- Email: [email protected]
Combined Transplantation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Restores Cavernous Nerve Injury-Related Erectile Dysfunction
ORIGINAL RESEARCH
BASIC SCIENCE
Combined Transplantation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Restores Cavernous Nerve Injury-Related Erectile Dysfunction Jia-feng Fang, MD,1,* Xu-na Huang, MD,2,* Xiao-yan Han, MD,2 Xi Ouyang, MD,1 Lei Fan, MD,3 Xin Zhao, MD,1 Ze-hong Chen, MD,1 and Hong-bo Wei, MD1
ABSTRACT
Background: Whether combined transplantation of mesenchymal stem cells (MSCs) and endothelial progenitor cells (EPCs) is more effective than transplantation of a single cell type in the restoration of erectile function is unknown. Aim: To investigate the effect of combined transplantation of MSCs and EPCs on restoration of erectile function in rats with cavernous nerve injury (CNI). Methods: MSCs were isolated from human bone marrow and EPCs were isolated from human umbilical cord blood. MSCs and EPCs were identified by flow cytometry and in vitro differentiation or immunofluorescence staining. 25 8-week-old male Sprague-Dawley rats were allocated to 1 of 5 groups: sham operation group, bilateral CNI group receiving periprostatic implantation of MSCs plus EPCs, MSCs, EPCs, or phosphate buffered saline (control group). 2 weeks after CNI and treatment, erectile function of rats was measured by electrically stimulating the CN. The penis and major pelvic ganglia were harvested for histologic examinations. RNA and protein levels of neurotrophin factors (vascular endothelial growth factor, nerve growth factor, and brain-derived neurotrophic factor) in mono- or coculture MSCs and EPCs were assessed by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Outcomes: Intracavernous pressure and mean arterial pressure were measured to evaluate erectile function. Histologic examinations of the penis and major pelvic ganglia and RNA and protein levels of neurotrophin factors in MSCs and EPCs were performed. Results: MSCs and EPCs expressed the specified cell markers and exhibited the typical appearance and characteristics. Treatments using MSCs and/or EPCs could increase endothelial and smooth muscle contents of the corpus cavernosum, decrease caspase-3 expression and increase penile neuronal nitric oxide synthase expression, and restore the neural component of the major pelvic ganglia in rats with CNI. Combined transplantation of MSCs and EPCs had a better effect on improving erectile function than single transplantation of MSCs or EPCs. Expression levels of vascular endothelial growth factor and nerve growth factor in coculture MSCs and EPCs were significantly higher than those of primary MSCs or EPCs. Clinical Translation: Combined transplantation of MSCs and EPCs was more effective in restoring erectile function in CNI-related erectile dysfunction models. Strengths and Limitations: The study, for the 1st time, proved that combined transplantation of MSCs and EPCs was more effective in restoring erectile function in rats with CNI. The rat model might not represent the human condition. Conclusion: Combined periprostatic transplantation of MSCs and EPCs could restore erectile function in rats with CNI more effectively. MSCs might restore CN fibers by secreting neurotrophin factors such as vascular endothelial growth factor and nerve growth factor, and EPCs could enhance the paracrine activity of MSCs. Fang J-f, Huang X-n, Han X-y, et al. Combined Transplantation of Mesenchymal Stem Cells and Endothelial Received October 11, 2017. Accepted January 9, 2018. 1
Department of Gastrointestinal Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China;
2
Central Laboratory, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China;
284
3
Department of Spine Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
*Equivalent contribution. Copyright ª 2018, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jsxm.2018.01.005
J Sex Med 2018;15:284e295
285
MSC Plus EPC for CNI-Related ED in Rats
Progenitor Cells Restores Cavernous Nerve Injury-Related Erectile Dysfunction. J Sex Med 2018;15:284e295. Copyright 2018, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.
Key Words: Mesenchymal Stem Cells; Endothelial Progenitor Cells; Erectile Dysfunction; Combined Transplantation; Paracrine Factor
INTRODUCTION Owing to intraoperative damage of the pelvic autonomic nerve (PAN), erectile dysfunction (ED) frequently occurs after pelvic surgery.1,2 Although PAN preservation has been applied to avoid urogenital dysfunction, some cases of PAN injury and related ED complication are inevitable.3,4 Moreover, phosphodiesterase type 5 inhibitors are only partly effective and some patients cannot tolerate their side effects. Thus, a new strategy is needed to cure nerve injury-related ED. Recently, mesenchymal stem cells (MSCs) from different tissues have been used for treatment of ED caused by age, diabetes, and nerve injury in animals,5e8 and the results have shown that implantation of stem cells can restore erectile function in animal models. However, a clinical trial of stem cell therapy for ED in Korea showed that despite having increased penile rigidity, none of the 7 patients with diabetes-related ED could achieve vaginal penetration.9 The result suggests that more efficient stem cells and methods are needed to better restore erectile function. Endothelial progenitor cells (EPCs) are mononuclear cells (MNCs) that circulate in the blood and are derived from different tissues. They can participate in vascular repair by migrating to distant vessels, differentiating into mature endothelial cells, and replacing old cells.10 Recent researches have shown that combined transplantation of MSCs and EPCs is more effective than transplantation of a single cell type in different diseases, such as cardiovascular disease,11,12 cerebrovascular disease,13 and bone-related disease.14,15 However, whether combined transplantation of MSCs and EPCs is more effective in restoring erectile function is unknown. In the present study, we established an ED rat model by crushing the bilateral cavernous nerves (CNs) and investigated the effect of combined transplantation of MSCs and EPCs on the amelioration of ED related to CN injury (CNI).
METHODS Isolation and Culture of MSCs and EPCs Institutional review board approval was obtained for all procedures. Written informed consent was obtained from the donors of the human bone marrow and umbilical cord blood samples. Human bone marrow MSCs were collected from young male healthy donors. Briefly, preparation of MNCs from bone marrow samples was performed using Ficoll density gradient centrifugation. Then, MNCs were resuspended in MSC culture
J Sex Med 2018;15:284e295
medium containing low glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), L-glutamine 2 mmol/L, sodium pyruvate 1 mmol/L, penicillin 100 U/mL, and streptomycin 100 mg/mL (all from Gibco, Grand Island, NY, USA) in 5% CO2 in a 37 C incubator. All non-adherent cells were removed and the medium was changed every 3 days. EPCs were isolated from human umbilical cord blood samples as previously described.16 Briefly, the blood was diluted with Dulbecco’s phosphate buffered saline (DPBS), overlaid with an equal volume of Ficoll, and centrifuged for 15 minutes at room temperature. MNCs were isolated and washed twice with DPBS and then cultured on 1% gelatin-coated plates using EPC medium: endothelial growth medium 2 (EGM-2; except for hydrocortisone; Lonza, Basel, Switzerland) supplemented with 20% FBS and 1 glutamine-penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA). The culture medium was changed every other day.
Characterization of MSCs and EPCs For flow cytometry, MSCs and EPCs were incubated with fluorescein isothiocyanate (FITC)-conjugated antibodies for 30 minutes at 4 C. The following antibodies were used: CD11b, CD31, CD34, CD45, CD73, CD90, CD105, and CD105 for MSCs and CD31, CD34, CD45 CD90, CD105, and vWF for EPCs. The cells were washed twice with PBS. FACSCalibur flow cytometer and CELLQuest software (BD Bioscience, San Jose, CA, USA) were used to analyze antibody binding. MSCs at passage 2 were used to assess the in vitro potential of differentiating into osteocytes and adipocytes as described previously.6 Cells were incubated in related medium: (i) adipogenic differentiation medium (DMEM and glucose 1 g/mL [DMEMLG] containing 10% FBS, ascorbate-1 phosphate 50 mg/mL, dexamethasone 107 mol/L, and indomethacin 50 mg/mL); and (ii) osteogenic differentiation medium (DMEM-LG containing 10% FBS, ascorbate-2 phosphate 50 mg/mL, dexamethasone 108 mol/L, and b-glycerophosphate 10 mmol/L). The medium was changed every 3 days. EPCs at passages 2 to 4 were used for assessment of characterization. Cells were washed with DPBS, fixed with 4% paraformaldehyde (Sigma, St Louis, MO, USA) and then incubated with FITC-conjugated Ulex europaeus agglutinin I (UEA-1; Sigma) in the dark at 37 C for 20 minutes and acetylated low-density lipoprotein labeled with 1,10 -dioctadecyl-3,3,30 ,30 -tetramethylindo-
286
Fang et al
carbocyanine perchlorate (DiI-ac-LDL; Invitrogen, Waltham, MA, USA) at 37 C for 4 hours. Cells were washed twice with DPBS and fixed with 4% paraformaldehyde for 30 minutes. Samples were observed under fluorescence microscopy.
Coculture of MSCs and EPCs MSCs and EPCs at passage 3 were mixed at a ratio of 1:2. Cells were cultured in EGM-2 and 5% FBS for 72 hours. Monocultures of MSCs and EPCs were used as control groups.
Real-Time Polymerase Chain Reaction RNAs of vascular endothelial growth factor (VEGF), nerve growth factor (NGF), and brain-derived neurotrophic factor (BDNF) in MSCs were extracted using TRIzol reagent kit (Invitrogen). RNA was reverse transcribed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan). Real-time polymerase chain reaction was performed on an ABI PRISM 7000 sequence detector (Applied Biosystems, Waltham, MA, USA) using SYBR Premix Ex Taq (Perfect Real Time; TaKaRa). The glyceraldehyde 3-phosphate dehydrogenase gene was used as an internal control. The primers used for analysis are listed in Table 1.
