Collagen I enhances functional activities of human monocyte-derived dendritic cells via discoidin domain receptor 2

Cellular Immunology 278 (2012) 95–102

Contents lists available at SciVerse ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

Collagen I enhances functional activities of human monocyte-derived dendritic cells via discoidin domain receptor 2 Barun Poudel a, Dong-Sik Yoon a, Jeong-Heon Lee b, Young-Mi Lee c, Dae-Ki Kim a,⇑ a

Department of Immunolgy and Institute of Medical Sciences, Chonbuk National University Medical School, Jeonju, Jeonbuk 561-756, Republic of Korea Department of Obstetrics and Gynecology, Chonbuk National University Medical School, Jeonju, Jeonbuk 561-756, Republic of Korea c Department of Oriental Pharmacy, College of Pharmacy, Wonkwang University, Iksan, Jeonbuk 570-749, Republic of Korea b

a r t i c l e

i n f o

Article history: Received 27 April 2012 Accepted 16 July 2012 Available online 3 August 2012 Keywords: Human monocyte-derived dendritic cells Collagen Discoidin domain receptors Interleukin-12 Maturation Melanoma

a b s t r a c t We evaluated the involvement of collagen and their discoidin domain receptors (DDRs), DDR1 and DDR2, on the activation of human monocyte-derived dendritic cells (hDCs). DDR2 was markedly expressed on mature hDCs in comparison to immature ones. Collagen I enhanced the release of IL-12p40, TNF-a and IFN-c by hDCs. Additionally, hDCs exhibited enhanced expression of costimulatory molecules, and potent functional activities which, in turn, has therapeutic value. Interestingly, DDR2 depletion showed decrease in capacity of hDCs to stimulate T cells proliferation, whereas DDR1 silencing had no significant affect. These data demonstrate that DDR2 enhances hDCs activation and contributes to their functional activities. In addition, application of collagen I treated dendritic cells (DCs) vaccine reduced tumor burden giving longer survival in melanoma mice. Our study suggests that collagen I may enhance functional activities of DCs in immune response. Ó 2012 Elsevier Inc. All rights reserved.

1. Introduction Dendritic cells (DCs) were first identified by their unique morphological characteristics. Later they were found to stimulate mixed leukocyte reaction (MLR) and effector T-cell response [1–4]. DCs are located in peripheral tissues and lymphoid organs. To elicit immunity, DCs undergo a maturation process, a transformation from antigen-capturing DCs into antigen presenting cells (APCs). This process accompanies changes in morphology, such as loss of adhesion molecules, reorganization of the cytoplasm, and increased cellular motility, and secretion of different chemokines and cytokines. Moreover, there is an increase in expression levels of cell surface major histocompatibilty complex (MHC) class I and II, and co-stimulatory molecules, such as CD40, CD80, CD86 and CD83 [5,6]. All these events provide the DCs with an exceptional ability for T cell stimulation and form the basis for DCs vaccines. In order to stimulate T cells, activated DCs migrate to lymphoid organs via extracellular matrix (ECM), which is composed of several molecules such as collagen, fibronectin and laminin. Several studies have revealed the functions of murine DCs and their interaction with T cells using in vitro studies without ECM [7,8]. In contrast, some studies show that the ECM as well as the structure of Abbreviations: hDCs, human dendritic cells; DDR, discoidin domain receptor; IL-12, interleukin 12. ⇑ Corresponding author. Fax: +82 63 855 6807. E-mail address: [email protected] (D.-K. Kim). 0008-8749/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.cellimm.2012.07.004

lymphoid organs plays a crucial role in interaction between DCs and T cells. It has been reported that the 3D structure of lymph node is important in positioning of cells, movement of T cells towards DCs, and for motility upon cell–cell interaction. Moreover, the ECM acts as a natural environment for interaction between DCs and T cells and allows the cells to migrate, proliferate and differentiate [7–11]. The cellular attachment of many ECM proteins is mediated by certain receptors, such as VLA (a1–6 chains of b1 integrins) [12–14]. It is reported that human derived DCs express no any b1 integrins collagen receptors [15], suggesting that the DCs maturation process mediated by collagen I possibly relies on some other receptors. Discoidin domain receptors (DDRs), DDR1 and DDR2, are next widely expressed collagen receptors in vertebrates. DDR1 is found on epithelial cells whereas DDR2 is expressed in mesenchymal derived cells [16,17]. DDR1 functions in several organs and regulates cellular morphology, proliferation and differentiation [18]. Whereas DDR2 is found to have a crucial role in ECM remodeling during cellular morphogenesis and tissue repair process [19]. However, potential role of DDRs in DCs activation is still not clear. In a previous study, we showed that DDR2 functions as a critical collagen receptor of mouse bone marrow derived DCs activation and their interaction upregulates their functional capacity [20]. This study investigates the role of DDRs on antigen presenting activity of human DCs (hDCs) and demonstrates that DDR2 mediates hDCs activation and functional capacity of hDCs is enhanced

96

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

by the DDR2-collagen I interaction. Furthermore, we show that use of collagen I treated DCs vaccination resulted in increased survival rate in tumor challenged mice.

using primers listed in Table 1, according to previously described reports [21,22].

