- Email: [email protected]
db mice
Pharmacological Research 57 (2008) 318–323
Contents lists available at ScienceDirect
Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs
Combretastatin A-4 activates AMP-activated protein kinase and improves glucose metabolism in db/db mice Fang Zhang a , Cheng Sun a , Jingxia Wu a , Chunyan He a , Xinjian Ge a , Wenming Huang b , Yong Zou b , Xingmiao Chen a , Wei Qi a , Qiwei Zhai a,∗ a Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, 294 Taiyuan Road, Shanghai 200031, PR China b Guangzhou Institute of Chemistry, Chinese Academy of Sciences, Guangzhou 510650, PR China
a r t i c l e
i n f o
Article history: Accepted 11 March 2008 Keywords: AMPK Combretastatin A-4 Resveratrol Glucose metabolism db/db mice
a b s t r a c t Resveratrol was reported to increase insulin sensitivity accompanied with the activation of AMP-activated protein kinase (AMPK), which is a key regulator of energy balance and an important drug target for type 2 diabetes. However, the effect of resveratrol structural analogs on AMPK activity and insulin sensitivity is still largely unknown. In this study, we analyzed the effect of several resveratrol structural analogs on AMPK activity in HepG2 cells, and combretastatin A-4 (CA-4) was identified as an activator of AMPK determined by its phosphorylation. AMPK activation was further confirmed by the phosphorylation of downstream acetyl-CoA carboxylase (ACC) and the decrease of upstream ATP level. Further investigation showed that CA-4 activates PPAR transcriptional activity in vitro with the luciferase reporter assay. In addition, we showed that CA-4 activated AMPK and downregulated gluconeogenic enzyme mRNA levels in liver, and improved the fasting blood glucose level in diabetic db/db mice. These results suggested that resveratrol analogs, such as CA-4, can function similarly as resveratrol and may provide important tools for improving insulin sensitivity. © 2008 Elsevier Ltd. All rights reserved.
1. Introduction Diabetes mellitus, previously considered as a disease of minor significance to world health, is now taking its place as one of the main threats to human health in the 21st century [1]. The global figure of people with diabetes is set to rise from the current estimate of over 170 million people and prospectively over 353 million in 2030 [1,2]. The development of diabetes in patients always companied with impaired glucose tolerance or impaired fasting glucose. Therefore, to ameliorate glucose tolerance is still one of the key avenues to treat diabetes [3]. The AMPK pathway is one of the regulatory mechanisms of energy balance at both the cellular and whole-body levels. Once AMPK is activated by low energy status, it switches the cell from ATP-consuming anabolic pathways to ATP-producing catabolic pathways [4,5]. By affecting glucose and lipid metabolism, energy balance is closely related to some metabolic disorders including obesity and type 2 diabetes [5,6]. Therefore, AMPK is considered
∗ Corresponding author. Tel.: +86 21 5492 0903; fax: +86 21 5492 0291. E-mail address: [email protected] (Q. Zhai). 1043-6618/$ – see front matter © 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.phrs.2008.03.002
as an important therapeutic target for the treatment of obesity and type 2 diabetes. For example, the biguanides and thiazolidinediones are the two kinds of antidiabetic drugs targeting AMPK [4,7]. Resveratrol is an activator of the NAD+ dependant protein deacetylase SIRT1, and was shown to increase insulin sensitivity probably due to activation of AMPK [8,9]. Recently, we found that resveratrol at a very low dose of 2.5 mg/kg/day improves insulin sensitivity probably by repressing PTP1B [10]. Previous studies showed that some chemicals derived from resveratrol possessed similar biological functions. A resveratrol structural analog named piceatannol activates Sirt1 enzyme activity similar as resveratrol [8,11]. In addition, some resveratrol derivatives modified on C2 position were found to produce similar cytotoxic activities against a human nasopharyngeal epidermoid tumor cell line KB [12]. However, the effects of resveratrol structural analogs on AMPK activity are still largely unknown. In this study, we investigated the effect of several resveratrol analogs on AMPK activation, and CA-4 was identified as an activator of AMPK. Further investigation revealed that CA-4 could activate PPAR transcriptional activity and improve glucose tolerance in diabetic db/db mice.
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
319
2. Materials and methods
2.6. Animal experiments
2.1. Materials
C57BL/KsJ-db/db mice obtained from Jackson Laboratory were maintained and used in accordance with the guidelines of the Institutional Animal Care and Use Committee of the Institute for Nutritional Sciences. Twelve male db/db mice at 9 weeks of age were randomly divided into two groups (six mice for each group), and were allowed to have access to water and diets ad libitum. From the age of 10 weeks, everyday after the light is on for 3–4 h, those mice were treated with CA-4 (7.9 mg/kg, p.o.). After treating with CA-4 for 2 weeks, fasting glucose levels were measured from tail blood using the FreeStyle blood glucose monitoring system (TheraSense). After treating with CA-4 for 3 weeks, all animals were sacrificed, and livers were harvested for Western blot or RT-PCR.