Enzyme-Linked Immunosorbent Assay The culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. VEGF, NGF, and BDNF levels were measured the respective enzyme-linked immunosorbent assay kits (R&D System, Minneapolis, MN, USA). Data from 3 independent experiments were statistically analyzed.
Animal Treatment 25 8-week-old male Sprague-Dawley rats (mean weight ¼ 250 g) were obtained from the Guangdong Medical Laboratory Animal Center (Guangdong, China) and housed in a standard animal facility with 12-hour on and off light conditions. All animals were acclimatized for at least 1 week before surgery and allowed free access to standard food and water. The experiments were approved by the institutional animal care and use subcommittee of the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China). Each rat was intraperitoneally anesthetized with chloral hydrate (0.35 mL/100 g). A 3- to 4-cm lower abdominal midline incision was used to identify and expose the major pelvic ganglia
(MPG) and the CN. Bilateral CNI was performed in 20 rats (CNI group) and the other 5 rats were subjected to only laparotomy (sham group). In the CNI group, bilateral CNs were crushed by a non-serrated hemostat (Karl Stortz, Tuttlingen, Germany). The hemostat was applied with full tip closure to each CN 1 mm distal to the MPG for 2 minutes. Then, the CNI group was randomly divided into 4 groups of 5 rats each, which received periprostatic implantation of (i) MSCs (1 106 cells in PBS 20 mL; M group); (ii) MSCs þ EPCs (1 106 MSCs þ 1 106 EPCs in PBS 20 mL; ME group); (iii) EPCs (1 106 cells in PBS 20 mL; E group); and (iv) PBS 20 mL (control group). The injection method was performed as previously described.8 Fibrin scaffolds of cells in PBS were prepared using a Porcine Fibrin Sealant Kit (Hangzhou Puji Medical Technology Development Co Ltd, Hangzhou, China) according to the manufacturer’s instructions. The mixtures of cells and fibrin scaffolds were injected along the CN towards the MPG.
Evaluation of Erectile Function Erectile function was evaluated by electrical stimulation of the CN as previously described using the BL-420s Biological Functional System (Chengdu Taimeng Technology Ltd, Chengdu, China). 2 weeks after treatment, the rats were intraperitoneally anesthetized again with chloral hydrate (0.35 mL/100 g). A midline incision from the neck to the upper thorax was used to expose the right carotid artery. Then, a heparinized 24-gauge Silastic cannula was fixed to measure the mean arterial pressure (MAP). The skin of the penis was stripped off to expose the corpus cavernosa and then a heparinized 23-gauge butterfly needle was inserted into the penile crus and connected to polyethylene-50 tubing to measure the intracavernous pressure (ICP). The CN was exposed again and stimulated by a bipolar electrode (5 V at 12 Hz for 50 seconds). During tumescence, the maximal ICP (mICP) and total ICP (tICP; area under the curve) were recorded. Ratios of mICP and tICP to MAP were calculated to evaluate erectile function.
Immunofluorescence and Immunohistochemical Stainings The penile and MPG segments were harvested, cut into frozen tissue sections, and stored at 80 C. For fluorescence microscopy, a penis or MPG section (10 mm) was fixed in methyl
Table 1. Primer sequences used in this study Gene
Forward
Reverse
BDNF GAPDH NGF VEGF
GTGGAGTCTGCATATGGGAGG GTTACCAGGGCTGCCTTCTC GAGCGCAGCGAGTTTTGG GCTCGGTGCTGGAATTTGATA
GGGCTCCCAATTCCACTGTT GATGGTGATGGGTTTCCCGT AGTGTGGTTCCGCCTGTATG TAGAGCAATCTCCCCAAGCC
BDNF ¼ brain-derived neurotrophic factor; GAPDH ¼ glyceraldehyde 3-phosphate dehydrogenase; NGF ¼ nerve growth factor; VEGF ¼ vascular endothelial growth factor. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
287
Figure 1. Panels A to D and E to G show the characterization of mesenchymal stem cells and endothelial progenitor cells, respectively. Panel A shows human bone marrow mesenchymal stem cells with a spindle-shaped fibroblastic morphology and an array resembling a whirlpool. Panels B and C show that after induction the cells possessed phenotypes typical of osteocytes (stained with alizarin red S) and adipocytes (stained with oil red O), respectively. Panel D shows that cells expressed the mesenchymal stem cell markers CD73, CD90, and CD105, but not the hematopoietic or endothelial markers CD11b, CD31, CD34, CD45, and CD103. Panel E1 shows that human umbilical cord blood endothelial progenitor cells formed representative colonies with a spindle-shaped appearance after 7 days. Panel E2 shows cells mixed together and forming a typical cobblestone appearance. Panel F shows cells were doubly positive for UEA-1 and DiI-ac-LDL by immunofluorescence staining. Panel G shows that cells expressed known hematopoietic markers and endothelial markers CD31, CD34, CD105, and vWF, but not CD45 or CD90. DiI-ac-LDL ¼ acetylated low-density lipoprotein labeled with 1,10 -dioctadecyl-3,3,30 ,30 tetramethylindo-carbocyanine perchlorate; UEA-1 ¼ Ulex europaeus agglutinin I. alcohol for 10 minutes at 4 C, washed thrice with PBS, and blocked with 3% bovine serum albumin and 0.1% Triton for 1 hour at room temperature. The penis sections were incubated with antibodies to platelet-endothelial cell adhesion molecule (PECAM-1; 1:100; ABclonal Biotech, Woburn, MA, USA) and a-actin (1:200; Abcam, Cambridge, MA, USA), and MPG sections were incubated with antibodies to S100b (1:100; J Sex Med 2018;15:284e295
Chemicon, Temecula, CA, USA) and myelin basic protein (MBP; 1:100; Abcam) at 4 C overnight. Control sections were incubated without a primary antibody. After washing thrice with PBS, sections were incubated with daylight 488- or 556-conjugated secondary antibody (Invitrogen, San Diego, CA, USA) for 1 hour and washed thrice with PBS. Nuclei were stained with 40 ,6-diamidino-2-phenylindole. Signals were
288
visualized and digital images were obtained with a fluorescence microscope. Fluorescence degree was examined with ImageJ (National Institutes of Health, Bethesda, MD, USA). For immunohistochemical staining, the penile tissue sections (4 mm) were fixed in cold methanol and blocked with 3% bovine serum albumin and 0.1% Triton-X100 for 1 hour at room temperature. Then, the slides were stained with primary antibodies against caspase-3 (1:400; Cell Signaling Technology, Danvers, MA, USA) and neuronal nitric oxide synthase (nNOS; 1:100; ABclonal Biotech). Immunoreactions were detected with the Dako-Cytomation Envision HRP System (Dako, Agilent, Santa Clara, CA, USA), and the sections were counterstained with hematoxylin (Sigma). Negative controls were stained with only secondary antibodies. Mean density was examined with Image-Pro Plus 6.0 (Media Cybernetics, Shanghai, China).
Western Blot Equal amounts of protein (50 mg/lane) were electrophoresed on sodium dodecylsulfate polyacrylamide gels (8%), transferred to nitrocellulose membranes, and probed with antibodies to PECAM-1 (1:1,000; ABclonal Biotech), a-actin (1:300; Abcam), caspase-3 (1:1,000; Cell Signaling Technology), or nNOS (1:1,000; Cell Signaling Technology). The results were quantified by densitometry (n ¼ 5 per group).
Statistical Analysis Statistical analysis was performed with IBM SPSS 19.0 (IBM Corp, Armonk, NY, USA). All results were expressed as mean ± SD. Differences among groups were evaluated using analysis of variance and Newman-Keuls post hoc analysis. All statistical tests were 2-sided, and a P value less than .05 was considered significant.
RESULTS Isolation and Characterization of MSCs and EPCs Primary human bone marrow MSCs showed the typical spindle-shaped fibroblastic morphology with an array resembling a whirlpool. After successful induction, the cells presented phenotypes typical of osteocytes and adipocytes. In addition, the cells expressed known MSCs markers CD73, CD90, and CD105, but not hematopoietic and endothelial markers CD11b, CD31, CD34, CD45, and CD103 (Figure 1AeD). Primary human umbilical cord blood EPCs showed representative colonies with a spindle-shaped appearance, and the colonies mixed together and formed the typical cobblestone appearance. Immunofluorescence staining showed that the cells were doubly positive for UEA-1 and DiI-ac-LDL. In addition, the cells expressed known hematopoietic or endothelial markers CD31, CD34, CD105, and vWF (Figure 1EeG).
Fang et al
Combined Transplantation of MSCs and EPCs Better Restores Erectile Function in Rats With CNI Erectile function was evaluated by electrical stimulation of the CN 2 weeks after CNI and treatment. There were no significant differences in the MAP and basic ICP among the 5 experimental groups (data not shown). As shown in Figure 2, compared with the PBS group (0.59 ± 0.05 and 42.6 ± 3.50), combined implantation of MSCs and EPCs (ME group, 1.06 ± 0.03 and 76.4 ± 2.24) and simple implantation of MSCs (M group, 0.98 ± 0.03 and 70.2 ± 2.32) or EPCs (E group, 0.83 ± 0.02 and 48.0 ± 1.79) significantly increased the mICP/MAP and tICP/MAP ratios. Furthermore, the data of the ME group were better than those of the M or E group.
Transplantations of MSCs and/or EPCs Increase Endothelial and Smooth Muscle Contents of the Corpus Cavernosum The penile segments were examined for endothelium and smooth muscle contents. Transplantations of MSCs and/or EPCs restored the expression of PECAM-1 and a-actin in rats with CNI (Figure 3A). The percentages of endothelial (Figure 3B) and smooth muscular (Figure 3C) contents of the corpus cavernosum in the ME group (10.70 ± 0.78 and 6.86 ± 0.35) were higher than those of the M (8.44 ± 0.86 and 5.16 ± 0.45) or E (6.26 ± 0.80 and 5.10 ± 0.31) group. The results of western blot for PECAM-1 and a-actin were consistent with the immunohistochemical staining (Figure 3DeF).