2. Materials and methods

2.4. Flow cytometric analysis

2.1. Mice

Expression of cell surface antigens of hDCs was evaluated by using a FACS Calibur (Beckton-Dickinson, San Diego, CA). The cells were washed in PBS containing 0.1% sodium azide and incubated on ice for 20 min and then with the relevant antibodies. Following antibodies were used: FITC-conjugated anti-DDR1 from Santa Cruz, CA; FITC-conjugated anti-DDR2 from R&D Systems, MN; FITCconjugated anti-CD14 from eBioscience, San Diego, CA; and CD83, PE-conjugated anti CD11C, PE-conjugated anti-CD86, PE-Cy7-conjugated anti-HLA-DR or PE-Cy7-conjugated anti-CD1a from BD Pharmingen, San Diego, CA. Data are interpreted in histograms and mean-fluorescence intensity (MFI).

Female C57BL/6 mice (age, 8–10 weeks) were purchased from Samtaco (Seoul, Korea). All animal studies were performed in accordance with the protocol approved by the Institutional Animal Care and Use of Committee of Chonbuk National University Medical School. B16BL6 cells were obtained from Korean Cell Line Bank (Seoul, Korea). DCs pulsed with the melanoma cells lysates in the presence of collagen, or TNF-a, or LPS, for 24 h, were injected into the tail vein of mice. Pulsed DCs (each 5  105) were transplanted twice in 2 weeks after introduction of tumor cells (105) and then the survival effect was compared. The mice were sacrificed at day 15 after the injection of cells. Subsequently, their lungs were excised and their sections were analyzed by hematoxylin–eosin stain (100). 2.2. Isolation of monocytes, and generation of monocyte derived DCs Heparin (250 unit/10 ml blood) treated human umbilical cord blood was obtained from Department of Obstetrics, Chonbuk National University Hospital. Monocytes were purified from the blood using RosetteSep™ Human Monocytes Enrichment Cocktail (Stemcell Tech., Vancouver, Canada), according to the manufacturer’s instruction. To establish DCs, purified monocytes were cultured in Stemline II Hematopoietic Stem Cell Expansion Medium (Sigma–Aldrich, St. Louis, MO) containing 50 lM 2mercaptoethanol and 100 lg/ml penicillin/streptomycin, and supplemented with 100 ng/ml rhGM-CSF (ATGen, Gyenggi-do, Korea), and 10 ng/ml IL-4 (eBioscience, San Diego, CA). The complete medium exchange was carried out every 2 days by gently swirling the plates. On day 6, non-adherent and loosely attached cells consisting of immature DCs were CD11c positive (>90%). The cells were incubated with serum free medium containing 100 ng/ml rhGM-CSF on a collagen I (Sigma) coated (10.5 lg/cm2) or non-coated plates until the indicated time points. 2.3. Reverse transcription PCR and quantitative real-time PCR assay Total RNA was isolated from cells using TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. cDNA synthesis was performed using iScript cDNA synthesis kit (Bio-Rad Inc., Hercules, CA). Forward and reverse primers used were listed in Table 1. Cycling temperatures were as follows: denaturing at 95 °C for 30 s; annealing at 58 °C for 30 s; and extension at 72 °C for 60 s. Amplified products were run on a 1.2% agarose gel and photographed. Quantitative real-time PCR was performed

2.5. Antigen uptake by hDCs In order to measure antigen uptake activity of immature hDCs, Fluorescein-isothiocynate (FITC)–dextran (Sigma–Aldrich, St. Louis, CA) was used. After 90 min of incubation of the cells with FITC–dextran (100 lg/ml) at 37 °C or 4 °C (as negative control), cells were washed with ice cold PBS containing 0.1% sodium azide, stained with PE conjugated and PE-Cy7-conjugated antibodies, washed again with ice cold PBS containing 0.1% sodium azide, and analyzed by flow cytometry. Data are presented as histograms and MFI (37 °C MFI/4 °C MFI).

2.6. Cytokine release analysis by ELISA hDCs were seeded on collagen I coated or non-coated plates. After incubation for 48 h, supernatants were collected and subjected to measure IL-12 (p40), IFN-c, and TNF-a levels by commercial ELISA kit (Biolegend, San Diego, CA), according to the manufacturer’s instructions. Similarly, LPS (10 ng/ml) was treated to the DCs and incubated for 24 h. Then supernatant was subjected to measure the above stated cytokines with the same ELISA kit. The micro plates were incubated overnight at 4 °C with capture antibody and then blocked with ELISA buffer containing 50 mM Tris– HCl (pH 7,2), 0.5% BSA, 2 mM EDTA, 150 mM NaCl and 0.05% Tween-20 for 1 h. Then, the medium (100 ll) was added into the plates and incubated for next 1 h at room temperature. After this, the plates were stained with biotinylated detection antibodies and streptavidin–horseradish peroxidase for 1 h, and washed with ELISA buffer. After washing, Tetramethylbenzidine substrate (BD Pharmingen) and 0.04% H2O2 in PBS was added to the plates. Finally, the reaction was stopped by adding 4 M H2SO4 and optical density was measured at 405 nm using a micro plate reader.

