Co-expression as a convenient method for the production and purification of core histones in bacteria

Protein Expression and Purification 72 (2010) 194–204

Contents lists available at ScienceDirect

Protein Expression and Purification journal homepage: www.elsevier.com/locate/yprep

Co-expression as a convenient method for the production and purification of core histones in bacteria Megan Anderson a, Joon H. Huh b, Thien Ngo a, Alice Lee a, Genaro Hernandez c, Joy Pang a, Jennifer Perkins a, Robert N. Dutnall a,d,* a

Section of Molecular Biology, Division of Biological Sciences, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0347, USA Department of Chemistry and Biochemistry, University of California San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0347, USA Department of Biology, San Diego State University, 5500 Campanile Drive, San Diego, CA 92182, USA d Department of Chemistry and Biochemistry, University of San Diego, 5998 Alcalá Park, San Diego, CA 92110, USA b c

a r t i c l e

i n f o

Article history: Received 14 January 2010 and in revised form 19 March 2010 Available online 27 March 2010 Keywords: Protein co-expression Histone Histone chaperone Chromatin Nucleosome Protein complexes

a b s t r a c t Co-expression offers an important strategy for producing multiprotein complexes for biochemical and biophysical studies. We have found that co-expression of histones H2A and H2B (from yeast, chicken or Drosophila) leads to production of soluble heterodimeric H2AH2B complexes. Drosophila histones H3 and H4 can also be produced as a soluble (H3H4)2 heterotetrameric complex if they are co-expressed with the histone chaperone Asf1. The soluble H2AH2B and (H3H4)2 can be purified by simple chromatographic techniques and have similar properties to endogenous histones. Our methods should facilitate histone production for studies of chromatin structure and regulatory proteins that interact with histones. We describe a simple strategy for constructing co-expression plasmids, based on the T7 RNA polymerase system, which is applicable to other systems. It offers several advantages for quickly creating plasmids to express two or more proteins and for testing different combinations of proteins for optimal complex production, solubility or activity. Ó 2010 Elsevier Inc. All rights reserved.

Introduction Chromosomal DNA in the nucleus of eukaryotic cells is organized into a nucleoprotein complex called chromatin [1]. At the heart of this organization is a fundamental repeating element called the nucleosome [2]. In each nucleosome a short (<200 bp) segment of DNA is wrapped in approximately two left-handed super-helical turns around a kernel composed of the core histone proteins (H2A, H2B, H3 and H4). Interactions between nucleosomes, and association with additional proteins, create successively higher levels of coiling and looping of this ‘‘beaded-string” structure. This architecture greatly reduces the total end-to-end length of DNA so that it fits within the confines of the nucleus. Evidence accumulated over many decades has shown that chromatin structure also plays a principal role in the control of gene expression, via its ability to control access to DNA [3]. Numerous proteins that function to regulate the assembly or alteration of chromatin structure have been identified [4]. These include histone modification enzymes and ATP-dependent nucleosome remodeling complexes. Aberrant control or functioning of many of these chromatin regulatory factors is associated with developmental disor* Corresponding author at: Department of Chemistry and Biochemistry, University of San Diego, 5998 Alcalá Park, San Diego, CA 92110, USA. Fax: +1 619 260 2211. E-mail address: [email protected] (R.N. Dutnall). 1046-5928/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.pep.2010.03.013

ders and diseases [5]. There is therefore considerable interest in understanding the structure of chromatin and the mechanisms by which it is assembled and altered by chromatin regulation factors. Biochemical and especially biophysical studies of chromatin structure and its regulatory factors are dependent on the availability of large quantities of highly purified histones. Historically, histones have been readily available via purification from endogenous sources such as calf thymus or chicken erythrocytes and general methods exist to extract them from other sources [1]. However, endogenous histone preparations invariably display heterogeneity due to numerous post-translational modifications and the presence of variant histone isoforms. More recently, heterologous expression methods have been used to individually produce histones in bacteria (see, for example, [6–8]). Histones produced in bacteria are more homogenous due to the lack of post-translational modifications and the ability to produce only defined histone sequences. This was an important factor in achieving a high resolution structure of the nucleosome core particle [9]. Bacterial expression methods also afford the easy ability to alter DNA sequence to produce point mutants or deletion mutants such as the so called ‘tail-less’ histones lacking the N-terminal tail region (see, for example, [6,10]). A drawback of bacterial expression methods is that production of histones individually results in incorporation into insoluble

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

inclusion bodies. This requires methods to solubilize the expressed protein using denaturants such as urea or guanidine hydrochloride, mixing in appropriate stoichiometry and refolding by removing the denaturant and moving to a more physiological solution [6,7]. This approach has proved successful in many cases and was the principal method used to determine the structure of the nucleosome core particle of Xenopus and yeast and also a structure containing the histone H2A variant H2A.Z [9,11,12]. However, these methods are technically demanding, and in particular, care must be taken to avoid chemical modification during exposure to denaturants, and to mix histones in appropriate stoichiometry to achieve maximum yields. In this paper, we describe methods to co-express histones in bacteria that offer an alternative and simplified means to produce histones in large quantities. Co-expression of histones H2A and H2B results in production of soluble H2AH2B heterodimers that can be readily purified using standard chromatographic approaches. Histones H3 and H4 can also be co-expressed but are not completely soluble. However, co-expression of histones H3 and H4 and the histone chaperone Asf1 yields soluble (H3H4)21 tetramers that can be purified by simple chromatographic procedures. Our cloning methods, based on the T7 RNA polymerase system [13], offer a simple procedure to create plasmids to co-express two, three or more proteins in multiple combinations that can be applied to production of other multiprotein complexes. Materials and methods All restriction enzymes and DNA modifying enzymes were purchased from New England Biolabs unless explicitly stated otherwise. All custom oligonucleotide primers were obtained from Invitrogen. All chemicals were purchased from Sigma unless explicitly stated. General plasmid nomenclature In most cases, we use a naming system for plasmids that conveys information on the type and species of histone(s) genes present (species code: y, yeast; d, Drosophila; c, chicken), their order (in the case of co-expression plasmids), and a suffix for the vector backbone (vector suffix code: .18 = pUC18, .29b = pET29b, etc.). Construction of individual yeast histone expression plasmids DNA encoding the open-reading frame each yeast core histone (HTA1 = H2A; HTB1 = H2B; HHT1 = H3; HHF1 = H4) was generated by PCR amplification using yeast genomic DNA template (the kind gift of Dr. L. Pillus, UCSD) and Pfu DNA polymerase (Stratagene) with the following sense-antisense primer sets as appropriate:yH2A: RND017 (50 -GAATTCGGATCCTTATTATAATTCTTGAGAAGCCTTG-30 ) and RND018 (50 -GAATTCCATATGTCCGGTGGTAAAGGTGG-30 );yH2B: RND019 (50 -GAATTCGGATCCTTATTATGCTTGAGTAGAGGAAG-30 ) and RND020 (50 -GAATTCCATATGTCTGCTAAAGCCGAAAAG-30 );yH3: RND021 (50 -GAATTCGGATCCTTACTATGATCTTTCACCTCTTAATC-30 ) and RND022 (50 -GAATTCCATATGGCCAGAACAAAGCAAAC-30 );yH4: RND023 (50 GAATTCGGATCCTTATTAACCACCGAAACCGTATAAG-30 ) and RND024 (50 -GAATTCCATATGTCCGGTAGAGGTAAAGG-30 ). Each sense primer was designed to encompass the initiation ATG codon within an NdeI restriction site (50 -CATATG-30 ), while the antisense primers add an additional TAA stop codon followed immediately by a BamHI restriction site (50 -GGATCC-30 ). Following PCR amplification, DNA was digested with NdeI and BamHI and in1 Abbreviations used: H2AH2B, histone H2A-histone H2B heterodimer complex; (H3H4)2, histone H3-histone H4 heterotetramer complex; NCP, nucleosome core particle; TBE, Tris–borate EDTA.

