Combinations of TLR and NOD2 ligands stimulate rat microglial P2X4R expression

BBRC Biochemical and Biophysical Research Communications 349 (2006) 1156–1162 www.elsevier.com/locate/ybbrc

Combinations of TLR and NOD2 ligands stimulate rat microglial P2X4R expression Liang-Hao Guo b

a,*

, Ke-Tai Guo b, Hans Peter Wendel b, Hermann J. Schluesener

a

a Institute of Brain Research, University of Tuebingen, Calwer Str. 3, D-72076 Tuebingen, Germany Department of Thoracic, Cardiac and Vascular Surgery, University Hospital of Tuebingen, Calwer Str. 7/1, D-72076 Tuebingen, Germany

Received 18 August 2006 Available online 1 September 2006

Abstract As ATP-gated ion channels, P2X4 receptors (P2X4R) of microglial cells play a crucial role in central nervous system (CNS) inflammation. In this study, we used rat microglial cell cultures to examine P2X4R expression in response to stimulation by combination of tolllike receptors (TLRs) and nucleotide-binding oligomerization domain 2 (NOD2) receptors. Various TLR1-9 ligands and NOD2 agonist muramyldipeptide (MDP) were investigated. Our results showed that certain combination of ligands had additive effects on upregulating microglial P2X4R at both mRNA and protein levels, and induced nitric oxide increase and tumor necrosis factor-a production. Thus TLRs and NOD2 combinations are contributors to the signaling cascades resulting in purinergic microglial activation.  2006 Elsevier Inc. All rights reserved. Keywords: Microglia; P2X4 receptor; Toll-like receptors; Muramyldipeptide; Innate immune system; CNS

Microglial cells are key sensors of pathological events in the central nervous system (CNS) and play important roles in pathology and physiology of the brain and the spinal cord. Microglia are regarded as innate immune protector cells of the CNS that they interact with neurons and astrocytes, and migrate to the sites of damage where they proliferate and phagocytose dead cells [1]. Recently, a great deal of attention is focusing on the relation between activated microglia through adenosine 5 0 -triphosphate (ATP) receptors and neuropathic pain, which might be dramatically amplified as the consequence of spinal cord microglial activation elicited by CNS injury or neuroinflammation [2,3]. Upon activation by various stressors, microglial cells release proinflammatory cytokines, as well as upregulate expression of purinergic receptor P2X4 (P2X4R), an ATP-gated ion channel expressed in the CNS [2–5]. Previous works demonstrate that P2X4R could be a sensor of a microglial subpopulation in neural development [6], and

*

Corresponding author. Fax: +49 7071 294846. E-mail address: [email protected] (L.-H. Guo).

0006-291X/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.08.146

various CNS pathologies, particularly in neuropathic and inflammatory pain models [7–12]. Innate immunity is considered the first line of defense by recognizing different pathogen-associated molecular patterns (PAMPs) through pattern-recognition receptors (PRRs). Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain 2 (NOD2), which represent two classes of PRRs in innate immune system, have recently emerged as central players in the innate immune responses [13]. Thirteen TLRs have been identified so far, and most of them have their own set of PAMPs. TLR2, regarded as a homodimer or heterodimer of either TLR1 or TLR6, recognizes lipoteichoic acids, peptidoglycans (PGN), and other bacterial compounds [14]; TLR3 interacts with viral double-stranded RNA, whereas single-stranded RNA viruses activate TRL7 and TLR8 [15,16]; TLR4 is the major receptor for lipopolysaccharide (LPS); TLR5 detects flagellin and flagellated bacteria [17]; TLR9 can be stimulated by unmethylated CpG DNA [18]. Distinct from TLRs which comprise a class of transmembrane PRRs, NOD2 contains three distinct regions: a leucinerich, pattern-recognition domain similar to TLRs, a

