- Email: [email protected]
Cobalt Chloride Enhances the Stemness of Human Dental Pulp Cells
Basic Research—Biology
Cobalt Chloride Enhances the Stemness of Human Dental Pulp Cells Kantaporn Laksana, DDS, MSc,* Sireerat Sooampon, DDS, PhD,† Prasit Pavasant, DDS, PhD,‡ and Wannakorn Sriarj, DDS, PhD* Abstract Introduction: Hypoxia is a factor in controlling stem cell stemness. We investigated if cobalt chloride (CoCl2), a chemical agent that mimics hypoxia in vitro, affected human dental pulp cell (hDPC) stemness by examining cell proliferation, stem cell marker expression, and osteogenic differentiation. Methods: hDPCs were cultured with or without 25 or 50 mmol/L CoCl2. The 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide assay was used to determine cell proliferation. The number of STRO-1+ cells was determined by flow cytometry. The messenger RNA expression of the stem cell markers REX1, OCT4, SOX2, and NANOG and the osteogenic-associated genes ALP, COLI, and RUNX2 were evaluated using reverse transcription polymerase chain reaction or real-time polymerase chain reaction. Osteogenic differentiation was assessed by alkaline phosphatase (ALP) activity and mineralization assays. Results: Although 25 and 50 mmol/L CoCl2 suppressed hDPC proliferation, 50 mmol/L CoCl2 increased the number of STRO-1+ cells. Moreover, CoCl2 dose dependently induced stem cell marker expression. Additionally, CoCl2 treatment suppressed osteogenic-associated gene expression, ALP activity, and calcium deposition. The addition of apigenin, a hypoxia-inducible factor 1-alpha inhibitor, reversed the inhibitory effect of CoCl2 on ALP activity. Conclusions: This study indicated that CoCl2 may enhance hDPC stemness. (J Endod 2017;-:1–6)
Key Words Cobalt chloride, human dental pulp cells, osteogenic differentiation, stemness
H
uman dental pulp Significance stem cells (hDPSCs) The use of CoCl2 would be an advantage in the are found in deciduous development of a method to increase the number and permanent teeth and of stem cells without the loss of their capability to may be used in tissue differentiate, which is a major problem of cellregeneration because of based approaches in current regenerative endtheir self-renewing and odontics. pluripotent ability (1–3). Dental pulp stem cells (DPSCs) are highly proliferative and formed dentin/pulplike complexes in vitro and in vivo (1, 2). However, the stem cells in the dental pulp represent <1% of the total cell population (4, 5). Therefore, stem cell amplification and stemness maintenance would benefit regenerative treatments. Extracellular oxygen concentration influences stem cell characteristics, with low oxygen tension inducing cell division and maintaining stemness (6, 7). Tissue oxygen saturation is typically lower than that of air (20% oxygen) (ie, a hypoxic state). The oxygen tension in cat brain tissue and bone marrow ranges from 0.5%– 7% and 0%–4%, respectively (8, 9). In the dental pulp, oxygen tension is 3% in mice and 4.5% in rabbits (10, 11). Therefore, these tissues possess a lower-thanatmosphere oxygen concentration (physiologic hypoxia) (12). The oxygen saturation level may alter stem cell behavior. Low oxygen tension (hypoxia) up-regulated cell proliferation and stem cell marker messenger RNA (mRNA) expression while reducing the expression of osteoblastic markers in human bone marrow stromal cells (6). Moreover, mesenchymal stem cells (MSCs) had an increased proliferative life span and diminished adipogenic or osteogenic differentiation under hypoxia (7). Hypoxia also enhanced the proliferation and the number of STRO-1+ cells while suppressing hDPC osteo/odontogenic differentiation (13, 14). To simulate hypoxic conditions in the laboratory, several methods have been used. Physically creating hypoxia is achieved using a hypoxic chamber in which the oxygen level can be controlled. However, it is difficult to control and maintain steady oxygen tension using this method. Thus, adding a chemical substance, such as cobalt chloride (CoCl2), into the culture media is an attractive alternative to physically creating hypoxia (15, 16). CoCl2 imitates hypoxia in vitro by preventing hypoxia-inducible factor-alpha (HIF-a) from being destroyed by oxygen (17). HIF-a regulates gene transcription in response to cellular oxygen reduction and maintains cell stemness (18). We previously found that CoCl2 enhanced stem cell marker expression and inhibited osteogenic differentiation in human periodontal ligament cells (19). Our literature review revealed that investigation into the influence of CoCl2 on hDPC stemness has not been reported. Therefore, this study evaluated the effect of CoCl2 on hDPC cell proliferation, stem cell gene expression, and osteogenic differentiation.
From the Departments of *Pediatric Dentistry, †Pharmacology, and ‡Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand. Address requests for reprints to Dr Wannakorn Sriarj, Chulalongkorn University, Bangkok 10330, Thailand. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2017 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2017.01.005
JOE — Volume -, Number -, - 2017
Cobalt Chloride and HDPCs
1
Basic Research—Biology Materials and Methods Tooth Collection This study was approved by the Ethics Committee of the Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand, and informed consent was acquired from each participant. The teeth consisted of premolars and impacted third molars without caries or periapical lesions indicated for extraction. Cell Isolation and Culture After extraction, the teeth were placed in sterile tubes containing Dulbecco modified Eagle medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco), 1% penicillin G 100 U/mL (Invitrogen, Carlsbad, CA), 100 mg/mL streptomycin (Invitrogen), 5 mg/mL amphotericin B (Invitrogen), and 1% 200 mmol/ L L-glutamine (Invitrogen) (culture media). The teeth were kept at 4 C, and pulp cell isolation was performed within 24 hours. The dental pulp tissues were removed from the teeth and washed with sterile phosphate-buffered saline. The tissues were cut into approximately 1 1 mm pieces, digested with 3 mg/mL type I collagenase at 4 C for 1 hour, and centrifuged at 2000 rpm. The tissue was resuspended and cultured in 35-mm plates containing culture media. The explants were maintained in culture media at 37 C in a humidified 5% CO2 atmosphere. When the cells from the explants reached confluence, they were subcultured at a 1:3 ratio. The culture media was changed every other day. Cells from passages 3 through 8 were used in this study. Cell lines from 3 donors were used. To evaluate osteogenic differentiation, hDPCs were seeded in 24-well plates at a density of 1.25 104 cells/well in osteogenic media (OM) (culture media supplemented with 50 mg/mL ascorbic acid, 100 nmol/L dexamethasone, and 10 mmol/L b-glycerophosphate) with or without 25 mmol/L or 50 mmol/L CoCl2. The media was changed every 48 hours. Cells cultured without CoCl2 served as the control. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl Tetrazolium Bromide Assay hDPCs were seeded into 24-well plates at a density of 1 104 cells/well and cultured in culture media with or without 25 or 50 mmol/L CoCl2 (Santa Cruz Biotechnology Inc, Santa Cruz, CA) for 1, 3, and 6 days. The medium was changed every other day. After each culture period, the medium was replaced with 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) solution (USB Corporation, Cleveland, OH) at 37 C for 30 minutes. The formazan product was dissolved in dimethyl sulfoxide (Sigma-Aldrich, St Louis, MO) solution and glycine buffer. Subsequently, the absorbance was evaluated using a microplate reader (Biotek Instruments, Winooski, VT) at 570 nm and converted into cell number using a standard curve. STRO-1+ Cell Quantification Using Flow Cytometry hDPCs were cultured in 60-mm dishes at a density of 2 105 cells/ dish in culture media with or without 50 mmol/L CoCl2 for 6 days. The cells were harvested and incubated with a mouse STRO-1 primary antibody (Chemicon, Temecula, CA) and then incubated with a biotinconjugated antimouse goat secondary antibody (Chemicon) on ice for 30 minutes. The cells were subsequently incubated with streptavidin– fluorescein isothiocyanate (Sigma-Aldrich) on ice for 30 minutes. The cells were resuspended twice in fluorescence-activated cell sorting buffer. The cells were fixed with 1% formaldehyde until analyzed using a flow cytometer (Beckman Coulter, Carlsbad, CA). Data analysis was performed using Cell Quest Software (BD Biosciences, Franklin Lakes, NJ). 2
Laksana et al.
