Cognitive and Sensorimotor Gating Impairments in Transgenic Mice Overexpressing the Schizophrenia Susceptibility Gene Tcf4 in the Brain

Cognitive and Sensorimotor Gating Impairments in Transgenic Mice Overexpressing the Schizophrenia Susceptibility Gene Tcf4 in the Brain Magdalena M. Brzózka, Konstantin Radyushkin, Sven P. Wichert, Hannelore Ehrenreich, and Moritz J. Rossner Background: The combined analysis of several large genome-wide association studies identified the basic helix-loop-helix (bHLH) transcription factor TCF4 as one of the most significant schizophrenia susceptibility genes. Its function in the adult brain, however, is not known. TCF4 belongs to the E-protein subfamily known to be involved in neurodevelopment. The messenger RNA expression of Tcf4 is sustained in the adult mouse brain, suggesting a function in the adult nervous system. Tcf4 null mutant mice die perinatally, and haploinsufficiency of TCF4 in humans causes severe mental retardation. Methods: To investigate the possible function of TCF4 in the adult central nervous system, we generated transgenic mice that moderately overexpress TCF4 postnatally in the brain to reduce the risk of developmental effects possibly interfering with adult brain functions. Tcf4 transgenic mice were characterized with molecular, histological, and behavioral methods. Results: Tcf4 transgenic mice display profound deficits in contextual and cued fear conditioning and sensorimotor gating. Furthermore, we show that TCF4 interacts with the neurogenic bHLH factors NEUROD and NDRF in vivo. Molecular analyses revealed the dynamic circadian deregulation of neuronal bHLH factors in the adult hippocampus. Conclusions: We conclude that TCF4 likely acts in concert with other neuronal bHLH transcription factors contributing to higher-order cognitive processing. Moderate transcriptional deregulation of Tcf4 in the brain interferes with cognitive functions and might alter circadian processes in mice. These observations provide insight for the first time into the physiological function of TCF4 in the adult brain and its possible contributions to neuropsychiatric disease conditions. Key Words: bHLH transcription factors, fear conditioning, prepulse inhibition, schizophrenia, Tcf4

N

europsychiatric diseases such as schizophrenia and bipolar spectrum disorders are thought to be based on subtle neurodevelopmental disturbances altering nervous system plasticity leading to brain dysfunction (1). Schizophrenia is a severe mental disorder that manifests in adulthood; has a lifetime risk of approximately 1%; and is characterized by hallucinations, delusions, cognitive deficits, and affective retraction. It has been estimated that genetics might confer up to 80% of the disease risk cooperating with several environmental factors (2,3). The unambiguous identification of the underlying genetic risk factors has proven difficult, due to polygenic contributions (4). Nonetheless, the largest meta-analysis of genomewide association scans performed so far revealed a few highly significant single nucleotide polymorphisms (SNPs) pointing toward novel presumptive susceptibility genes (5,6). Among these was TCF4, a basic helix-loop-helix (bHLH) protein whose function in the adult central nervous system (CNS) is unknown. Genetic analyses in a variety of organisms have revealed that basic bHLH proteins play important roles in the development of the nervous system (7). Although some bHLH proteins show sustained expression in postmitotic neurons throughout lifetime, their respective function in the adult brain largely remains From the Max-Planck Institute of Experimental Medicine (MMB, KR, SPW, HE, MJR), Göttingen, Germany. Address reprint requests to Dr. Moritz J. Rossner, Max-Planck Institute of Experimental Medicine, Hermann-Rein-Strasse 3, 37075 Göttingen, Germany; E-mail: [email protected]. Received Nov 13, 2009; revised Feb 10, 2010; accepted Mar 3, 2010.

0006-3223/$36.00 doi:10.1016/j.biopsych.2010.03.015

elusive. Neuronal bHLH transcriptional activators are heterodimers of ubiquitously expressed E-proteins and cell-type specific bHLH proteins that regulate gene transcription via E-box enhancer elements (7). Negative regulation of bHLH activators is achieved by members of the ID family that lack the basic domain and act as dominant negative factors (8). The precise coordination of the temporal and spatial interplay between positive and negative components of the bHLH protein network influences cell fate decisions and differentiation processes in very different cell types (7–9). In mammals, three E-protein (E2A, TF12, and TCF4) and four ID (ID1-4) protein encoding genes exist. The Neurod family of neuronal bHLH factors comprises three members (NEUROD, NDRF/NEUROD2, and NEX/ NEUROD6), which have been implicated in later stages of neuronal differentiation processes during development and are expressed in the adult CNS (10). Corresponding mouse mutants revealed a high degree of functional redundancy within this family (11). Haploinsufficiency of TCF4 causes mental retardation and Pitt-Hopkins syndrome (12–15). Moreover, a trinucleotide repeat in intron three and an SNP in intron 4 of TCF4 might confer increased risks of developing bipolar disease and schizophrenia, respectively, in adulthood (5,6,16). Thus, whereas severe dysfunctions of TCF4 cause developmental phenotypes, more subtle alterations at the transcript level might predispose to neuropsychiatric symptoms. The function of TCF4 in the adult brain has not been investigated so far. The persistent expression of Tcf4 in the CNS is also prominent in the hippocampus and neocortex, regions known to be important for learning and memory formation (17). To assess TCF4 functions in the adult CNS, we generated transgenic mice that overexpress TCF4 postnatally in the brain and performed behavioral assays. Although Tcf4 transgenic mice do not display a developmental phenotype, we found that fear memory formaBIOL PSYCHIATRY 2010;68:33– 40 © 2010 Society of Biological Psychiatry

34 BIOL PSYCHIATRY 2010;68:33– 40 tion and prepulse inhibition are strongly impaired in these mice. Furthermore, we show that adult-expressed neuronal bHLH factors are expressed in a circadian fashion. The TCF4 overexpression alters the amplitude and the kinetics of this profile, and we observed behavioral alterations at different circadian time points. We hypothesize, that the dynamic interplay of negative and positive neuronal bHLH factors in the adult brain is involved in the regulation of cognitive functions and is disturbed by TCF4 misexpression.