195

serted into the NdeI and BamHI sites of the general cloning vector pUC18 to create plasmids yH2A.18, yH2B.18, yH3.18 and yH4.18. Positive clones were sequenced to verify that no mutations were introduced during PCR, then cut with NdeI and BamHI and each ORF fragment inserted into pET29b (Novagen) to create the expression plasmids yH2A.29b, yH2B.29b, yH3.29b and yH4.29b. In addition, the NdeI–BamHI fragment containing yH3 was inserted into pET11a to create yH3.11a. Plasmids yH2A(14–132).18, yH2A(14–132).29b, yH2B(31– 131).18 and yH2B(31–131).29b for truncation mutants of yH2A and yH2B lacking the N-terminal regions (to leave residues 14– 132 of yH2A and residues 31–131 of yH2B) were made in a similar fashion using the sense primers RND047 (50 -GAATTCCATATGAAAG CTTCTCAATCTAGATC-30 ) and RND048 (50 -GAATTCCATATGAAGAAG AGAAGCAAGGCTAG-30 ) in place of RND017 and RND019, respectively. Expression plasmids for chicken and Drosophila histones Expression plasmids for chicken core histones (H2Aplk and H2Bplk), containing the Gallus gallus H2A and H2B genes inserted into the T7 expression vector pET13a [14] were the gift of Dr. V. Ramakrishnan. pET11a-based expression plasmids containing the Drosophila H2A and H2B genes (dH2A.11a and dH2B.11a) were generously supplied by Dr. Mark Levenstein and have been described elsewhere [15]. dH2A.29b was created by moving the dH2A coding sequence from dH2A.11a to pET29b as an NdeI–BamHI fragment. dH2B.28TEV was created by moving the coding sequence of dH2B from dH2B.11a into pET28TEV (the gift of Dr. V. Ramakrishnan) as an NdeI–BamHI fragment. pET28TEV is designed to place a His6 affinity tag, spacer element, and recognition site for the tobacco etch virus (TEV) protease at the N-terminus of the expressed protein. pET28TEV was created by replacing the NcoI–NdeI fragment of pET28b with an NcoI–NdeI fragment from pPro-EX1 (Gibco–BRL). If a target gene is inserted into pET28TEV with a 50 NdeI-site to place the inititiator Met codon then the additional N-terminal sequence is as follows: MGHHHHHHDYDIPTTENLYFQG^AH (^ indicates the cleavage site for TEV protease). Expression plasmid for Drosophila Asf1 The coding sequence for Drosophila Asf1 was amplified by PCR using the following primers: RND30 (50 - GAATTCCATATGGCCAAGG TGCACATCAC-30 ) and RND31 (50 - GAATTCAAGCTTATCAACATTCCA TGGCCAGTG-30 ) using a Drosophila cDNA library (Invitrogen) as template. The amplicon was cut with NdeI and HindIII and ligated into pUC18 to create pUC18dAsf1. Positive clones were sequenced and the NdeI–HindIII fragment was then excised and ligated into NdeI–HindIII cut pET28TEV to create pET28TEVdAsf1. Construction of H2AH2B co-expression plasmids Plasmid yH2AH2B.29b was created as follows: plasmid yH2B.29b was cut with XbaI, and overhanging ends filled in using the Klenow fragment of DNA polymerase I. The plasmid was then cut with XhoI, and the 450 bp fragment containing H2B flanked by a 50 -blunt end, and 30 -XhoI overhang was ligated into yH2A.29b that had been cut with EcoRI, filled in with Klenow fragment, and then cut again with XhoI. A similar protocol was used to create the additional yeast histone H2AH2B co-expression plasmids containing different combinations of intact histones, and truncation mutants lacking N-terminal tails using the appropriate individual expression vectors described above. Plasmid cH2AH2Bplk: Plasmid cH2Bplk was cut with XbaI and then the overhanging end filled in partially with dATP, dCTP and dTTP to leave a 50 -C overhang. It was then cut with EcoRI and the