Transplantations of MSCs and/or EPCs Decrease Caspase-3 Expression and Increase Penile nNOS Expression Expressions of caspase-3 and nNOS were examined by immunohistochemical staining in the corpus cavernosum 2 weeks after CNI and treatment. After treatment of MSCs or combined treatments of MSCs and EPCs, the expression of caspase-3 decreased in rats with CNI (Figure 4A, B). Transplantation of MSCs or EPCs or combined transplantation increased the expression of nNOS in rats with CNI (Figure 4C, D). Results of western blot for nNOS and caspase-3 were consistent with the immunohistochemical staining (Figure 4EeG).
Combined Transplantation of MSCs and EPCs Better Restores Neural Component of MPG in CNI Rats The MPG segments were examined for the nerve cell marker MBP and S100b by immunofluorescence staining 2 weeks after CNI and treatment. Transplantations of MSCs and/or EPCs restored the expression of MBP and S100b in rats with CNI. Compared with single implantation of stem cells, combined
J Sex Med 2018;15:284e295
289
MSC Plus EPC for CNI-Related ED in Rats
Figure 2. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells better restores erectile function in rats with cavernosal nerve injury. Panel A shows representative ICP responses for the sham, PBS, ME, M, and E groups 2 weeks after cavernosal nerve injury and treatment. Panels B and C show ratios of maximal ICP and total ICP (area under the curve) to MAP. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M, and E groups; $P < .01 vs PBS and E groups; #P < .05 vs PBS group; s P < .05 vs M group and P < .01 vs PBS and E groups, respectively. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; ICP ¼ intracavernous pressure; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; MAP ¼ mean arterial pressure; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; PBS ¼ phosphate buffered saline 20 mL (control). Figure 2 is available in color at www.jsm.jsexmed.org.
transplantation of MSCs and EPCs exhibited higher expression of MBP and S100b (Figure 5).
Underlying Mechanisms of Enhanced Effect of Combined Transplantation of MSCs and EPCs on Restoration of Erectile Function in Rats With CNI 72 hours after mono- or coculture of cells, MSCs and EPCs were sorted by fluorescence-activated cell sorting. We used a panel of 2 dyes with different channel gating strategies and sorted the MSC (CD90-allophycocyanin) and EPC (CD31-FITC) populations. Then, RNA of neurotrophic factors in sorted MSCs (co-MSCs or 72-hour co-MSCs) or monoculture MSCs were extracted and detected. As shown in Figure 6A, the expression levels of VEGF and NGF in co-MSCs or 72-hour co-MSCs were significantly higher than those of primary MSCs. In addition, the culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. Protein levels of VEGF, NGF, and BDNF were measured using enzyme-linked immunosorbent assay kits. As shown in Figure 6B, expression levels of VEGF and NGF in coculture J Sex Med 2018;15:284e295
MSCs and EPCs (131.10 ± 26.23 and 4.05 ± 0.31 pg/ml) were significantly higher than those of primary MSCs (61.37 ± 5.40 and 1.15 ± 1.11 pg/ml) and EPCs (2.77 ± 1.86 and 1.14 ± 0.37 pg/ml). However, the expression level of BDNF did not differ among the 3 groups.
DISCUSSION Owing to inevitable damage of the PAN, ED is one of the most common complications after pelvic surgery.1,2,17 Phosphodiesterase type 5 inhibitors have been widely applied for patients with ED.18,19 However, it is only partly effective and some patients cannot tolerate its side effects. Thus, a new strategy is needed to cure nerve injury-related ED. In recent years, different kinds of stem cells have been applied in regenerative medicine. MSCs are adult stem cells derived from the bone marrow and have multidirectional differentiation potential. According to the specific microenvironment, MSCs can differentiate into various cell types and thus repair damaged tissues.20,21 Previous studies have proved MSCs effective for treatment of ED in animals caused by age, diabetes, and nerve
290
Fang et al
Figure 3. Transplantations of mesenchymal stem cells and/or endothelial progenitor cells increase endothelial and smooth muscle contents of the corpus cavernosum. Panel A shows expressions of PECAM-1 and a-actin in corpus cavernosum 2 weeks after cavernous nerve injury and treatment. Panels B and C show quantitative analysis of endothelial and smooth muscular contents, respectively, in cavernous tissue performed using Image-Pro Plus. Panel D shows representative western blot for PECAM-1 and a-actin in each group. Panels E and F present data as the relative density of PECAM-1 and a-actin protein, respectively, compared with that of b-actin. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M, and E groups; #P < .01 vs PBS and E groups; $P < .01 vs PBS group. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; PBS ¼ phosphate buffered saline 20 mL (control); PECAM-1 ¼ platelet endothelial cell adhesion molecule-1.
injury.5e8 EPCs are MNCs that circulate in the blood and are derived from different tissues. They can participate in vascular repair by migrating to distant vessels, differentiating into mature endothelial cells, and replacing old cells. Recent studies have shown that, similar to MSCs, implantation of EPCs also can restore erectile function in animals with ED.22e24 However, the clinical efficiency of stem cells for ED therapy has not met expectations, suggesting that more efficient stem cells and methods are needed to better restore erectile function.9 Recently, more and more studies have focused on the effect of combined transplantation of MSCs and EPCs on regeneration medicine. Because the repair and regeneration of impaired tissue requires a sufficient blood supply, the promotion of neovascularization during tissue repair is the key point of regenerative medicine. EPCs have been proved to not only participate in angiogenesis and microvascular neovascularization but also serve as trophic mediators for MSC engraftment through paracrine signaling. In contrast, MSCs have been proved to differentiate into injury cells and repair impaired tissues. Many studies have reported that combined transplantation of MSCs and EPCs is more effective than single-cell transplantation in different
diseases, such as cardiovascular disease,11,12 cerebrovascular disease,13 and bone-related disease.14,15 However, whether combined transplantation of MSCs and EPCs is more effective in treating ED is unknown. In the present study, we examined the effect of combined transplantation of MSCs and EPCs on the restoration of erectile function after CNI-related ED. The results showed that periprostatic transplantation of MSCs or EPCs could increase the mICP/MAP and tICP/MAP ratios and improve erectile function in rats with CNI, and that combined transplantation of the 2 cell types had a better effect on restoration of erectile function than single cell type transplantation. Loss of endothelial and smooth muscle contents has been reported to be due to CNI-related ED.25,26 In this study, we found that expressions of PECAM-1 and a-actin in penile sections, which represented cavernous endothelial and smooth muscle contents, respectively, increased after transplantations of MSCs and/or EPCs. In addition, it has been proved that nerve injury-related ED can lead to deficiency of penile nNOS and insensitivity to phosphodiesterase type 5 inhibitors.27 In the present study, we found that implantation of MSCs and/or EPCs could reverse the expression of nNOS in rats with CNI. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
291
Figure 4. Transplantations of mesenchymal stem cells and/or endothelial progenitor cells decrease caspase-3 expression and increase penile nNOS expression. Panels A and C show expressions of caspase-3 and nNOS, respectively, in the corpus cavernosum 2 weeks after cavernous nerve injury and treatment. Panels B and D show quantitative analysis of caspase-3 and nNOS, respectively, in cavernous tissue using Image-Pro Plus. Panel E shows representative western blot for nNOS and caspase-3 in each group. Panels F and G present data as J Sex Med 2018;15:284e295
292
Fang et al
Figure 5. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells better restores the neural component of the MPG in rats with cavernous nerve injury. Expressions of nerve cell marker MBP and S100b in MPG were detected 2 weeks after cavernous nerve injury and treatment. Quantitative analysis was performed using ImageJ. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M and E groups; $P < .01 vs PBS and E groups; #P < .01 vs PBS group; sP < .05 vs PBS group, respectively. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; MPG ¼ major pelvic ganglia; nNOS ¼ neuronal nitric oxide synthase; PBS ¼ phosphate buffered saline 20 mL (control).
=
the relative density of caspase-3 and nNOS protein, respectively, compared with that of b-actin. Each bar represent mean ± SD (n ¼ 5 animals per group). *P < .05 vs PBS group; #P < .01 vs PBS group. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; nNOS ¼ neuronal nitric oxide synthase; PBS ¼ phosphate buffered saline 20 mL (control). J Sex Med 2018;15:284e295
293
MSC Plus EPC for CNI-Related ED in Rats
Figure 6. Coculture of MSCs and EPCs enhances paracrine activity of MSCs. Panel A shows that 72 hours after mono- or coculture of cells, RNAs of neurotrophic factors in co-MSCs were extracted and detected. Expression levels of VEGF and NGF in co-MSCs or 72-hour co-MSCs were significantly higher than those of primary MSCs. *P < .05 vs MSC group; #P < .05 vs MSC and 72-hour MSC groups; $P < .01 vs MSC and 72-hour MSC groups, respectively. In addition, the culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. Panel B shows protein levels of VEGF, NGF, and BDNF measured using enzyme-linked immunosorbent assay kits. Expression levels of VEGF and NGF in coculture MSCs and EPCs were significantly higher than those of primary MSCs and EPCs. However, the expression level of BDNF did not differ among the 3 groups. *P < .05 vs co-ME group; #P < .01 vs co-ME group. BDNF ¼ brain-derived neurotrophic factor; co-ME ¼ mesenchymal stem cells plus endothelial progenitor cells; co-MSCs ¼ monoculture and sorted mesenchymal stem cells; EPCs ¼ endothelial progenitor cells; MSCs ¼ mesenchymal stem cells; NGF ¼ nerve growth factor; VEGF ¼ vascular endothelial growth factor.