Methods and Materials Mice Mice were bred and maintained at an in-house animal facility. We used Tcf4tg animals and their wildtype littermates of different genetic background as indicated. Only males were used for our studies. Mice were housed in groups of 3–5 in standard plastic cages, with food and water ad libitum. The temperature in the colony room was maintained at 22 ⫾ 1°C in the 12-hour light-dark cycle. For experiments conducted in the light (L) phase (Zeitgeber times [ZT]4 –ZT6), the lights-on was at 8:00 AM. For the experiments performed under the dim red light in the dark phase (D) (ZT17–ZT19), animals were maintained in reversed light cycle with lights on at 8:00 PM. Mice were habituated to the experimental room at least 1 week before behavioral experiments. Before experiments in the D phase, mice were habituated to the reverse light cycle for at least 3 weeks. All behavioral experiments were conducted by an investigator blinded to genotype. All experiments were performed in accordance with the German Animal Protection Law. Tcf4 Transgenic Mice Generation of Thy-1 transgenic mice was essentially performed as described (18) with an N-Flag- and C-TAP-tag modified full-length mouse Tcf4 open reading frame construct. Linearized constructs were injected in FVB/N oocytes followed by implantation into foster animals according to standard procedures. Transgenic offspring were crossed to FVB/N mice and analyzed with Western blots for transgene expression. One line that showed stable expression of the transgenic protein over generations was subjected to further analysis (Tcf4tg). Genotyp ing was performed on tail-biopsy DNA sampled from 3-weekold littermates. For polymerase chain reaction (PCR), TAP-tagspecific primers (s: CATCGTGTTGCGCAAGAGCCGCGG, as: TCATAGCCGTCTCAGCCAACCGC) were used, generating a 140 base pair fragment in transgenic mice. Molecular and Behavioral Analyses Detailed descriptions of materials and methods used for the molecular and behavioral analysis of mice can be found online (Supplement 1). Statistical Analysis Statistical significance was evaluated with Mann–Whitney test, unpaired t test, or 2-way analysis of variance (ANOVA) and Bonferroni post-test when applicable. Significance value was set to p ⬍ .05. Data are shown as mean ⫾ SEM in figures and text if not otherwise stated. The data were analyzed with Prism4 (GraphPad Software, San Diego, California).

Results bHLH Proteins Expressed in the Adult Brain In this study, we aimed at investigating the proposed function of Tcf4 in higher-order cognitive processes such as those underwww.sobp.org/journal

M.M. Brzózka et al. lying learning and memory formation. We first assessed gene expression levels of all E-proteins (Tcfe2a, Tcf4, and Tcf12), the neuronal differentiation factors (Neurod, Ndrf, Nex), and dominant-negative (Id1-4) HLH factors in the adult brain. Inspection of microarray and in situ hybridization databases confirmed that all E-proteins are strongly expressed at early developmental stages and that only Tcf4 shows sustained expression in the adult brain (Figure S1 in Supplement 1). All three related neuronal differentiation factors (Neurod, Ndrf, and Nex) and Id2 and Id4 display sustained expression in the adult brain as well (Figure S1 in Supplement 1). The Tcf4 expression is most prominent in the cerebellum, hippocampus, and cortex and thus overlaps with Neurod, Ndrf, Nex, Id2, and Id4 expression domains (Figure S1 in Supplement 1). Reporter gene assays performed in primary cortical neurons revealed that cotransfection of expression plasmids encoding NEUROD, NDRF, and NEX along with TCF4 strongly enhanced E-box– dependent gene transcription severalfold in a dose-dependent manner (Figure 1A–1C). Co-expression of ID1, 2, or 4 constructs reduced these effects substantially (Figure 1A–1C). Next, we proved interactions of endogenous TCF4 with NEUROD and NDRF in lysates prepared from subregions of the adult brain. We detected interactions of TCF4 with NEUROD in the cerebellum, hippocampus, and—to a weaker extent—also in the cortex (Figure 1D). NDRF was copurified with TCF4 from cerebellar and cortical lysates but not from hippocampus (Figure 1D). From these data, we conclude that TCF4 is most likely the obligate interaction partner of neurogenic and dominant-negative HLH factors coexpressed in the adult brain and thus most likely represents a “nodal point” within this protein interaction network. Overexpression of TCF4 in the Postnatal Brain To assess TCF4 function in the brain, we generated transgenic mice overexpressing full-length TCF4 under control of the Thy1.2 minigene to restrict the expression of the transgene to the postnatal brain (18,19). To facilitate the detection of the transgene-derived protein, a Flag-tag was added to the N-terminus of the Tcf4 open reading frame as well as a TAP-tag on the C-Terminus (Figure 1E). The modified TCF4 protein (TCF4tg) proved to be functional in a reporter gene assay (Figure 1F). Subsequently, the Thy-1-Tcf4Tg construct was injected into FVB/N blastocysts. Transgenic offspring were crossed to FVB/N mice. A mouse line (Tg[Thy-1-Tcf4] 1Mr henceforth referred to as Tcf4tg) stably expressing the transgenic protein for several generations were further crossed with C57Bl/6N mice, and resulting F1-hybrids (FVB/N ⫻ C57Bl/6N) were subjected to biochemical, histological, and behavioral analysis. Quantitative reverse-transcriptase (qRT)-PCR with primers directed against endogenous and transgenic Tcf4 revealed an approximately 1.5-fold overexpression in the hippocampus of Tcf4tg mice (Figure 1G), and we detected elevated expression also in the cortex and amygdala but not in the striatum (Figure S2B in Supplement 1). Western blotting detected the transgene-derived protein in the cortex and hippocampus but not in the cerebellum (Figure 1H). In situ hybridization with radioactive labeled antisense oligonucleotides specific for the transgenic Tcf4 revealed expression in the hippocampus, the neocortex, thalamus, and mesencephalic structures of adult mice (Figure 1I). To assess the onset of transgene expression, we performed Western blot analyses with cortical and hippocampal protein lysates collected at different developmental time points from embryonic Day 17,5 (E17,5) up to 15 months of age (Figure 1J). In Tcf4tg mice, the expression of the transgene is first evident at postnatal Day 2 in