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162

nucleotide-binding domain that is essential for oligomerization and subsequent signaling, and effector motifs such as the caspase-recruitment domain [19]. NOD2 is involved in intracellular recognition of pathogens and their products, such as muramyldipeptide (MDP, N-acetylmuramylL-alanyl-D-isoglutamine), from bacteria [20]. In the CNS, glial cells determine the inflammatory response in which ligation of TLRs and NOD2 by different PAMPs has the capacity to initiate intracellular signaling cascades that might involve the myeloid differentiation factor 88 (MyD88), an intracellular adapter protein resulting in the translocation of nuclear factor-kappa B (NF-jB) to the nucleus, and the production of proinflammatory cytokines and chemokines [21–23]. It has been demonstrated that TLR signaling triggers and tailors innate immune responses in microglia [23–25]. Our previous works demonstrated that polyinosinic–polycytidylic (polyIC), R848, and MDP, the ligands of TLR3, 7/8, and NOD2, respectively, could stimulate proliferation of cells in the rat spinal cord as well as microglial activation in vivo, suggesting an important role of TLRs in the regulation of CNS innate immune responses [26]. So far, most studies have analyzed microglial activation induced by single microbial compounds. A recent study reported that combinations of TLR ligands had effects on microglial activation in a dose-dependent manner [27]. As activated microglia may have an important role in the development of neuropathic pain through activation of P2X4R, thus in the present study, we have investigated the regulation of P2X4R expression on microglial cells stimulated by combinations of TLRs and NOD2 ligands. Materials and methods Reagents. All TLR agonists were purchased from InvivoGen (San Diego, CA), including Pam3CSK4 (TLR1/2), HKLM (TLR2), poly(I:C) (TLR3), Escherichia coli K12 LPS (TLR4), Salmonella typhimurium Flagellin (TLR5), FSL1 (TLR6/2), R848 (TLR7/8), and ODN2006 (TLR9). NOD2 ligand MDP and poly-D-lysine (PDL) were from Sigma–Aldrich Chemie GmbH (Steinheim, Germany). Cell culture reagents included DMEM (Cambrex Bio Science, Verviers, Belgium), fetal calf serum (FCS) (Biochrom AG, Berlin, Germany), penicillin and streptomycin (100 U/ml), and PBS, trypsin (Invitrogen, Paisley, Scotland, UK). The following antibodies were used in this study: monoclonal antibodies against OX-42 (Serotec, Paisley, UK), polyclonal antibodies against P2X4R (Alomone Labs, Jerusalem, Israel), monoclonal antibody against glial fibrillary acid protein (GFAP) (Chemicon International, California, US), and secondary antibodies fluorescein-conjugated sheep anti-rabbit IgG (Chemicon International Inc., Temecula, CA) and fluorescein-conjugated anti-mouse IgG (Serotec, Paisley, UK). For real-time PCR, optimized primers were synthesized by MWG (MWG-BIOTECH AG, Ebersberg, Germany); SYBRGreen PCR master mixture was purchased from Bio-Rad (Munich, Germany). Culture of primary glial cells. Primary glial cells were isolated from 2- to 4-day-old Lewis rat pups and cultures prepared essentially as described previously [28]. Briefly, the rat pups were killed by cervical dislocation followed by decapitation. The cortices were separated from meninges, and minced, triturated, and centrifuged (300g for 3 min) to remove dead cells. The pellet was resuspended in media and triturated again. Thereafter cells from two brains were collected and transferred to a PDL-coated 75 cm2 flask containing 10 ml culture medium (DMEM including 10% FCS, and 1.2%

1157

penicillin and streptomycin) and incubated at 37 C, 95% relative humidity in a 5% CO2 atmosphere. The medium was changed after 2 days and twice a week thereafter. Enrichment of primary microglia. When primary glial cell cultures became fully confluent on day 10–14, enriched microglia were isolated by shaking the flasks on an orbital shaker at 240 rpm for 3 h. Microglial cells in the supernatant were collected at 800g 10 min and cultured on PDLcoated plates at indicated density. Purity of obtained microglial cultures was routinely assessed by immunofluorescence using anti-OX-42 antibody and anti-GFAP antibody (>95% OX-42+ and <3% GFAP+). Primary microglial cells were then used 1–7 days after enrichment. Drug treatment and assay of nitric oxygen (NO) synthesis. Purified primary microglial cells were stimulated by single or combined TLR ligands and MDP at indicated concentrations which were optimized from the NO assays. Synthesis of NO was determined by assay of 24 h cultured supernatants for nitrite, a stable reaction product of NO with molecular oxygen. Briefly, supernatants were centrifuged to remove cells (1 · 105 cells/well in 48-well plates), and either directly analyzed or stored frozen at 80 C until measurement of TNF-a. Hundred microliters of each supernatant was allowed to react with 100 ll of Griess reagent (Sigma–Aldrich Chemie GmbH, Steinheim, Germany) and incubated at room temperature for 15 min. The optical density of the assay samples was measured spectrophotometrically at 570 nm. Fresh culture medium served as a control. Nitrite concentrations were calculated from a standard curve derived from the reaction of NaNO2 in the assay. Flow cytometric analysis of microglia cultures. The immunoreactivity of P2X4R was assessed by flow cytometry. Briefly microglial cells (2.5 · 105 cells/well in 12-well plates) were collected 24 h after drug stimulation and fixed in 4% paraformaldehyde for 15 min. After washing with FACS buffer (PBS containing 0.1% BAS and 0.01% NaN3), cells were incubated in blocking buffer (1% normal swine serum in PBS) for 1 h on ice and then incubated with P2X4R antibody. After washing, cells were incubated for 30 min with fluorescein isothiocyanate (FITC)-conjugated secondary antibody followed by washing, and then the FITC-labeled cells were analyzed on a BD Biosciences FACSCan (Heidelberg, Germany) at 3 · 104–105 counting events. Real-time polymerase chain reaction. 106 cells/well in 12-well plates were stimulated by TLR ligands and MDP for 24 h. Total RNA was prepared using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer’s instruction. One microgram of RNA was reverse transcribed into cDNA using random primers. Subsequently, P2X4R mRNA expression was quantified by real-time PCR in comparison to unstimulated cells using SYBR Green as detection reagent and b-actin as inter-reference standard. Following primers were used: P2X4R-forward AGACACTGCTGTGGCTTACG, P2X4R-reverse GCTGACAGCAC CTGAGAGAG; b-actin-forward CCGTCTTCCCCTCCATCGT, b-actin-reverse ATCGTCCCAGTTGGTTACAATGC. PCR was performed by a real-time iCycler (Bio-Rad, Munich, Germany). All reactions were carried out in a total volume of 15 ll comprised of 2· SYBRGreen PCR master mixture and optimized primer concentrations. Cycling was started at 95 C for 15 min, then 38 cycles of: 94 C for 40 s, 57 C for 30 s, and 72 C for 45 s with fluorescence detection at 72 C. Melting curve analysis was performed between 50 and 100 C at 0.5 C intervals. Tumor necrosis factor-a (TNF-a) assay. Antigenic rat TNF-a was detected by ELISA system from BioSource (Nivelles, Belgium) and based on the quantitative ‘‘sandwich’’ enzyme immunoassay technique. The detection was done according to the manufacturer’s instructions. The sensitivity of the assay was 10 pg/ml. Data analysis. For the real-time PCR experiment, we used a relative quantification based on the relative standard method. By this method, a standard curve was created for P2X4R and b-actin, and generated by plotting the threshold cycle vs. the known dilution of the cDNA. From each standard curve the slope was calculated, as well as the x value (amount from the unknown probe). The amount of target gene (P2X4R) was then divided by the endogenous reference (b-actin) to obtain a normalized target value. The untreated cells (cell 0) were used as the calibrator, or 1· sample. Each of the normalized target values was divided by the calibrator normalized target value to generate the relative expression