196

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

800 bp fragment containing the cH2B coding sequence purified. Plasmid cH2A was cut with BamHI and filled in partially with dATP, dGTP and dTTP to leave a 50 -G overhang before cutting with EcoRI and ligation with the fragment derived from cH2Bplk. Plasmid dH2AhH2B.29b: Plasmid dH2B.28TEV was cut with XbaI and filled in before being cut with EcoRI. The 500 bp fragment containing the His-tagged H2B sequence flanked by a 50 -blunt end and 30 -EcoRI overhang was purified and ligated with dH2A.29b that had been cut with BamHI, filled in, and then cut with EcoRI. Note that blunt-end ligation of the filled in BamHI and XbaI sites creates a junction with the following sequence: 50 -GGATCCTAGA30 . Thus, the BamHI is restored while the XbaI site is destroyed. Construction of H3H4 co-expression plasmids Plasmid yH4H3.29b: Plasmid yH3.29b was cut with XbaI, and overhanging ends filled in using the Klenow fragment of DNA polymerase I. The plasmid was then cut with XhoI, and the 460 bp fragment containing H3 flanked by a 50 -blunt end, and 30 -XhoI overhang was ligated into yH4.29b that had been cut with EcoRI, filled in with Klenow fragment, and then cut again with XhoI. The dual T7 promoter plasmid yH4yH3.29b was created by moving a 520 bp BglII–BamHI fragment containing H3 from yH3.11a into yH4.29b that had been cut with BamHI. The triple co-expression vector for RCAF was constructed using pET28TEVdAsf1 and pdH3dH4.11a (the kind gift of M. Levenstein). pdH3dH4.11a is a dual T7 promoter plasmid for Drosophila H3 and H4, based on pET11a, with a similar expression cassette architecture to yH4yH3.29b [15]. A BglII–BamHI fragment containing the T7 promoter-dH3-T7 promoter-dH4 segment of pdH3dH4.11a was ligated into BglII cut pET28TEVdAsf1. The BglII site in pET28TEVdAsf1 is located just upstream of the T7 promoter. Thus, the expression cassette has the following order of elements: T7 promoter-dH3-T7 promoter-dH4-T7 promoter-(His6-dAsf1)-T7 terminator. General expression conditions Plasmids were transformed into Escherichia coli BL21(DE3) and cultured in LB medium plus kanamycin at 30 or 37 °C. Expression was induced by addition of isopropyl-b-D-thiogalactopyranoside (IPTG) to 0.4 mM when the culture reached exponential growth phase (OD600 0.4–0.6) and allowed to continue for 2–3 h postinduction before cells were harvested by centrifugation. For H3H4 and RCAF co-expression, the only significant differences were that plasmids were transformed into E. coli BL21(DE3) Rosetta cells (Novagen) which provides increased expression of rare tRNAs, cultures were grown at 30 °C, and expression was allowed to continue overnight (or for up to 16 h) prior to harvesting. Purification of H2AH2B heterodimers All chromatographic procedures were carried out at 4 °C using a Gradifrac low-pressure chromatography system (GE Healthcare). Cell pellets were resuspended in ice cold 50 mM Tris–Cl, pH 8.0, 1 mM EDTA (5–10 mL/g cell pellet) with the addition of fresh PMSF and benzamidine (1 mM final concentration), and 2-mercaptoethanol (6 mM). The suspension was homogenized using a dounce homogenizer, lysozyme added to 0.5 mg/mL and incubated for up to 1 h on ice. Sodium deoxycholate was added to 0.08% (w/v) final concentration, the solution homogenized and then sonicated for 2 min. The lysate was centrifuged for 40 min at 18,000 rpm (Sorvall RC5B-plus, SS34 rotor) at 4 °C, the supernatant filtered through 0.45 and 0.2 lm filters and applied to a Fractogel-SO3 (EMD Biosciences) column (50 mL volume in XK26/20 column from GE Healthcare) equilibrated with 20 mM Tris–Cl, pH 8.0, 1 mM EDTA, 1 mM DTT, 10% (v/v) glycerol. After binding, the column was washed with

100 mL of the equilibration buffer followed by 20 mL of 20 mM Tris–Cl, pH 8.0, 1 mM EDTA, 1 mM DTT. Protein was eluted using a linear NaCl gradient (0–2 M NaCl in total volume of 400 mL of 20 mM Tris–Cl, pH 8.0, 1 mM EDTA, 1 mM DTT) collecting 5 mL fractions. Histones elute at 1 M NaCl concentration. Pooled histone fractions from cation exchange chromatography were diluted fivefold with 20 mM Na/K phosphate, pH 7.0, 1 mM DTT prior to loading onto a hydroxyapatite (Bio-Rad CHT ceramic hydroxyapatite type I, 40 lm particle size) column (40 mL volume in XK26/20 column) equilibrated with 20 mM Na/K phosphate, pH 7.0, 1 mM DTT. After binding, the column was washed with at least 100 mL of 20 mM Na/K phosphate, pH 7.0, 1 mM DTT and protein eluted using a linear gradient of NaCl (0–2 M in 400 mL of 20 mM Na/K phosphate, pH 7.0, 1 mM DTT) collecting 5 mL fractions. Histone H2A and H2B co-elute at 1 M NaCl. Histone fractions were pooled and concentrated using a stirred ultrafiltration cell using a YM3 membrane (Millipore). Igepal was added to 0.01% (v/v) to reduce adherence to the membrane and walls of the filtration cell. The concentrated protein was then subjected to size exclusion chromatography using Superdex 75 (GE Healthcare Prep Grade, XK26/100 column). The column buffer was 20 mM Tris–Cl, pH 8.0, 500 mM NaCl, 1 mM DTT, 1 mM EDTA, 0.01% igepal and a flow rate of 1 mL/min collecting 2 mL fractions was used. Histone containing fractions were pooled and concentrated by ultrafiltration as above. A similar procedure was used to purify co-expressed dH2A-His6H2B using nickel-affinity chromatography as a first step in place of ion exchange chromatography and omitting EDTA from the lysis buffer. Purification of (H3H4)2 heterotetramers Co-expressed yeast H3H4 were purified using a modification of a previously described acid extraction protocol [15]. Following acid extraction and neutralization, soluble material was subjected to cation exchange, hydroxyapatite and size exclusion chromatography as described above. Drosophila H3 and H4 were purified following co-expression with Asf1 via a combination of nickel-chelate, cation exchange, hydroxyapatite and size exclusion chromatography. Cell lysis was performed as before with the exception that EDTA was omitted from the lysis buffer and the soluble lysate fraction was applied to a Ni–NTA agarose column (Qiagen). The flow through containing H3 and H4 was then applied to a Fractogel-SO3 column and purification proceeded as described for H2AH2B above. Characterization of H2AH2B and H3H4 complexes Glutaraldehyde cross-linking reactions were carried out as described previously [16]. Nucleosome core particles were assembled on a 204 bp DNA fragment containing the Xenopus 5S RNA gene by salt dialysis as described previously [17]. Histone octamers for reconstitution were prepared by mixing purified H2AH2B and (H3H4)2 complexes in a 2:1 ratio and adjusting the concentration of NaCl to 2 M. The DNA fragment was prepared by AvaI digestion of the plasmid pSS(16x204), a pUC19 based plasmid that contains 16 tandem repeats of the Xenopus borealis 5S RNA gene (the kind gift of Mrs. S. Searles, MRC Laboratory of Molecular Biology, UK). Reconstitution mixtures were analyzed by agarose gel electrophoresis (0.7% agarose in 0.25 TBE buffer) and DNA visualized by ethidium bromide staining after electrophoresis. Results The core histones form obligate heterotypic associations [1]. Histone H2A forms a heterodimer with H2B. Histones H3 and H4