Resveratrol, piceatannol and AICAR (5-aminoimidazole-4carboxamide-1--d-ribofuranoside) were purchased from Sigma. Polydatin and 2,3,5,4 -tetrahydroxystilbene-2-O--d-glucoside (TSG) were obtained from National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Erianin and CA-4 were synthesized and purified as previously described [13,14]. 2.2. Cell culture and treatment HepG2 cells were maintained in DMEM with 25 mM glucose and 10% FBS. HepG2 cells were starved in serum-free medium for 8 h, and then treated with different chemicals at the indicated doses for 24 h. C2C12 myoblasts were maintained in DMEM with 10% FBS, and differentiated in DMEM with 2% horse serum after reaching confluence. After 4 days, the C2C12 cells were differentiated into myotubes. C2C12 myotubes were starved in serum-free medium for 4 h, and then treated with CA-4. After treatment, the cells were harvested for Western blot. To differentiate 3T3-L1 preadipocytes cells to adipocytes, 3T3-L1 cells were grown in DMEM with 10% newborn calf serum until growing confluence. The cells were continued to grow for 2 days, and then exposed to fresh differentiation medium consisting of DMEM, 10% FBS, 1 M DEX, 0.5 mM MIX, 10 mM troglitazone and 1 g/ml insulin. Two days later, the cells were replaced with fresh DMEM containing 10% FBS, 10 mM troglitazone and 1 g/ml of insulin for another 2 days. Then the cells cultured in DMEM with 10% FBS.
2.7. RNA Isolation and RT-PCR Total RNA was prepared from the livers of db/db mice treated with vehicle or CA-4 by Trizol reagent (Invitrogen). Then cDNA was reverse-transcribed and amplified by PCR using GGCACCTCAGTGAAGACAAAT and GCTTCATAGACAAGGGGGAC as primers for PEPCK, ATTGTCTCATCACCATCTTCTTG and TGGGGGCTTCAGAGAGTCA as primers for G6Pase. Quantification was carried out by Quantity One software (Bio–Rad), and the results were normalized to actin. 2.8. Statistic Data are expressed as mean ± S.D. of at least three independent experiments. Statistical significance was assessed by Student’s ttest. Differences were considered statistically significant at p < 0.05. 3. Results
2.3. Western blot
3.1. The effect of the resveratrol analogs on AMPK activation
Protein samples were analyzed with antibodies against PGC1␣ (Santa Cruz), -actin (Sigma), AMPK␣, Thr172-phosphorylated AMPK␣, Ser79-phosphorylated ACC and Ser9-phosphorylated GSK3 from Cell Signaling. Each blot shown in the figures is the representative of at least three experiments. Protein quantification was performed using Quantity One software (Bio–Rad), and the intensity values were normalized to actin.
Previous studies showed that resveratrol activates AMPK in cultured cells [8,16]. We therefore examined whether AMPK was activated by resveratrol structural analogs, including polydatin, piceatannol, TSG, erianin, and CA-4. As expected, resveratrol significantly increased AMPK phosphorylation level in HepG2 cells (Fig. 1A). Similar effects were also observed in the cells treated with piceatannol or CA-4 (Fig. 1A). Meanwhile, the total AMPK protein was not changed, as well as the internal control actin. The quantification data showed that AMPK phosphorylation level was 1.6-, 1.7- and 2.0-fold of the basal level, when treated with resveratrol, piceatannol and CA-4, respectively (Fig. 1B). The chemical structures of these compounds were illustrated in Fig. 1C. However, other chemicals including polydatin, TSG and erianin failed to induce AMPK phosphorylation (Fig. 1A and B). These results showed that CA-4 was an activator of AMPK, and we chose CA-4 for further investigation in the following experiments.
2.4. Measurement of ATP To measure the intracellular ATP level, C2C12 myotubes were cultured in 48-well plates and treated with CA-4. Then the cells were harvested, and the intracellular ATP level was detected using an ATP bioluminescent assay kit (Sigma) according to the manufacturer’s instructions. 2.5. Luciferase assay Luciferase reporter construct PPREX3-TK-LUC containing PPAR response element was kindly provided by Dr. Ronald M. Evans [15]. Luciferase assays were performed with C2C12 cells in 48well plates cotransfected with PPREX3-TK-LUC (0.05 g/well) and pSV40--gal (0.05 g/well) using Lipofectamine 2000 (Invitrogen). After transfection for 24 h, the cells were treated with CA-4 in fresh medium at the indicated doses for an additional 24 h, and then the cells were harvested and measured with a luciferase assay kit (Promega) and normalized to -galactosidase activity.