Reverse Transcription Polymerase Chain Reaction and Real-time Polymerase Chain Reaction hDPCs were seeded in 6-well plates at a density of 3 106 cells/ well and incubated in culture media. The cells were treated with or without 25 or 50 mmol/L CoCl2. hDPCs cultured without CoCl2 served as the control. Total RNA was extracted using TRIzol reagent (Roche Diagnostics, Indianapolis, IN) per the manufacturer’s protocol. One microgram of mRNA was converted into complementary DNA using the ImProm II Reverse Transcription System (Promega, Southampton, UK) and amplified by polymerase chain reaction (PCR) using Tag polymerase (Tag DNA Polymerase, Invitrogen) and primers for REX1, OCT4, SOX2, NANOG, ALP, RUNX2, or COLI in a DNA thermal cycler (Biometra GmH, G€ottingen, Germany). The primer sequences are shown in Table 1. The amplified DNA was electrophoresed on a 1.8% agarose gel and visualized using ethidium bromide fluorostaining. The intensity of the specific bands was read by the Scion Image program (Scion Corporation, Fort Worth, TX). For real-time PCR, the reaction was performed using a LightCycler Nano (Roche Diagnostics) with a LightCycler_480 SYBR Green I Master kit (Roche Diagnostics). Alkaline Phosphatase Assay hDPCs were seeded in 24-well plates at a density of 2.5 104 cells/well and incubated in OM with or without 25 or 50 mmol/L CoCl2 for 7 and 14 days. In some groups, cells were cultured in OM with 50 mmol/L CoCl2 for 7 days before being replaced by OM without CoCl2 for 7 days. After the culture periods, the cells were treated with an alkaline lysis buffer. The supernatants were incubated at 37 C in an alkaline phosphatase (ALP) substrate solution containing 2 mg/mL p-nitrophenol phosphate (Invitrogen), 0.1 mol/L 2-amino-2-methyl-1-propanol (Sigma-Aldrich), and 2 mmol/L MgCl2 for 30 minutes. The reaction was stopped using 50 mmol/L NaOH. The absorbance was measured at 410 nm with a microplate reader. Total cellular protein was measured using the BCA protein assay (Thermo Scientific, Waltham, MA) per the manufacturer’s instructions. ALP activity was normalized to the total cellular protein. Mineralization Assay hDPCs were seeded at a density of 1.25 104 cells/well in 24-well plates. Osteogenic differentiation was performed similar to the ALP assay. After culturing for 28 days, the cells were fixed with absolute
TABLE 1. Reverse Transcription Polymerase Chain Reaction Primer Sequences Gene REX1 OCT4 NANOG SOX2 ALP RUNX2 COLI 18S
Forward primer Reverse primer 50 AGAATTCGCTTGAGTATTCTGA30 50 GGCTTTCAGGTTATTTGACTGA30 50 AGACCCAGCAGCCTCAAAATC30 50 GCAACCTGGAGAATTTGTTCCT30 50 GGAAGAGTAGAGGCTGGGGT30 50 TCTCTCCTCTTCCTTCTCCA30 50 ACCAGCTCGCAGACCTACAT30 50 ATGTGTGAGAGGGGCAGTGT30 50 CGAGATACAAGCACTCCCACTTC30 50 CTGTTCAGCTCGTACTGCATGTC30 50 CCCCACGACAACCGCACCAT30 50 CACTCCGGCCCACAAATC30 50 GTGCTAAAGGTGCCAATGGT 30 50 ACCAGGTTCACCGCTGTTAC 30 50 GTGATGCCCTTAGATGTCC30 50 CCATCCAATCGGTAGTAGC30
JOE — Volume -, Number -, - 2017
Basic Research—Biology using 10% cetylpyridinium chloride monohydrate (Sigma-Aldrich) in 10 mmol/L sodium phosphate at room temperature for 15 minutes. The absorbance was measured at 570 nm with a microplate reader.
Data Analysis Each experiment was performed in triplicate and repeated at least twice. Data are shown as mean standard deviation. One-way analysis of variance was used to analyze the differences in cell number, stem cell marker expression, ALP activity, and mineralization between groups. The STRO-1+ cell number was compared with the control group using the independent sample t test. All analyses were performed using SPSS 16.0 software (SPSS Inc, Chicago, IL). Statistical significance was determined at P < .05.
Results
Figure 1. (A) The proliferation of hDPCs cultured with 0, 25, or 50 mmol/L CoCl2. The MTT assay was performed after 1, 3, and 6 days of culture. CoCl2 significantly decreased the number of hDPCs at day 6 compared with the control group. (B) The STRO-1+ cells were assessed by flow cytometry after 6 days. The cells cultured in normal culture media supplemented with 50 mmol/L CoCl2 showed a higher proportion of STRO-1+ cells compared with the control group. The data were expressed in fold change compared with the control. *P < .05.
ethanol for 15 minutes, washed with deionized water, and stained with 1% alizarin red S (Sigma-Aldrich) for 5 minutes at room temperature. Excess stain was removed with deionized water, and the images were obtained. Calcium deposition was quantified by destaining the deposits
CoCl2 Inhibited hDPC Proliferation To study the effect of CoCl2 on hDPC proliferation, the cells were cultured in culture media with or without 25 or 50 mmol/L CoCl2 over a span of 6 days. The MTT assay revealed that after 3 days CoCl2 did not affect the hDPC number (Fig. 1A). However, after 6 days, 25 and 50 mmol/L CoCl2 significantly decreased hDPC proliferation compared with those cultured in culture media. Because hDPCs contain multiple heterogeneous cell groups and the number of stem cells is much lower than the total hDPC population (4), we determined if the proliferation of the DPSCs in the hDPC population was influenced by CoCl2 treatment. STRO-1, an early MSC marker, was examined to quantify stem cell number. STRO-1+ cells were determined by flow cytometry. We found that hDPCs cultured in culture media containing 50 mmol/L CoCl2 for 6 days showed a significant increase in STRO-1+ cells compared with the control (Fig. 1B). CoCl2 Increased Stem Cell Marker mRNA Expression The effects of CoCl2 on mRNA expression of the stem cell markers REX1, OCT4, SOX2, and NANOG after the cells were cultured with or without 25 or 50 mmol/L CoCl2 for 3 days was evaluated (Fig. 2A). The results revealed no significant increase in stem cell marker expression between the 25 mmol/L CoCl2 and control groups (Fig. 2B). However, 50 mmol/L CoCl2 significantly induced the expression of these markers compared with the control.
Figure 2. (A) The hDPC mRNA expression of REX1, OCT4, NANOG, and SOX2 after treatment with 25 or 50 mmol/L CoCl2 for 3 days as assessed by reverse transcription PCR. (B) The band density was determined by Scion Image analysis. The expression of the 18S mRNA was used as the internal control. The data are shown as relative gene expression compared with the internal control. *P < .05.