M.M. Brzózka et al.

BIOL PSYCHIATRY 2010;68:33– 40 35

Figure 1. TCF4 interactions and molecular analysis of Tcf4 transgenic mice. (A–C) Luciferase assays monitoring the dose-dependent transcriptional activation of E-box reporter by heterodimers comprising TCF4 and NEUROD (A), TCF4 and NDRF (B), and TCF4 and NEX (C) in primary cultured cortical neurons. Coexpression of the dominant-negative helix-loop-helix (HLH) factors ID1, ID2, and ID4 reduced cooperative effects of TCF4 with NEUROD and NEX by nearly 50% (A,C), whereas only ID1 and ID2 were similarly effective on TCF4/NDRF complexes (B). (D) Coimmunoprecipitation (Co-IP) of TCF4, NEUROD, and NDRF from adult mouse brain lysates detecting interactions of TCF4 and NEUROD as well as between TCF4 and NDRF in vivo. The input for precipitation was probed with ␣-TCF4 (upper panel). The Co-IP fraction was subjected to immunoblot detection with ␣-NEUROD (middle panel) and ␣-NDRF (lowest panel) antibodies, respectively. Arrows indicate specific bands; asterisks show light and heavy chains of the ␣-TCF4 antibody in the IP lanes. (E–J) Generation and molecular analysis of transgenic mice (tg) overexpressing Tcf4 in the brain. (E) Schematic drawing of cloning strategy. The full-length Tcf4 coding region flanked by a Flag at the 5=- and a TAP-tag at the 3= terminus was inserted in the Thy-1 minigene replacing the Thy-1 open reading frame. (F) Reporter gene assay in PC12 cells comparing a native (Tcf4) and tagged Tcf4 construct (Tcf4tg). TCF4 and TCF4tg along with NEUROD activate an E-Box reporter severalfold, and this effect can be efficiently reduced by the dominant negative HLH factor ID1. (G) Quantitative reverse-transcriptase polymerase chain reaction analysis of Tcf4 expression in hippocampus (Hi) samples of tg (n ⫽ 3) and wildtype (wt) littermates (n ⫽ 3). Expression level of total Tcf4 is increased to approximately 1.5-fold in the tg in comparison with control subjects. Data are normalized to ␣-actin. (H) Western blot analysis showing prominent expression of TCF4tg in cortex (Cx) and Hi lysates of adult tg (n ⫽ 3) monitored with ␣-Flag antibody. Cortex lysate of wt mice (n ⫽ 3) was used as a negative control. The ␣-tubulin (␣Tub) is shown as loading standard. (I) In situ hybridization demonstrating expression of the Tcf4 transgene in brains of tg. Wildtype littermates served as control subjects. The (␣-33P) deoxyadenosine triphosphate labeled antisense TAP-tag oligonucleotides were hybridized on sagittal brain sections of adult mice. Representative data from n ⫽ 3 per genotype are shown. (J) Western blot analysis of transgenic and endogenous TCF4 protein expression during different stages of brain development in Tcf4tg mice. The expression onset of TCFtg starts postnatally at postnatal Day 2 (P2) in both Cx and Hi of tg (␣Flag; upper blot panels). The expression of endogenous TCF4 (␣TCF4; central panels) is present in Cx and Hi in all examined developmental stages. The ␣Tub is shown in the lowest panels of blots as a loading standard. Each lane was loaded with 40 ␮g of total protein lysates. RLU, relative luciferase unit; DG, dentate gyrus; Cb, cerebellum; E, embryonic day; M, month(s); CA1, Cornum ammonis 1; CA3, Cornum ammonis 3.

www.sobp.org/journal

36 BIOL PSYCHIATRY 2010;68:33– 40

M.M. Brzózka et al.