3.2. AMPK activation by CA-4 accompanied with phosphorylation of acetyl-CoA carboxylase (ACC) and downregulation of intracellular ATP level To further confirm the stimulating effect of CA-4 on AMPK signaling pathway, we treated C2C12 myotubes with CA-4 and examined the phosphorylation levels of AMPK and ACC. ACC is a well-characterized downstream effector of AMPK pathway [17,18]. As expected, CA-4 stimulated AMPK and ACC phosphorylation in a dose-dependent manner (Fig. 2A). CA-4 at the concentration of 10 M led to about 4-fold and 5-fold stimulation in AMPK and ACC phosphorylation, respectively (Fig. 2B). In addition, we also
320
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
Fig. 1. The effect of resveratrol and its structural analogs on AMPK activation. (A) Resveratrol, piceatannol and CA-4 induced AMPK phosphorylation. After treatment with resveratrol, polydatin, piceatannol, TSG, erianin or CA-4 at a dose of 10 M for 24 h, HepG2 cells were harvested for western blot using antibodies against phosphorylated AMPK (p-AMPK), AMPK or actin. (B) AMPK phosphorylation levels were qualified after normalization with actin. ** p < 0.01 versus vehicle-treated cells. In this and all other figures, error bars represent S.D. (C) Chemical structures of resveratrol, polydatin, piceatannol, TSG, erianin and CA-4.
examined other energy balance related proteins including PGC-1␣ and GSK3. Similar with AMPK and ACC, GSK3 phosphorylation was also increased by CA-4. However, no significant changes were observed in PGC-1␣ protein level (Fig. 2A and B). AICAR, a wellknown AMPK activator, was used as a positive control. As shown in Fig. 2C and D, AICAR at the concentration of 500 M led to about 5-fold and 8-fold stimulation in AMPK and ACC phosphorylation, respectively in C2C12 myotubes. CA-4 had a weaker effect on AMPK and ACC phosphorylation than AICAR, but activated AMPK and ACC at a much lower concentration. Meanwhile neither AICAR nor CA-4 had effect on the PGC-1␣ protein level. Similarly, we found that the phosphorylation level of AMPK and ACC were also upregulated by CA-4 in adipocytes (Fig. 2E and F). These results showed that CA4 activated the AMPK accompanied with ACC phosphorylation in different cells. The decrease of ATP level has been reported to activate AMPK signaling pathway [19]. To elucidate the potential mechanism responsible for CA-4 induced activation of AMPK, we investigated whether CA-4 affected the intracellular ATP level. Thus, we treated C2C12 myotubes with CA-4 ranging from 0.1 to 30 M for 1 h and determined intracellular ATP level. As shown in Fig. 2G, no significant change in ATP level was observed at dose of 0.1 M, but there was a significant decrease of ATP levels in the cells treated with CA-4 at the doses of 0.3–30 M. Next, we treated cells with 10 M CA-4 with different time courses. As shown in Fig. 2H, ATP level was downregulated by CA-4 in a time-dependent manner. These
results demonstrated that CA-4 treatment activates the AMPK signaling pathway including the phosphorylation of AMPK and ACC and the decrease of intracellular ATP level. 3.3. CA-4 activates PPAR transcriptional activity Previous studies showed that the effect of AMPK on lipid and glucose metabolism is at least partially mediated by activation of PPARs [20–22]. As an AMPK activator, probably CA-4 may also activate PPARs. To address this hypothesis, we transfected C2C12 cells with luciferase reporter construct driven by PPAR response element and examined the effect of CA-4 on PPAR transcriptional activity. As shown in Fig. 3A, troglitazone, a PPAR agonist, markedly activated the luciferase activity, meanwhile resveratrol and CA-4 at concentration of 1 and 10 M had similar effect on PPAR transcriptional activity. AICAR had no significant effect on PPAR transcriptional activity in C2C12 cells (Fig. 3A). To further investigate the effect of CA-4 on PPRE reporter, we examined CA-4 ranging from 0.1 to 30 M. As shown in Fig. 3B, CA-4 upregulated the luciferase activity in a dose-dependent manner. Our data showed that CA-4 could activate PPAR transcriptional activity. 3.4. CA-4 improves glucose metabolism in db/db mice Since both AMPK and PPAR are closely related to glucose metabolism and insulin sensitivity [23–26] and resveratrol
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
321