JOE — Volume -, Number -, - 2017
Cobalt Chloride and HDPCs
3
Basic Research—Biology CoCl2 Inhibited the Osteogenic Differentiation of hDPCs To determine the effect of CoCl2 on osteogenic differentiation, hDPCs were cultured in OM with or without 25 or 50 mmol/L CoCl2. The mRNA expression of osteogenic-related genes was determined. The results showed that 50 mmol/L CoCl2 significantly reduced the mRNA expression of ALP, an early marker of osteogenic differentiation (20) (Fig. 3A). The mRNA expression of other osteogenic-associated genes (ie, COLI [21] and RUNX2, an essential transcription factor for
osteoblast differentiation [22]) was also reduced (Fig. 3A). In agreement with the PCR results, hDPCs cultured with either 25 or 50 mmol/L CoCl2 exhibited a significant dose-dependent reduction in ALP activity at 7 and 14 days (Fig. 3B). To investigate whether the inhibitory effect of CoCl2 on osteogenic differentiation was reversible, hDPCs were cultured in OM with 50 mmol/L CoCl2 for 7 days, the CoCl2 was removed, and then the cells were cultured in OM for 7 more days. We found that after CoCl2 was
Figure 3. CoCl2 significantly decreased the osteogenic differentiation of hDPCs. The hDPCs cultured in osteogenic medium with 25 or 50 mmol/L CoCl2. (A) After 7 days of osteogenic induction, the mRNA expression of ALP, RUNX2, and COLI was examined by real-time PCR. Data are shown as relative gene expression compared with the internal control (*P < .05). (B) hDPCs cultured in OM with 25 or 50 mmol/L CoCl2 for 7 or 14 days showed an inhibition of ALP activity. (C) hDPCs cultured in normal culture media supplemented with 50 mmol/L CoCl2 for 7 days and then further cultured in OM alone for 7 days showed increased ALP activity compared with hDPCs cultured in OM with 50 mmol/L CoCl2 for 7 days. (D) Deposition of calcium exhibited by alizarin red staining. hDPCs cultured in OM with either 25 or 50 mmol/L CoCl2 for 28 days showed reduced mineral deposition (*P < .05). Other hDPCs were treated with 50 mmol/L CoCl2 for 7 days, and then the CoCl2 was eliminated from the culture media. hDPCs were further cultured until 28 days. Data were expressed in fold change compared with the control. *P < .05.
4
Laksana et al.
JOE — Volume -, Number -, - 2017
Basic Research—Biology removed, hDPC ALP activity increased compared with the ALP activity of hDPCs cultured in OM with 50 mmol/L CoCl2 for 7 days. These results imply that the effect of CoCl2 was reversible (Fig. 3C). Calcium deposition was evaluated by alizarin red staining. We found that CoCl2 decreased calcium deposition after culturing for 28 days. Similar to the ALP activity assay, after culturing the hDPCs in OM with 50 mmol/L CoCl2 for 7 days, CoCl2 was removed. The cells were cultured in OM until day 28, and calcium deposition was assessed. After culturing hDPCs in OM with and then without CoCl2, the mineral deposition was similar to that of the hDPCs cultured in OM alone (Fig. 3D). These findings suggest that CoCl2 may maintain the stem cell property of hDPCs by inhibiting osteogenic differentiation.
Apigenin Reversed the Inhibitory Effect of CoCl2 in hDPCs CoCl2 imitates hypoxia by stabilizing HIF-a (18). Thus, to investigate whether the inhibitory effect of CoCl2 was mediated by HIF-a, apigenin, which inhibits the expression of HIF-1a (23), was used. After 7 days of osteogenic induction, the decrease in ALP activity of hDPCs cultured with 50 mmol/L CoCl2 was partly rescued when apigenin was added (Fig. 4). This suggests that CoCl2 inhibits osteogenic differentiation, at least in part, via a HIF-a–dependent pathway.
Discussion Hypoxia induces stem cell proliferation and the expression of stem cell marker genes while inhibiting MSC osteogenic differentiation (6, 24, 25). CoCl2-simulated hypoxia also increased MSC proliferation (16). However, studies of the effect of CoCl2 on hDPCs are limited. This is the first study to show the effect of CoCl2 on hDPC stemness. We found that CoCl2 inhibited the proliferation and osteogenic differentiation of hDPCs, whereas stem cell marker mRNA expression and the number of STRO-1+ cells increased. The cytotoxicity of CoCl2 is still unresolved. In our pilot study, we found that 100 mmol/L CoCl2 induced cell death (data not shown). However, previous studies reported using 100 mmol/L CoCl2 when
Figure 4. CoCl2 inhibited osteogenic differentiation through HIF-1a. hDPCs were treated with 50 mmol/L CoCl2 for 7 days. Apigenin, an HIF-1a inhibitor, reversed the inhibitory effect of CoCl2 on ALP activity. The data were expressed in fold change compared with the control. *P < .05.
JOE — Volume -, Number -, - 2017
culturing human periodontal ligament cells, neuroprogenitor cells, and human MSCs (19, 20, 26). This implies that the cytotoxicity of CoCl2 may be cell type dependent. Our MTT assay showed that mimicking hypoxia in vitro using 25–50 mmol/L CoCl2 for 6 days decreased hDPC proliferation. This finding supports the results of a previous study in which CoCl2 suppressed human MSC proliferation via cell cycle alteration (16). This study found that the cell resting phase (G0/G1 phase) was lengthened, and the cell proliferation phase (G2/S/M) was halted. However, we cannot definitively conclude that CoCl2 inhibited DPSC proliferation because the hDPCs are composed of heterogeneous groups of cells and the number of DPSCs is much fewer compared with the total dental pulp composition (4). Flow cytometry revealed that CoCl2 increased the number of STRO-1+ cells, an early MSC marker present in DPSCs (27). Treating hDPCs with CoCl2 significantly increased the number of STRO-1+ cells, similar to that of hDPCs cultured in hypoxia (13, 14). The elevated number of STRO1+ DPCs in the 50 mmol/L CoCl2 group correlated with the increased mRNA expression of the pluripotent REX1, OCT4, SOX2, and NANOG seen in previous studies (28, 29). These results suggest that although CoCl2 inhibits pulp cell proliferation, it selectively enhances hDPC stem cell number. Although similar methods were used in prior studies, there have been conflicting results regarding the effect of hypoxia on stem cell differentiation. In hDPCs, Iida et al (13) found that hypoxia (3% oxygen) inhibited osteogenic differentiation, whereas Li et al (30) showed that hypoxia (5% oxygen) induced cell mineralization. This may be because of differences in the oxygen percentage used in these studies. Additionally, we could not directly compare the concentration of CoCl2 and the oxygen percentage. However, our results correspond with the study by Osathanon et al (19), which found the inhibitory effect of CoCl2 on osteogenic differentiation in human periodontal ligament pulp cells. Here we showed that CoCl2 inhibited the osteogenic differentiation of hDPCs as shown by the reduction in osteogenic-related genes, ALP activity, and calcium deposition. Interestingly, ALP activity and the level of calcium deposition were rescued when CoCl2 was eliminated from the OM. Thus, the effect of CoCl2 on osteogenic differentiation is reversible. CoCl2 might be used to maintain stem cells in vitro because of its reversible effect on inhibiting osteogenic differentiation and by increasing the proportion of stem cells. However, these mechanisms should be investigated. The inhibitory effect of cell differentiation found with CoCl2 treatment may not be the same as that of hypoxia. This is because CoCl2 acts only through HIF-1a, whereas hypoxia mediates a HIF-1a–dependent and –independent pathway (17, 31). However, the results from the present study revealed that apigenin, an HIF-1a expression inhibitor, partly reversed the inhibitory effect of CoCl2 on ALP activity. This suggests that HIF-1a may be involved in the CoCl2-mediated mechanism. However, apigenin is not a specific HIF-1a inhibitor (32). Therefore, further study is needed to confirm that HIF-1a is involved in this mechanism. The current technology in regenerative endodontics requires a cell-based approach. Previous studies have shown that the autologous transplantation of pulpal MSCs induced pulp-dentin regeneration (33, 34). The major disadvantage of cell-based approaches is the availability of stem cells, especially in older patients. Thus, the stem cells need to be extensively expanded in vitro to obtain an adequate cell number. However, this can induce the loss of differentiation capacity (35). Therefore, the use of CoCl2 would be an advantage in the development of a method to increase the number of stem cells without the loss of their capability to differentiate. Future studies are recommended to examine the relationship between the concentration of CoCl2 and the level of oxygen tension as well as the mechanisms wherein CoCl2 affects cell stemness.