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

form a stable (H3H4)2 heterotetramer composed of two H3:H4 heterodimers whose overall structure is very similar to that of the H2AH2B complex [18]. This folding interdependence is a likely explanation for the insolubility of each histone when expressed in bacteria in the absence of its partner [6,7]. We reasoned that co-expression of histone pairs in bacteria (H2A with H2B, H3 with H4) might yield soluble histone complexes and afford a simplified method of purification based on previous isolation methods. Our approach was based on a previous study in which histones H3 and H4 (from Drosophila) were co-expressed in bacteria [15]. We therefore set out to create co-expression plasmids, based on the widely used T7 RNA polymerase system [13]. Before describing the construction of histone co-expression plasmids, we describe our general strategy for creating co-expression plasmids as these methods should be widely applicable to production of other protein complexes. A convenient strategy for construction of polycistronic co-expression plasmids using the T7 RNA polymerase system Most commercially available plasmids for the T7 RNA polymerase system, such as the pET series available from Novagen, contain an expression cassette that includes the following principal elements (Fig. 1a and d): the T7 U10 promoter (with or without a downstream lac operator element), a unique XbaI restriction site, a ribosome binding site (RBS), a unique NdeI or NcoI site for insertion of the 50 end of the open-reading frame with its ‘ATG’ initiation codon placed at an optimal distance from the RBS, multiple unique downstream cloning sites for insertion of the 30 end of the openreading frame, and the T7 TU transcriptional terminator. We have used a general strategy for constructing co-expression plasmids that uses two parent plasmids with this type of cassette to construct a plasmid containing two open-reading frames under the control of a single T7 U10 promoter. The aim is to produce a single polycistronic messenger RNA in order to achieve balanced levels of expression of the two target proteins. This strategy was first employed by Rosenberg et al. [19]. The cloning procedure is illustrated in Fig. 1. The first (recipient) plasmid is cut at two sites. One site (EcoRI in this example) immediately follows (or is as close as possible to) the translation termination codon of the open-reading frame (ORF1) and is completely filled in after digestion. The second site is chosen on the basis that it is common to both expression plasmids and ideally that it does not create a blunt end (XhoI in Fig. 1a). It should also be a unique site positioned upstream of the T7 terminator in the recipient plasmid. There is typically more than once choice for such a site, due to similarity among the multiple cloning sites available in the pET plasmid series, and especially if the two plasmids used for the procedure derive from the same pET vector. The second (donor) plasmid is cut at the XbaI site upstream of the RBS (which is completely filled in following digestion) and the site downstream of the open-reading frame that is also found in the first plasmid, thereby generating a DNA fragment containing the RBS and open-reading frame of the second protein (RBS-ORF2). These procedures create two DNA fragments (Fig. 1b) that have one end with a complementary overhang and one blunt end, allowing the RBSORF2 fragment to be directionally ligated into the first plasmid, immediately downstream of the open-reading frame. As illustrated by the examples in Fig. 1 this creates an expression cassette with ORF1 followed by ORF2 under control of a single T7 promoter and transcription terminator. Both open-reading frames have a RBS placed optimally for translation. Furthermore, by using cloning sites at or close to the translation stop signal of ORF1 in the recipient plasmid, and the XbaI site upstream of the RBS of ORF2 in the donor, the distance between the translation stop site of ORF1 and the RBS of ORF2 is kept to a minimum,

197

increasing the likelihood of translation reinitiation by a ribosome completing translation of ORF1. In the example shown in Fig. 1c this distance is 37 nucleotides, within the 30–40 nucleotide distance for optimal translation reinitiation [20]. This adds to the likelihood of balanced expression levels of the two products contained within the single polycistronic message produced by this expression cassette. We have not systematically tested for any effect of the length of the intervening distance between the stop codon of the ORF1 and the RBS of ORF2 but it can be kept with a short, optimal range as long as suitable restriction sites are available. It is also typically feasible to create a similar co-expression plasmid in which ORF2 is positioned upstream of ORF1 by simply reversing the identities of the recipient and donor plasmids. Depending on the availability of restriction sites, this cloning procedure can be repeated multiple times to insert additional RBS-ORF fragments following ORF2 for co-expression of more than two target proteins. In the example shown in Fig. 1d–f, a BamHI site following ORF1 is partially filled into leave a 50 -G overhang, while the XbaI site upstream of ORF2 is partially filled into leave a complementary 50 -C overhang, thus allowing fully directional cloning (Fig. 1e). Ligation destroys the BamHI site downstream of ORF1, so that the BamHI site downstream of ORF2 becomes unique in the co-expression plasmid (Fig. 1f). This BamHI site could be used to insert a third ORF using the same procedure. Construction of co-expression plasmids with T7 promoters driving expression of each ORF We have also created co-expression plasmids in which each ORF has it own T7 promoter. As illustrated in Fig. 2, some pET plasmids (e.g., pET11a) contain a BglII restriction site upstream of the T7 promoter. If such a donor plasmid is cut with BglII and at a suitable site downstream of the ORF, this DNA fragment (T7 promoter-RBSORF2) can be inserted into a recipient plasmid in a similar fashion to that described above. If a unique BamHI site is available downstream of ORF1 in the recipient plasmid, it can be joined with the BglII end of the donor fragment due to the compatibility of the cohesive ends, allowing fully directional cloning. This strategy does not recreate the BglII or BamHI site in the product. As described above, in suitable cases this procedure can be repeated to introduce additional ORFs (either with or without their own T7 promoter). As illustrated in Fig. 2, this procedure creates a plasmid in which each ORF has an upstream T7 promoter, but there is only a single transcription terminator (downstream of ORF2). Potentially this should lead to production of two mRNA molecules: one containing only ORF2, and another polycistronic mRNA with both ORFs (so that there is a 2:1 ORF2:ORF1 mRNA ratio). This may be an advantage to produce balanced levels of expression in cases where one protein of the desired complex is not produced as efficiently as a result of translation or some subsequent process. It may also improve yields of complexes whose stoichiometry requires a greater quantity of one protein. Co-expression of histones H2A and H2B in bacteria The procedures described above were used to create co-expression vectors for histone H2A and H2B from the yeast Saccharomyces cerevisiae (Fig. 1c), chicken (Fig. 1f) and Drosophila (Fig. 1g). For convenience, further references to the species of each histone will be made using a simple one letter code; y, yeast; c, chicken; d, Drosophila. For full-length yeast H2A and H2B (yH2A and yH2B), individual expression plasmids were generated using standard cloning procedures. Deletion mutants lacking the N-terminal tail regions (yH2At and yH2Bt – see Materials and methods) were also prepared in a