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162

5

Flow cytometric analysis of TLR ligands and MDP combination in the upregulation of P2X4R To characterize and to compare expression of P2X4R by primary microglia, we examined purified cultures of rat microglia 24 h after stimulation by TLR ligands and MDP by flow cytometry. In untreated microglia, only 23.8% P2X4R+ cells were detected. Dose dependency of

3

***

***

**

**

**

2 1 0

PI C

TLR ligands and MDP stimulated NO release

5 ***

4

***

***

***

***

***

3 2 1

+R C PI

M

D

84

8

P

06 20

8+ 84

8+ 84

R

R

L1

pG

FS

el

8+ 84

C

S ag Fl 8+ 84

R

R

R

84

8+

KL

LP

M

4 H 8+ 84

Pa

m

3C

SK

84 R R

48

4+

lin

0 8

Nitrite Production (treated cells/control)

B

C

5 4 3

***

*** **

**

2 1 0

M D P+ M D Pa P m 3C SK M D 4 P+ H KL M M D P+ LP M S +F la ge M llin D P M + D P+ FSL 1 C pG 20 06 M D P+ PI R C 84 8+ M D P

Nitrite Production (treated cells/control)

To determine the optimal concentrations of drugs, primary rat microglia were exposed to different concentrations of TLR1-9 ligands and MDP for 24 h. Then we measured the amount of nitric oxide in the supernatants of cell cultures as the activation of microglial cells is associated with the release of NO. NO production was stimulated in a dose-dependent manner (data not shown) [27]. Thereafter, the submaximal (50% of maximal stimulation) concentration of each ligand was selected for the following drug-combination experiments. In detail, Pam3CSK4 was used at 1 lg/ml, HKLM was at 107 cells/ ml, polyIC at 25 lg/ml, LPS at 100 ng/ml, flagellin at 1 lg/ml, FSL1 at 1 lg/ml, R848 at 10 lg/ml, CpGODN2006 at 1 lg/ml, and MDP at 20 lg/ml. Cell cultures were then incubated with two combined ligands at indicated concentrations for 24 h. Untreated control cells released little NO into the cell culture supernatants. Simultaneous treatment of microglial cells by two ligands had obvious stimulatory effects on NO production. PolyIC, R848, or MDP alone had mild effects on microglial NO with 1.30 ± 0.07-, 1.51 ± 0.24-, 1.41 ± 0.03-fold increases, respectively (Fig. 1). As shown in Fig. 1A, all combinations of polyIC with other TLR ligands elicited a significant increase in NO compared to polyIC stimulation alone (combination of polyIC and Pam3CSK4 (p < 0.001), polyIC and HKLM (p < 0.01), polyIC and LPS (p < 0.001), polyIC and flagellin (p < 0.01), polyIC and FSL1 (p < 0.001), polyIC and CpG2006 (p < 0.01), and polyIC and R848 (p < 0.001)). Costimulations by R848 and Pam3CSK4 (p < 0.001), R848 and HKLM (p < 0.001), R848 and flagellin (p < 0.001), R848 and FSL1 (p < 0.001), R848 and CpG2006 (p < 0.001), and R848 and polyIC (p < 0.001), significantly increased production of NO compared to R848 alone (Fig. 1B). Compared to MDP stimulation alone, the upregulation of NO can be seen by combinations of MDP and Pam3CSK4 (p < 0.001), MDP and LPS (p < 0.01), MDP and FSL1 (p < 0.001), and MDP and R848 (p < 0.01).