Figure 2. Unaltered pain sensitivity and impairment of contextual and cued fear memory in Tcf4tg mice are independent of the genetic background. (A) Performance on the hot plate indicates no difference in pain sensitivity between genotypes in the F1-hybrid background (FVB/N ⫻ C57Bl/6N). (B) In fear conditioning tests with two tone–foot-shock pairings, transgenic F1-hybrid mice showed significant fewer freezings in the contextual (p ⫽ .0112) and cued (p ⫽ .0245) memory task. (C) With five tone–foot-shock pairings performed with F1-hybrids, both genotypes showed similar freezing behavior for context (p ⫽ .2304) and cued (p ⫽ .0616) memory. (D) Performance on the hot plate indicates no difference in pain sensitivity between genotypes in the mice that were backcrossed five times to C57Bl/6N background (N5 ⫻ C57Bl/6N). (E) Fear conditioning with two tone–foot-shock pairings with N5 ⫻ C57Bl/6N mice showed that Tcf4tg mice display strain-independent diminished contextual (p ⫽ .0025) and cued (p ⫽ .0029) fear memory. (F) Fear conditioning with two tone–foot-shock pairings with mice of pure C57Bl/6N background (N10 ⫻ C57Bl/6N) showed impairment of contextual (p ⫽ .0402) and cued (p ⫽ .0002) fear memory in Tcf4tg mice. Values represent mean ⫾ SEM for the indicated numbers of animals: (A) wildtype mice (wt), n ⫽ 16; transgenic mice (tg), n ⫽ 12; (B) wt, n ⫽ 18; tg, n ⫽ 19; (C) wt, n ⫽ 21; tg, n ⫽ 23; (D) wt, n ⫽ 19; tg, n ⫽ 15; (E) wt, n ⫽ 20; tg, n ⫽ 15; (F) wt, n ⫽ 14; tg, n ⫽ 15. *p ⬍ .05; **p ⬍ .01; ***p ⬍ .001. Significance values refer to Mann–Whitney test.

the hippocampus and in the cortex (Figure 1J). Expression of the transgene remains constant in the hippocampus until late adulthood, whereas at the same time expression was reduced in the cortex. The expression of endogenous TCF4 was prominent in all examined stages of development (Figure 1J). We next performed histological and immunohistochemical analyses with neuronal and synaptic markers to assess whether the moderate postnatal overexpression of TCF4 might have caused structural abnormalities in Tcf4tg mice (Figures S3A and S3B in Supplement 1). This analysis revealed that the hippocampal formation remains unaltered in transgenic mice and all regions of the hippocampus are properly formed (Figure S3A in Supplement 1). The arrangement of cortical layers in transgenic mice is indistinguishable from wildtype control subjects (Figure S3B in Supplement 1). In situ hybridization with 33P-labeled specific probes directed against the messenger RNA (mRNA) of the major myelin component proteolipid protein and immunostaining against cyclic nucleotide phosphodiesterase did not reveal any alteration in oligodendrocyte abundance or myelination (data not shown). Behavioral Analysis of Tcf4tg Mice A standardized battery of behavioral tests with male FVB/N ⫻ C57Bl/6N F1 hybrid Tcf4tg mice and their wildtype littermates revealed that Tcf4tg mice showed similar activity, exploratory, motor, and motivational behavior when compared with control subjects (Figures S3C–S3M in Supplement 1). We next tested spatial learning in a water maze task. The visible platform test indicated proper visual perception of Tcf4tg mice (Figure S4A in Supplement 1). We did not observe any significant differences in the initial and reversal learning tasks as well as in the probe trials www.sobp.org/journal

monitoring for spatial memory formation (Figures S4B–S4F in Supplement 1). Only on the first and second day of the reversal training, we observed greater escape latencies in transgenic mice that might indicate slight impairment in cognitive flexibility [2-way ANOVA Day 2: effect of genotype F (1,114) ⫽ 5.47; p ⫽ .0247] (Figures S4D and S4E in Supplement 1). Altered Fear Memory Formation and Sensorimotor Gating As a control for pain sensitivity and peripheral sensory processing, we applied the hot plate assay to F1-hybrid mice that did not reveal differences between the genotypes (Figure 2A). Next, we analyzed contextual and cued fear memory formation with two (Figure 2B) and five (Figure 2C) foot-shock tone pairings with F1-hybrids. Upon two foot-shocks, Tcf4tg mice showed significantly reduced freezing in the contextual and cue memory tests (p ⬍ .05 for both conditions) (Figure 2B). The impairment of fear memory was masked upon strong stimulation with five foot-shocks as assessed with an independent cohort (Figure 2C). To examine a potential influence of the genetic background, we performed fear memory tests with cohorts of Tcf4tg mice that were backcrossed to the C57Bl6/N background 5 and 10 times (N5 and N10 ⫻ C57Bl/6N, respectively). Similar to the F1-hybrids, C57Bl/6N-backcrossed Tcf4tg mice performed normally in the hot plate assay (Figure 2D) yet displayed impaired contextual (N5: p ⬍ .01; N10: p ⬍ .05) and cued (N5: p ⬍ .01; N10: p ⬍ .001) fear memory formation (Figures 2E and 2F). Thus, the impairment of fear memory formation seems to be independent from the genetic background. Because of the possible implication of TCF4 in schizophrenia (5,6), we analyzed sensorimotor gating with the prepulse inhibition test. Prepulse

BIOL PSYCHIATRY 2010;68:33– 40 37

M.M. Brzózka et al.