198

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

Fig. 1. Construction of co-expression plasmids for H2A and H2B. Schematic representations of relevant segments of expression plasmids (surrounding T7 expression cassette) used for construction are shown in parts (a and d). Ligation substrates produced by digestion are shown in parts (b and e), and final constructs in parts (c, f and g). Symbols are defined in part (a) and selected restriction sites are shown. Numbers below the diagrams (parts a, f and g) indicate length of DNA segments. Lower case letters at ends of ligation substrates indicate nucleotides added by fill-in reactions.

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

199

Fig. 2. Construction of co-expression plasmids for H3 and H4. Initial expression plasmids and final constructs are shown (see Fig. 1 for explanation of symbols).

similar fashion. As shown in Fig. 3a, individual expression of yH2A, yH2B, yH2At and yH2Bt leads to production of each histone at high levels in E. coli. As expected, each histone is produced in insoluble form within inclusion bodies (data not shown). Co-expression plasmids were constructed for full-length yH2A with yH2B, the double tailless mutant (yH2At with yH2Bt), and mutants lacking a single N-terminal tail of either yH2A or yH2B (yH2At with yH2B, or yH2A with yH2Bt). All of these co-expression

plasmids had a single T7 promoter driving production of a polycistronic mRNA. As shown in Fig. 3b, these plasmids support coexpression of protein within each target pair under conditions similar to those found to support high levels of expression of the individual histones. Furthermore, each protein within a target pair is expressed at a similar level, as anticipated for a polycistronic mRNA. For full-length yH2A and yH2B we did not observe any significant difference in expression levels using plasmids in which the

Fig. 3. SDS–PAGE analysis of histone expression. (a) Individual expression of yeast histones (– = uninduced cells). (b) Co-expression of various yeast H2AH2B constructs. (c) Co-expression of chicken H2AH2B. (d) Individual expression of Drosophila H2A, His6-tagged H2B and co-expression. Protein samples were analyzed using 10–20% SDS–PAGE gradient gels. Protein was visualized by staining with Coomassie blue.

200

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

ORF for yH2A was upstream or downstream of that for yH2B (data not shown). Co-expression plasmids for full-length chicken H2A and H2B were generated from plasmids for individual expression based on the pET13a expression plasmid [14]. As shown in Fig. 3c, coexpression yields high and similar levels of expression of cH2A and cH2B. Similar to our findings with yeast H2A and H2B we did not observe any significant difference in expression for a plasmid in which the relative order of cH2A and cH2B was reversed (data not shown). We constructed plasmids for expression of dH2A and dH2B based on those described in a previous study by subcloning the respective ORFs into pET plasmids that use Kanamycin resistance as a selectable marker [15]. As observed previously, dH2A is produced in E. coli at high levels (Fig. 3d, lane 2), while only very low levels of expression of dH2B are obtained (not shown), placing a limit on the potential yield of H2AH2B heterodimer. We also observed low level expression of dH2B in a variety of strains of E. coli, including those supplemented with tRNA for rare codons [21], and under a variety of growth conditions. We therefore created an expression plasmid to produce dH2B with a N-terminal His6 affinity tag, separated by a cleavage site for the tobacco etch virus (TEV) protease for convenient tag removal. Addition of this N-terminal tag permits high levels of expression of His6-dH2B (Fig. 3d, lane 3). From this plasmid we created a plasmid for co-expression of dH2A with His6-dH2B (Fig. 1g) which supports similarly high production levels of both proteins (Fig. 3d, lane 4). Solubility and purification of H2AH2B heterodimers produced by coexpression Co-expression of histone H2A with H2B leads to production of histones in a soluble form, suggesting that they correctly associate and fold to form H2AH2B heterodimers (see also below). The fraction of histone in the soluble fraction varies with the species source. For yH2AH2B, typically greater than 50% of the expressed protein is present in the soluble fraction (Fig. 4a). For cH2AH2B all of the detectable histone is present in the soluble fraction (Fig. 4b). The fraction of soluble dH2A and His6-dH2B is much lower (Fig. 4c) but the presence of an affinity tag on dH2B simplifies the process of purification and the insoluble material can be recovered by acid extraction procedures [15] to improve protein yield. The soluble H2AH2B heterodimers can be purified by a combination of cation exchange, hydroxyapatite and size exclusion chromatography. Fig. 5 shows an example of such a procedure for yH2AH2B. The cleared cell lysate is initially applied to a cation exchange column and bound material eluted with a NaCl gradient. yH2A and yH2B co-elute in a single peak (data not shown) and histone containing fractions are then combined and diluted or dialyzed into a phosphate buffer and applied to a hydroxyapatite column. yH2A and yH2B again co-elute in a single, sharp peak at approximately 1 M NaCl (Fig. 5a). SDS–PAGE analysis reveals that the purity of the histones is very high following hydroxyapatite chromatography and suitable for most biochemical applications. For further purification the histone fractions may be subjected to size exclusion chromatography (Fig. 5b) which leads to a single peak, containing H2A and H2B. The peak elution volume has an apparent molecular mass of 28,000 Da, consistent with a heterodimer complex and the presence of yH2A and yH2B was confirmed by mass spectrometry (data not shown). The yield of purified yH2AH2B is approximately 10 mg/L cell culture. Similar results are obtained for cH2AH2B (data not shown) and the final purified protein is shown in Fig. 4b. The His-tagged dH2AH2B complex can also be purified using nickel-affinity chromatography in place of ion exchange chromatography, followed by hydroxyapatite and size exclusion chromatography. The His-tag sequence can be effi-