***

***

4

R

Results

A

po +P ly am IC 3C SK PI 4 C +H KL M PI C +L PI P C +F S la ge llin PI C + PI FS C L1 +C pG 20 06 PI C +R 84 M 8 D P+ PI C

level. Data of flow cytometry, NO, and TNF-a measurements were calculated as fold increases from untreated cells, i.e. cell 0 was set as 1· sample. Statistical analysis was done by one-way ANOVA post Bonferroni’s Multiple Comparison test (Graph Pad Prism 4.0 software) and the significance level was set at p < 0.05.

Nitrite Production (treated cells/control)

1158

Fig. 1. TLRs and NOD2 ligands induce significant increases in release of nitric oxide. Primary rat microglial cells were activated with single ligands or various combinations at indicated concentrations for 24 h: Pam3CSK4 (TLR1/2 ligand) was used at 1 lg/ml, HKLM (TLR2 ligand) at 107 cells/ ml, polyIC (PIC, TLR3 ligand) at 25 lg/ml, LPS (TLR4 ligand) at 100 ng/ ml, flagellin (TLR5 ligand) at 1 lg/ml, FSL1 (TLR6 ligand) at 1 lg/ml, R848 (TLR7/8 ligand) at 10 lg/ml, CpG-ODN2006 (TLR9 ligand) at 1 lg/ml, and MDP (NOD2 ligand) at 20 lg/ml (combined effects of each TLR ligand and MDP with PIC (A), R848 (B), or MDP (C)). Data represented x-fold increase of nitric oxide over control (untreated cells), which was set as 1· sample. Data are given as means ± SEM of duplicate determinations from three independent experiments. **p < 0.01, ***p < 0.001 vs. single ligand treatment.

P2X4R expression by microglia was observed by LPS, polyIC, R848 or MDP stimulation at indicated concentrations (Table 1). Obviously, maximal P2X4R expression was induced by LPS. At their highest concentrations, polyIC, R848, and MDP induced P2X4R+ cells at 42.0%, 37.3%, and 30.1%, respectively, but 1 lg/ml LPS induced up to 59.5% P2X4R+ cells.

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162

1159

Table 1 Dose dependency of polyIC, R848, MDP, and LPS on microglial P2X4R expression PolyIC

R848 +

MDP +

LPS +

Concentration (lg/ml)

P2X4 cells

Concentration (lg/ml)

P2X4 cells

Concentration (lg/ml)

P2X4 cells

Concentration (lg/ml)

P2X4+ cells

2.5 10 25 100

23.5 25.1 29.5 42.0

0.1 1 10 100

23.9 24.1 24.5 37.3

0.1 1 10 100

20.1 23.2 25.0 30.1

103 102 0.1 1

19.8 20.6 26.6 59.5

Microglial expressed P2X4R is upregulated by polyIC, R848, MDP or LPS alone at the indicated concentration. Data show means of percentage of mean of fluorescence positive cells from duplicates.

The combined effects of TLR1-9 ligands and MDP upon polyIC, R848 or MDP were further tested. As shown in Fig. 2, polyIC, R848 or MDP at submaximal alone slightly upregulated P2X4R expression by microglia; whereas after costimulation, additive effects can be seen. Expression of P2X4R at microglial cell surface increased relative to controls following exposure to all pairs of polyIC, R848, or MDP combinations (Fig. 2A–C). Statistically, Pam3CSK4, LPS, or R848 had significant additive effects with polyIC compared with effect of polyIC alone (Fig. 2A). After costimulation by polyIC and Pam3CSK4, polyIC and LPS, and polyIC and R848, numbers of FITC-stained P2XR+ microglia increased to 43.5%, 47.9%, and 42.4%, respectively, which were higher than the effect of a single ligand stimulation at its maximal concentration. Significant P2X4R upregulation was seen after combination of R848 with Pam3CSK4 or polyIC (Fig. 2B). NOD2 ligand MDP could also increase microglial P2X4R expression in costimulations with TLR ligands Pam3CSK4 or LPS (Fig. 2C). TLR ligands and MDP combinations increased P2X4R mRNA levels By real-time PCR, we analyzed whether additive effects seen by FCS analysis described above correlated with changes in P2X4R mRNA level. As shown in Fig. 3, the increases observed in mRNA levels are all in good agreement with observations by FACS described above. In microglia, expression of P2X4R mRNA by polyIC stimulation was increased by combination of polyIC with Pam3CSK4, LPS, or R848 (Fig. 3A). Increased microglial P2X4R mRNA was also detected after costimulation of R848 with Pam3CSK4, polyIC, or CpG2006 (Fig. 3B). The only upregulation by MDP combinations was seen with polyIC and LPS (Fig. 3C). TLR ligands and MDP combinations affect TNF-a production TLR-activated microglial cells produce a large variety of inflammatory cytokines, including TNF-a. TNF-a is not efficiently produced by resting microglial cells and only 81.10 ± 6.72 pg/ml TNF-a was detectable in supernatants of untreated cells. After TLR ligands and MDP stimula-