The exact mechanism of stem cells in the treatment for ED is not clear. Previous studies have found that intracavernous MSCs could differentiate into cavernous endothelial cells and smooth muscle cells.28 However, periprostatic implantation, but not direct intracavernous implantation of MSCs, also could increase endothelial and smooth muscle contents of animals with CNI,8 suggesting that direct differentiation of stem cells to target cells might not be the unique mechanism. In recent years, more and more evidences have shown that the paracrine activity of MSCs plays a key role in regeneration medicine.29,30 In the present study, expression levels of VEGF and NGF in coculture MSCs and EPCs were significantly higher than those of monoculture MSCs or EPCs. Moreover, the expression of S100b and MBP were higher in the ME group than in the M group, suggesting that MSCs might restore CN fibers by secreting neurotrophin factors, and EPCs might enhance the paracrine activity of MSCs. J Sex Med 2018;15:284e295
In addition, the expression level of caspase-3 decreased after treatment of stem cells, suggesting that stem cells might decrease ratios of apoptotic cells in the corpus cavernous and repair ED.
CONCLUSION In the present study, we established an ED rat model by crushing the bilateral CNs, and, to our knowledge, for the 1st time to investigate the effect of combined transplantation of MSCs and EPCs on restoration of erectile function in rats with CNI. The results showed that combined periprostatic transplantation of MSCs and EPCs could increase mICP/MAP and tICP/MAP ratios and improve erectile function in rats with CNI more effectively. MSCs might restore CN fibers by secreting neurotrophin factors containing VEGF and NGF, and EPCs could enhance the paracrine activity of MSCs.
294
Corresponding Author: Hong-bo Wei, MD, Department of Gastrointestinal Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Tianhe Road 600, Guangzhou, 510630, China. Tel: þ86-020-8525-2228; Fax: þ86-020-8525-3336; E-mail: [email protected] Conflicts of Interest: The authors report no conflicts of interest. Funding: The Natural Science Foundation of Guangdong Province, China (grants 2015A030313063 and 2017A030313505) and the Science and Technology Planning Project of Guangdong Province, China (grant 2014B090901066).
STATEMENT OF AUTHORSHIP Category 1 (a) Conception and Design Jia-feng Fang; Hong-bo Wei (b) Acquisition of Data Xu-na Huang; Xiao-yan Han; Xi Ouyang; Lei Fan (c) Analysis and Interpretation of Data Xin Zhao; Ze-hong Chen Category 2 (a) Drafting the Article Jia-feng Fang (b) Revising It for Intellectual Content Jia-feng Fang; Xu-na Huang Category 3 (a) Final Approval of the Completed Article Hong-bo Wei
REFERENCES 1. Hendren SK, O’Connor BI, Liu M, et al. Prevalence of male and female sexual dysfunction is high following surgery for rectal cancer. Ann Surg 2005;242:212-223. 2. Sivarajan G, Prabhu V, Taksler GB, et al. Ten-year outcomes of sexual function after radical prostatectomy: results of a prospective longitudinal study. Eur Urol 2014;65:58-65. 3. Luca F, Valvo M, Ghezzi TL, et al. Impact of robotic surgery on sexual and urinary functions after fully robotic nerve-sparing total mesorectal excision for rectal cancer. Ann Surg 2013; 257:672-678. 4. Salonia A, Burnett AL, Graefen M, et al. Prevention and management of postprostatectomy sexual dysfunctions. Part 1: choosing the right patient at the right time for the right surgery. Eur Urol 2012;62:261-272.
Fang et al mouse model of cavernous nerve injury. J Sex Med 2014; 11:411-423. 8. You D, Jang MJ, Lee J, et al. Periprostatic implantation of human bone marrow-derived mesenchymal stem cells potentiates recovery of erectile function by intracavernosal injection in a rat model of cavernous nerve injury. Urology 2013;81:104-110. 9. Bahk JY, Jung JH, Han H, et al. Treatment of diabetic impotence with umbilical cord blood stem cell intracavernosal transplant: preliminary report of 7 cases. Exp Clin Transplant 2010;8:150-160. 10. Altabas V, Altabas K, Kirigin L. Endothelial progenitor cells (EPCs) in ageing and age-related diseases: how currently available treatment modalities affect EPC biology, atherosclerosis, and cardiovascular outcomes. Mech Ageing Dev 2016;159:49-62. 11. Derval N, Barandon L, Dufourcq P, et al. Epicardial deposition of endothelial progenitor and mesenchymal stem cells in a coated muscle patch after myocardial infarction in a murine model. Eur J Cardiothorac Surg 2008;34:248-254. 12. Suuronen EJ, Price J, Veinot JP, et al. Comparative effects of mesenchymal progenitor cells, endothelial progenitor cells, or their combination on myocardial infarct regeneration and cardiac function. J Thorac Cardiovasc Surg 2007;134:12491258. 13. Sun K, Zhou Z, Ju X, et al. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells for tissue engineering: a systematic review and meta-analysis. Stem Cell Res Ther 2016;7:151. 14. Usami K, Mizuno H, Okada K, et al. Composite implantation of mesenchymal stem cells with endothelial progenitor cells enhances tissue-engineered bone formation. J Biomed Mater Res A 2009;90:730-741. 15. Zigdon-Giladi H, Bick T, Lewinson D, et al. Mesenchymal stem cells and endothelial progenitor cells stimulate bone regeneration and mineral density. J Periodontol 2014;85:984-990. 16. Melero-Martin JM, Khan ZA, Picard A, et al. In vivo vasculogenic potential of human blood-derived endothelial progenitor cells. Blood 2007;109:4761-4768. 17. Saito S, Fujita S, Mizusawa J, et al. Male sexual dysfunction after rectal cancer surgery: results of a randomized trial comparing mesorectal excision with and without lateral lymph node dissection for patients with lower rectal cancer: Japan Clinical Oncology Group Study JCOG0212. Eur J Surg Oncol 2016;42:1851-1858.
5. Lin CS, Xin ZC, Wang Z, et al. Stem cell therapy for erectile dysfunction: a critical review. Stem Cells Dev 2012;21:343-351.
18. Loeb S, Folkvaljon Y, Lambe M, et al. Use of phosphodiesterase type 5 inhibitors for erectile dysfunction and risk of malignant melanoma. JAMA 2015;313:2449-2455.
6. Qiu X, Lin H, Wang Y, et al. Intracavernous transplantation of bone marrow-derived mesenchymal stem cells restores erectile function of streptozocin-induced diabetic rats. J Sex Med 2011;8:427-436.
19. Lombardi G, Nelli F, Celso M, et al. Treating erectile dysfunction and central neurological diseases with oral phosphodiesterase type 5 inhibitors. Review of the literature. J Sex Med 2012; 9:970-985.
7. Ryu JK, Kim DH, Song KM, et al. Intracavernous delivery of clonal mesenchymal stem cells restores erectile function in a
20. Ciccocioppo R, Corazza GR. Mesenchymal stem cells for fistulising Crohn’s disease. Lancet 2016;388:1251-1252. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
295
21. Kalladka D, Sinden J, Pollock K, et al. Human neural stem cells in patients with chronic ischaemic stroke (PISCES): a phase 1, first-in-man study. Lancet 2016;388:787-796.
26. Iacono F, Giannella R, Somma P, et al. Histological alterations in cavernous tissue after radical prostatectomy. J Urol 2005; 173:1673-1676.
22. Condorelli RA, Calogero AE, Vicari E, et al. Arterial erectile dysfunction and peripheral arterial disease: reliability of a new phenotype of endothelial progenitor cells and endothelial microparticles. J Androl 2012;33:1268-1275.
27. Zagaja GP, Mhoon DA, Aikens JE, et al. Sildenafil in the treatment of erectile dysfunction after radical prostatectomy. Urology 2000;56:631-634.
23. Zhang Y, Chen Z, Wang T, et al. Treatment of diabetes mellitus-induced erectile dysfunction using endothelial progenitor cells genetically modified with human telomerase reverse transcriptase. Oncotarget 2016;7:39302-39315. 24. Liao CH, Wu YN, Lin YH, et al. Restoration of erectile function with intracavernous injections of endothelial progenitor cells after bilateral cavernous nerve injury in rats. Andrology 2015; 3:924-932. 25. Leungwattanakij S, Bivalacqua TJ, Usta MF, et al. Cavernous neurotomy causes hypoxia and fibrosis in rat corpus cavernosum. J Androl 2003;24:239-245.
J Sex Med 2018;15:284e295
28. Song YS, Lee HJ, Park IH, et al. Potential differentiation of human mesenchymal stem cell transplanted in rat corpus cavernosum toward endothelial or smooth muscle cells. Int J Impot Res 2007;19:378-385. 29. Tan J, Wu W, Xu X, et al. Induction therapy with autologous mesenchymal stem cells in living-related kidney transplants: a randomized controlled trial. JAMA 2012;307:1169-1177. 30. Chen QH, Liu AR, Qiu HB, et al. Interaction between mesenchymal stem cells and endothelial cells restores endothelial permeability via paracrine hepatocyte growth factor in vitro. Stem Cell Res Ther 2015;6:44.