Fig. 4. SDS–PAGE analysis of solubility and purification of co-expressed H2AH2B. (a) Solubility of yeast H2AH2B, (b) solubility and final purity of chicken H2AH2B, (c) solubility and steps in purification of His6-tagged Drosophila H2AH2B and removal of His6-tag via TEV protease treatment. Protein samples were analyzed using 10– 20% SDS–PAGE gradient gels. Protein was visualized by staining with coomassie blue.

ciently removed from dH2B following purification via cleavage with TEV protease (Fig. 4c). Although it may be possible to omit the cation exchange step and apply the cleared lysate directly to a hydroxyapatite column, the cation exchange step is convenient because it allows EDTA to be included in the cell lysis buffer to remove divalent metal ions and reduce protease activity. Direct application of the lysate to hydroxyapatite requires the absence or removal of EDTA prior to loading. In our procedure EDTA is present during lysis and the buffer used to wash the cation exchange column after binding, but is then excluded from the elution buffers so that the fractions can be diluted into phosphate buffer and applied to hydroxyapatite. In cases where the fraction of soluble histone is low, yields can be improved by an alternative acid extraction procedure [15]. Following cell lysis, the total cell lysate is extracted with hydrochloric acid. During acid extraction most bacterial proteins precipitate, leaving the highly basic histones enriched in the soluble fraction. Once the solution is neutralized the mixture can be subjected to cation exchange and hydroxyapatite chromatography as described above.

Co-expression of yeast H3 and H4 We created plasmids for co-expression of yH3 and yH4 either with a single T7 promoter or with a T7 promoter upstream of each ORF (Fig. 2). Expression from a single T7 promoter was not robust even in bacterial strains expressing tRNA for rarely used codons,

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

201

Fig. 5. Chromatography of co-expressed yeast H2H2B. (a) Hydroxyapatite chromatography, (b) size exclusion chromatography. Upper panels are chromatograms showing peaks (absorbance at 280 nm) observed during elution. SDS–PAGE analysis of fractions is shown in lower panels. Protein samples were analyzed using 10–20% SDS–PAGE gradient gels. Protein was visualized by staining with Coomassie blue.

and levels of H4 were lower than those of H3 (regardless of whether H3 or H4 was positioned at the 50 end of the message; data not shown). As shown in Fig. 6a, more robust and balanced expression was observed using a dual T7 promoter plasmid that is predicted to produce two mRNA molecules; one containing both H3 and H4, and another just H4 alone (a 2:1 ratio of H4:H3 message). A plasmid with similar construction has previously been used to successfully co-express Drosophila H3 and H4 in bacteria [15] and we have observed similar results with chicken H3 and H4 (not shown). Although this strategy yields apparently balanced levels of expression of H3 and H4, the histones are not readily soluble under standard lysis con-

ditions (data not shown). However, the y(H3H4)2 or d(H3H4)2 complexes can be purified using an acid extraction procedure as described above (data not shown; see also [15]). Co-expression of H3 and H4 with a histone chaperone produces a soluble (H3H4)2 complex Histone chaperones are a diverse group of proteins that bind histones and play a role in nucleosome assembly and other chromatin modification reactions [22,23]. They are generally acidic proteins that form discrete soluble complexes with histones, often

Fig. 6. SDS–PAGE analysis of histone H3H4 expression and RCAF purification. (a) Expression of yeast H3 and H4 (– = uninduced cells). (b) Steps in purification of co-expressed RCAF. Ni–NTA FT = flow through from Ni–NTA column. IEX FT = flow through of cation exchange column. Protein samples were analyzed using 10–20% SDS–PAGE gradient gels. Protein was visualized by staining with Coomassie blue.

202

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

displaying specificity or preferential binding toward particular histone subtypes (H2A and H2B or H3 and H4). We therefore wondered if co-expression of a suitable histone chaperone might improve the solubility of H3 and H4, possibly leading to the production of a ternary complex that could be directly used in nucleosome assembly reactions. We chose the H3H4-specific Asf1 histone chaperone (that forms the RCAF complex with H3 and H4 [24]) since it is functions as a single polypeptide and is a relatively small protein (218 amino acids). We created a co-expression plasmid by initially constructing a plasmid to express an N-terminally His-tagged version of Drosophila Asf1 with a view to purifying recombinant RCAF complex via affinity chromatography. A DNA segment containing the T7 promoter, RBS and His6-Asf1 ORF was then ligated into a dual T7 promoter plasmid containing dH3 and dH4, creating a plasmid for expression of all three proteins. In this plasmid, each ORF is preceded by a T7 promoter but there is only single T7 terminator such that it could produce three predicted mRNA molecules: one containing coding sequence for all three proteins, one with H4 and Asf1, and one with Asf1 alone. Induction of bacterial cells containing the triple expression plasmid leads to production of all three polypeptides. Remarkably, all three proteins are present in the soluble fraction following cell lysis, with little protein in the insoluble fraction (Fig. 6b). To determine if Asf1 had formed a complex with H3 and H4 and to purify the complex, we used nickel-affinity chromatography to purify the His6-tagged Asf1. Surprisingly, although the His6-tagged dAsf1 protein bound efficiently to a nickel-affinity column, histone H3 and H4 were present in the flow through with no significant quantity of histone in the bound fraction (Fig. 6b). This was true under a variety of expression and lysis conditions (data not shown). Although co-expression fails to produce the predicted RCAF complex, it does lead to a soluble form of H3 and H4 that can be purified by cation exchange, hydroxyapatite and size exclusion chromatography (Fig. 6b) in a fashion similar to H2A and H2B. H3 and H4 co-elute in all steps and the mass of the complex estimated from size exclusion elution volume (50 kDa) is consistent with a (H3H4)2 heterotetramer (not shown). The yield of (H3H4)2 complex ranges from 5 to 10 mg/L of induced cell culture.