Figure 3. Tcf4tg mice show deficits in sensorimotor gating. (A) Tcf4tg mice are impaired in the prepulse inhibition. Two-way analysis of variance showed significant effect of genotype [F(1,48) ⫽ 4,56; p ⫽ .0431]; Bonferroni post hoc analysis revealed significant differences at 75 dB (p ⫽ .019). (B) Startle response to 120-dB tone is similar in Tcf4tg mice and control animals (p ⫽ .3299; Mann–Whitney test). Values represent mean ⫾ SEM for the indicated numbers of animals: (A) and (B) wildtype mice (wt), n ⫽ 15; transgenic mice (tg), n ⫽ 15. AUs, arbitrary units.

inhibition was impaired in Tcf4tg mice (Figure 3A) as revealed by 2-way ANOVA [effect of genotype F (1,48) ⫽ 4.56; p ⫽ .0431], most prominent at 75 dB prepulse (p ⫽ .019; Bonferroni posttest). The startle response to a 120-dB tone was unaltered between the genotypes (Figure 3B). In summary, Tcf4tg mice are impaired in distinct cognitive processes and in sensorimotor gating. Dynamic Deregulation of Neuronal bHLH Factors To identify possible molecular correlates for the behavioral impairments seen in Tcf4tg mice, we performed a microarray analysis with RNA isolated from hippocampi of adult transgenic and wildtype mice. In accordance with the subtle overexpression, we detected only a few transcripts that were significantly different between the genotypes (data not shown). We could only validate, among four candidates that were selected for further evaluation, the approximately 1.5-fold upregulation of Per2 by qRT-PCR in hippocampus samples obtained from an independent cohort of mice (data not shown). Per2 is a component of the molecular clock and is expressed in a circadian manner in the suprachiasmatic nucleus (20,21) and in the hippocampus and cortex (22,23). Due to the daytime-dependent expression in the forebrain, we next collected hippocampi from both genotypes at precise 4-hour intervals at different ZTs from animals that were housed under constant 12-hour L and 12-hour D conditions. With qRT-PCR, we first determined the relative level of Actb (␣-actin) expression that remained unaltered over all time points and served as internal control to verify proper normalization (Figure S5A in Supplement 1). Next, we monitored the expression of the activity-regulated gene Fos, known to be strongly increased during the D phase (where mice are awake and active) (Figure S5A in Supplement 1). The circadian regulation of Per2 mRNA with a trough in L and peak in D was seen in wildtype as well as Tcf4tg mice; however, the expression level was significantly elevated in Tcf4tg mice in most time points examined (Figure S5B in Supplement 1). This corroborated our previous observation from the hippocampal samples, which were not isolated in a precisely timed manner, likely representing the averaged overall difference at the beginning of L. The expression of the dominant-negative HLH factor Id2 was also increased at several time points in Tcf4tg mice and showed a circadian regulation peaking at the DL transition (Figure S5C in Supplement 1). The neurogenic bHLH factors Neurod, Ndrf,

and—to a lesser extent—also Nex displayed daytime-dependent expression differences with a trough close to the DL transition (Figures S5D–S5F in Supplement 1). We validated this so-far unknown circadian expression pattern in an independent cohort of wildtype mice (Figure S6 in Supplement 1). Remarkably, the peak of Id2 expression overlapped with the trough of Neurod (Figures S5C and S5D in Supplement 1). The level of Neurod was significantly decreased in Tcf4tg mice only at the end of D, whereas Ndrf expression seems to be phase-shifted (Figure S5E in Supplement 1). Because the transcriptional regulation of bHLH factors is thought to be mediated by a balance of negatively and positively acting family members at a given time point (7–9), we also plotted the Neurod/Ndrf/Nex and Id2 expression ratios, clearly depicting the amplitude (Neurod: Id2) and phase (Ndrf: Id2) differences in Tcf4tg versus wildtype mice (Figures S5G and S5H in Supplement 1). Taken together, the overexpression of TCF4 alters the circadian gene expression profile of neuronal bHLH factors and that of the clock gene Per2 in the hippocampus, which indicates that TCF4 possibly regulates distinct circadian aspects in the forebrain. Daytime-Dependent Differences in Behavior We hypothesized— on the basis of the deregulated circadian expression of neuronal bHLH factors in Tcf4tg mice, particularly at the end of the activity period—that daytime-dependent behaviors might be differentially affected between Tcf4tg and wildtype mice. Therefore, we performed selected behavioral tests at ZT17–19 (compared with the previous tests at ZT4 – 6) (Figure 4A). We analyzed Tcf4tg and wildtype F1-hybrids in open field behavior and fear memory formation under dim red light at ZT17–19 (Figures 4B– 4E). The total spontaneous activity and traveled distance in the open field did not differ between genotypes when analyzed at late D (Figure 4B and 4C). However, the relative time mice spent in the center versus the periphery was slightly but significantly different, with Tcf4tg mice spending less time in the center (p ⫽ .0259), indicating an altered level of anxiety that was not apparent at ZT4 – 6 (Fig. 4D and Figure S3E in Supplement 1). Contextual and cued fear memory formation in F1-hybrids were also slightly altered when performed at ZT17–19 (Figure 4E) and compared with the analysis at ZT4 – 6. The genotype differences at D were not significantly altered for the context (although a tendency toward a lower freezing rate was still observed in Tcf4tg mice, p ⫽ .07) (Figure 4E). In contrast, cue memory formation was even more pronounced and highly significantly different between the genotypes (p ⫽ .0001) (Figure 4E).