Table 1 Primers for RT–PCR and quantitative real-time PCR. Genes

Forward primers

Reverse primers

Product

Methods

DDR1 DDR2 VLA1 VLA2 GAPDH DDR1 DDR2 GADPH

ATCCTGCTCCTGCTGCTCAT0 ATGGCCAGTGCCATCAAGTG ACAGCGAAGAACCTCCTGAA GTGCCTTTGGACAAGTGGTT GAAGGTGAAGGTCGGAGT GCGTCTGTCTGCGGGTAGAG GGAGGTCATGGGATCGAGTT GTTAGGAAAGCCTGCCGGTG

ATCTTGAGGGCTGTCGACCTCA TCTCCATTCTCATGTATTC CAGAATTGTGCCTCGTTTGA GGGCAACTCTGTGCTTGATT GAAGATGGTGATGGGATTTC ACGGCCTCAGATAAATACATTGTCT GAGTGCCATCCCGACTGTAATT GCATCACCCGGAGGAGAAATC

653 bp 953 bp 407 bp 298 bp 226 bp 100 bp 68 bp 118 bp

RT–PCR RT–PCR RT–PCR RT–PCR RT–PCR Quantitative RT–PCR Quantitative RT–PCR Quantitative RT–PCR

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

97

The human umbilical cord blood purified monocytes using RosetteSep™ Human Monocyte Cocktail (Stemcell Tech., Vancouver, Canada) were used as responding cells. The immature hDCs were treated with OVA (100 lg/ml) for 24 h on collagen I coated or non-coated plates. 1  105/well of allogenic human T cells were added and incubated with hDCs (1  104/well) for 48 h. Meanwhile, the medium was collected and subjected for IFN-c measurement using ELISA kit (Biolegend). Then, to assess the T-cell proliferation, 2 lCi/well [3H]-thymidine (American Radiolebeled Chemicals Inc., St. Louis, MO) was added and additionally incubated for 18 h, and incorporation of radioactivity was measured using liquid scintillation counter (TRI-CARB 2300TR, Packard Co., Meriden, CT).

immature hDCs with TNF-a, or LPS. We then performed RT–PCR using RNA extracted from immature hDCs, and TNF-a, or LPS treated hDCs. As shown in Fig. 2A, immature hDCs expressed the mRNA of DDR2 and VLA1, but no DDR1 and VLA2 expression was observed. There was an elevated expression of DDR2 in mature hDCs in comparison to immature hDCs whereas transcripts of DDR1 were only slightly expressed. Furthermore, to know the expression levels of DDR1 and DDR2 on the surface of TNF-a treated hDCs, we analyzed expression levels of HLA-DR and CD11c using flow cytometry and found that DDR2 expression was significant in comparison to DDR1 (Fig. 2B). The expression levels of DDR1 verified by quantitative real-time PCR showed about 1-fold difference in mature hDCs in comparison to control, whereas DDR2 expression was about 20-fold difference in both mature and immature DCs as compared with control (Fig. 2C and Fig. 2D).

2.8. Statistical analysis

3.2. Collagen I increases co-stimulatory molecules expression

All data were expressed as the mean ± SEM. The statistical analysis of data was performed using the Student’s t-test, and p < 0.05 was considered statistically significant.

After capturing antigens, DCs upregulate the expression of costimulatory molecules, migrate to the secondary lymphoid organs and prime naïve T cells to initiate the immune response [5]. We therefore performed flow cytometric analysis to examine the expression of co-stimulatory molecules such as HLA-DR, CD83, and CD86. As shown in Fig. 3A and Fig. 3B, the cell surface expression of CD86, HLA-DR and CD83 was upregulated by collagen. When compared to control, collagen strongly enhanced the expression of CD86 and HLA-DR. However, when compared to that of TNF-a or LPS, the expression of CD86, HLA-DR and CD83 was almost similar to that of collagen. Results indicated that the co-stimulatory molecules expression is upregulated by collagen I in hDCs.

2.7. Allogenic mixed leukocyte reaction

3. Results 3.1. hDCs express VLA1 and DDR2 as collagen receptor Firstly, we assayed surface markers of human monocytes and human monocyte-derived hDCs using flow cytometric analysis. We observed that the monocytes dominantly expressed CD14 whereas hDCs showed enhanced expression of CD1a (Fig. 1A, Fig. 1B and Fig. 1C), suggesting that hDCs are differentiated from human monocytes [23]. Previous reports have shown that collagen I attaches to the cells by certain receptors like VLA1, VLA2, VLA3, DDR1 or DDR2 [18,24]. Thus, to determine the expression of collagen receptors such as VLA1, VLA2, DDR1, and DDR2, we treated