Characterization of histone complexes produced by co-expression The solubility and chromatographic behavior of the histone complexes produced by co-expression is consistent with formation of the anticipated heterodimeric H2AH2B and heterotetrameric (H3H4)2 complexes. Further support for this conclusion is provided by the results of chemical cross-linking analysis with glutaraldehyde. As shown for co-expressed yeast histones (Fig. 7a), glutaraldehyde treatment produces the predicted pattern of crosslinked products. The pattern observed for yH3 and yH4 is strikingly similar to that observed for endogenous H3 and H4 [16] and entirely consistent with the known structure of the (H3H4)2 heterotetramer. A similar pattern is obtained for dH3H4 obtained from coexpression with Asf1 (not shown). Yeast and chicken H2A and H2B have similar mass and so it is not possible to definitely rule out the presence of homodimeric complexes, which have been observed under some conditions [1]. However, analysis of dH2AH2B (in which H2B has a significantly different mass due to the presence of the N-terminal His6sequence) does not reveal the presence of any such homodimers (Fig. 7b). Since soluble homodimeric complexes are also not observed when H2A or H2B are expressed individually, it seems unlikely that they represent a significant fraction and that the bulk, if not all, of the complex formed is a heterodimeric H2AH2B complex.

We also assessed whether the purified histones could be reconstituted into nucleosome core particles (NCPs). For this analysis, we used a short DNA fragment containing a nucleosome positioning signal from the Xenopus 5S RNA gene [25] and assayed the formation of NCPs via a simple gel shift analysis. Yeast and chicken H2AH2B and (H3H4)2 complexes can be mixed to create 2:1 ratios of H2AH2B:(H3H4)2 and reconstituted into NCPs by mixing with DNA by salt dialysis method [17] or by addition of a histone chaperone such as Nap1 (data not shown). As shown in Fig. 7c, NCPs can also be formed using mixtures of Drosophila histones. In this case, the core histone mixtures contain H3 and H4 produced via coexpression with Asf1, along with H2AH2B in which H2B has an N-terminal His6-tag or from which the His-tag has been removed by treatment with TEV protease. Consistent with previous observations [7], the nucleosome positioning signal in the DNA used is not perfect and in both cases the salt dilution method produces two major translational positions for the NCP. Mild heating of the reconstituted particles allows repositioning to favor the central position. Similar results were obtained when NCPs were assembled using Nap1 (data not shown).

Discussion Our results indicate that co-expression offers a viable strategy for producing histones in bacteria that has several advantages over previous methods. Notably it produces histones as soluble complexes that can be purified by standard chromatographic techniques. Based on chromatographic properties, analysis of quaternary structure and ability to be incorporated into nucleosomes, histones produced by this method are similar to those produced by refolding or those purified from endogenous sources. When compared to production of histones individually, production of soluble histone complexes avoids the technical demands associated with solubilizing and refolding from inclusion bodies. Although the yields of complexes are lower (based per liter of culture) than for individual expression, simple scaling of the volume of bacterial culture used should yield sufficient quantity of final material. Also, to produce both H2AH2B and (H3H4)2 complexes, only two cultures, and two (similar) purification efforts are required. Producing mutants for particular aspects of a study, for example H2AH2B complexes in which one or both histones lack their N-terminal tail, requires only a different bacterial transformation and culture using the appropriate plasmid. In this regard, individual expression offers the ability to produce a range of different histones that can stored in partially pure form, and mixed in different combinations at a later time as demanded. For the co-expression method, making different complexes requires effort at the level of simple cloning techniques to make the appropriate expression plasmids. For co-expression of H2A and H2B, there is variation in the fraction of soluble complex depending on the histone species produced. For example, co-expressed chicken H2AH2B is almost completely soluble, yeast H2AH2B is approx. 50% soluble, but dH2AH2B (in which H2B is His6-tagged) is mostly insoluble. The reason for this difference is not immediately clear although it is probably linked in some way to the sequence variation among species for H2A and H2B. Also, we found most H2A and H2B types were expressed robustly (both individually and when co-expressed) with the exception of dH2B, as noted previously [15]. However, addition of an Nterminal His6-tag to dH2B produces robust expression, suggesting that the problem in expression may be due to inefficient translation in the N-terminal segment of the protein. A similar problem with expression of the globular domains of the linker histones H1 and H5 was encountered by Gerchman et al. [14]. In this case, altering the codons for the first few amino acids (for example, making the first five codons optimal for E. coli and also AT rich) was necessary

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

203

Fig. 7. Characterization of purified histones. Chemical cross-linking of (a) yH2AH2B and y(H3H4)2, or (b) Drosophila H2AH2B (intact or after removal of His6-tag from H2B with TEV protease) with glutaraldehyde (GA). (c) Reconstitution of Drosophila histone mixtures into nucleosome core particles. The upper panel shows SDS–PAGE analysis of core histone mixtures containing His-tagged H2AH2B (left) or after removal of His6-tag from H2B with TEV protease (right). The lower panel shows agarose gel electrophoresis of these mixtures reconstituted with a 204 bp DNA fragment containing the Xenopus 5S RNA nucleosome positioning signal (shaded box) via salt dialysis before () and after (+) mild heat treatment (55 °C for 2 h). The inferred position of the nucleosome core particle is depicted by an open oval. The agarose gel image is a reverse color image of the ethidium bromide stained gel.

to achieve good expression. Addition of a sequence for an N-terminal His6-tag that uses optimal codons may act in a similar way. Addition of the His6-tag to H2B does not appear to interfere with H2AH2B complex formation or quaternary structure and does not preclude incorporation into NCPs, offering the ability to make affinity tagged nucleosomes for binding studies. Co-expression of H3 and H4 is successful but differs from H2A and H2B in some important aspects. Robust expression of H3 and especially H4 is more dependent on the presence of a secondary plasmid to produce tRNA for rarely used codons. This may be a reflection of the greater arginine content of these histones. A high frequency of arginine codons appears to limit expression of fulllength histone H1 and H5 in E. coli [14]. Low expression of human [8] and Xenopus [6] histone H4 protein has previously been improved by optimizing codon usage. Balanced expression of histones H3 and H4 is also more successful using the dual T7 promoter plasmids and we have generally observed that it works better if the ORF for H4 is placed downstream of H3. Although we have not di-

rectly tested whether this plasmid construction produces the two types of mRNA as predicted, the production of more mRNA for H4 would provide an explanation for our observation and be consistent with the limiting factor being the production of histone H4. Co-expression of H3 and H4 does not produce significant levels of soluble histone complex. Although this could in part be due to their higher intrinsic DNA-binding affinity [1], treatment of cell extracts with nucleases or varying ionic strength does not seem to release soluble complex, suggesting that other factors are involved. However, co-expression affords a simpler method to extract and purify (H3H4)2 heterotetramers via an acid extraction method as previously noted [15]. We found that soluble (H3H4)2 complex can be produced if H3 and H4 are co-expressed with the histone chaperone Asf1. Asf1 has been shown to form a complex with a heterodimer of H3 and H4 and to block formation of the (H3H4)2 heterotetramer [26]. Interestingly this study produced a stable Asf1–H3H4 complex also by co-expression methods using an affinity tagged version of Asf1.