Discussion Behavioral Deficits in Tcf4tg Mice TCF4 is the only E-protein of the bHLH transcription factor family expressed in the adult forebrain and is most likely the obligatory interaction partner for coexpressed neuron-specific bHLH proteins (7–9). We could show that TCF4 interacts with the neuronal bHLH factors NEUROD and NDRF in vivo and is required for transcriptional activation in reporter gene assays performed in neuronal cells. TCF4 thus might represent a nodal point in the neuronal bHLH network operating in the adult forebrain. To address the TCF4 function in the brain, we generated and analyzed transgenic mice that moderately overexpress (approximately 1.5-fold) Tcf4 in forebrain structures known to be involved in cognitive processing. Tcf4tg mice do not display any alterations in activity, exploratory, and motor behavior as well as www.sobp.org/journal

38 BIOL PSYCHIATRY 2010;68:33– 40

M.M. Brzózka et al.

Figure 4. Daytime-dependent behavior in Tcf4tg mice. (A) Schematic drawing of time frames of experiments performed during the light (L) (between ZT4-6) and dark (D) phases (ZT17–19). Experiments in the D phase were performed under dim red light. (B–D) Open field test in the D phase (ZT17–ZT19). The Tcf4tg and control mice showed similar motor activity (B) and traveled comparable distance (C) during the test. (D) Mutant mice spent significantly more time in the periphery of open field when compared with wildtype (wt) littermates (p ⫽ .0259). (E) When analyzed in the D phase, Tcf4tg mice did not show significantly less freezings in the contextual paradigm when compared with wt control subjects (p ⫽ .0736); however, a tendency of reduced memory was detected. In contrast, cued fear memory formation was highly significantly reduced in Tcf4tg mice (p ⫽ .0001). Values represent mean ⫾ SEM for the indicated numbers of animals: (BⴚD) wt, n ⫽ 22; transgenic mice (tg), n ⫽ 28; (E) wt, n ⫽ 22; tg, n ⫽ 27. *p ⬍ .05; ***p ⬍ .001. Significance values refer to Mann–Whitney test.

in pain sensitivity. In addition, we could not detect apparent histological alterations of brain structures. However, fear memory formation was substantially impaired in Tcf4tg mice. Increasing the aversive stimulus in fear conditioning with five tone–footshock pairings led to the so-called “ceiling effect” where the genotype differences in the contextual and cued fear memory tests were reduced. This implies that in Tcf4tg mice the neuronal networks required for these associative learning tasks retain a certain level of plasticity. Furthermore, sensorimotor gating monitored in the prepulse inhibition paradigm was significantly reduced in Tcf4tg mice. Sensorimotor gating has been shown to be reduced in schizophrenic patients and psychiatric mouse models (24 –26). Taken together, Tcf4tg mice display some behavioral deficits that parallel features frequently observed in psychiatric disease conditions (27). Behavioral phenotypes in mice are, however, often restricted to a defined genetic background (28). We could show that the impaired fear memory formation was robust against alterations in the variability of the genetic background, which might be of relevance in the context of the genetic heterogeneity seen in human patient collectives. We detected elevated Tcf4 expression levels in the hippocampus and amygdala, regions known to be important for fear memory formation (29); but because the transgenic Tcf4 expression is not strictly overlapping with the endogenous expression patterns, we cannot formally rule out that the ectopic expression might contribute to the behavioral phenotypes. Deregulation of Circadian Gene Expression In an attempt to identify deregulated genes in the hippocampus of Tcf4tg mice, we found the clock gene Per2 to be upregulated and validated this observation in independent cohorts of mice with different genetic backgrounds. PER2 is a key element of the molecular clock, and its mRNA oscillates in the suprachiasmatic nucleus and in the hippocampus and cortex (21–23). This finding prompted us to hypothesize that the rather moderate overexpression of Tcf4 might have altered the circawww.sobp.org/journal

dian gene expression profile in the hippocampus. The qRT-PCR analyses performed with precisely timed samples supported this assumption. Per2 expression level was elevated in Tcf4tg at most examined time points. Moreover, we found that other adultexpressed neuronal HLH factors are dynamically regulated with circadian kinetics in the hippocampus and that their daytimedependent expression profiles were altered in Tcf4tg mice. The expression profile of the dominant negative factor Id2 (with a peak at the DL transition and trough at the LD transition) is essentially inverted when compared with the neuronal bHLH factor Neurod. The amplitude of Id2 expression was elevated in Tcf4tg mice, and it has been shown that TCF4 can interact with ID2 and activate the Id2 promoter in cell culture (17,30). It should be noted that ID2 itself is an entrainment factor of the circadian system and can directly interfere with BMAL:CLOCK and possibly also with BMAL:NPAS2 dimerization, which are considered as the main forebrain clock components (31). These observations in conjunction with our data thus suggest that ID2 and TCF4 might link circadian- and plasticity-regulated gene expression in forebrain structures. Further experiments are certainly required to obtain more mechanistic insight supporting this assumption. The neuronal bHLH factors Ndrf and Nex were also deregulated in Tcf4tg mice in a circadian fashion. Interestingly, heterozygous Ndrf mutant mice have deficits in fear memory formation (32). This finding additionally supports the assumption that the precise control of gene dosage within the neuronal bHLH network seems to be critical for aspects of proper cognitive processing. Moreover, recent reports show that circadian mechanisms and cognitive performance are interconnected processes (33,34). Schizophrenia and bipolar spectrum disorders all display episodic characteristics such as severely altered sleepwake behavior that might reflect a circadian component (35–37). TCF4 Dysfunction and Neuropsychiatric Diseases Haploinsufficiency of TCF4 has been shown to cause PittHopkins syndrome, a severe epileptic encephalopathy with