BASIC SCIENCE
Combined Transplantation of Mesenchymal Stem Cells and Endothelial Progenitor Cells Restores Cavernous Nerve Injury-Related Erectile Dysfunction Jia-feng Fang, MD,1,* Xu-na Huang, MD,2,* Xiao-yan Han, MD,2 Xi Ouyang, MD,1 Lei Fan, MD,3 Xin Zhao, MD,1 Ze-hong Chen, MD,1 and Hong-bo Wei, MD1
ABSTRACT
Background: Whether combined transplantation of mesenchymal stem cells (MSCs) and endothelial progenitor cells (EPCs) is more effective than transplantation of a single cell type in the restoration of erectile function is unknown. Aim: To investigate the effect of combined transplantation of MSCs and EPCs on restoration of erectile function in rats with cavernous nerve injury (CNI). Methods: MSCs were isolated from human bone marrow and EPCs were isolated from human umbilical cord blood. MSCs and EPCs were identified by flow cytometry and in vitro differentiation or immunofluorescence staining. 25 8-week-old male Sprague-Dawley rats were allocated to 1 of 5 groups: sham operation group, bilateral CNI group receiving periprostatic implantation of MSCs plus EPCs, MSCs, EPCs, or phosphate buffered saline (control group). 2 weeks after CNI and treatment, erectile function of rats was measured by electrically stimulating the CN. The penis and major pelvic ganglia were harvested for histologic examinations. RNA and protein levels of neurotrophin factors (vascular endothelial growth factor, nerve growth factor, and brain-derived neurotrophic factor) in mono- or coculture MSCs and EPCs were assessed by real-time polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. Outcomes: Intracavernous pressure and mean arterial pressure were measured to evaluate erectile function. Histologic examinations of the penis and major pelvic ganglia and RNA and protein levels of neurotrophin factors in MSCs and EPCs were performed. Results: MSCs and EPCs expressed the specified cell markers and exhibited the typical appearance and characteristics. Treatments using MSCs and/or EPCs could increase endothelial and smooth muscle contents of the corpus cavernosum, decrease caspase-3 expression and increase penile neuronal nitric oxide synthase expression, and restore the neural component of the major pelvic ganglia in rats with CNI. Combined transplantation of MSCs and EPCs had a better effect on improving erectile function than single transplantation of MSCs or EPCs. Expression levels of vascular endothelial growth factor and nerve growth factor in coculture MSCs and EPCs were significantly higher than those of primary MSCs or EPCs. Clinical Translation: Combined transplantation of MSCs and EPCs was more effective in restoring erectile function in CNI-related erectile dysfunction models. Strengths and Limitations: The study, for the 1st time, proved that combined transplantation of MSCs and EPCs was more effective in restoring erectile function in rats with CNI. The rat model might not represent the human condition. Conclusion: Combined periprostatic transplantation of MSCs and EPCs could restore erectile function in rats with CNI more effectively. MSCs might restore CN fibers by secreting neurotrophin factors such as vascular endothelial growth factor and nerve growth factor, and EPCs could enhance the paracrine activity of MSCs. Fang J-f, Huang X-n, Han X-y, et al. Combined Transplantation of Mesenchymal Stem Cells and Endothelial Received October 11, 2017. Accepted January 9, 2018. 1
Department of Gastrointestinal Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China;
2
Central Laboratory, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China;
284
3
Department of Spine Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, China
*Equivalent contribution. Copyright ª 2018, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved. https://doi.org/10.1016/j.jsxm.2018.01.005
J Sex Med 2018;15:284e295
285
MSC Plus EPC for CNI-Related ED in Rats
Progenitor Cells Restores Cavernous Nerve Injury-Related Erectile Dysfunction. J Sex Med 2018;15:284e295. Copyright 2018, International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.
Key Words: Mesenchymal Stem Cells; Endothelial Progenitor Cells; Erectile Dysfunction; Combined Transplantation; Paracrine Factor
INTRODUCTION Owing to intraoperative damage of the pelvic autonomic nerve (PAN), erectile dysfunction (ED) frequently occurs after pelvic surgery.1,2 Although PAN preservation has been applied to avoid urogenital dysfunction, some cases of PAN injury and related ED complication are inevitable.3,4 Moreover, phosphodiesterase type 5 inhibitors are only partly effective and some patients cannot tolerate their side effects. Thus, a new strategy is needed to cure nerve injury-related ED. Recently, mesenchymal stem cells (MSCs) from different tissues have been used for treatment of ED caused by age, diabetes, and nerve injury in animals,5e8 and the results have shown that implantation of stem cells can restore erectile function in animal models. However, a clinical trial of stem cell therapy for ED in Korea showed that despite having increased penile rigidity, none of the 7 patients with diabetes-related ED could achieve vaginal penetration.9 The result suggests that more efficient stem cells and methods are needed to better restore erectile function. Endothelial progenitor cells (EPCs) are mononuclear cells (MNCs) that circulate in the blood and are derived from different tissues. They can participate in vascular repair by migrating to distant vessels, differentiating into mature endothelial cells, and replacing old cells.10 Recent researches have shown that combined transplantation of MSCs and EPCs is more effective than transplantation of a single cell type in different diseases, such as cardiovascular disease,11,12 cerebrovascular disease,13 and bone-related disease.14,15 However, whether combined transplantation of MSCs and EPCs is more effective in restoring erectile function is unknown. In the present study, we established an ED rat model by crushing the bilateral cavernous nerves (CNs) and investigated the effect of combined transplantation of MSCs and EPCs on the amelioration of ED related to CN injury (CNI).
METHODS Isolation and Culture of MSCs and EPCs Institutional review board approval was obtained for all procedures. Written informed consent was obtained from the donors of the human bone marrow and umbilical cord blood samples. Human bone marrow MSCs were collected from young male healthy donors. Briefly, preparation of MNCs from bone marrow samples was performed using Ficoll density gradient centrifugation. Then, MNCs were resuspended in MSC culture
J Sex Med 2018;15:284e295
medium containing low glucose Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), L-glutamine 2 mmol/L, sodium pyruvate 1 mmol/L, penicillin 100 U/mL, and streptomycin 100 mg/mL (all from Gibco, Grand Island, NY, USA) in 5% CO2 in a 37 C incubator. All non-adherent cells were removed and the medium was changed every 3 days. EPCs were isolated from human umbilical cord blood samples as previously described.16 Briefly, the blood was diluted with Dulbecco’s phosphate buffered saline (DPBS), overlaid with an equal volume of Ficoll, and centrifuged for 15 minutes at room temperature. MNCs were isolated and washed twice with DPBS and then cultured on 1% gelatin-coated plates using EPC medium: endothelial growth medium 2 (EGM-2; except for hydrocortisone; Lonza, Basel, Switzerland) supplemented with 20% FBS and 1 glutamine-penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA). The culture medium was changed every other day.
Characterization of MSCs and EPCs For flow cytometry, MSCs and EPCs were incubated with fluorescein isothiocyanate (FITC)-conjugated antibodies for 30 minutes at 4 C. The following antibodies were used: CD11b, CD31, CD34, CD45, CD73, CD90, CD105, and CD105 for MSCs and CD31, CD34, CD45 CD90, CD105, and vWF for EPCs. The cells were washed twice with PBS. FACSCalibur flow cytometer and CELLQuest software (BD Bioscience, San Jose, CA, USA) were used to analyze antibody binding. MSCs at passage 2 were used to assess the in vitro potential of differentiating into osteocytes and adipocytes as described previously.6 Cells were incubated in related medium: (i) adipogenic differentiation medium (DMEM and glucose 1 g/mL [DMEMLG] containing 10% FBS, ascorbate-1 phosphate 50 mg/mL, dexamethasone 107 mol/L, and indomethacin 50 mg/mL); and (ii) osteogenic differentiation medium (DMEM-LG containing 10% FBS, ascorbate-2 phosphate 50 mg/mL, dexamethasone 108 mol/L, and b-glycerophosphate 10 mmol/L). The medium was changed every 3 days. EPCs at passages 2 to 4 were used for assessment of characterization. Cells were washed with DPBS, fixed with 4% paraformaldehyde (Sigma, St Louis, MO, USA) and then incubated with FITC-conjugated Ulex europaeus agglutinin I (UEA-1; Sigma) in the dark at 37 C for 20 minutes and acetylated low-density lipoprotein labeled with 1,10 -dioctadecyl-3,3,30 ,30 -tetramethylindo-
286
Fang et al
carbocyanine perchlorate (DiI-ac-LDL; Invitrogen, Waltham, MA, USA) at 37 C for 4 hours. Cells were washed twice with DPBS and fixed with 4% paraformaldehyde for 30 minutes. Samples were observed under fluorescence microscopy.
Coculture of MSCs and EPCs MSCs and EPCs at passage 3 were mixed at a ratio of 1:2. Cells were cultured in EGM-2 and 5% FBS for 72 hours. Monocultures of MSCs and EPCs were used as control groups.
Real-Time Polymerase Chain Reaction RNAs of vascular endothelial growth factor (VEGF), nerve growth factor (NGF), and brain-derived neurotrophic factor (BDNF) in MSCs were extracted using TRIzol reagent kit (Invitrogen). RNA was reverse transcribed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan). Real-time polymerase chain reaction was performed on an ABI PRISM 7000 sequence detector (Applied Biosystems, Waltham, MA, USA) using SYBR Premix Ex Taq (Perfect Real Time; TaKaRa). The glyceraldehyde 3-phosphate dehydrogenase gene was used as an internal control. The primers used for analysis are listed in Table 1.
Enzyme-Linked Immunosorbent Assay The culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. VEGF, NGF, and BDNF levels were measured the respective enzyme-linked immunosorbent assay kits (R&D System, Minneapolis, MN, USA). Data from 3 independent experiments were statistically analyzed.