3.3. Collagen I enhances antigen uptake activity of hDCs DCs are capable of internalizing fluorescein isothiocynatelabeled dextran via the cell surface mannose receptor at

Fig. 1. Differentiation of human dendritic cell (hDC) from monocyte (hMC) and identification of cell surface markers expression. Human cord blood derived monocytes were incubated with fetal bovine serum free Stemline II hematopoietic stem cell expansion medium in the presence of GM-CSF (100 ng/ml) and IL-4 (10 ng/ml) up to 5 days. The hDCs were immunostained directly with PE-Cy7-conjugated anti-CD1a, or PE-conjugated anti-CD11c, or FITC-conjugated anti-CD14. Then the cells were analyzed by flow cytometry. Results are shown as mean fluorescence intensity (MFI) of CD1a, CD11c and CD14 (shaded) vs. control IgG (open) in chart (A). MFI of monocytes were shown in (B) and that of DCs in (C). The bar graphs are the average of three independent experiments.

98

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

not shown). Hence, we were unable to examine if DDR2 has an effective role in upregulation of hDCs antigen uptake activity. 3.4. Collagen I increases the production of cytokines in hDCs We next evaluated the effect of collagen I activation of hDCs on the production of inflammatory mediators such as IL-12, TNF-a and IFN-c. As shown in Fig. 5A, when compared to collagen I, LPS-induced hDCs released similar levels of the cytokines. However, the levels of IL-12, TNF-a and IFN-c produced from collagen I stimulated hDCs increased by about 5, 12 and 4 folds respectively in comparison to negative controls. Moreover, addition of antiintegrin b1 blocking mAb showed the secretion of similar levels of these cytokines to those obtained with collagen I stimulated hDCs (Fig. 5B). To assess whether DDR2 is involved on the cytokines release by hDCs stimulated by collagen, we transfected DDR2 siRNA into immature hDCs. But, we found that hDCs being undesirably differentiated by transfection procedure. Therefore, we could not examine the role of DDR2 on the cytokines release by hDCs. Moreover, we observed the reduced expression of DDR2 in hDCs differentiated by the transfection. But there was no significant change in levels of cytokines secretion in hDCs stimulated by collagen I (data not shown). 3.5. Collagen I stimulated hDCs show enhanced allogenic T cell response

Fig. 2. Expression of collagen receptors on hDCs. Immature hDCs established by culturing for 5 days were treated with LPS (10 mg/ml) and total RNA was isolated. The transcripts of DDR1, DDR2, VLA1 (integrin a1) and VLA2 (integrin a2) were analyzed by RT–PCR. The relative levels of transcripts were normalized to GAPDH. Agarose-gel electrophoresis of RT–PCR products were shown in (A). Immature hDCs were cultured for 2 days in the presence of LPS, and the established mature hDCs were probed directly with anti-DDR1 or anti-DDR2 monoclonal antibodies (shaded) and control IgM or IgG, respectively (open). Cells were gated to separate CD11c and HLA-DR-expressing DCs by using FACS Calibur. Flow histogram and MFI of the DCs were shown in (B). Relative gene expression (fold change) of DDR1, DDR2 and GAPDH was determined by real-time PCR using cDNA isolated from immature and mature hDCs. DDR1 and DDR2 expression levels were shown in (C). The bar graph is the average of three independent experiments.

physiological temperature. Here, we examined whether the dextran–FITC treated immature hDCs might achieve maturation when allowed to grow in presence of collagen I. For this purpose, hDCs were cultured with dextran–FITC on a collagen I coated or non coated plates for 90 min at 4 °C or 37 °C. hDCs from collagen I coated plates displayed an increased internalization of dextran– FITC in comparison to the non-coated plate’s hDCs (Fig. 4). To further examine the role of collagen receptor DDR2, we investigated the capacity of hDCs to uptake antigen by depletion of DDR2 by specific siRNA. Consistent with previously published data [15,24], we observed that the collagen I enhanced antigen uptake by hDCs. Similar to our previous report [20], we again encountered the transfection mediated maturation of hDCs and inhibition of dextran–FITC uptake upon collagen treatment to transfectants (data

In order to examine whether collagen I regulates the antigen presenting activity of hDCs to the allogenic T cells and if DDRs are associated with the antigen presentation activity of collagen I stimulated hDCs, immature hDCs were incubated with OVA on collagen I coated plates, co-cultured with allogenic CD3 + T cells for 3 days, and analysis of the IFN-c production and proliferation activity of T cells was performed. Fig. 6A shows that, when compared with collagen stimulated hDCs, the collagen untreated hDCs showed less potency to induce T cells proliferation. Furthermore, DDR2 depletion showed decrement in collagen-induced hDCs to proliferate T cells. On the other hand, DDR1 silencing did not significantly affect the allogenic T cell proliferation. Additionally, there was significant difference in IFN-c production between collagen treated hDCs and untreated hDCs, the former showing an enhanced production of IFN-c by allogenic T cells than the latter ones. When DDR2 was silenced, there was significant decrease in IFN-c production. However, we observed no substantial change in IFN-c production when DDR1 was silenced (Fig. 6B). 3.6. Prolonged survival of melanoma mice by DCs vaccination We noticed a difference in survival days of tumor challenged mice in response to collagen I treated DCs vaccine, when compared to TNF-a treated or control mice (Fig. 7A), suggesting that collagen I plays an important role in enhancing DCs based vaccine efficiency. Moreover, as shown in Fig. 7B, the histopathological analysis of lung sections revealed that there were more tumor foci in the control mice than in collagen, or TNF-a, or LPS treated DCs vaccinated mice. In particular, collagen treated DCs vaccinated mice showed not only fewer but also smaller tumor foci in comparison to the other two, suggesting that collagen treated DCs vaccination reduces the tumor burden in melanoma mice yielding longer survival. 4. Discussion The transformation of immature to mature DCs involves several processes and this part of the system of DCs has gained a world-