Cobalt Chloride and HDPCs
5
Basic Research—Biology Acknowledgments The authors thank Dr Kevin Tompkins for language editing. Supported by the Research Unit of Mineral Tissue, Faculty of Dentistry, Chulalongkorn University, and the 90th anniversary of Chulalongkorn University fund (Ratchadaphiseksomphot Endowment Fund). W.S. was supported by a faculty research grant (DRF 56005), Faculty of Dentistry, Chulalongkorn University. P.P. was supported by the Research Chair Grant 2012, the National Science and Technology Development Agency (NSTDA), Thailand. The authors deny any conflicts of interest related to this study.
References 1. Gronthos S, Mankani M, Brahim J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97:13625–30. 2. Gronthos S, Brahim J, Li W, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;81:531–5. 3. Koyama N, Okubo Y, Nakao K, Bessho K. Evaluation of pluripotency in human dental pulp cells. J Oral Maxillofac Surg 2009;67:501–6. 4. Sloan AJ, Waddington RJ. Dental pulp stem cells: what, where, how? Int J Paediatr Dent 2009;19:61–70. 5. Stocum DL. Stem cells in regenerative biology and medicine. Wound Repair Regen 2001;9:429–42. 6. D’Ippolito G, Diabira S, Howard GA, et al. Low oxygen tension inhibits osteogenic differentiation and enhances stemness of human MIAMI cells. Bone 2006;39:513–22. 7. Fehrer C, Brunauer R, Laschober G, et al. Reduced oxygen tension attenuates differentiation capacity of human mesenchymal stem cells and prolongs their lifespan. Aging Cell 2007;6:745–57. 8. Whalen WJ, Ganfield R, Nair P. Effects of breathing O 2 or O 2 +CO 2 and of the injection of neurohumors on the PO 2 of cat cerebral cortex. Stroke 1970;1:194–200. 9. Chow DC, Wenning LA, Miller WM, Papoutsakis ET. Modeling pO(2) distributions in the bone marrow hematopoietic compartment. I. Krogh’s model. Biophys J 2001; 81:675–84. 10. Yu CY, Boyd NM, Cringle SJ, et al. Oxygen distribution and consumption in rat lower incisor pulp. Arch Oral Biol 2002;47:529–36. 11. Kozam G. Oxygen tension of rabbit incisor pulp. J Dent Res 1967;46:352–8. 12. Guzy RD, Schumacker PT. Oxygen sensing by mitochondria at complex III: the paradox of increased reactive oxygen species during hypoxia. Exp Physiol 2006; 91:807–19. 13. Iida K, Takeda-Kawaguchi T, Tezuka Y, et al. Hypoxia enhances colony formation and proliferation but inhibits differentiation of human dental pulp cells. Arch Oral Biol 2010;55:648–54. 14. Sakdee JB, White RR, Pagonis TC, Hauschka PV. Hypoxia-amplified proliferation of human dental pulp cells. J Endod 2009;35:818–23. 15. Pacary E, Tixier E, Coulet F, et al. Crosstalk between HIF-1 and ROCK pathways in neuronal differentiation of mesenchymal stem cells, neurospheres and in PC12 neurite outgrowth. Mol Cell Neurosci 2007;35:409–23.
6
Laksana et al.
16. Zeng HL, Zhong Q, Qin YL, et al. Hypoxia-mimetic agents inhibit proliferation and alter the morphology of human umbilical cord-derived mesenchymal stem cells. BMC Cell Biol 2011;12:32. 17. Yuan Y, Hilliard G, Ferguson T, Millhorn DE. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J Biol Chem 2003;278:15911–6. 18. Mohyeldin A, Garzon-Muvdi T, Quinones-Hinojosa A. Oxygen in stem cell biology: a critical component of the stem cell niche. Cell Stem Cell 2010;7:150–61. 19. Osathanon T, Vivatbutsiri P, Sukarawan W, et al. Cobalt chloride supplementation induces stem-cell marker expression and inhibits osteoblastic differentiation in human periodontal ligament cells. Arch Oral Biol 2015;60:29–36. 20. Milosevic J, Adler I, Manaenko A, et al. Non-hypoxic stabilization of hypoxiainducible factor alpha (HIF-alpha): relevance in neural progenitor/stem cells. Neurotox Res 2009;15:367–80. 21. Aubin JE. Bone stem cells. J Cell Biochem Suppl 1998;30–31:73–82. 22. Ducy P, Zhang R, Geoffroy V, et al. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. 23. Fang J, Xia C, Cao Z, et al. Apigenin inhibits VEGF and HIF-1 expression via PI3K/ AKT/p70S6K1 and HDM2/p53 pathways. FASEB J 2005;19:342–53. 24. Hung SP, Ho JH, Shih YR, et al. Hypoxia promotes proliferation and osteogenic differentiation potentials of human mesenchymal stem cells. J Orthop Res 2012;30: 260–6. 25. Ranera B, Remacha AR, Alvarez-Arguedas S, et al. Effect of hypoxia on equine mesenchymal stem cells derived from bone marrow and adipose tissue. BMC Vet Res 2012;8:142. 26. Jeon ES, Shin JH, Hwang SJ, et al. Cobalt chloride induces neuronal differentiation of human mesenchymal stem cells through upregulation of microRNA-124a. Biochem Biophys Res Commun 2014;444:581–7. 27. Shi S, Bartold PM, Miura M, et al. The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res 2005;8:191–9. 28. Szablowska-Gadomska I, Zayat V, Buzanska L. Influence of low oxygen tensions on expression of pluripotency genes in stem cells. Acta Neurobiol Exp (Wars) 2011;71: 86–93. 29. Govindasamy V, Abdullah AN, Ronald VS, et al. Inherent differential propensity of dental pulp stem cells derived from human deciduous and permanent teeth. J Endod 2010;36:1504–15. 30. Li L, Zhu YQ, Jiang L, et al. Hypoxia promotes mineralization of human dental pulp cells. J Endod 2011;37:799–802. 31. Mizukami Y, Kohgo Y, Chung DC. Hypoxia inducible factor-1 independent pathways in tumor angiogenesis. Clin Cancer Res 2007;13:5670–4. 32. Yayama T, Kobayashi S, Kokubo Y, et al. Motion analysis of the wrist joints in patients with rheumatoid arthritis. Mod Rheumatol 2007;17:322–6. 33. Nishina S, Hino K, Korenaga M, et al. Hepatitis C virus-induced reactive oxygen species raise hepatic iron level in mice by reducing hepcidin transcription. Gastroenterology 2008;134:226–38. 34. Mimura K, Kono K, Takahashi A, et al. Vascular endothelial growth factor partially inhibits the trastuzumab-mediated antibody-dependent cellular cytotoxicity of human monocytes. Oncology 2007;72:172–80. 35. Tonooka Y, Mizukami Y, Fujishima M. One-base excess adaptor ligation method for walking uncloned genomic DNA. Appl Microbiol Biotechnol 2008;78: 173–80.