BIOL PSYCHIATRY 2010;68:33– 40 39

M.M. Brzózka et al. mental retardation and intermittent hyperventilation (12–15), showing the importance of a proper gene dosage and tight control of TCF4 gene expression during brain development. Furthermore, common genetic variability in the TCF4 gene has been associated with neuropsychiatric disease conditions. An extended CTG repeat in the third intron of TCF4 might be associated with bipolar disorder in the homozygous situation (16). Likewise, an SNP in intron 4 of the TCF4 gene might confer an increased risk of schizophrenia (5,6). Remarkably, the association with this SNP was among the most statistically significant findings in a meta-analysis of the largest genome-wide association study conducted so far, with 12,945 schizophrenic cases and 34,591 control subjects (6). It thus seems possible that TCF4 polymorphisms, which do not cause haploinsufficiency and thus do not lead to overt developmental alterations, rather interfere with the proper function and fine-tuning of neuronal networks that are important for cognitive performance and affective behavior in adulthood. Our findings obtained with transgenic mice that moderately overexpress Tcf4 in the postnatal brain support this hypothesis. However, it might be possible that changes in neuronal connectivity caused by early postnatal overexpression of Tcf4 could contribute to the observed phenotypes. Alterations in intron 3 and 4 of TCF4 that have been associated with an increased risk of bipolar diseases and schizophrenia might cause an increase or decrease in TCF4 expression levels. Because Tcf4 null mutant mice die perinatally and display neurodevelopmental deficits (38 – 40), the analysis of appropriate conditional mouse mutants will certainly be helpful to further understand the function of TCF4 in cognitive processes and its contributions to psychiatric diseases.

11.

12.

13.

14.

15.

16.

17.

18.

19. 20.

This study was supported by the Max-Planck-Society, a stipend of the Deutsche Forschungsgemeinschaft to MMB (GRK 632), and a grant of the European Union to MJR (LSHM-CT2005-018637). We would like to acknowledge the expert technical support by Carolin Stünkel and Harry Scherer and KlausArmin Nave, Sergi Papiol, Peter Falkai, and Andrea Schmitt for stimulating discussions and feedback. The authors report no biomedical financial interests or potential conflicts of interest.

21.

Supplementary material cited in this article is available online.

25.

1. van Os J, Kapur S (2009): Schizophrenia. Lancet 374:635– 645. 2. Williams HJ, Owen MJ, O’Donovan MC (2009): Schizophrenia genetics: New insights from new approaches. Br Med Bull 91:61–74. 3. Cardno AG, Gottesman II (2000): Twin studies of schizophrenia: From bow-and-arrow concordances to star wars Mx and functional genomics. Am J Med Genet 97:12–17. 4. Purcell SM, Wray NR, Stone JL, Visscher PM, O’Donovan MC, Sullivan PF, et al. (2009): Common polygenic variation contributes to risk of schizophrenia and bipolar disorder. Nature 460:748 –752. 5. Shi J, Levinson DF, Duan J, Sanders AR, Zheng Y, Pe’Er I, et al. (2009): Common variants on chromosome 6p22.1 are associated with schizophrenia. Nature 460:753–757. 6. Stefansson H, Ophoff RA, Steinberg S, Andreassen OA, Cichon S, Rujescu D, et al. (2009): Common variants conferring risk of schizophrenia. Nature 460:744 –747. 7. Bertrand N, Castro DS, Guillemot F (2002): Proneural genes and the specification of neural cell types. Nat Rev Neurosci 3:517–530. 8. Ruzinova MB, Benezra R (2003): Id proteins in development, cell cycle and cancer. Trends Cell Biol 13:410 – 418. 9. Massari ME, Murre C (2000): Helix-loop-helix proteins: Regulators of transcription in eucaryotic organisms. Mol Cell Biol 20:429 – 440. 10. Schwab MH, Druffel-Augustin S, Gass P, Jung M, Klugmann M, Bartholomae A, et al. (1998): Neuronal basic helix-loop-helix proteins (NEX, neu-

22. 23.

24.

26.

27. 28.

29.

30. 31.

32.

33.