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

99

Fig. 3. Effects of collagen I on the expression of CD83, CD86, and HLA-DR on hDCs. Monocyte derived DCs were cultured for 5 days and were stimulated with collagen type 1 (Col1) for 48 h, or LPS, or TNF-a for 24 h. Then, immunostaining was performed directly with FITC-conjugated anti-CD83 or PE-conjugated anti-86 or PE-Cy7-conjugated antiHLA-DR, and then surface markers were evaluated using flow cytometry. The chart representing the mean fluorescence intensity (MFI) of different surface markers (shaded) and control IgM (open) is shown in (A). Live cells were gated to separate CD11c-expressing DCs using FACS Calibur. The bar graph shown was the average of three independent experiments (B).

wide attention of scientists. It is probably due to broad range applications of DCs in augmenting immune responses in vivo [15]. In our previous data [20], we showed that mouse monocyte derived dendritic cells activation and upregulation of functional capacity of DCs are mediated via collagen I and DDR2 interaction. In the present study, we have explored the involvement of collagen receptors in the activation of hDCs and characterized the molecules that are involved in DCs activation. Additionally, we developed the mouse model of malignant melanoma and examined the anti-tumor responses of collagen I stimulated DCs. Previously reported data indicate that inflammatory molecules such as TNF-a and LPS lead to DC maturation [25], characterized by enhanced expression of HLA-DR and costimulatory molecules [26]. Consistent with these results we observed that TNF-a and LPS stimulation converted immature DCs into the mature phenotype. Moreover, ECM component such as collagen I has also been found to cause maturation of hDCs [27], without expressing VLA1, VLA2 and VLA3 [15], suggesting that alternative receptors may be involved in the maturation of DCs. Consistent with these

results, we found that DDR2 was expressed in both immature and mature hDCs without any expression of VLA1 and VLA2. However, the expression level of DDR2 on mature hDCs was more in comparison to immature hDCs. Whereas DDR1 transcripts were slightly detected in mature hDCs, suggesting that it may be involved partially in collagen I induced activation of immature hDCs. On the other hand, we observed that hDCs treated with collagen I showed increased expression of CD83, HLA-DR and CD86 in comparison to control, indicating that collagen may be functionally involved in maturation or activation of hDCs. CD83 is highly expressed on mature DCs and provides the cells with optimal T-cell stimulatory capacity [28]. Therefore, an elevated expression of CD83 on collagen-induced cells indicates its role on hDCs maturation process. Enhanced expression of CD83 in hDCs cultured in collagen I coated plates have been reported [15], in line with our findings. Although there are considerable controversies about the role of CD86, current perceptions are based around the concept that it is the initial co-stimulatory ligand with abundant and earliest expression [29]. Consistent with our results, an elevated

100

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

Fig. 4. Effects of collagen I on antigen uptake activities of hDCs. hDCs were incubated on collagen I (Col1) coated dish or none coated dish for 2 h and then treated with FITC–dextran for 90 min at 37 °C (shaded) or 4 °C(open). The cells were analyzed using FACS Calibur. Data represent one of the mean fluorescence intensity (MFI) from three independent experiments. The bar graph shown was the average of three independent experiments.

expression of CD86 in hDCs from collagen I coated plates have been reported in previous reports [15]. Therefore, this implicates that collagen I could enhance T cell activation capacity of hDCs through CD86. This capability of dendritic cells to express such molecules has been implemented in designing anti-tumor vaccines [30,31]. Several studies have described about the potency of antigen pulsed DCs against many diseases such as B cell lymphoma, melanoma, and HIV infection as well as bacterial and parasitic infections [5]. Therefore, we aimed to establish in vivo model and evaluate the immunological response of collagen I treated DCs in malignant melanoma, which is an aggressive cutaneous malignant disease with very poor survival rates [32]. This study showed that collagen I stimulated DCs may have important role in yielding relatively improved survival in mice, suggesting that collagen I could be a wealth of new treatment in cancer patients. However DCs utilized vaccines bear certain limitations like poor viability and migration to the lymphoid organs [33]. But in case of melanoma, DCs based vaccines have been found to show clinical response rates of 10%. Whereas in other tumor types the rates of only 4% has been reported [34–36], indicating that improvement in the DCs based cancer vaccines is necessary. Importantly, collagen upregulated cytokine production by hDCs. IFN-c and IL-12 are crucial players of the cross-talk between DCs and Th cells, a cross-talk that has been found to regulate the antigen presenting functions of DCs [37]. Additionally, production of TNF-a, a pro-inflammatory cytokine, by hDCs affects the outcome of inflammatory reactions [38]. In our data, we observed a significant increase in IL-12, TNF-a and IFN-c production by collagen treated hDCs, suggesting that collagen upregulates the antigen presenting functions of hDCs. Our study found that the observed effects of collagen on hDCs cytokine production were not mediated by integrins, raising the speculation that the effects may be because of DDR1 or DDR2. We transfected the hDCs with DDR1 and DDR2 siRNA and examined the IFN-c release by hDCs. In this