204

M. Anderson et al. / Protein Expression and Purification 72 (2010) 194–204

Remarkably, although we observed production of all three polypeptides from our co-expression plasmid, we did not find that Asf1 formed a stable complex with H3 and H4 as anticipated, but that H3 and H4 were present as a soluble (H3H4)2 heterotetramer. The reason for this difference is not known, but may be due to the different polypeptides expressed (Drosophila Asf1, H3 and H4 in our study cf. yeast Asf1 with Xenopus H3 and H4), the difference in affinity tag (His6-tag vs. GST-tag) or the construction of the co-expression plasmid and levels of each protein produced. In future studies it will be interesting to determine if co-expression can be used to produce complexes containing histone variant polypeptides such as H2A.Z or macroH2A, that play specific roles in aspects of chromatin structure and function [27]. It will also be valuable to determine if co-expression of a histone chaperone is a generalized method that can aid expression or solubility of histone complexes. In this regard, the Nap1 histone chaperone may represent a good target protein due to its ability to bind all four core histones including some histone variants. Co-expression is an increasingly important tool to produce multiprotein complexes for biochemical and biophysical studies. The method we describe for producing co-expression plasmids begins with plasmids for expression of individual components, which will often be available from efforts to produce the isolated proteins or can readily be created, and uses simple cloning techniques to offer the ability to quickly produce plasmids with varying number and/ or combinations of proteins. Plasmids in which the order of ORFs is varied can also be quickly created to determine the effect of ordering on expression, solubility or activity. Our cloning strategy for creating co-expression plasmids should be broadly applicable to produce other multiprotein complexes using the T7 expression system. Acknowledgments The authors thank Mark Levenstein, Dmitry Fyodorov and James Kadonaga for many useful reagents, discussions on histone preparation and encouragement. The authors acknowledge Ross Hoffman for mass spectrometry analysis. J.H.H. was supported by a Fellowship from an NIH Molecular Biophysics Training Grant (GM08319). References [1] K.E. van Holde, Chromatin, Springer-Verlag, New York, 1989. [2] D.E. Olins, A.L. Olins, Chromatin history: our view from the bridge, Nat. Rev. Mol. Cell Biol. 4 (2003) 809–814.

[3] G. Felsenfeld, M. Groudine, Controlling the double helix, Nature 421 (2003) 448–453. [4] J. Wu, M. Grunstein, 25 years after the nucleosome model: chromatin modifications, Trends Biochem. Sci. 25 (2000) 619–623. [5] C. Huang, E.A. Sloan, C.F. Boerkoel, Chromatin remodeling and human disease, Curr. Opin. Genet. Dev. 13 (2003) 246–252. [6] K. Luger et al., Characterization of nucleosome core particles containing histone proteins made in bacteria, J. Mol. Biol. 272 (1997) 301–311. [7] K. Luger, T.J. Rechsteiner, T.J. Richmond, Preparation of nucleosome core particle from recombinant histones, Methods Enzymol. 304 (1999) 3–19. [8] Y. Tanaka et al., Expression and purification of recombinant human histones, Methods 33 (2004) 3–11. [9] K. Luger et al., Crystal structure of the nucleosome core particle at 2.8 A resolution, Nature 389 (1997) 251–260. [10] A. Hamiche et al., Histone tails modulate nucleosome mobility and regulate ATP-dependent nucleosome sliding by NURF, Proc. Natl. Acad. Sci. USA 98 (2001) 14316–14321. [11] R.K. Suto et al., Crystal structure of a nucleosome core particle containing the variant histone H2A.Z, Nat. Struct. Biol. 7 (2000) 1121–1124. [12] C.L. White, R.K. Suto, K. Luger, Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions, EMBO J. 20 (2001) 5207–5218. [13] F.W. Studier et al., Use of T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185 (1990) 60–89. [14] S.E. Gerchman, V. Graziano, V. Ramakrishnan, Expression of chicken linker histones in E. coli: sources of problems and methods for overcoming some of the difficulties, Protein Expr. Purif. 5 (1994) 242–251. [15] M.E. Levenstein, J.T. Kadonaga, Biochemical analysis of chromatin containing recombinant Drosophila core histones, J. Biol. Chem. 277 (2002) 8749–8754. [16] J.O. Thomas, Chemical cross-linking of histones, Methods Enzymol. 170 (1989) 549–571. [17] P.N. Dyer et al., Reconstitution of nucleosome core particles from recombinant histones and DNA, Methods Enzymol. 375 (2004) 23–44. [18] G. Arents et al., The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix, Proc. Natl. Acad. Sci. USA 88 (1991) 10148–10152. [19] A.H. Rosenberg et al., Effects of consecutive AGG codons on translation in Escherichia coli, demonstrated with a versatile codon test system, J. Bacteriol. 175 (1993) 716–722. [20] M.R. Adhin, J. van Duin, Scanning model for translational reinitiation in eubacteria, J. Mol. Biol. 213 (1990) 811–818. [21] C.P. Carstens, Use of tRNA-supplemented host strains for expression of heterologous genes in E. coli, Methods Mol. Biol. 205 (2003) 225–233. [22] T. Ito, J.K. Tyler, J.T. Kadonaga, Chromatin assembly factors: a dual function in nucleosome formation and mobilization?, Genes Cells 2 (1997) 593–600 [23] C.W. Akey, K. Luger, Histone chaperones and nucleosome assembly, Curr. Opin. Struct. Biol. 13 (2003) 6–14. [24] J.K. Tyler et al., The RCAF complex mediates chromatin assembly during DNA replication and repair, Nature 402 (1999) 555–560. [25] R.T. Simpson, F. Thoma, J.M. Brubaker, Chromatin reconstituted from tandemly repeated cloned DNA fragments and core histones: a model system for study of higher order structure, Cell 42 (1985) 799–808. [26] C.M. English et al., ASF1 binds to a heterodimer of histones H3 and H4: a twostep mechanism for the assembly of the H3–H4 heterotetramer on DNA, Biochemistry 44 (2005) 13673–13682. [27] J. Ausio et al., Histone variants and histone modifications: a structural perspective, Biochem. Cell Biol. 79 (2001) 693–708.