JOE — Volume -, Number -, - 2017
Cobalt Chloride Enhances the Stemness of Human Dental Pulp Cells Kantaporn Laksana, DDS, MSc,* Sireerat Sooampon, DDS, PhD,† Prasit Pavasant, DDS, PhD,‡ and Wannakorn Sriarj, DDS, PhD* Abstract Introduction: Hypoxia is a factor in controlling stem cell stemness. We investigated if cobalt chloride (CoCl2), a chemical agent that mimics hypoxia in vitro, affected human dental pulp cell (hDPC) stemness by examining cell proliferation, stem cell marker expression, and osteogenic differentiation. Methods: hDPCs were cultured with or without 25 or 50 mmol/L CoCl2. The 3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide assay was used to determine cell proliferation. The number of STRO-1+ cells was determined by flow cytometry. The messenger RNA expression of the stem cell markers REX1, OCT4, SOX2, and NANOG and the osteogenic-associated genes ALP, COLI, and RUNX2 were evaluated using reverse transcription polymerase chain reaction or real-time polymerase chain reaction. Osteogenic differentiation was assessed by alkaline phosphatase (ALP) activity and mineralization assays. Results: Although 25 and 50 mmol/L CoCl2 suppressed hDPC proliferation, 50 mmol/L CoCl2 increased the number of STRO-1+ cells. Moreover, CoCl2 dose dependently induced stem cell marker expression. Additionally, CoCl2 treatment suppressed osteogenic-associated gene expression, ALP activity, and calcium deposition. The addition of apigenin, a hypoxia-inducible factor 1-alpha inhibitor, reversed the inhibitory effect of CoCl2 on ALP activity. Conclusions: This study indicated that CoCl2 may enhance hDPC stemness. (J Endod 2017;-:1–6)
Key Words Cobalt chloride, human dental pulp cells, osteogenic differentiation, stemness
H
uman dental pulp Significance stem cells (hDPSCs) The use of CoCl2 would be an advantage in the are found in deciduous development of a method to increase the number and permanent teeth and of stem cells without the loss of their capability to may be used in tissue differentiate, which is a major problem of cellregeneration because of based approaches in current regenerative endtheir self-renewing and odontics. pluripotent ability (1–3). Dental pulp stem cells (DPSCs) are highly proliferative and formed dentin/pulplike complexes in vitro and in vivo (1, 2). However, the stem cells in the dental pulp represent <1% of the total cell population (4, 5). Therefore, stem cell amplification and stemness maintenance would benefit regenerative treatments. Extracellular oxygen concentration influences stem cell characteristics, with low oxygen tension inducing cell division and maintaining stemness (6, 7). Tissue oxygen saturation is typically lower than that of air (20% oxygen) (ie, a hypoxic state). The oxygen tension in cat brain tissue and bone marrow ranges from 0.5%– 7% and 0%–4%, respectively (8, 9). In the dental pulp, oxygen tension is 3% in mice and 4.5% in rabbits (10, 11). Therefore, these tissues possess a lower-thanatmosphere oxygen concentration (physiologic hypoxia) (12). The oxygen saturation level may alter stem cell behavior. Low oxygen tension (hypoxia) up-regulated cell proliferation and stem cell marker messenger RNA (mRNA) expression while reducing the expression of osteoblastic markers in human bone marrow stromal cells (6). Moreover, mesenchymal stem cells (MSCs) had an increased proliferative life span and diminished adipogenic or osteogenic differentiation under hypoxia (7). Hypoxia also enhanced the proliferation and the number of STRO-1+ cells while suppressing hDPC osteo/odontogenic differentiation (13, 14). To simulate hypoxic conditions in the laboratory, several methods have been used. Physically creating hypoxia is achieved using a hypoxic chamber in which the oxygen level can be controlled. However, it is difficult to control and maintain steady oxygen tension using this method. Thus, adding a chemical substance, such as cobalt chloride (CoCl2), into the culture media is an attractive alternative to physically creating hypoxia (15, 16). CoCl2 imitates hypoxia in vitro by preventing hypoxia-inducible factor-alpha (HIF-a) from being destroyed by oxygen (17). HIF-a regulates gene transcription in response to cellular oxygen reduction and maintains cell stemness (18). We previously found that CoCl2 enhanced stem cell marker expression and inhibited osteogenic differentiation in human periodontal ligament cells (19). Our literature review revealed that investigation into the influence of CoCl2 on hDPC stemness has not been reported. Therefore, this study evaluated the effect of CoCl2 on hDPC cell proliferation, stem cell gene expression, and osteogenic differentiation.
From the Departments of *Pediatric Dentistry, †Pharmacology, and ‡Anatomy, Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand. Address requests for reprints to Dr Wannakorn Sriarj, Chulalongkorn University, Bangkok 10330, Thailand. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2017 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2017.01.005
JOE — Volume -, Number -, - 2017
Cobalt Chloride and HDPCs
1
Basic Research—Biology Materials and Methods Tooth Collection This study was approved by the Ethics Committee of the Faculty of Dentistry, Chulalongkorn University, Bangkok, Thailand, and informed consent was acquired from each participant. The teeth consisted of premolars and impacted third molars without caries or periapical lesions indicated for extraction. Cell Isolation and Culture After extraction, the teeth were placed in sterile tubes containing Dulbecco modified Eagle medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Gibco), 1% penicillin G 100 U/mL (Invitrogen, Carlsbad, CA), 100 mg/mL streptomycin (Invitrogen), 5 mg/mL amphotericin B (Invitrogen), and 1% 200 mmol/ L L-glutamine (Invitrogen) (culture media). The teeth were kept at 4 C, and pulp cell isolation was performed within 24 hours. The dental pulp tissues were removed from the teeth and washed with sterile phosphate-buffered saline. The tissues were cut into approximately 1 1 mm pieces, digested with 3 mg/mL type I collagenase at 4 C for 1 hour, and centrifuged at 2000 rpm. The tissue was resuspended and cultured in 35-mm plates containing culture media. The explants were maintained in culture media at 37 C in a humidified 5% CO2 atmosphere. When the cells from the explants reached confluence, they were subcultured at a 1:3 ratio. The culture media was changed every other day. Cells from passages 3 through 8 were used in this study. Cell lines from 3 donors were used. To evaluate osteogenic differentiation, hDPCs were seeded in 24-well plates at a density of 1.25 104 cells/well in osteogenic media (OM) (culture media supplemented with 50 mg/mL ascorbic acid, 100 nmol/L dexamethasone, and 10 mmol/L b-glycerophosphate) with or without 25 mmol/L or 50 mmol/L CoCl2. The media was changed every 48 hours. Cells cultured without CoCl2 served as the control. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl Tetrazolium Bromide Assay hDPCs were seeded into 24-well plates at a density of 1 104 cells/well and cultured in culture media with or without 25 or 50 mmol/L CoCl2 (Santa Cruz Biotechnology Inc, Santa Cruz, CA) for 1, 3, and 6 days. The medium was changed every other day. After each culture period, the medium was replaced with 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) solution (USB Corporation, Cleveland, OH) at 37 C for 30 minutes. The formazan product was dissolved in dimethyl sulfoxide (Sigma-Aldrich, St Louis, MO) solution and glycine buffer. Subsequently, the absorbance was evaluated using a microplate reader (Biotek Instruments, Winooski, VT) at 570 nm and converted into cell number using a standard curve. STRO-1+ Cell Quantification Using Flow Cytometry hDPCs were cultured in 60-mm dishes at a density of 2 105 cells/ dish in culture media with or without 50 mmol/L CoCl2 for 6 days. The cells were harvested and incubated with a mouse STRO-1 primary antibody (Chemicon, Temecula, CA) and then incubated with a biotinconjugated antimouse goat secondary antibody (Chemicon) on ice for 30 minutes. The cells were subsequently incubated with streptavidin– fluorescein isothiocyanate (Sigma-Aldrich) on ice for 30 minutes. The cells were resuspended twice in fluorescence-activated cell sorting buffer. The cells were fixed with 1% formaldehyde until analyzed using a flow cytometer (Beckman Coulter, Carlsbad, CA). Data analysis was performed using Cell Quest Software (BD Biosciences, Franklin Lakes, NJ). 2
Laksana et al.