tion, we measured that either polyIC, R848, MDP alone or in combination with other ligands elicited relative increase of TNF-a release into the cell culture supernatant. As shown in Table 2, primary microglia were effectively activated by TLRs and NOD2 ligand combinations that the introduced TNF-a fold increase was higher than the effects of ligands on their own. The combination pairs which upregulated microglial P2X4R expression (indicated by ‘a’ in Table 2) also induced relatively higher TNF-a production, although no statistical significance was seen. Discussion Microglial P2X4R expression is typical of inflammatory pathologies of the CNS, particularly in chronic pain facilitation. In the present study, we have demonstrated that microglial P2X4R expression can be regulated by combination of TLRs and NOD2 ligands. Microglia are immune cells of the CNS. As constituents of the innate immune system, the myeloid-derived microglia, consequent to activation, release various immune mediators, such as TNF-a and nitric oxide [1]. In the CNS, microglia represent a critical population of P2X4R+ cells [5]. As purinergic receptor, P2X4R is a cell surface ion channel that mediates the physiologic effects of purine nucleotides [29,30]. P2X4R responds to extracellular ATP which activates inward currents, increase of intracellular calcium concentrations, activation of mitogen-activated protein kinase (MAPK) and transcription factors, and stimulates the release of proinflammatory cytokines [30– 32]. In the present work, we showed that TLR and NOD2 combinations increased cellular P2X4R mRNA and protein expression. Notably, TLR4 ligand LPS alone elicited maximal P2X4R expression with 59.47% cells stained as P2X4R+ at its highest concentration (1 lg/ml); other ligands, acting either alone or combinatorially, induced no more than 50% P2X4R+ microglial cells. Our previous works have demonstrated that in vivo P2X4R+ microglia were one important fraction of total activated microglial cells in rat CNS inflammation [8–12]. Therefore, the current data confirm the notion that P2X4R can be used to define an activated microglial subpopulation in CNS immune responses. In the CNS, ATP is a key factor not only released by activated microglical cells, but also influencing microglial

***

1.5 1.0 0.5

3C SK

2.0 ***

B

***

1.5 1.0 0.5

8 84

P

+R

D C

M 8+

84

R

R

84

R

C 8+

R

PI

20

06

L1 FS

el 84

8+

ag Fl

8+ 84

R

R

pG

S LP 8+

KL

84

84

m

8+

H

3C

M

4 SK

84 R Pa R

48

4+

lin

0.0 8

2.0

**

1.5 1.0 0.5 0.0

2.0

*** 1.5

**

**

1.0 0.5 0.0

C

***

1.5 1.0 0.5

el lin P+ M F D SL P+ 1 C pG 20 06 M D P+ PI R C 84 8+ M D P M

D

D

ag Fl P+

D

P+ L

KL M

M

M

D

m

P+ H

3C

M

4 SK

D M P+ Pa M

D

PS

0.0

Fig. 2. TLRs and NOD2 ligand upregulate P2X4R expression by microglial cells. Primary rat microglial cells were incubated with single ligands or various combinations at concentrations indicated in Fig. 1 for 24 h. Flow cytometry was then used to detect ligand-induced changes in cell surface P2X4R expression. The percentage of means of fluorescence positive cells in each cell sample was normalized to control (untreated) expression levels and represented as the x-fold increase over control, which was set as 1· sample. Combined effects of each TLR ligand or MDP in combination with PIC (A), R848 (B), or MDP (C) are shown. Data are means ± SEM of duplicate determinations of three independent experiments. ***p < 0.001 vs. single ligand treatment.

activation [3]. Resting microglia produce little ATP, and constitutive purinergic ATP receptors are slightly active. Upon inflammatory stimulation, microglia are capable to sense increased extracellular ATP, upregulate expression

relative P2X4R mRNA expression

***

P

percentage of P2x4+ cells (treated cells/control)

C

*** **

2.0 ***

1.5

*

1.0 0.5 0.0 M D M P+ D Pa P m 3C SK M D 4 P+ H KL M M D P+ M LP D P+ S Fl ag el M lin D P +F M D SL P+ 1 C pG 20 06 M D P+ PI R C 84 8+ M D P

percentage of P2x4+ cells (treated cells/control)

B

relative P2X4R mRNA expression

PI

C +P

PI

am

po

4 C +H KL M PI C +L PI PS C +F la ge llin PI C +F PI SL C 1 +C pG 20 06 PI C +R 84 8 M D P+ PI C

0.0

2.0

PI po C +P ly am IC 3C SK PI 4 C +H KL M PI C +L PI PS C +F la ge llin PI C + PI FS C L1 +C pG 20 06 PI C +R 84 8 M D P+ PI C

A

***

R 48 4+ R 84 Pa 8 m 3C S R K4 84 8+ H KL M R 84 8+ R 84 LP 8+ S Fl ag el R lin 84 8 R + 84 FS 8+ L1 C pG 20 R 06 84 8+ M D P PI C +R 84 8

***

2.0

ly IC

percentage of P2x4+ cells (treated cells/control)