Animal Treatment 25 8-week-old male Sprague-Dawley rats (mean weight ¼ 250 g) were obtained from the Guangdong Medical Laboratory Animal Center (Guangdong, China) and housed in a standard animal facility with 12-hour on and off light conditions. All animals were acclimatized for at least 1 week before surgery and allowed free access to standard food and water. The experiments were approved by the institutional animal care and use subcommittee of the Third Affiliated Hospital of Sun Yat-sen University (Guangzhou, China). Each rat was intraperitoneally anesthetized with chloral hydrate (0.35 mL/100 g). A 3- to 4-cm lower abdominal midline incision was used to identify and expose the major pelvic ganglia
(MPG) and the CN. Bilateral CNI was performed in 20 rats (CNI group) and the other 5 rats were subjected to only laparotomy (sham group). In the CNI group, bilateral CNs were crushed by a non-serrated hemostat (Karl Stortz, Tuttlingen, Germany). The hemostat was applied with full tip closure to each CN 1 mm distal to the MPG for 2 minutes. Then, the CNI group was randomly divided into 4 groups of 5 rats each, which received periprostatic implantation of (i) MSCs (1 106 cells in PBS 20 mL; M group); (ii) MSCs þ EPCs (1 106 MSCs þ 1 106 EPCs in PBS 20 mL; ME group); (iii) EPCs (1 106 cells in PBS 20 mL; E group); and (iv) PBS 20 mL (control group). The injection method was performed as previously described.8 Fibrin scaffolds of cells in PBS were prepared using a Porcine Fibrin Sealant Kit (Hangzhou Puji Medical Technology Development Co Ltd, Hangzhou, China) according to the manufacturer’s instructions. The mixtures of cells and fibrin scaffolds were injected along the CN towards the MPG.
Evaluation of Erectile Function Erectile function was evaluated by electrical stimulation of the CN as previously described using the BL-420s Biological Functional System (Chengdu Taimeng Technology Ltd, Chengdu, China). 2 weeks after treatment, the rats were intraperitoneally anesthetized again with chloral hydrate (0.35 mL/100 g). A midline incision from the neck to the upper thorax was used to expose the right carotid artery. Then, a heparinized 24-gauge Silastic cannula was fixed to measure the mean arterial pressure (MAP). The skin of the penis was stripped off to expose the corpus cavernosa and then a heparinized 23-gauge butterfly needle was inserted into the penile crus and connected to polyethylene-50 tubing to measure the intracavernous pressure (ICP). The CN was exposed again and stimulated by a bipolar electrode (5 V at 12 Hz for 50 seconds). During tumescence, the maximal ICP (mICP) and total ICP (tICP; area under the curve) were recorded. Ratios of mICP and tICP to MAP were calculated to evaluate erectile function.
Immunofluorescence and Immunohistochemical Stainings The penile and MPG segments were harvested, cut into frozen tissue sections, and stored at 80 C. For fluorescence microscopy, a penis or MPG section (10 mm) was fixed in methyl
Table 1. Primer sequences used in this study Gene
Forward
Reverse
BDNF GAPDH NGF VEGF
GTGGAGTCTGCATATGGGAGG GTTACCAGGGCTGCCTTCTC GAGCGCAGCGAGTTTTGG GCTCGGTGCTGGAATTTGATA
GGGCTCCCAATTCCACTGTT GATGGTGATGGGTTTCCCGT AGTGTGGTTCCGCCTGTATG TAGAGCAATCTCCCCAAGCC
BDNF ¼ brain-derived neurotrophic factor; GAPDH ¼ glyceraldehyde 3-phosphate dehydrogenase; NGF ¼ nerve growth factor; VEGF ¼ vascular endothelial growth factor. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
287
Figure 1. Panels A to D and E to G show the characterization of mesenchymal stem cells and endothelial progenitor cells, respectively. Panel A shows human bone marrow mesenchymal stem cells with a spindle-shaped fibroblastic morphology and an array resembling a whirlpool. Panels B and C show that after induction the cells possessed phenotypes typical of osteocytes (stained with alizarin red S) and adipocytes (stained with oil red O), respectively. Panel D shows that cells expressed the mesenchymal stem cell markers CD73, CD90, and CD105, but not the hematopoietic or endothelial markers CD11b, CD31, CD34, CD45, and CD103. Panel E1 shows that human umbilical cord blood endothelial progenitor cells formed representative colonies with a spindle-shaped appearance after 7 days. Panel E2 shows cells mixed together and forming a typical cobblestone appearance. Panel F shows cells were doubly positive for UEA-1 and DiI-ac-LDL by immunofluorescence staining. Panel G shows that cells expressed known hematopoietic markers and endothelial markers CD31, CD34, CD105, and vWF, but not CD45 or CD90. DiI-ac-LDL ¼ acetylated low-density lipoprotein labeled with 1,10 -dioctadecyl-3,3,30 ,30 tetramethylindo-carbocyanine perchlorate; UEA-1 ¼ Ulex europaeus agglutinin I. alcohol for 10 minutes at 4 C, washed thrice with PBS, and blocked with 3% bovine serum albumin and 0.1% Triton for 1 hour at room temperature. The penis sections were incubated with antibodies to platelet-endothelial cell adhesion molecule (PECAM-1; 1:100; ABclonal Biotech, Woburn, MA, USA) and a-actin (1:200; Abcam, Cambridge, MA, USA), and MPG sections were incubated with antibodies to S100b (1:100; J Sex Med 2018;15:284e295
Chemicon, Temecula, CA, USA) and myelin basic protein (MBP; 1:100; Abcam) at 4 C overnight. Control sections were incubated without a primary antibody. After washing thrice with PBS, sections were incubated with daylight 488- or 556-conjugated secondary antibody (Invitrogen, San Diego, CA, USA) for 1 hour and washed thrice with PBS. Nuclei were stained with 40 ,6-diamidino-2-phenylindole. Signals were
288
visualized and digital images were obtained with a fluorescence microscope. Fluorescence degree was examined with ImageJ (National Institutes of Health, Bethesda, MD, USA). For immunohistochemical staining, the penile tissue sections (4 mm) were fixed in cold methanol and blocked with 3% bovine serum albumin and 0.1% Triton-X100 for 1 hour at room temperature. Then, the slides were stained with primary antibodies against caspase-3 (1:400; Cell Signaling Technology, Danvers, MA, USA) and neuronal nitric oxide synthase (nNOS; 1:100; ABclonal Biotech). Immunoreactions were detected with the Dako-Cytomation Envision HRP System (Dako, Agilent, Santa Clara, CA, USA), and the sections were counterstained with hematoxylin (Sigma). Negative controls were stained with only secondary antibodies. Mean density was examined with Image-Pro Plus 6.0 (Media Cybernetics, Shanghai, China).
Western Blot Equal amounts of protein (50 mg/lane) were electrophoresed on sodium dodecylsulfate polyacrylamide gels (8%), transferred to nitrocellulose membranes, and probed with antibodies to PECAM-1 (1:1,000; ABclonal Biotech), a-actin (1:300; Abcam), caspase-3 (1:1,000; Cell Signaling Technology), or nNOS (1:1,000; Cell Signaling Technology). The results were quantified by densitometry (n ¼ 5 per group).
Statistical Analysis Statistical analysis was performed with IBM SPSS 19.0 (IBM Corp, Armonk, NY, USA). All results were expressed as mean ± SD. Differences among groups were evaluated using analysis of variance and Newman-Keuls post hoc analysis. All statistical tests were 2-sided, and a P value less than .05 was considered significant.
RESULTS Isolation and Characterization of MSCs and EPCs Primary human bone marrow MSCs showed the typical spindle-shaped fibroblastic morphology with an array resembling a whirlpool. After successful induction, the cells presented phenotypes typical of osteocytes and adipocytes. In addition, the cells expressed known MSCs markers CD73, CD90, and CD105, but not hematopoietic and endothelial markers CD11b, CD31, CD34, CD45, and CD103 (Figure 1AeD). Primary human umbilical cord blood EPCs showed representative colonies with a spindle-shaped appearance, and the colonies mixed together and formed the typical cobblestone appearance. Immunofluorescence staining showed that the cells were doubly positive for UEA-1 and DiI-ac-LDL. In addition, the cells expressed known hematopoietic or endothelial markers CD31, CD34, CD105, and vWF (Figure 1EeG).
Fang et al
Combined Transplantation of MSCs and EPCs Better Restores Erectile Function in Rats With CNI Erectile function was evaluated by electrical stimulation of the CN 2 weeks after CNI and treatment. There were no significant differences in the MAP and basic ICP among the 5 experimental groups (data not shown). As shown in Figure 2, compared with the PBS group (0.59 ± 0.05 and 42.6 ± 3.50), combined implantation of MSCs and EPCs (ME group, 1.06 ± 0.03 and 76.4 ± 2.24) and simple implantation of MSCs (M group, 0.98 ± 0.03 and 70.2 ± 2.32) or EPCs (E group, 0.83 ± 0.02 and 48.0 ± 1.79) significantly increased the mICP/MAP and tICP/MAP ratios. Furthermore, the data of the ME group were better than those of the M or E group.
Transplantations of MSCs and/or EPCs Increase Endothelial and Smooth Muscle Contents of the Corpus Cavernosum The penile segments were examined for endothelium and smooth muscle contents. Transplantations of MSCs and/or EPCs restored the expression of PECAM-1 and a-actin in rats with CNI (Figure 3A). The percentages of endothelial (Figure 3B) and smooth muscular (Figure 3C) contents of the corpus cavernosum in the ME group (10.70 ± 0.78 and 6.86 ± 0.35) were higher than those of the M (8.44 ± 0.86 and 5.16 ± 0.45) or E (6.26 ± 0.80 and 5.10 ± 0.31) group. The results of western blot for PECAM-1 and a-actin were consistent with the immunohistochemical staining (Figure 3DeF).