Reverse Transcription Polymerase Chain Reaction and Real-time Polymerase Chain Reaction hDPCs were seeded in 6-well plates at a density of 3 106 cells/ well and incubated in culture media. The cells were treated with or without 25 or 50 mmol/L CoCl2. hDPCs cultured without CoCl2 served as the control. Total RNA was extracted using TRIzol reagent (Roche Diagnostics, Indianapolis, IN) per the manufacturer’s protocol. One microgram of mRNA was converted into complementary DNA using the ImProm II Reverse Transcription System (Promega, Southampton, UK) and amplified by polymerase chain reaction (PCR) using Tag polymerase (Tag DNA Polymerase, Invitrogen) and primers for REX1, OCT4, SOX2, NANOG, ALP, RUNX2, or COLI in a DNA thermal cycler (Biometra GmH, G€ottingen, Germany). The primer sequences are shown in Table 1. The amplified DNA was electrophoresed on a 1.8% agarose gel and visualized using ethidium bromide fluorostaining. The intensity of the specific bands was read by the Scion Image program (Scion Corporation, Fort Worth, TX). For real-time PCR, the reaction was performed using a LightCycler Nano (Roche Diagnostics) with a LightCycler_480 SYBR Green I Master kit (Roche Diagnostics). Alkaline Phosphatase Assay hDPCs were seeded in 24-well plates at a density of 2.5 104 cells/well and incubated in OM with or without 25 or 50 mmol/L CoCl2 for 7 and 14 days. In some groups, cells were cultured in OM with 50 mmol/L CoCl2 for 7 days before being replaced by OM without CoCl2 for 7 days. After the culture periods, the cells were treated with an alkaline lysis buffer. The supernatants were incubated at 37 C in an alkaline phosphatase (ALP) substrate solution containing 2 mg/mL p-nitrophenol phosphate (Invitrogen), 0.1 mol/L 2-amino-2-methyl-1-propanol (Sigma-Aldrich), and 2 mmol/L MgCl2 for 30 minutes. The reaction was stopped using 50 mmol/L NaOH. The absorbance was measured at 410 nm with a microplate reader. Total cellular protein was measured using the BCA protein assay (Thermo Scientific, Waltham, MA) per the manufacturer’s instructions. ALP activity was normalized to the total cellular protein. Mineralization Assay hDPCs were seeded at a density of 1.25 104 cells/well in 24-well plates. Osteogenic differentiation was performed similar to the ALP assay. After culturing for 28 days, the cells were fixed with absolute
TABLE 1. Reverse Transcription Polymerase Chain Reaction Primer Sequences Gene REX1 OCT4 NANOG SOX2 ALP RUNX2 COLI 18S
Forward primer Reverse primer 50 AGAATTCGCTTGAGTATTCTGA30 50 GGCTTTCAGGTTATTTGACTGA30 50 AGACCCAGCAGCCTCAAAATC30 50 GCAACCTGGAGAATTTGTTCCT30 50 GGAAGAGTAGAGGCTGGGGT30 50 TCTCTCCTCTTCCTTCTCCA30 50 ACCAGCTCGCAGACCTACAT30 50 ATGTGTGAGAGGGGCAGTGT30 50 CGAGATACAAGCACTCCCACTTC30 50 CTGTTCAGCTCGTACTGCATGTC30 50 CCCCACGACAACCGCACCAT30 50 CACTCCGGCCCACAAATC30 50 GTGCTAAAGGTGCCAATGGT 30 50 ACCAGGTTCACCGCTGTTAC 30 50 GTGATGCCCTTAGATGTCC30 50 CCATCCAATCGGTAGTAGC30
JOE — Volume -, Number -, - 2017
Basic Research—Biology using 10% cetylpyridinium chloride monohydrate (Sigma-Aldrich) in 10 mmol/L sodium phosphate at room temperature for 15 minutes. The absorbance was measured at 570 nm with a microplate reader.
Data Analysis Each experiment was performed in triplicate and repeated at least twice. Data are shown as mean standard deviation. One-way analysis of variance was used to analyze the differences in cell number, stem cell marker expression, ALP activity, and mineralization between groups. The STRO-1+ cell number was compared with the control group using the independent sample t test. All analyses were performed using SPSS 16.0 software (SPSS Inc, Chicago, IL). Statistical significance was determined at P < .05.
Results
Figure 1. (A) The proliferation of hDPCs cultured with 0, 25, or 50 mmol/L CoCl2. The MTT assay was performed after 1, 3, and 6 days of culture. CoCl2 significantly decreased the number of hDPCs at day 6 compared with the control group. (B) The STRO-1+ cells were assessed by flow cytometry after 6 days. The cells cultured in normal culture media supplemented with 50 mmol/L CoCl2 showed a higher proportion of STRO-1+ cells compared with the control group. The data were expressed in fold change compared with the control. *P < .05.
ethanol for 15 minutes, washed with deionized water, and stained with 1% alizarin red S (Sigma-Aldrich) for 5 minutes at room temperature. Excess stain was removed with deionized water, and the images were obtained. Calcium deposition was quantified by destaining the deposits
CoCl2 Inhibited hDPC Proliferation To study the effect of CoCl2 on hDPC proliferation, the cells were cultured in culture media with or without 25 or 50 mmol/L CoCl2 over a span of 6 days. The MTT assay revealed that after 3 days CoCl2 did not affect the hDPC number (Fig. 1A). However, after 6 days, 25 and 50 mmol/L CoCl2 significantly decreased hDPC proliferation compared with those cultured in culture media. Because hDPCs contain multiple heterogeneous cell groups and the number of stem cells is much lower than the total hDPC population (4), we determined if the proliferation of the DPSCs in the hDPC population was influenced by CoCl2 treatment. STRO-1, an early MSC marker, was examined to quantify stem cell number. STRO-1+ cells were determined by flow cytometry. We found that hDPCs cultured in culture media containing 50 mmol/L CoCl2 for 6 days showed a significant increase in STRO-1+ cells compared with the control (Fig. 1B). CoCl2 Increased Stem Cell Marker mRNA Expression The effects of CoCl2 on mRNA expression of the stem cell markers REX1, OCT4, SOX2, and NANOG after the cells were cultured with or without 25 or 50 mmol/L CoCl2 for 3 days was evaluated (Fig. 2A). The results revealed no significant increase in stem cell marker expression between the 25 mmol/L CoCl2 and control groups (Fig. 2B). However, 50 mmol/L CoCl2 significantly induced the expression of these markers compared with the control.
Figure 2. (A) The hDPC mRNA expression of REX1, OCT4, NANOG, and SOX2 after treatment with 25 or 50 mmol/L CoCl2 for 3 days as assessed by reverse transcription PCR. (B) The band density was determined by Scion Image analysis. The expression of the 18S mRNA was used as the internal control. The data are shown as relative gene expression compared with the internal control. *P < .05.