A

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162

relative P2X4R mRNA expression

1160

Fig. 3. TLRs and NOD2 ligand upregulate P2X4 mRNA levels. Primary rat microglial cells were incubated with single ligands or various combinations at indicated concentrations for 24 h. Combined effects of each TLR ligand and MDP with PIC (A), R848 (B), or MDP (C) are shown (concentrations as in Fig. 2). RNA quantity was determined by real-time PCR using standard curves to extrapolate P2X4 gene expression levels relative to the housekeeper b-actin in culture of rat microglia. Data represented fold increase over control (untreated cells), which is set as 1· sample. Data are means ± SEM of triplicate determinations of two independent experiments. *p < 0.05, **p < 0.01, and ***p < 0.001 vs. single ligand treatment.

of cell surface purinergic receptors, including P2X4R, and further elicit cellular events, for example TNF-a and NO production [1,3]. Previous studies reported P2X4R

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162 Table 2 TLR ligands and MDP combinations affects microglial TNF-a introduction

Alone Pam3CSK4 HKLM LPS Flagellin FSL1 CpG2006 R848 MDP PolyIC

polyIC

R848

MDP

3.93 ± 0.60 7.29 ± 0.74a 4.13 ± 1.51 4.98 ± 1.71a 5.94 ± 1.46 4.79 ± 1.13 2.95 ± 1.26 5.52 ± 1.35a 5.44 ± 0.66 —

3.96 ± 0.48 6.55 ± 1.12a 3.87 ± 0.90 2.85 ± 1.08 4.91 ± 1.51 4.74 ± 1.49 4.91 ± 1.04 — 8.96 ± 0.40 5.52 ± 1.35a

3.81 ± 0.26 6.27 ± 0.78a 5.66 ± 0.41 6.52 ± 0.50a 4.92 ± 0.43 5.45 ± 0.84 7.50 ± 0.60 8.96 ± 0.40 — 5.44 ± 0.66

Microglial secretion of TNF-a stimulated by TLR ligands, MDP and combinations. TNF-a production (pg/ml in cell culture supernatant) of each treatment group was normalized to control (untreated cells) expression (set as 1·), and is shown as fold increase over control (as means ± SEM of triplicate measurements from each two independent experiments). a Indicates combined pairs which upregulated P2X4R expression.

expression in vivo colocalizing with immunoreactivity of microglial activation markers in distinct CNS pathological immune responses after CNS damage [8–12]. In the present in vitro study, we detected P2X4R in rat primary microglial cultures at both protein and mRNA levels, and microglial P2X4R was upregulated after TLR and NOD2 stimulation. This suggests a link between TLRs, NOD2, and purinergic mechanism of inflammation in the CNS. As innate immune PRRs, TLRs and NOD2 ligands enable to induce bacterial and viral stimulations to elicit microglial activation [19]. Activated microglia can release ATP [33,34], which then activates P2X4 subunit at the microglial cell surface [3,29,35,36]. As current upregulated P2X4R expression paralleled well with nitric oxide increase and TNF-a production, it might be implicated that those innate immune PRRs, both TLRs and NOD2, are also involved in purinergic microglial activation. TLRs and NOD2 are evolutionarily conserved receptors of innate immunity [19]. They are able to sense pathogens and trigger microglial activation inducing expression of inflammatory cytokines, chemokines, and multiple effector molecules [23–25]. Accumulating evidence indicates that combination of TLRs and NOD2 ligands functionally affects immune cells, including microglia [27]. In the current data, the combination pair of polyIC, R848, and MDP with other TLRs and NOD2 ligands induced significant increase of microglial NO release, and a modest augment on TNF-a production as well. This is in line well with the in vitro behavior of microglia/macrophages after costimulated with more than one TLRs at submaximum concentrations [27,37,38]. Structurally, most TLRs are present on the cell surface, while TLR7, TLR8, and TLR9 are in the endosomal compartment, and TLR3 is cytoplasmic, as well as NOD2 [23]. The signaling capabilities of TLRs acting in combination are thought to overlap. However, the mechanism by which selected TLRs pairs act in combination to induce a few genes remains to be estab-