Fig. 5. Collagen I induces cytokines release by hDCs. Immature hDCs (105) were treated with or without collagen I, or LPS for 24 h and then supernatants were subjected for ELISA to measure IL-12p40, TNF-a and IFN-c. Concentrations (pg/ml) of respective cytokines produced were shown in (A). The immature hDCs (105) were pretreated with anti-integrin b1 or control IgM for 10 min and then incubated on collagen coated dish for 24 h. Then, supernatants were collected to measure the levels of IL-12p40, TNF-a and IFN-c by ELISA. Levels of cytokines released were shown in (B) (n = 3, ⁄p < 0.05).

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

Fig. 6. Mixed T cells reaction by collagen treated hDCs. ColI-treated DCs (104) were cultured together with CD3 + T cells (1  105) for 3 days. [3H]thymidine (2 lCi) was added for an additional 16 h and [3H]thymidine incorporation was quantified by liquid scintillation counter (A). To assess cytokines production of T cells by ColI-stimulated DCs, T cells were cocultured with ColI-treated DCs. After 3 days, levels of IFN-c in the supernatant was analyzed by ELISA (B). Depletion of DDR1 or DDR2 was performed by transfection with specific or nonspecific control siRNA to the DCs and incubated for 48 h. The cells were stimulated with ColI for 24 h and used as stimulator of T cells. All data represent means ± SEM of three independent experiments (⁄p < 0.05).

experiment, DDR2 silencing significantly reduced IFN-c release by hDCs, indicating that DDR2 is critically involved in modulation of DCs functions. We also observed that collagen I induced antigen uptake activities of hDCs. Although we were unable to show DDR2–collagen I interaction in antigen uptake activity of immature DCs because of transfection mediated DCs maturation, our data tends to show that the interaction between collagen I and DDR2 may increase the functional activity of hDCs. In comparison to DDR1, there have been no considerable studies in the field of collagen and DDR2 interaction for hDCs maturation. Many of the studies regarding DDR2 are centred on matrix metalloproteinase (MMP) production and organization of collagen. DDR2 only binds to the fibrillar collagens [39], which are known to be degraded by MMP. Moreover, DDR2 is expressed in pathological states such as wound healing, arthritis and cancer. In case of DDR2 knockout mice, defective wound healing has been found to be associated with reduced activity of MMP [40,41]. On the other hand, MMP has been shown to play important role in DCs migration [42]. Briefly, these findings illustrate the importance of DDR2 in enhancing dendritic cells functional capacities. Taken together, this study demonstrates that collagen I-induced DDR2 activation results in the production of highly functional hDCs showing high capacity for antigen uptake and T cells stimulation. An enhanced functional ability that DCs gain when treated with

101

Fig. 7. The anti-tumor effect by administration of DCs pulsed with melanoma (B16BL6) lysates in the presence of collagen, or TNF-a, or LPS on the mouse tumor model. Pulsed DCs (each 5  105) were transplanted twice at first and second weeks after introduction of tumor cells (105) and then the survival effect was compared. The length of survival of mice under various treatments was shown in (A). Lungs were obtained day 15 after injection of tumor cells and their sections were stained with hematoxylin and eosin (100). Microscopic finding of tumors in the lung were shown in dotted circle (B).

collagen reduces the melanoma growth, increasing the survival time in mice, suggesting the potential implementation of this form of treatment in human melanoma patients. However, further detailed investigations on molecular and genetic levels are essential before this treatment comes into clinical practice. Similarly, further studies regarding the role and associated pathways of collagen receptors are necessary to elucidate the immune response regulation by DCs in the presence of collagen. Acknowledgment This study was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2011-0013855). References [1] R.M. Steinman, Z.A. Cohn, Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution, J. Exp. Med. 137 (1973) 1142–1162. [2] R.M. Steinman, M.D. Witmer, Lymphoid dendritic cells are potent stimulators of the primary mixed leukocyte reaction in mice, Proc. Natl. Acad. Sci. 75 (1978) 5132–5136. [3] M.C. Nussenzweig, R.M. Steinman, B. Gutchinov, Z.A. Cohn, Dendritic cells are accessory cells for the development of anti-trinitrophenyl cytotoxic lymphocytes, J. Exp. Med. 152 (1980) 1070–1084. [4] R.M. Steinman, Dendritic cells: understanding immunogenicity, Eur. J. Immunol. 37 (2007) 53S–60S.