Transplantations of MSCs and/or EPCs Decrease Caspase-3 Expression and Increase Penile nNOS Expression Expressions of caspase-3 and nNOS were examined by immunohistochemical staining in the corpus cavernosum 2 weeks after CNI and treatment. After treatment of MSCs or combined treatments of MSCs and EPCs, the expression of caspase-3 decreased in rats with CNI (Figure 4A, B). Transplantation of MSCs or EPCs or combined transplantation increased the expression of nNOS in rats with CNI (Figure 4C, D). Results of western blot for nNOS and caspase-3 were consistent with the immunohistochemical staining (Figure 4EeG).
Combined Transplantation of MSCs and EPCs Better Restores Neural Component of MPG in CNI Rats The MPG segments were examined for the nerve cell marker MBP and S100b by immunofluorescence staining 2 weeks after CNI and treatment. Transplantations of MSCs and/or EPCs restored the expression of MBP and S100b in rats with CNI. Compared with single implantation of stem cells, combined
J Sex Med 2018;15:284e295
289
MSC Plus EPC for CNI-Related ED in Rats
Figure 2. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells better restores erectile function in rats with cavernosal nerve injury. Panel A shows representative ICP responses for the sham, PBS, ME, M, and E groups 2 weeks after cavernosal nerve injury and treatment. Panels B and C show ratios of maximal ICP and total ICP (area under the curve) to MAP. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M, and E groups; $P < .01 vs PBS and E groups; #P < .05 vs PBS group; s P < .05 vs M group and P < .01 vs PBS and E groups, respectively. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; ICP ¼ intracavernous pressure; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; MAP ¼ mean arterial pressure; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; PBS ¼ phosphate buffered saline 20 mL (control). Figure 2 is available in color at www.jsm.jsexmed.org.
transplantation of MSCs and EPCs exhibited higher expression of MBP and S100b (Figure 5).
Underlying Mechanisms of Enhanced Effect of Combined Transplantation of MSCs and EPCs on Restoration of Erectile Function in Rats With CNI 72 hours after mono- or coculture of cells, MSCs and EPCs were sorted by fluorescence-activated cell sorting. We used a panel of 2 dyes with different channel gating strategies and sorted the MSC (CD90-allophycocyanin) and EPC (CD31-FITC) populations. Then, RNA of neurotrophic factors in sorted MSCs (co-MSCs or 72-hour co-MSCs) or monoculture MSCs were extracted and detected. As shown in Figure 6A, the expression levels of VEGF and NGF in co-MSCs or 72-hour co-MSCs were significantly higher than those of primary MSCs. In addition, the culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. Protein levels of VEGF, NGF, and BDNF were measured using enzyme-linked immunosorbent assay kits. As shown in Figure 6B, expression levels of VEGF and NGF in coculture J Sex Med 2018;15:284e295
MSCs and EPCs (131.10 ± 26.23 and 4.05 ± 0.31 pg/ml) were significantly higher than those of primary MSCs (61.37 ± 5.40 and 1.15 ± 1.11 pg/ml) and EPCs (2.77 ± 1.86 and 1.14 ± 0.37 pg/ml). However, the expression level of BDNF did not differ among the 3 groups.
DISCUSSION Owing to inevitable damage of the PAN, ED is one of the most common complications after pelvic surgery.1,2,17 Phosphodiesterase type 5 inhibitors have been widely applied for patients with ED.18,19 However, it is only partly effective and some patients cannot tolerate its side effects. Thus, a new strategy is needed to cure nerve injury-related ED. In recent years, different kinds of stem cells have been applied in regenerative medicine. MSCs are adult stem cells derived from the bone marrow and have multidirectional differentiation potential. According to the specific microenvironment, MSCs can differentiate into various cell types and thus repair damaged tissues.20,21 Previous studies have proved MSCs effective for treatment of ED in animals caused by age, diabetes, and nerve
290
Fang et al
Figure 3. Transplantations of mesenchymal stem cells and/or endothelial progenitor cells increase endothelial and smooth muscle contents of the corpus cavernosum. Panel A shows expressions of PECAM-1 and a-actin in corpus cavernosum 2 weeks after cavernous nerve injury and treatment. Panels B and C show quantitative analysis of endothelial and smooth muscular contents, respectively, in cavernous tissue performed using Image-Pro Plus. Panel D shows representative western blot for PECAM-1 and a-actin in each group. Panels E and F present data as the relative density of PECAM-1 and a-actin protein, respectively, compared with that of b-actin. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M, and E groups; #P < .01 vs PBS and E groups; $P < .01 vs PBS group. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; PBS ¼ phosphate buffered saline 20 mL (control); PECAM-1 ¼ platelet endothelial cell adhesion molecule-1.
injury.5e8 EPCs are MNCs that circulate in the blood and are derived from different tissues. They can participate in vascular repair by migrating to distant vessels, differentiating into mature endothelial cells, and replacing old cells. Recent studies have shown that, similar to MSCs, implantation of EPCs also can restore erectile function in animals with ED.22e24 However, the clinical efficiency of stem cells for ED therapy has not met expectations, suggesting that more efficient stem cells and methods are needed to better restore erectile function.9 Recently, more and more studies have focused on the effect of combined transplantation of MSCs and EPCs on regeneration medicine. Because the repair and regeneration of impaired tissue requires a sufficient blood supply, the promotion of neovascularization during tissue repair is the key point of regenerative medicine. EPCs have been proved to not only participate in angiogenesis and microvascular neovascularization but also serve as trophic mediators for MSC engraftment through paracrine signaling. In contrast, MSCs have been proved to differentiate into injury cells and repair impaired tissues. Many studies have reported that combined transplantation of MSCs and EPCs is more effective than single-cell transplantation in different
diseases, such as cardiovascular disease,11,12 cerebrovascular disease,13 and bone-related disease.14,15 However, whether combined transplantation of MSCs and EPCs is more effective in treating ED is unknown. In the present study, we examined the effect of combined transplantation of MSCs and EPCs on the restoration of erectile function after CNI-related ED. The results showed that periprostatic transplantation of MSCs or EPCs could increase the mICP/MAP and tICP/MAP ratios and improve erectile function in rats with CNI, and that combined transplantation of the 2 cell types had a better effect on restoration of erectile function than single cell type transplantation. Loss of endothelial and smooth muscle contents has been reported to be due to CNI-related ED.25,26 In this study, we found that expressions of PECAM-1 and a-actin in penile sections, which represented cavernous endothelial and smooth muscle contents, respectively, increased after transplantations of MSCs and/or EPCs. In addition, it has been proved that nerve injury-related ED can lead to deficiency of penile nNOS and insensitivity to phosphodiesterase type 5 inhibitors.27 In the present study, we found that implantation of MSCs and/or EPCs could reverse the expression of nNOS in rats with CNI. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
291
Figure 4. Transplantations of mesenchymal stem cells and/or endothelial progenitor cells decrease caspase-3 expression and increase penile nNOS expression. Panels A and C show expressions of caspase-3 and nNOS, respectively, in the corpus cavernosum 2 weeks after cavernous nerve injury and treatment. Panels B and D show quantitative analysis of caspase-3 and nNOS, respectively, in cavernous tissue using Image-Pro Plus. Panel E shows representative western blot for nNOS and caspase-3 in each group. Panels F and G present data as J Sex Med 2018;15:284e295
292
Fang et al
Figure 5. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells better restores the neural component of the MPG in rats with cavernous nerve injury. Expressions of nerve cell marker MBP and S100b in MPG were detected 2 weeks after cavernous nerve injury and treatment. Quantitative analysis was performed using ImageJ. Each bar represents mean ± SD (n ¼ 5 animals per group). *P < .01 vs PBS, M and E groups; $P < .01 vs PBS and E groups; #P < .01 vs PBS group; sP < .05 vs PBS group, respectively. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; MPG ¼ major pelvic ganglia; nNOS ¼ neuronal nitric oxide synthase; PBS ¼ phosphate buffered saline 20 mL (control).
=
the relative density of caspase-3 and nNOS protein, respectively, compared with that of b-actin. Each bar represent mean ± SD (n ¼ 5 animals per group). *P < .05 vs PBS group; #P < .01 vs PBS group. E ¼ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; M ¼ 1 106 mesenchymal stem cells in phosphate buffered saline; ME ¼ 1 106 mesenchymal stem cells þ 1 106 endothelial progenitor cells in phosphate buffered saline 20 mL; nNOS ¼ neuronal nitric oxide synthase; PBS ¼ phosphate buffered saline 20 mL (control). J Sex Med 2018;15:284e295
293
MSC Plus EPC for CNI-Related ED in Rats
Figure 6. Coculture of MSCs and EPCs enhances paracrine activity of MSCs. Panel A shows that 72 hours after mono- or coculture of cells, RNAs of neurotrophic factors in co-MSCs were extracted and detected. Expression levels of VEGF and NGF in co-MSCs or 72-hour co-MSCs were significantly higher than those of primary MSCs. *P < .05 vs MSC group; #P < .05 vs MSC and 72-hour MSC groups; $P < .01 vs MSC and 72-hour MSC groups, respectively. In addition, the culture medium was collected from equal cell quantities of MSCs, EPCs, or coculture MSCs and EPCs. Panel B shows protein levels of VEGF, NGF, and BDNF measured using enzyme-linked immunosorbent assay kits. Expression levels of VEGF and NGF in coculture MSCs and EPCs were significantly higher than those of primary MSCs and EPCs. However, the expression level of BDNF did not differ among the 3 groups. *P < .05 vs co-ME group; #P < .01 vs co-ME group. BDNF ¼ brain-derived neurotrophic factor; co-ME ¼ mesenchymal stem cells plus endothelial progenitor cells; co-MSCs ¼ monoculture and sorted mesenchymal stem cells; EPCs ¼ endothelial progenitor cells; MSCs ¼ mesenchymal stem cells; NGF ¼ nerve growth factor; VEGF ¼ vascular endothelial growth factor.