1161

lished. A most recent study reported that fibronectin, a ligand of TLR2 and TLR4, induced a marked increase in microglial P2X4R expression, implicating a TLR2 and TLR4 mechanism might be involved in microglial P2X4R mediation [39]. In the present study, we demonstrated that TLR2 and/or TLR4 with TLR3, TLR7/8, and NOD2 ligands combined to induce microglial activation and P2X4R upregulation, suggesting that extracellular TLRs and intracellular NOD2 might lead to the combinative activation of microglia. It has been reported that NOD2 in combination with TLR2, TLR4, and TLR9 additively induced inflammatory responses in various types of immune cells [20,40,41], although a negative cross talk between TLR2 and NOD2 has recently been proposed [42]. These results may imply ambiguous interrelations between different pathogen responses under different experimental conditions which remain to be clarified. In conclusion, our results showed that TLRs and NOD2 ligands stimulated microglial P2X4R upregulation which was associated well with elicited microglia activation. Innate immune system sensors like TLRs or NOD2 are key receptors to sense PAMPs to induce bacterial and viral stimulation of microglia in the CNS [19]. Our observation of the combinational consequences suggests that microglia sense the presence of inflammatory stimulation using multiple recognition systems. Considering the critical role of microglia P2X4R in the pain facilitation and neuroinflammatory pathologies, the possible use of purinergic antagonist, particularly P2X4R antagonist, in the pharmacological treatment might necessary involve CNS innate immune regulations. Acknowledgments The authors acknowledge the assistance of Prof. Schoeffl and Mr. Wunderlich for help with real-time PCR analysis. Mrs. Guo is member of the Graduate College ‘‘Cellular mechanisms of immune-associated process’’ (DFG: GK 794). References [1] G.W. Kreutzberg, Microglia: a sensor for pathological events in the CNS, Trends Neurosci. 19 (1996) 312–318. [2] L.R. Watkins, S.F. Maier, Immune regulation of central nervous system functions: from sickness responses to pathological pain, J. Intern. Med. 257 (2005) 139–155. [3] K. Inoue, The function of microglia through purinergic receptors: neuropathic pain and cytokine release, Pharmacol. Ther. 109 (2006) 210–226. [4] J.A. DeLeo, R.P. Yezierski, The role of neuroinflammation and neuroimmune activation in persistent pain, Pain 90 (2001) 1–6. [5] X. Bo, Y. Zhang, M. Nassar, G. Burnstock, R. Schoepfer, A P2X purinoceptor cDNA conferring a novel pharmacological profile, FEBS Lett. 375 (1995) 129–133. [6] Z. Xiang, G. Burnstock, Expression of P2X receptors on rat microglial cells during early development, Glia 52 (2005) 119–126. [7] F. Cavaliere, F. Florenzano, S. Amadio, F.R. Fusco, M.T. Viscomi, N. D’Ambrosi, F. Vacca, G. Sancesario, G. Bernardi, M. Molinari, C. Volonte, Up-regulation of P2X2, P2X4 receptor and ischemic cell death: prevention by P2 antagonists, Neuroscience 120 (2003) 85–98.

1162

L.-H. Guo et al. / Biochemical and Biophysical Research Communications 349 (2006) 1156–1162

[8] M. Tsuda, Y. Shigemoto-Mogami, S. Koizumi, A. Mizokoshi, S. Kohsaka, M.W. Salter, K. Inoue, P2X4 receptors induced in spinal microglia gate tactile allodynia after nerve injury, Nature 424 (2003) 778–783. [9] L.H. Guo, K. Trautmann, H.J. Schluesener, Expression of P2X4 receptor in rat C6 glioma by tumor-associated macrophages and activated microglia, J. Neuroimmunol. 152 (2004) 67–72. [10] L.H. Guo, K. Trautmann, H.J. Schluesener, Expression of P2X4 receptor by lesional activated microglia during formalin-induced inflammatory pain, J. Neuroimmunol. 163 (2005) 120–127. [11] J.M. Schwab, L. Guo, H.J. Schluesener, Spinal cord injury induces early and persistent lesional P2X4 receptor expression, J. Neuroimmunol. 163 (2005) 85–189. [12] L.H. Guo, H.J. Schluesener, Lesional accumulation of P2X(4) receptor(+) macrophages in rat CNS during experimental autoimmune encephalomyelitis, Neuroscience 134 (2005) 199–205. [13] J.H. Fritz, S.E. Girardin, How toll-like receptors and Nod-like receptors contribute to innate immunity in mammals, J. Endotoxin. 11 (2005) 390–394. [14] S. Akira, S. Sato, Toll-like receptors and their signaling mechanisms, Scand. J. Infect. Dis. 35 (2003) 555–562. [15] L. Alexopoulou, A.C. Holt, R. Medzhitov, R.A. Flavell, Recognition of double-stranded RNA and activation of NF-jB by toll-like receptor 3, Nature 413 (2001) 732–738. [16] F. Heil, H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner, S. Bauer, Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8, Science 303 (2004) 1526–1529. [17] F. Hayashi, K.D. Smith, A. Ozinsky, T.R. Hawn, E.C. Yi, D.R. Goodlett, J.K. Eng, S. Akira, D.M. Underhill, A. Aderem, The innate immune response to bacterial flagellin is mediated by toll-like receptor 5, Nature 410 (2001) 1099–1103. [18] H. Hemmi, O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda, S. Akira, A toll-like receptor recognizes bacterial DNA, Nature 408 (2000) 740–745. [19] E. Cario, Bacterial interactions with cells of the intestinal mucosa: toll-like receptors and NOD2, Gut 54 (2005) 1182–1193. [20] S.E. Girardin, I.G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas, D.J. Philpott, P.J. Sansonetti, Nod2 is a general sensor of peptidoglycan through muramyldipeptide (MDP) detection, J. Biol. Chem. 278 (2003) 8869–8872. [21] D.J. Philpott, S.E. Girardin, The role of toll-like receptors and Nod proteins in bacterial infection, Mol. Immunol. 41 (2004) 1099–1108. [22] K. Takeda, S. Akira, Toll-like receptors in innate immunity, Int. Immunol. 17 (2005) 1–14. [23] T. Kielian, Toll-like receptors in central nervous system glial inflammation and homeostasis, J. Neurosci. Res. 83 (2006) 711–730. [24] M. Bsibsi, R. Ravid, D. Gveric, J.M. van Noort, Broad expression of toll-like receptors in the human central nervous system, J. Neuropathol. Exp. Neurol. (2002) 1013–1021. [25] C.S. Jack, N. Arbour, J. Manusow, V. Montgrain, M. Blain, E. McCrea, A. Shapiro, J.P. Antel, TLR signaling tailors innate immune responses in human microglia and astrocytes, J. Immunol. 175 (2005) 4320–4330. [26] Y. Su, Z. Zhang, K. Trautmann, S. Xu, H.J. Schluesener, TLR and NOD2 ligands induce cell proliferation in the rat intact spinal cord, J. Neuropathol. Exp. Neurol. 64 (2005) 991–997.