102

B. Poudel et al. / Cellular Immunology 278 (2012) 95–102

[5] H. Ueno, E. Klechevsky, R. Morita, C. Aspord, T. Cao, T. Matsui, T.D. Pucchio, J. Connolly, J.W. Fay, V. Pascual, A.K. Palucka, J. Banchereau, Dendritic cell subsets in health and disease, Immunol. Rev. 219 (2007) 118–142. [6] D.B. Fearnley, A.D. McLellan, S.I. Mannering, B.D. Hock, D.N.J. Hart, Isolation of human blood dendritic cells using the CMRF-44 monoclonal antibody: implications for studies on antigen-presenting cell function and immunotherapy, Blood 89 (1997) 3708–3716. [7] A. Lanzavecchia, F. Sallusto, Regulation of T cell immunity by dendritic cells, Cell 106 (2001) 263–266. [8] M.L. Kapsenberg, Dendritic-cell control of pathogen-driven T-cell polarization, Nat. Rev. Immunol. 3 (2003) 984–993. [9] K. Ebnet, E.P. Kaldjian, A.O. Anderson, S. Shaw, Orchestrated information transfer underlying leukocyte endothelial interactions, Annu. Rev. Immunol. 14 (1996) 155–177. [10] J.E. Gretz, E.P. Kaldjian, A.O. Anderson, S. Shaw, Sophisticated strategies for information encounter in the lymph node: the reticular network as a conduit of soluble information and a highway for cell traffic, J. Immunol. 157 (1996) 495–499. [11] K. Mahnke, R.S. Bhardwaj, T.A. Luger, T. Schwarz, S. Grabbe, Interaction of murine dendritic cells with collagen up-regulates allostimulatory capacity, surface expression of heat stable antigen, and release of cytokines, J. Leukoc. Biol. 60 (1996) 465–472. [12] T. Carlos, J. Harlan, Leukocyte-endothelial adhesion molecules, Blood 84 (1994) 2068–2101. [13] M.J. Staquet, Y. Kobayashi, D.C. Dezutter, D. Schmitt, Role of specific successive contacts between extracellular matrix proteins and epidermal Langerhans cells in the control of their direct migration, Eur. J. Cell Biol. 66 (1995) 342– 348. [14] R. Hynes, Integrins: versatility, modulation and signaling in cell adhesion, Cell 69 (1992) 11. [15] R.M. Suri, J.M. Austyn, Bacterial lipopolysaccharide contamination of commercial collagen preparations may mediate dendritic cell maturation in culture, J. Immunol. Methods 214 (1998) 149–163. [16] R.R. Valiathan, M. Marco, B. Leitinger, C.G. Kleer, R. Fridman, Discoidin domain receptor tyrosine kinases: new players in cancer progression, Cancer Metastasis Rev. 31 (2012) 295–321. [17] F. Alves, W. Vogel, K. Mossie, B. Millauer, H. Hofler, A. Ullrich, Distinct structural characteristics of discoidin I subfamily receptor tyrosine kinases and complementary expression in human cancer, Oncogene 10 (1995) 609–618. [18] G. Hou, W.F. Vogel, M.P. Bendeck, Tyrosine kinase activity of discoidin domain receptor 1 is necessary for smooth muscle cell migration and matrix metalloproteinase expression, Circ. Res. 90 (2002) 1147–1149. [19] W. Vogel, G.D. Gish, F. Alves, T. Pawson, The discoidin domain receptor tyrosine kinases are activated by collagen, Mol. Cell 1 (1997) 13–23. [20] J.E. Lee, C.S. Kang, X.Y. Guan, B.T. Kim, S.H. Kim, Y.M. Lee, W.S. Moon, D.K. Kim, Discoidin domain receptor 2 is involved in the activation of bone marrowderived dendritic cells caused by type I collagen, Biochem. Biophys. Res. Commun. 352 (2007) 244–250. [21] P.A. Ruiz, G. Jarai, Collagen I induces discoidin domain receptor (DDR) 1 expression through DDR2 and a JAK2–REK1/2-mediated mechanism in primary human lung fibroblasts, J. Biol. Chem. 286 (2011) 12912–12923. [22] C.E. Ford, S.K. Lau, C.Q. Zhu, T. Andersson, M.S. Tsao, W.F. Vogel, Expression and mutation analysis of the discoidin domain receptors 1 and 2 in non-small cell lung carcinoma, Br. J. Cancer 96 (2007) 808–814. [23] Z. Zheng, M. Takahashi, M. Narita, K. Toba, A. Liu, T. Furukawa, T. Koike, Y. Aizawa, Generation of dendritic cells from adherent cells of cord blood by culture with granulocyte–macrophage colony stimulating factor, interleukin4, and tumor necrosis factor-alpha, J. Hematother. Stem Cell Res. 9 (2000) 453– 464.