Fig. 2. AMPK activation by CA-4 accompanied with phosphorylation of ACC and downregulation of intracellular ATP level. (A) CA-4 stimulated phosphorylation of AMPK, ACC and GSK3. After treatment with CA-4 at the indicated doses for 12 h, C2C12 myotubes were harvested for western blot using antibodies against phosphorylated AMPK (p-AMPK), phosphorylated ACC (p-ACC), PGC-1␣, phosphorylated GSK3 (p-GSK3) or actin. (B) Quantification of the protein levels of p-AMPK, p-ACC, PGC-1␣ and p-GSK3. * p < 0.05, ** p < 0.01 versus vehicle treated control in each group. (C) Both CA-4 and AICAR induced phosphorylation of AMPK and ACC. After treating with 10 M CA-4 or 500 M AICAR for 12 h, C2C12 myotubes were harvested for Western blot. (D) Quantification of the protein levels of p-AMPK, p-ACC and PGC-1␣. ** p < 0.01 versus vehicle treated control in each group. (E) CA-4 stimulated phosphorylation of AMPK and ACC in adipocytes. After cultured in serum-free medium for 16 h, 3T3-L1 adipocytes were treated with CA-4 at the indicated doses for 12 h, then the cells were harvested for Western blot. (F) Quantification of the protein levels of p-AMPK and p-ACC. * p < 0.05, ** p < 0.01 versus vehicle treated control in each group. (G) CA-4 downregulated the intracellular ATP level in C2C12 myotubes in a dose-dependent manner. After treating with CA-4 at the indicated doses for 1 h, C2C12 myotubes were harvested for ATP assay. * p < 0.05, ** p < 0.01 versus vehicle-treated cells. (H) The time-dependent effect of CA-4 on intracellular ATP level in C2C12 myotubes. C2C12 myotubes were treated with 10 M CA-4 for the indicated times. * p < 0.05, ** p < 0.01 versus vehicle-treated cells.
improves glucose homeostasis [10]. Thus, we postulate that CA4 may also affect glucose metabolism and insulin sensitivity. To test this speculation, we administered CA-4 to diabetic db/db mice and detected blood glucose level. The fasting blood glucose level in CA-4-treated mice was significantly lower than the vehicle group (Fig. 4A). While there was no significant difference in body weight and food intake between the two groups (data not shown). To confirm the effect of CA-4 on AMPK signaling in vivo, we measured protein levels of phosphorylated AMPK and ACC
from the livers of mice treated with or withour CA-4. As shown in Fig. 4B and C, CA-4 stimulated phosphorylation of AMPK and ACC in vivo. In consistent with the in vitro results, PGC-1 protein level in liver was also not affected by CA-4 treatment. The improved fasting blood glucose level in CA-4 administered mice may result from turning off the extra gluconeogenesis. To study the effect of CA-4 on glucogenesis, we examined the expression of key gluconeogenic enzyme gene, glucose-6-phosphatase (G6Pase) and phosphoenolpyruvate carboxylase (PEPCK) in liver. The mRNA lev-
322
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
4. Discussion
Fig. 3. CA-4 activated PPAR transcriptional activity. (A) After transfection with reporter constructs for 24 h, C2C12 cells were treated with vehicle, resveratrol, CA-4 at the indicated doses, troglitazone at 5 M or AICAR at 500 M for 24 h. Then the cells were harvested for luciferase assay. *p < 0.05, **p < 0.01 versus vehicle-treated cells. (B) Dose–response of CA-4 on PPAR transcriptional activity. **p < 0.01 versus vehicle-treated cells.
els of PEPCK and G6Pase were significantly downregulated by CA-4 (Fig. 4D and E). These findings showed that CA-4 induces AMPK activation and improves glucose metabolism in diabetic db/db mice.
CA-4 is a natural cis-stilbene which was originally isolated from the South African tree Combretum caffrum [27]. It is well characterized that CA-4 possesses potent antiproliferation effect in a variety of tumor cells by depolymerization of microtubule [28,29]. However, the effect of CA-4 on AMPK signaling pathway are largely unkown. In the present study, we found that, as well as resveratrol, CA-4 could stimulate AMPK phosphorylation in HepG2 cells (Fig. 1A and B). In addition, such activation on AMPK was also observed in CA-4-treated C2C12 myotubes and 3T3-L1 adipocytes (Fig. 2A and E), which further confirmed the activating effect of CA-4 on AMPK. Previous studies showed that AMPK activation is usually induced by the decrease of ATP level [19]. Our results showed that CA-4 significantly decreased intracellular ATP level (Fig. 2G and H). These data suggest that the stimulating effect of CA-4 on AMPK might result from reduction in ATP level. Resveratrol and piceatannol has similar effect as CA-4, but polydatin and erianin even have negative effect on AMPK activation. The different effect of these compounds should be due the different structure of each compound, and the underlying mechanisms need to be studied in the future. In addition, it should be noted that CA-4 at 30 M had weaker effect on PPAR transcriptional activity than CA-4 at 1 or 10 M (Fig. 3B). We found CA-4 at 50 or 100 M is toxic to cells (data not shown), which might be due to the dramatic decrease of ATP induced by high concentration of CA-4. ACC is an important downstream effector in AMPK signaling pathway, and activation of AMPK can increase ACC phosphorylation [30,31]. Our results showed that ACC phosphorylation was also enhanced with the increase of AMPK phosphorylation induced by CA-4. It has been demonstrated that PGC-1␣ gene expression is upregulated after AMPK activation induced by AICAR in skeletal muscle [20,32], suggesting PGC-1␣ is likely an important downstream target of AMPK. However, we found that neither AICAR nor CA-4 increased PGC-1␣ protein level in C2C12 skeletal muscle cells although AMPK was activated (Fig. 2C). CA-4 activated PPAR transcriptional activity, but the AMPK activator AICAR showed no effect