[27] S. Ebert, J. Gerber, S. Bader, F. Muhlhauser, K. Brechtel, T.J. Mitchell, R. Nau, Dose-dependent activation of microglial cells by toll-like receptor agonists alone and in combination, J. Neuroimmunol. 159 (2005) 87–96. [28] P.J. Gebicke-Haerter, J. Bauer, A. Schobert, H. Northoff, Lipopolysaccharide-free conditions in primary astrocyte cultures allow growth and isolation of microglial cells, J. Neurosci. 9 (1989) 183–194. [29] (a) R.A. North, Molecular physiology of P2X receptors, Physiol. Rev. 82 (2002) 1013–1067; (b) E. Cario, Bacterial interactions with cells of the intestinal mucosa: toll-like receptors and NOD2, Gut 54 (2005) 1182–1193. [30] L.M. Schwiebert, W.C. Rice, B.A. Kudlow, A.L. Taylor, E.M. Schwiebert, Extracellular ATP signaling and P2X nucleotide receptor in monolayers of primary human vascular endothelial cells, Am. J. Physiol. 282 (2002) C289–C301. [31] D. Ferrari, P. Chiozzi, S. Falzoni, S. Hanau, F. Di Virgilio, Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin, J. Exp. Med. 185 (1997) 579–582. [32] F.P. Gendron, M. Chalimoniuk, J. Strosznajder, S. Shen, F.A. Gonzalez, G.A. Weisman, G.Y. Sun, P2X7 nucleotide receptor activation enhances IFNc-induced type II nitric oxide synthase activity in BV-2 microglial cells, J. Neurochem. 87 (2003) 344–352. [33] P. Bodin, G. Burnstock, Purinergic signalling: ATP release, Neurochem. Res. 26 (2001) 959–969. [34] G.J. Liu, A. Kalous, E.L. Werry, M.R. Bennett, Purine release from spinal cord microglia following elevation of calcium by glutamate, Mol. Pharmacol. 70 (2006) 851–859. [35] F. Di. Virgilio, P. Chiozzi, D. Ferrari, S. Falzoni, J.M. Sanz, A. Morelli, M. Torboli, G. Bolognesi, O.R. Baricordi, Nucleotide receptors: an emerging family of regulatory molecules in blood cells, Blood 97 (2001) 587–600. [36] E.R. Lazarowski, R.C. Boucher, T.K. Harden, Mechanisms of release of nucleotides and integration of their action as P2X- and P2Yreceptor activating molecules, Mol. Pharmacol. 64 (2003) 785–795. [37] D.A. Hume, D.M. Underhill, M.J. Sweet, A.O. Ozinsky, F.Y. Liew, A. Aderem, Macrophages exposed continuously to lipopolysaccharide and other agonists that act via toll-like receptors exhibit a sustained and additive activation state, BMC Immunol. 2 (2001) 11. [38] A.H. Dalpke, M. Frey, S. Morath, T. Hartung, K. Heeg, a Interaction of lipoteichoic acid and CpG-DNA during activation of innate immune cells, Immunobiology 206 (2002) 392–407. [39] K. Nasu-Tada, S. Koizumi, M. Tsuda, E. Kunifusa, K. Inoue, Possible involvement of increase in spinal fibronectin following peripheral nerve injury in upregulation of microglial P2X4, a key molecule for mechanical allodynia, Glia 53 (2006) 769–775. [40] S. Yang, R. Tamai, S. Akashi, O. Takeuchi, S. Akira, S. Sugawara, H. Takada, Synergistic effect of muramyldipeptide with lipopolysaccharide or lipoteichoic acid to induce inflammatory cytokines in human monocytic cells in culture, Infect. Immun. 69 (2001) 2045– 2053. [41] H. Tada, S. Aiba, K. Shibata, T. Ohteki, H. Takada, Synergistic effect of Nod1 and Nod2 agonists with toll-like receptor agonists on human dendritic cells to generate interleukin-12 and T helper type 1 cells, Infect. Immun. 73 (2005) 7967–7976. [42] T. Watanabe, A. Kitani, P.J. Murray, W. Strober, NOD2 is a negative regulator of Toll-like receptor 2-mediated T helper type 1 responses, Nat. Immunol. 5 (2004) 800–808.