roD, NDRF): Spatiotemporal expression and targeted disruption of the NEX gene in transgenic mice. J Neurosci 18:1408 –1418. Schwab MH, Bartholomae A, Heimrich B, Feldmeyer D, Druffel-Augustin S, Goebbels S, et al. (2000): Neuronal basic helix-loop-helix proteins (NEX and BETA2/Neuro D) regulate terminal granule cell differentiation in the hippocampus. J Neurosci 20:3714 –3724. Zweier C, Peippo MM, Hoyer J, Sousa S, Bottani A, Clayton-Smith J, et al. (2007): Haploinsufficiency of TCF4 causes syndromal mental retardation with intermittent hyperventilation (Pitt-Hopkins syndrome). Am J Hum Genet 80:994 –1001. Zweier C, Sticht H, Bijlsma EK, Clayton-Smith J, Boonen SE, Fryer A, et al. (2008): Further delineation of Pitt-Hopkins syndrome: Phenotypic and genotypic description of 16 novel patients. J Med Genet 45:738 –744. Amiel J, Rio M, de Pontual L, Redon R, Malan V, Boddaert N, et al. (2007): Mutations in TCF4, encoding a class I basic helix-loop-helix transcription factor, are responsible for Pitt-Hopkins syndrome, a severe epileptic encephalopathy associated with autonomic dysfunction. Am J Hum Genet 80:988 –993. Kalscheuer VM, Feenstra I, Van Ravenswaaij-Arts CM, Smeets DF, Menzel C, Ullmann R, et al. (2008): Disruption of the TCF4 gene in a girl with mental retardation but without the classical Pitt-Hopkins syndrome. Am J Med Genet A 146A:2053–2059. Del-Favero J, Gestel SV, Borglum AD, Muir W, Ewald H, Mors O, et al. (2002): European combined analysis of the CTG18.1 and the ERDA1 CAG/CTG repeats in bipolar disorder. Eur J Hum Genet 10:276 –280. Chiaramello A, Soosaar A, Neuman T, Zuber MX (1995): Differential expression and distinct DNA-binding specificity of ME1a and ME2 suggest a unique role during differentiation and neuronal plasticity. Brain Res Mol Brain Res 29:107–118. Rossner MJ, Hirrlinger J, Wichert SP, Boehm C, Newrzella D, Hiemisch H, et al. (2006): Global transcriptome analysis of genetically identified neurons in the adult cortex. J Neurosci 26:9956 –9966. Caroni P (1997): Overexpression of growth-associated proteins in the neurons of adult transgenic mice. J Neurosci Methods 71:3–9. Albrecht U, Sun ZS, Eichele G, Lee CC (1997): A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light. Cell 91:1055–1064. Shearman LP, Zylka MJ, Weaver DR, Kolakowski LF Jr, Reppert SM (1997): Two period homologs: Circadian expression and photic regulation in the suprachiasmatic nuclei. Neuron 19:1261–1269. Reick M, Garcia JA, Dudley C, McKnight SL (2001): NPAS2: An analog of clock operative in the mammalian forebrain. Science 293:506 –509. Shieh KR, Yang SC, Lu XY, Akil H, Watson SJ (2005): Diurnal rhythmic expression of the rhythm-related genes, rPeriod1, rPeriod2, and rClock, in the rat brain. J Biomed Sci 12:209 –217. Braff DL, Geyer MA (1990): Sensorimotor gating and schizophrenia. Human and animal model studies. Arch Gen Psychiatry 47:181–188. Radyushkin K, Hammerschmidt K, Boretius S, Varoqueaux F, El-Kordi A, Ronnenberg A, et al. (2009): Neuroligin-3-deficient mice: Model of a monogenic heritable form of autism with an olfactory deficit. Genes Brain Behav 8:416 – 425. Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, et al. (2002): Neuregulin 1 and susceptibility to schizophrenia. Am J Hum Genet 71:877– 892. Flint J, Shifman S (2008): Animal models of psychiatric disease. Curr Opin Genet Dev 18:235–240. Wolfer DP, Lipp HP (2000): Dissecting the behaviour of transgenic mice: Is it the mutation, the genetic background, or the environment? Exp Physiol 85:627– 634. Maren S (2008): Pavlovian fear conditioning as a behavioral assay for hippocampus and amygdala function: Cautions and caveats. Eur J Neurosci 28:1661–1666. Neuman K, Nornes HO, Neuman T (1995): Helix-loop-helix transcription factors regulate Id2 gene promoter activity. FEBS Lett 374:279 –283. Duffield GE, Watson NP, Mantani A, Peirson SN, Robles-Murguia M, Loros JJ, et al. (2009): A role for Id2 in regulating photic entrainment of the mammalian circadian system. Curr Biol 19:297–304. Lin CH, Hansen S, Wang Z, Storm DR, Tapscott SJ, Olson JM (2005): The dosage of the neuroD2 transcription factor regulates amygdala development and emotional learning. Proc Natl Acad Sci U S A 102:14877– 14882. Chaudhury D, Colwell CS (2002): Circadian modulation of learning and memory in fear-conditioned mice. Behav Brain Res 133:95–108.

www.sobp.org/journal

40 BIOL PSYCHIATRY 2010;68:33– 40 34. Eckel-Mahan KL, Phan T, Han S, Wang H, Chan GC, Scheiner ZS, Storm DR (2008): Circadian oscillation of hippocampal MAPK activity and Camp: Implications for memory persistence. Nat Neurosci 11:1074 –1082. 35. Harvey AG (2008): Sleep and circadian rhythms in bipolar disorder: Seeking synchrony, harmony, and regulation. Am J Psychiatry 165:820 – 829. 36. McClung CA (2007): Circadian genes, rhythms and the biology of mood disorders. Pharmacol Ther 114:222–232. 37. Boivin DB (2000): Influence of sleep-wake and circadian rhythm disturbances in psychiatric disorders. J Psychiatry Neurosci 25:446 – 458.

www.sobp.org/journal

M.M. Brzózka et al. 38. Bergqvist I, Eriksson M, Saarikettu J, Eriksson B, Corneliussen B, Grundstrom T, Holmberg D (2000): The basic helix-loop-helix transcription factor E2-2 is involved in T lymphocyte development. Eur J Immunol 30:2857–2863. 39. Flora A, Garcia JJ, Thaller C, Zoghbi HY (2007): The E-protein Tcf4 interacts with Math1 to regulate differentiation of a specific subset of neuronal progenitors. Proc Natl Acad Sci U S A 104:15382–15387. 40. Zhuang Y, Cheng P, Weintraub H (1996): B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB. Mol Cell Biol 16:2898 –2905.