990. Sandström, Å., Shchukarev, A., Paul, J., 2005. XPS characterisation of chalcopyrite chemically and bio-leached at high and low redox potential. Miner. Eng. 18 (5), 505–515. Shahrabi-Farahani, M., Yaghmai, S., Mousavi, S., Amiri, F., 2014. Bioleaching of heavy metals from a petroleum spent catalyst using Acidithiobacillus thiooxidans in a slurry bubble column bioreactor. Sep. Purif. Technol. Shiers, D., Collinson, D., Watling, H., 2016. Life in heaps: a review of microbial responses to variable acidity in sulfide mineral bioleaching heaps for metal extraction. Res. Microbiol. Tupikina, O.V., Minnaar, S.H., Van Hille, R.P., Van Wyk, N., Rautenbach, G., Dew, D. W., Harrison, S.T.L., 2013. Determining the effect of acid stress on the persistence and growth of thermophilic microbial species after mesophilic colonisation of low grade ore in a heap leach environment. Miner. Eng. 53, 152– 159. Wang, Y., Su, L., Zeng, W., Wan, L., Chen, Z., Zhang, L., Qiu, G., Chen, X., Zhou, H., 2014. Effect of pulp density on planktonic and attached community dynamics during bioleaching of chalcopyrite by a moderately thermophilic microbial culture under uncontrolled conditions. Miner. Eng. 61, 66–72. Watling, H., 2013. Chalcopyrite hydrometallurgy at atmospheric pressure: 1. Review of acidic sulfate, sulfate–chloride and sulfate–nitrate process options. Hydrometallurgy 140, 163–180. Watling, H., Collinson, D., Shiers, D., Bryan, C., Watkin, E., 2013. Effects of pH, temperature and solids loading on microbial community structure during batch culture on a polymetallic ore. Miner. Eng. 48, 68–76. Watling, H., Watkin, E., Ralph, D., 2010. The resilience and versatility of acidophiles that contribute to the bio-assisted extraction of metals from mineral sulphides. Environ. Technol. 31 (8–9), 915–933. Xia, L., Dai, S., Yin, C., Hu, Y., Liu, J., Qiu, G., 2009. Comparison of bioleaching behaviors of different compositional sphalerite using Leptospirillum ferriphilum, Acidithiobacillus ferrooxidans and Acidithiobacillus caldus. J. Ind. Microbiol. Biotechnol. 36 (6), 845–851. Zeng, W., Qiu, G., Zhou, H., Peng, J., Chen, M., Tan, S.N., Chao, W., Liu, X., Zhang, Y., 2010. Community structure and dynamics of the free and attached microorganisms during moderately thermophilic bioleaching of chalcopyrite concentrate. Bioresour. Technol. 101 (18), 7068–7075. Zhang, X., Qu, Y., Ma, Q., Zhang, Z., Li, D., Wang, J., Shen, W., Shen, E., Zhou, J., 2015. Illumina MiSeq sequencing reveals diverse microbial communities of activated sludge systems stimulated by different aromatics for indigo biosynthesis from indole. PLoS One 10 (4), e0125732. Zhao, H., Wang, J., Gan, X., Zheng, X., Tao, L., Hu, M., Li, Y., Qin, W., Qiu, G., 2015. Effects of pyrite and bornite on bioleaching of two different types of chalcopyrite in the presence of Leptospirillum ferriphilum. Bioresour. Technol. 194, 28–35. Zhou, S., Gan, M., Zhu, J., Li, Q., Jie, S., Yang, B., Liu, X., 2015. Catalytic effect of light illumination on bioleaching of chalcopyrite. Bioresour. Technol. 182, 345–352.