JOE — Volume -, Number -, - 2017
Cobalt Chloride and HDPCs
3
Basic Research—Biology CoCl2 Inhibited the Osteogenic Differentiation of hDPCs To determine the effect of CoCl2 on osteogenic differentiation, hDPCs were cultured in OM with or without 25 or 50 mmol/L CoCl2. The mRNA expression of osteogenic-related genes was determined. The results showed that 50 mmol/L CoCl2 significantly reduced the mRNA expression of ALP, an early marker of osteogenic differentiation (20) (Fig. 3A). The mRNA expression of other osteogenic-associated genes (ie, COLI [21] and RUNX2, an essential transcription factor for
osteoblast differentiation [22]) was also reduced (Fig. 3A). In agreement with the PCR results, hDPCs cultured with either 25 or 50 mmol/L CoCl2 exhibited a significant dose-dependent reduction in ALP activity at 7 and 14 days (Fig. 3B). To investigate whether the inhibitory effect of CoCl2 on osteogenic differentiation was reversible, hDPCs were cultured in OM with 50 mmol/L CoCl2 for 7 days, the CoCl2 was removed, and then the cells were cultured in OM for 7 more days. We found that after CoCl2 was
Figure 3. CoCl2 significantly decreased the osteogenic differentiation of hDPCs. The hDPCs cultured in osteogenic medium with 25 or 50 mmol/L CoCl2. (A) After 7 days of osteogenic induction, the mRNA expression of ALP, RUNX2, and COLI was examined by real-time PCR. Data are shown as relative gene expression compared with the internal control (*P < .05). (B) hDPCs cultured in OM with 25 or 50 mmol/L CoCl2 for 7 or 14 days showed an inhibition of ALP activity. (C) hDPCs cultured in normal culture media supplemented with 50 mmol/L CoCl2 for 7 days and then further cultured in OM alone for 7 days showed increased ALP activity compared with hDPCs cultured in OM with 50 mmol/L CoCl2 for 7 days. (D) Deposition of calcium exhibited by alizarin red staining. hDPCs cultured in OM with either 25 or 50 mmol/L CoCl2 for 28 days showed reduced mineral deposition (*P < .05). Other hDPCs were treated with 50 mmol/L CoCl2 for 7 days, and then the CoCl2 was eliminated from the culture media. hDPCs were further cultured until 28 days. Data were expressed in fold change compared with the control. *P < .05.
4
Laksana et al.
JOE — Volume -, Number -, - 2017
Basic Research—Biology removed, hDPC ALP activity increased compared with the ALP activity of hDPCs cultured in OM with 50 mmol/L CoCl2 for 7 days. These results imply that the effect of CoCl2 was reversible (Fig. 3C). Calcium deposition was evaluated by alizarin red staining. We found that CoCl2 decreased calcium deposition after culturing for 28 days. Similar to the ALP activity assay, after culturing the hDPCs in OM with 50 mmol/L CoCl2 for 7 days, CoCl2 was removed. The cells were cultured in OM until day 28, and calcium deposition was assessed. After culturing hDPCs in OM with and then without CoCl2, the mineral deposition was similar to that of the hDPCs cultured in OM alone (Fig. 3D). These findings suggest that CoCl2 may maintain the stem cell property of hDPCs by inhibiting osteogenic differentiation.
Apigenin Reversed the Inhibitory Effect of CoCl2 in hDPCs CoCl2 imitates hypoxia by stabilizing HIF-a (18). Thus, to investigate whether the inhibitory effect of CoCl2 was mediated by HIF-a, apigenin, which inhibits the expression of HIF-1a (23), was used. After 7 days of osteogenic induction, the decrease in ALP activity of hDPCs cultured with 50 mmol/L CoCl2 was partly rescued when apigenin was added (Fig. 4). This suggests that CoCl2 inhibits osteogenic differentiation, at least in part, via a HIF-a–dependent pathway.
Discussion Hypoxia induces stem cell proliferation and the expression of stem cell marker genes while inhibiting MSC osteogenic differentiation (6, 24, 25). CoCl2-simulated hypoxia also increased MSC proliferation (16). However, studies of the effect of CoCl2 on hDPCs are limited. This is the first study to show the effect of CoCl2 on hDPC stemness. We found that CoCl2 inhibited the proliferation and osteogenic differentiation of hDPCs, whereas stem cell marker mRNA expression and the number of STRO-1+ cells increased. The cytotoxicity of CoCl2 is still unresolved. In our pilot study, we found that 100 mmol/L CoCl2 induced cell death (data not shown). However, previous studies reported using 100 mmol/L CoCl2 when
Figure 4. CoCl2 inhibited osteogenic differentiation through HIF-1a. hDPCs were treated with 50 mmol/L CoCl2 for 7 days. Apigenin, an HIF-1a inhibitor, reversed the inhibitory effect of CoCl2 on ALP activity. The data were expressed in fold change compared with the control. *P < .05.
JOE — Volume -, Number -, - 2017
culturing human periodontal ligament cells, neuroprogenitor cells, and human MSCs (19, 20, 26). This implies that the cytotoxicity of CoCl2 may be cell type dependent. Our MTT assay showed that mimicking hypoxia in vitro using 25–50 mmol/L CoCl2 for 6 days decreased hDPC proliferation. This finding supports the results of a previous study in which CoCl2 suppressed human MSC proliferation via cell cycle alteration (16). This study found that the cell resting phase (G0/G1 phase) was lengthened, and the cell proliferation phase (G2/S/M) was halted. However, we cannot definitively conclude that CoCl2 inhibited DPSC proliferation because the hDPCs are composed of heterogeneous groups of cells and the number of DPSCs is much fewer compared with the total dental pulp composition (4). Flow cytometry revealed that CoCl2 increased the number of STRO-1+ cells, an early MSC marker present in DPSCs (27). Treating hDPCs with CoCl2 significantly increased the number of STRO-1+ cells, similar to that of hDPCs cultured in hypoxia (13, 14). The elevated number of STRO1+ DPCs in the 50 mmol/L CoCl2 group correlated with the increased mRNA expression of the pluripotent REX1, OCT4, SOX2, and NANOG seen in previous studies (28, 29). These results suggest that although CoCl2 inhibits pulp cell proliferation, it selectively enhances hDPC stem cell number. Although similar methods were used in prior studies, there have been conflicting results regarding the effect of hypoxia on stem cell differentiation. In hDPCs, Iida et al (13) found that hypoxia (3% oxygen) inhibited osteogenic differentiation, whereas Li et al (30) showed that hypoxia (5% oxygen) induced cell mineralization. This may be because of differences in the oxygen percentage used in these studies. Additionally, we could not directly compare the concentration of CoCl2 and the oxygen percentage. However, our results correspond with the study by Osathanon et al (19), which found the inhibitory effect of CoCl2 on osteogenic differentiation in human periodontal ligament pulp cells. Here we showed that CoCl2 inhibited the osteogenic differentiation of hDPCs as shown by the reduction in osteogenic-related genes, ALP activity, and calcium deposition. Interestingly, ALP activity and the level of calcium deposition were rescued when CoCl2 was eliminated from the OM. Thus, the effect of CoCl2 on osteogenic differentiation is reversible. CoCl2 might be used to maintain stem cells in vitro because of its reversible effect on inhibiting osteogenic differentiation and by increasing the proportion of stem cells. However, these mechanisms should be investigated. The inhibitory effect of cell differentiation found with CoCl2 treatment may not be the same as that of hypoxia. This is because CoCl2 acts only through HIF-1a, whereas hypoxia mediates a HIF-1a–dependent and –independent pathway (17, 31). However, the results from the present study revealed that apigenin, an HIF-1a expression inhibitor, partly reversed the inhibitory effect of CoCl2 on ALP activity. This suggests that HIF-1a may be involved in the CoCl2-mediated mechanism. However, apigenin is not a specific HIF-1a inhibitor (32). Therefore, further study is needed to confirm that HIF-1a is involved in this mechanism. The current technology in regenerative endodontics requires a cell-based approach. Previous studies have shown that the autologous transplantation of pulpal MSCs induced pulp-dentin regeneration (33, 34). The major disadvantage of cell-based approaches is the availability of stem cells, especially in older patients. Thus, the stem cells need to be extensively expanded in vitro to obtain an adequate cell number. However, this can induce the loss of differentiation capacity (35). Therefore, the use of CoCl2 would be an advantage in the development of a method to increase the number of stem cells without the loss of their capability to differentiate. Future studies are recommended to examine the relationship between the concentration of CoCl2 and the level of oxygen tension as well as the mechanisms wherein CoCl2 affects cell stemness.