[24] W. Vogel, C. Brakebusch, R. Fassler, F. Alves, F. Ruggiero, T. Pawson, Discoidin domain receptor 1 is activated independently of beta(1) integrin, J. Biol. Chem. 275 (2000) 5779–5784. [25] J.A. Roake, A.S. Rao, P.J. Morris, C.P. Larsen, D.F. Hankins, J.M. Austyn, Dendritic cell loss from nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin 1, J. Exp. Med. 181 (1995) 2237–2247. [26] M. Bros, F. Jährling, A. Renzing, N. Wiechmann, N.A. Dang, A. Sutter, R. Ross, J. Knop, S. Sudowe, A.B. Reske-Kunz, A newly established murine immature dendritic cell line can be differentiated into a mature state, but exerts tolerogenic function upon maturation in the presence of glucocorticoid, Blood 109 (2007) 3820–3829. [27] C. Radymayr, G. Bock, A. Hobisch, H. Klocker, G. Bartsch, M. Thurnher, Dendritic antigen-presenting cells from the peripheral blood of renal-cellcarcinoma patients, Int. J. Cancer 63 (1995) 627–632. [28] L.J. Zhou, T.F. Tedder, Human blood dendritic cells selectively express CD83, a member of the immunoglobulin superfamily, J. Immunol. 154 (1995) 3821– 3835. [29] D.M. Sansom, C.N. Manzotti, Y. Zheng, What’s the difference between CD80 and CD86?, Trends Immunol 24 (2003) 314–319. [30] F.J. Hsu, C. Benike, F. Fagnoni, T.M. Liles, D. Czerwinski, B. Taidi, E.G. Engleman, R. Levy, Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells, Nat. Med. 2 (1996) 52–58. [31] J.M. Timmerman, D.K. Czerwinski, T.A. Davis, F.J. Hsu, C. Benike, Z.M. Hao, B. Taidi, R. Rajapaksa, C.B. Caspar, C.Y. Okada, A. van Beckhoven, T.M. Liles, E.G. Engleman, R. Levy, Idiotype pulsed dendritic cell vaccination for B-cell lymphoma: clinical and immune responses in 35 patients, Blood 99 (2002) 1517–1526. [32] K. Tsuda, K. Yamanaka, W. Linan, Y. Miyahara, T. Akeda, T. Nakanishi, H. Kitagawa, M. Kakeda, I. Kurokawa, H. Shiku, E.C. Gabazza, H. Mizutani, Intratumoral injection of Propionibacterium acnes suppresses malignant melanoma by enhancing Th1 immune responses, PLoS ONE 6 (2011) e29020. [33] A.S. Bear, C.R. Cruz, A.E. Foster, T cells as vehicles for cancer vaccination, J. Biomed. Biotechnol. 2011 (2011) 1–7. [34] J. Banchereau, A.K. Palucka, Dendritic cells as therapeutic vaccines against cancer, Nat. Rev. Immunol. 5 (2005) 296–306. [35] C.A. Klebanoff, N. Acquavella, Z. Yu, N.P. Restifo, Therapeutic cancer vaccines: are we there yet?, Immunol Rev. 239 (2011) 27–44. [36] S.A. Rosenberg, J.C. Yang, N.P. Restifo, Cancer immunotherapy: moving beyond current vaccines, Nat. Med. 10 (2004) 909–915. [37] G. Trinchieri, Interleukin-12 and the regulation of innate resistance and adaptive immunity, Nat. Rev. Immunol. 3 (2003) 133–146. [38] M. Idzko, E. Panther, C. Stratz, T. Müller, H. Bayer, G. Zissel, T. Dürk, S. Sorichter, F. Di Virgilio, M. Geissler, B. Fiebich, Y. Herouy, P. Elsner, J. Norgauer, D. Ferrari, The serotoninergic receptors of human dendritic cells: indentification and coupling to cytokine release, J. Immunol. 172 (2004) 6011–6019. [39] C.D. Franco, G. Hou, M.P. Bendeck, Collagens, integrins, and the discoidin domain receptors in arterial occlusive disease, Trends Cardiovasc. Med. 12 (2002) 143–148. [40] A. Page-McCaw, A.J. Ewald, Z. Werb, Matrix metalloproteinases and the regulation of tissue remodeling, Nat. Rev. Mol. Cell Biol. 8 (2007) 221–233. [41] E. Olaso, H.C. Lin, L.H. Wang, S.L. Friedman, Impaired dermal wound healing in discoidin domain receptor 2-deficient mice associated with defective extracellular matrix remodeling, Fibrogenesis Tissue Repair 4 (2011) 1–9. [42] V. Chabot, P. Reverdiau, S. Iochmann, A. Rico, D. Senecal, C. Foupille, P.Y. Sizaret, L. Sensebe, CCL5-enhanced human immature dendritic cell migration through the basement membrane in vitro depends on matrix metalloproteinase-9, J. Leukoc. Biol. 79 (2006) 767–778.