Fig. 4. CA-4 improved glucose metabolism in db/db mice. (A) The fasting blood glucose level in db/db mice was significantly improved by CA-4 when treated at a dose of 7.9 mg/kg/day, for 2 weeks. *p < 0.05. (B) The effect of CA-4 on phosphorylation level of AMPK and ACC in vivo. The protein levels of phosphorylated AMPK and ACC in the liver from mice treated with or without CA-4 were detected by Western blot. (C) The protein levels were quantitated after being normalized with actin. **p < 0.01 versus vehicle-treated group. (D) The mRNA levels of the indicated gluconeogenic genes from the livers of db/db mice with or without CA-4 treatment. (E) The mRNA levels were quantitated after being normalized with actin. *p < 0.05 versus vehicle-treated group.
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
(Fig. 3A). These results suggested that CA-4 signaling has some overlap with AICAR, but is different from AICAR. GSK3 is another protein closely related to glucose metabolism and energy balance [33,34]. Our results showed that GSK3 phosphorylation was also elevated in CA-4-treated cells (Fig. 2A). The increase in GSK3 phosphorylation might be a result of the activation of AMPK induced by CA-4. The fasting blood glucose level was significantly improved in diabetic db/db mice when treated with CA-4 (Fig. 4A). This observation is consistent with previous reports which showed that AMPK activation could increase insulin sensitivity and improve glucose tolerance in animal models of type 2 diabetes [6,35]. In addition to AMPK, PPARs are also closely related with insulin sensitivity and glucose metabolism. Chemical activation of PPARs induced by thiazolidinediones or genetic upregulation of PPARs is widely considered as effective approaches to improve insulin sensitivity [36]. Similarly, our results presented here also showed that CA-4 activates PPAR transcriptional activity. In addition, two key gluconeogenic enzyme genes, G6Pase and PEPCK in liver, were decreased by CA-4 (Fig. 4). Thus, AMPK and PPAR activation, and decrease of gluconeogenic genes induced by CA-4 provides the potential mechanisms for the improved glucose metabolism in CA-4-treated db/db mice. Taken together, this study demonstrated that CA-4 activates AMPK signaling pathway in HepG2 hepatocytes and C2C12 skeletal muscle cells. Moreover, probably by activating AMPK and/or PPAR, CA-4 improves glucose metabolism in diabetic db/db mice. These results suggested that resveratrol structural analogs, such as CA-4, can be potentially used for improving glucose metabolism, thereby preventing and treating type 2 diabetes. Acknowledgements This study was supported by grants from National Natural Science Foundation of China (30400083 and 30570558), the Chinese Academy of Sciences (KSCX2-2-25, KSCX2-YW-N-034 and KSCX1YW-02), National Basic Research Program of China (973 Program, 2006CB503900 and 2007CB914501), the Science and Technology Commission of Shanghai Municipality (06DZ19021), and the Knowledge Innovation Program of Shanghai Institutes for Biological Sciences (2007KIP103), Chinese Academy of Sciences. Q. Zhai is a scholar of the Hundred Talents Program from Chinese Academy of Sciences, and a scholar of the Shanghai Rising-Star Program from Science and Technology Commission of Shanghai Municipality. References [1] Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 2004;27:1047–53. [2] Yach D, Stuckler D, Brownell KD. Epidemiologic and economic consequences of the global epidemics of obesity and diabetes. Nat Med 2006;12:62–6. [3] Cohen ND, Shaw JE. Diabetes: advances in treatment. Intern Med J 2007;37:383–8. [4] Hardie DG. AMP-activated protein kinase as a drug target. Annu Rev Pharmacol Toxicol 2007;47:185–210. [5] Towler MC, Hardie DG. AMP-activated protein kinase in metabolic control and insulin signaling. Circ Res 2007;100:328–41. [6] Steinberg GR, Jorgensen SB. The AMP-activated protein kinase: role in regulation of skeletal muscle metabolism and insulin sensitivity. Mini Rev Med Chem 2007;7:519–26. [7] Waki H, Park KW, Mitro N, Pei L, Damoiseaux R, Wilpitz DC, et al. The small molecule harmine is an antidiabetic cell-type-specific regulator of PPARgamma expression. Cell Metab 2007;5:357–70.