Cobalt Chloride and HDPCs
5
Basic Research—Biology Acknowledgments The authors thank Dr Kevin Tompkins for language editing. Supported by the Research Unit of Mineral Tissue, Faculty of Dentistry, Chulalongkorn University, and the 90th anniversary of Chulalongkorn University fund (Ratchadaphiseksomphot Endowment Fund). W.S. was supported by a faculty research grant (DRF 56005), Faculty of Dentistry, Chulalongkorn University. P.P. was supported by the Research Chair Grant 2012, the National Science and Technology Development Agency (NSTDA), Thailand. The authors deny any conflicts of interest related to this study.
References 1. Gronthos S, Mankani M, Brahim J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;97:13625–30. 2. Gronthos S, Brahim J, Li W, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;81:531–5. 3. Koyama N, Okubo Y, Nakao K, Bessho K. Evaluation of pluripotency in human dental pulp cells. J Oral Maxillofac Surg 2009;67:501–6. 4. Sloan AJ, Waddington RJ. Dental pulp stem cells: what, where, how? Int J Paediatr Dent 2009;19:61–70. 5. Stocum DL. Stem cells in regenerative biology and medicine. Wound Repair Regen 2001;9:429–42. 6. D’Ippolito G, Diabira S, Howard GA, et al. Low oxygen tension inhibits osteogenic differentiation and enhances stemness of human MIAMI cells. Bone 2006;39:513–22. 7. Fehrer C, Brunauer R, Laschober G, et al. Reduced oxygen tension attenuates differentiation capacity of human mesenchymal stem cells and prolongs their lifespan. Aging Cell 2007;6:745–57. 8. Whalen WJ, Ganfield R, Nair P. Effects of breathing O 2 or O 2 +CO 2 and of the injection of neurohumors on the PO 2 of cat cerebral cortex. Stroke 1970;1:194–200. 9. Chow DC, Wenning LA, Miller WM, Papoutsakis ET. Modeling pO(2) distributions in the bone marrow hematopoietic compartment. I. Krogh’s model. Biophys J 2001; 81:675–84. 10. Yu CY, Boyd NM, Cringle SJ, et al. Oxygen distribution and consumption in rat lower incisor pulp. Arch Oral Biol 2002;47:529–36. 11. Kozam G. Oxygen tension of rabbit incisor pulp. J Dent Res 1967;46:352–8. 12. Guzy RD, Schumacker PT. Oxygen sensing by mitochondria at complex III: the paradox of increased reactive oxygen species during hypoxia. Exp Physiol 2006; 91:807–19. 13. Iida K, Takeda-Kawaguchi T, Tezuka Y, et al. Hypoxia enhances colony formation and proliferation but inhibits differentiation of human dental pulp cells. Arch Oral Biol 2010;55:648–54. 14. Sakdee JB, White RR, Pagonis TC, Hauschka PV. Hypoxia-amplified proliferation of human dental pulp cells. J Endod 2009;35:818–23. 15. Pacary E, Tixier E, Coulet F, et al. Crosstalk between HIF-1 and ROCK pathways in neuronal differentiation of mesenchymal stem cells, neurospheres and in PC12 neurite outgrowth. Mol Cell Neurosci 2007;35:409–23.
6
Laksana et al.
16. Zeng HL, Zhong Q, Qin YL, et al. Hypoxia-mimetic agents inhibit proliferation and alter the morphology of human umbilical cord-derived mesenchymal stem cells. BMC Cell Biol 2011;12:32. 17. Yuan Y, Hilliard G, Ferguson T, Millhorn DE. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha. J Biol Chem 2003;278:15911–6. 18. Mohyeldin A, Garzon-Muvdi T, Quinones-Hinojosa A. Oxygen in stem cell biology: a critical component of the stem cell niche. Cell Stem Cell 2010;7:150–61. 19. Osathanon T, Vivatbutsiri P, Sukarawan W, et al. Cobalt chloride supplementation induces stem-cell marker expression and inhibits osteoblastic differentiation in human periodontal ligament cells. Arch Oral Biol 2015;60:29–36. 20. Milosevic J, Adler I, Manaenko A, et al. Non-hypoxic stabilization of hypoxiainducible factor alpha (HIF-alpha): relevance in neural progenitor/stem cells. Neurotox Res 2009;15:367–80. 21. Aubin JE. Bone stem cells. J Cell Biochem Suppl 1998;30–31:73–82. 22. Ducy P, Zhang R, Geoffroy V, et al. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747–54. 23. Fang J, Xia C, Cao Z, et al. Apigenin inhibits VEGF and HIF-1 expression via PI3K/ AKT/p70S6K1 and HDM2/p53 pathways. FASEB J 2005;19:342–53. 24. Hung SP, Ho JH, Shih YR, et al. Hypoxia promotes proliferation and osteogenic differentiation potentials of human mesenchymal stem cells. J Orthop Res 2012;30: 260–6. 25. Ranera B, Remacha AR, Alvarez-Arguedas S, et al. Effect of hypoxia on equine mesenchymal stem cells derived from bone marrow and adipose tissue. BMC Vet Res 2012;8:142. 26. Jeon ES, Shin JH, Hwang SJ, et al. Cobalt chloride induces neuronal differentiation of human mesenchymal stem cells through upregulation of microRNA-124a. Biochem Biophys Res Commun 2014;444:581–7. 27. Shi S, Bartold PM, Miura M, et al. The efficacy of mesenchymal stem cells to regenerate and repair dental structures. Orthod Craniofac Res 2005;8:191–9. 28. Szablowska-Gadomska I, Zayat V, Buzanska L. Influence of low oxygen tensions on expression of pluripotency genes in stem cells. Acta Neurobiol Exp (Wars) 2011;71: 86–93. 29. Govindasamy V, Abdullah AN, Ronald VS, et al. Inherent differential propensity of dental pulp stem cells derived from human deciduous and permanent teeth. J Endod 2010;36:1504–15. 30. Li L, Zhu YQ, Jiang L, et al. Hypoxia promotes mineralization of human dental pulp cells. J Endod 2011;37:799–802. 31. Mizukami Y, Kohgo Y, Chung DC. Hypoxia inducible factor-1 independent pathways in tumor angiogenesis. Clin Cancer Res 2007;13:5670–4. 32. Yayama T, Kobayashi S, Kokubo Y, et al. Motion analysis of the wrist joints in patients with rheumatoid arthritis. Mod Rheumatol 2007;17:322–6. 33. Nishina S, Hino K, Korenaga M, et al. Hepatitis C virus-induced reactive oxygen species raise hepatic iron level in mice by reducing hepcidin transcription. Gastroenterology 2008;134:226–38. 34. Mimura K, Kono K, Takahashi A, et al. Vascular endothelial growth factor partially inhibits the trastuzumab-mediated antibody-dependent cellular cytotoxicity of human monocytes. Oncology 2007;72:172–80. 35. Tonooka Y, Mizukami Y, Fujishima M. One-base excess adaptor ligation method for walking uncloned genomic DNA. Appl Microbiol Biotechnol 2008;78: 173–80.
JOE — Volume -, Number -, - 2017