The exact mechanism of stem cells in the treatment for ED is not clear. Previous studies have found that intracavernous MSCs could differentiate into cavernous endothelial cells and smooth muscle cells.28 However, periprostatic implantation, but not direct intracavernous implantation of MSCs, also could increase endothelial and smooth muscle contents of animals with CNI,8 suggesting that direct differentiation of stem cells to target cells might not be the unique mechanism. In recent years, more and more evidences have shown that the paracrine activity of MSCs plays a key role in regeneration medicine.29,30 In the present study, expression levels of VEGF and NGF in coculture MSCs and EPCs were significantly higher than those of monoculture MSCs or EPCs. Moreover, the expression of S100b and MBP were higher in the ME group than in the M group, suggesting that MSCs might restore CN fibers by secreting neurotrophin factors, and EPCs might enhance the paracrine activity of MSCs. J Sex Med 2018;15:284e295
In addition, the expression level of caspase-3 decreased after treatment of stem cells, suggesting that stem cells might decrease ratios of apoptotic cells in the corpus cavernous and repair ED.
CONCLUSION In the present study, we established an ED rat model by crushing the bilateral CNs, and, to our knowledge, for the 1st time to investigate the effect of combined transplantation of MSCs and EPCs on restoration of erectile function in rats with CNI. The results showed that combined periprostatic transplantation of MSCs and EPCs could increase mICP/MAP and tICP/MAP ratios and improve erectile function in rats with CNI more effectively. MSCs might restore CN fibers by secreting neurotrophin factors containing VEGF and NGF, and EPCs could enhance the paracrine activity of MSCs.
294
Corresponding Author: Hong-bo Wei, MD, Department of Gastrointestinal Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Tianhe Road 600, Guangzhou, 510630, China. Tel: þ86-020-8525-2228; Fax: þ86-020-8525-3336; E-mail: [email protected] Conflicts of Interest: The authors report no conflicts of interest. Funding: The Natural Science Foundation of Guangdong Province, China (grants 2015A030313063 and 2017A030313505) and the Science and Technology Planning Project of Guangdong Province, China (grant 2014B090901066).
STATEMENT OF AUTHORSHIP Category 1 (a) Conception and Design Jia-feng Fang; Hong-bo Wei (b) Acquisition of Data Xu-na Huang; Xiao-yan Han; Xi Ouyang; Lei Fan (c) Analysis and Interpretation of Data Xin Zhao; Ze-hong Chen Category 2 (a) Drafting the Article Jia-feng Fang (b) Revising It for Intellectual Content Jia-feng Fang; Xu-na Huang Category 3 (a) Final Approval of the Completed Article Hong-bo Wei
REFERENCES 1. Hendren SK, O’Connor BI, Liu M, et al. Prevalence of male and female sexual dysfunction is high following surgery for rectal cancer. Ann Surg 2005;242:212-223. 2. Sivarajan G, Prabhu V, Taksler GB, et al. Ten-year outcomes of sexual function after radical prostatectomy: results of a prospective longitudinal study. Eur Urol 2014;65:58-65. 3. Luca F, Valvo M, Ghezzi TL, et al. Impact of robotic surgery on sexual and urinary functions after fully robotic nerve-sparing total mesorectal excision for rectal cancer. Ann Surg 2013; 257:672-678. 4. Salonia A, Burnett AL, Graefen M, et al. Prevention and management of postprostatectomy sexual dysfunctions. Part 1: choosing the right patient at the right time for the right surgery. Eur Urol 2012;62:261-272.
Fang et al mouse model of cavernous nerve injury. J Sex Med 2014; 11:411-423. 8. You D, Jang MJ, Lee J, et al. Periprostatic implantation of human bone marrow-derived mesenchymal stem cells potentiates recovery of erectile function by intracavernosal injection in a rat model of cavernous nerve injury. Urology 2013;81:104-110. 9. Bahk JY, Jung JH, Han H, et al. Treatment of diabetic impotence with umbilical cord blood stem cell intracavernosal transplant: preliminary report of 7 cases. Exp Clin Transplant 2010;8:150-160. 10. Altabas V, Altabas K, Kirigin L. Endothelial progenitor cells (EPCs) in ageing and age-related diseases: how currently available treatment modalities affect EPC biology, atherosclerosis, and cardiovascular outcomes. Mech Ageing Dev 2016;159:49-62. 11. Derval N, Barandon L, Dufourcq P, et al. Epicardial deposition of endothelial progenitor and mesenchymal stem cells in a coated muscle patch after myocardial infarction in a murine model. Eur J Cardiothorac Surg 2008;34:248-254. 12. Suuronen EJ, Price J, Veinot JP, et al. Comparative effects of mesenchymal progenitor cells, endothelial progenitor cells, or their combination on myocardial infarct regeneration and cardiac function. J Thorac Cardiovasc Surg 2007;134:12491258. 13. Sun K, Zhou Z, Ju X, et al. Combined transplantation of mesenchymal stem cells and endothelial progenitor cells for tissue engineering: a systematic review and meta-analysis. Stem Cell Res Ther 2016;7:151. 14. Usami K, Mizuno H, Okada K, et al. Composite implantation of mesenchymal stem cells with endothelial progenitor cells enhances tissue-engineered bone formation. J Biomed Mater Res A 2009;90:730-741. 15. Zigdon-Giladi H, Bick T, Lewinson D, et al. Mesenchymal stem cells and endothelial progenitor cells stimulate bone regeneration and mineral density. J Periodontol 2014;85:984-990. 16. Melero-Martin JM, Khan ZA, Picard A, et al. In vivo vasculogenic potential of human blood-derived endothelial progenitor cells. Blood 2007;109:4761-4768. 17. Saito S, Fujita S, Mizusawa J, et al. Male sexual dysfunction after rectal cancer surgery: results of a randomized trial comparing mesorectal excision with and without lateral lymph node dissection for patients with lower rectal cancer: Japan Clinical Oncology Group Study JCOG0212. Eur J Surg Oncol 2016;42:1851-1858.
5. Lin CS, Xin ZC, Wang Z, et al. Stem cell therapy for erectile dysfunction: a critical review. Stem Cells Dev 2012;21:343-351.
18. Loeb S, Folkvaljon Y, Lambe M, et al. Use of phosphodiesterase type 5 inhibitors for erectile dysfunction and risk of malignant melanoma. JAMA 2015;313:2449-2455.
6. Qiu X, Lin H, Wang Y, et al. Intracavernous transplantation of bone marrow-derived mesenchymal stem cells restores erectile function of streptozocin-induced diabetic rats. J Sex Med 2011;8:427-436.
19. Lombardi G, Nelli F, Celso M, et al. Treating erectile dysfunction and central neurological diseases with oral phosphodiesterase type 5 inhibitors. Review of the literature. J Sex Med 2012; 9:970-985.
7. Ryu JK, Kim DH, Song KM, et al. Intracavernous delivery of clonal mesenchymal stem cells restores erectile function in a
20. Ciccocioppo R, Corazza GR. Mesenchymal stem cells for fistulising Crohn’s disease. Lancet 2016;388:1251-1252. J Sex Med 2018;15:284e295
MSC Plus EPC for CNI-Related ED in Rats
295
21. Kalladka D, Sinden J, Pollock K, et al. Human neural stem cells in patients with chronic ischaemic stroke (PISCES): a phase 1, first-in-man study. Lancet 2016;388:787-796.
26. Iacono F, Giannella R, Somma P, et al. Histological alterations in cavernous tissue after radical prostatectomy. J Urol 2005; 173:1673-1676.
22. Condorelli RA, Calogero AE, Vicari E, et al. Arterial erectile dysfunction and peripheral arterial disease: reliability of a new phenotype of endothelial progenitor cells and endothelial microparticles. J Androl 2012;33:1268-1275.
27. Zagaja GP, Mhoon DA, Aikens JE, et al. Sildenafil in the treatment of erectile dysfunction after radical prostatectomy. Urology 2000;56:631-634.
23. Zhang Y, Chen Z, Wang T, et al. Treatment of diabetes mellitus-induced erectile dysfunction using endothelial progenitor cells genetically modified with human telomerase reverse transcriptase. Oncotarget 2016;7:39302-39315. 24. Liao CH, Wu YN, Lin YH, et al. Restoration of erectile function with intracavernous injections of endothelial progenitor cells after bilateral cavernous nerve injury in rats. Andrology 2015; 3:924-932. 25. Leungwattanakij S, Bivalacqua TJ, Usta MF, et al. Cavernous neurotomy causes hypoxia and fibrosis in rat corpus cavernosum. J Androl 2003;24:239-245.
J Sex Med 2018;15:284e295
28. Song YS, Lee HJ, Park IH, et al. Potential differentiation of human mesenchymal stem cell transplanted in rat corpus cavernosum toward endothelial or smooth muscle cells. Int J Impot Res 2007;19:378-385. 29. Tan J, Wu W, Xu X, et al. Induction therapy with autologous mesenchymal stem cells in living-related kidney transplants: a randomized controlled trial. JAMA 2012;307:1169-1177. 30. Chen QH, Liu AR, Qiu HB, et al. Interaction between mesenchymal stem cells and endothelial cells restores endothelial permeability via paracrine hepatocyte growth factor in vitro. Stem Cell Res Ther 2015;6:44.