323
[8] Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, et al. Resveratrol improves health and survival of mice on a high-calorie diet. Nature 2006;444:337–42. [9] Zang M, Xu S, Maitland-Toolan KA, Zuccollo A, Hou X, Jiang B, et al. Polyphenols stimulate AMP-activated protein kinase, lower lipids, and inhibit accelerated atherosclerosis in diabetic LDL receptor-deficient mice. Diabetes 2006;55:2180–91. [10] Sun C, Zhang F, Ge XJ, Yan TT, Chen XM, Shi XL, et al. SIRT1 improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B. Cell Metab 2007;6:307–19. [11] Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, et al. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 2003;425:191–6. [12] Huang XF, Ruan BF, Wang XT, Xu C, Ge HM, Zhu HL, et al. Synthesis and cytotoxic evaluation of a series of resveratrol derivatives modified in C2 position. Eur J Med Chem 2007;42:263–7. [13] Zou Y, Zhong RQ, Zhang XJ, Zhou Y, Wang ZX, Lin HZ. The preparation of 3-hydroxy-4,3 ,4 ,5 -tetramethoxybibenzyl. Chinese Patent Office, 2006;200410077574.5. [14] Gaukroger K, Hadfield JA, Hepworth LA, Lawrence NJ, McGown AT. Novel syntheses of cis and trans isomers of combretastatin A-4. J Org Chem 2001;66:8135–8. [15] Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxydelta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 1995;83:803–12. [16] Park CE, Kim MJ, Lee JH, Min BI, Bae H, Choe W, et al. Resveratrol stimulates glucose transport in C2C12 myotubes by activating AMP-activated protein kinase. Exp Mol Med 2007;39:222–9. [17] Park SH, Gammon SR, Knippers JD, Paulsen SR, Rubink DS, Winder WW. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. J Appl Physiol 2002;92:2475–82. [18] Hardie DG, Pan DA. Regulation of fatty acid synthesis and oxidation by the AMP-activated protein kinase. Biochem Soc Trans 2002;30:1064–70. [19] Hardie DG, Hawley SA, Scott JW. AMP-activated protein kinase—development of the energy sensor concept. J Physiol 2006;574:7–15. [20] Lee WJ, Kim M, Park HS, Kim HS, Jeon MJ, Oh KS, et al. AMPK activation increases fatty acid oxidation in skeletal muscle by activating PPARalpha and PGC-1. Biochem Biophys Res Commun 2006;340:291–5. [21] Ravnskjaer K, Boergesen M, Dalgaard LT, Mandrup S. Glucose-induced repression of PPARalpha gene expression in pancreatic beta-cells involves PP2A activation and AMPK inactivation. J Mol Endocrinol 2006;36:289–99. [22] Leff T. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem Soc Trans 2003;31:224–7. [23] Musi N, Goodyear LJ. Targeting the AMP-activated protein kinase for the treatment of type 2 diabetes. Curr Drug Targets Immune Endocr Metabol Disord 2002;2:119–27. [24] Winder WW. AMP-activated protein kinase: possible target for treatment of type 2 diabetes. Diabetes Technol Ther 2000;2:441–8. [25] Kim HI, Cha JY, Kim SY, Kim JW, Roh KJ, Seong JK, et al. Peroxisomal proliferatoractivated receptor-gamma upregulates glucokinase gene expression in betacells. Diabetes 2002;51:676–85. [26] Sauma L, Stenkula KG, Kjolhede P, Stralfors P, Soderstrom M, Nystrom FH. PPARgamma response element activity in intact primary human adipocytes: effects of fatty acids. Nutrition 2006;22:60–8. [27] Pettit GR, Singh SB, Hamel E, Lin CM, Alberts DS, Garcia-Kendall D. Isolation and structure of the strong cell growth and tubulin inhibitor combretastatin A-4. Experientia 1989;45:209–11. [28] Young SL, Chaplin DJ. Combretastatin A4 phosphate: background and current clinical status. Expert Opin Investig Drugs 2004;13:1171–82. [29] West CM, Price P. Combretastatin A4 phosphate. Anticancer Drugs 2004;15:179–87. [30] Xue B, Kahn BB. AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance through effects in the hypothalamus and peripheral tissues. J Physiol 2006;574:73–83. [31] Long YC, Zierath JR. AMP-activated protein kinase signaling in metabolic regulation. J Clin Invest 2006;116:1776–83. [32] Jorgensen SB, Wojtaszewski JF, Viollet B, Andreelli F, Birk JB, Hellsten Y, et al. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J 2005;19:1146–8. [33] Henriksen EJ, Dokken BB. Role of glycogen synthase kinase-3 in insulin resistance and type 2 diabetes. Curr Drug Target 2006;7:1435–41. [34] Handlon AL, Zhou H. Melanin-concentrating hormone-1 receptor antagonists for the treatment of obesity. J Med Chem 2006;49:4017–22. [35] Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 2005;1:15–25. [36] Brown JD, Plutzky J. Peroxisome proliferator-activated receptors as transcriptional nodal points and therapeutic targets. Circulation 2007;115:518–33.
Contents lists available at ScienceDirect
Pharmacological Research journal homepage: www.elsevier.com/locate/yphrs
Combretastatin A-4 activates AMP-activated protein kinase and improves glucose metabolism in db/db mice Fang Zhang a , Cheng Sun a , Jingxia Wu a , Chunyan He a , Xinjian Ge a , Wenming Huang b , Yong Zou b , Xingmiao Chen a , Wei Qi a , Qiwei Zhai a,∗ a Key Laboratory of Nutrition and Metabolism, Institute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Graduate School of the Chinese Academy of Sciences, 294 Taiyuan Road, Shanghai 200031, PR China b Guangzhou Institute of Chemistry, Chinese Academy of Sciences, Guangzhou 510650, PR China
a r t i c l e
i n f o
Article history: Accepted 11 March 2008 Keywords: AMPK Combretastatin A-4 Resveratrol Glucose metabolism db/db mice
a b s t r a c t Resveratrol was reported to increase insulin sensitivity accompanied with the activation of AMP-activated protein kinase (AMPK), which is a key regulator of energy balance and an important drug target for type 2 diabetes. However, the effect of resveratrol structural analogs on AMPK activity and insulin sensitivity is still largely unknown. In this study, we analyzed the effect of several resveratrol structural analogs on AMPK activity in HepG2 cells, and combretastatin A-4 (CA-4) was identified as an activator of AMPK determined by its phosphorylation. AMPK activation was further confirmed by the phosphorylation of downstream acetyl-CoA carboxylase (ACC) and the decrease of upstream ATP level. Further investigation showed that CA-4 activates PPAR transcriptional activity in vitro with the luciferase reporter assay. In addition, we showed that CA-4 activated AMPK and downregulated gluconeogenic enzyme mRNA levels in liver, and improved the fasting blood glucose level in diabetic db/db mice. These results suggested that resveratrol analogs, such as CA-4, can function similarly as resveratrol and may provide important tools for improving insulin sensitivity. © 2008 Elsevier Ltd. All rights reserved.
1. Introduction Diabetes mellitus, previously considered as a disease of minor significance to world health, is now taking its place as one of the main threats to human health in the 21st century [1]. The global figure of people with diabetes is set to rise from the current estimate of over 170 million people and prospectively over 353 million in 2030 [1,2]. The development of diabetes in patients always companied with impaired glucose tolerance or impaired fasting glucose. Therefore, to ameliorate glucose tolerance is still one of the key avenues to treat diabetes [3]. The AMPK pathway is one of the regulatory mechanisms of energy balance at both the cellular and whole-body levels. Once AMPK is activated by low energy status, it switches the cell from ATP-consuming anabolic pathways to ATP-producing catabolic pathways [4,5]. By affecting glucose and lipid metabolism, energy balance is closely related to some metabolic disorders including obesity and type 2 diabetes [5,6]. Therefore, AMPK is considered
∗ Corresponding author. Tel.: +86 21 5492 0903; fax: +86 21 5492 0291. E-mail address: [email protected] (Q. Zhai). 1043-6618/$ – see front matter © 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.phrs.2008.03.002
as an important therapeutic target for the treatment of obesity and type 2 diabetes. For example, the biguanides and thiazolidinediones are the two kinds of antidiabetic drugs targeting AMPK [4,7]. Resveratrol is an activator of the NAD+ dependant protein deacetylase SIRT1, and was shown to increase insulin sensitivity probably due to activation of AMPK [8,9]. Recently, we found that resveratrol at a very low dose of 2.5 mg/kg/day improves insulin sensitivity probably by repressing PTP1B [10]. Previous studies showed that some chemicals derived from resveratrol possessed similar biological functions. A resveratrol structural analog named piceatannol activates Sirt1 enzyme activity similar as resveratrol [8,11]. In addition, some resveratrol derivatives modified on C2 position were found to produce similar cytotoxic activities against a human nasopharyngeal epidermoid tumor cell line KB [12]. However, the effects of resveratrol structural analogs on AMPK activity are still largely unknown. In this study, we investigated the effect of several resveratrol analogs on AMPK activation, and CA-4 was identified as an activator of AMPK. Further investigation revealed that CA-4 could activate PPAR transcriptional activity and improve glucose tolerance in diabetic db/db mice.
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
319
2. Materials and methods
2.6. Animal experiments
2.1. Materials
C57BL/KsJ-db/db mice obtained from Jackson Laboratory were maintained and used in accordance with the guidelines of the Institutional Animal Care and Use Committee of the Institute for Nutritional Sciences. Twelve male db/db mice at 9 weeks of age were randomly divided into two groups (six mice for each group), and were allowed to have access to water and diets ad libitum. From the age of 10 weeks, everyday after the light is on for 3–4 h, those mice were treated with CA-4 (7.9 mg/kg, p.o.). After treating with CA-4 for 2 weeks, fasting glucose levels were measured from tail blood using the FreeStyle blood glucose monitoring system (TheraSense). After treating with CA-4 for 3 weeks, all animals were sacrificed, and livers were harvested for Western blot or RT-PCR.
Resveratrol, piceatannol and AICAR (5-aminoimidazole-4carboxamide-1--d-ribofuranoside) were purchased from Sigma. Polydatin and 2,3,5,4 -tetrahydroxystilbene-2-O--d-glucoside (TSG) were obtained from National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Erianin and CA-4 were synthesized and purified as previously described [13,14]. 2.2. Cell culture and treatment HepG2 cells were maintained in DMEM with 25 mM glucose and 10% FBS. HepG2 cells were starved in serum-free medium for 8 h, and then treated with different chemicals at the indicated doses for 24 h. C2C12 myoblasts were maintained in DMEM with 10% FBS, and differentiated in DMEM with 2% horse serum after reaching confluence. After 4 days, the C2C12 cells were differentiated into myotubes. C2C12 myotubes were starved in serum-free medium for 4 h, and then treated with CA-4. After treatment, the cells were harvested for Western blot. To differentiate 3T3-L1 preadipocytes cells to adipocytes, 3T3-L1 cells were grown in DMEM with 10% newborn calf serum until growing confluence. The cells were continued to grow for 2 days, and then exposed to fresh differentiation medium consisting of DMEM, 10% FBS, 1 M DEX, 0.5 mM MIX, 10 mM troglitazone and 1 g/ml insulin. Two days later, the cells were replaced with fresh DMEM containing 10% FBS, 10 mM troglitazone and 1 g/ml of insulin for another 2 days. Then the cells cultured in DMEM with 10% FBS.
2.7. RNA Isolation and RT-PCR Total RNA was prepared from the livers of db/db mice treated with vehicle or CA-4 by Trizol reagent (Invitrogen). Then cDNA was reverse-transcribed and amplified by PCR using GGCACCTCAGTGAAGACAAAT and GCTTCATAGACAAGGGGGAC as primers for PEPCK, ATTGTCTCATCACCATCTTCTTG and TGGGGGCTTCAGAGAGTCA as primers for G6Pase. Quantification was carried out by Quantity One software (Bio–Rad), and the results were normalized to actin. 2.8. Statistic Data are expressed as mean ± S.D. of at least three independent experiments. Statistical significance was assessed by Student’s ttest. Differences were considered statistically significant at p < 0.05. 3. Results
2.3. Western blot
3.1. The effect of the resveratrol analogs on AMPK activation
Protein samples were analyzed with antibodies against PGC1␣ (Santa Cruz), -actin (Sigma), AMPK␣, Thr172-phosphorylated AMPK␣, Ser79-phosphorylated ACC and Ser9-phosphorylated GSK3 from Cell Signaling. Each blot shown in the figures is the representative of at least three experiments. Protein quantification was performed using Quantity One software (Bio–Rad), and the intensity values were normalized to actin.
Previous studies showed that resveratrol activates AMPK in cultured cells [8,16]. We therefore examined whether AMPK was activated by resveratrol structural analogs, including polydatin, piceatannol, TSG, erianin, and CA-4. As expected, resveratrol significantly increased AMPK phosphorylation level in HepG2 cells (Fig. 1A). Similar effects were also observed in the cells treated with piceatannol or CA-4 (Fig. 1A). Meanwhile, the total AMPK protein was not changed, as well as the internal control actin. The quantification data showed that AMPK phosphorylation level was 1.6-, 1.7- and 2.0-fold of the basal level, when treated with resveratrol, piceatannol and CA-4, respectively (Fig. 1B). The chemical structures of these compounds were illustrated in Fig. 1C. However, other chemicals including polydatin, TSG and erianin failed to induce AMPK phosphorylation (Fig. 1A and B). These results showed that CA-4 was an activator of AMPK, and we chose CA-4 for further investigation in the following experiments.
2.4. Measurement of ATP To measure the intracellular ATP level, C2C12 myotubes were cultured in 48-well plates and treated with CA-4. Then the cells were harvested, and the intracellular ATP level was detected using an ATP bioluminescent assay kit (Sigma) according to the manufacturer’s instructions. 2.5. Luciferase assay Luciferase reporter construct PPREX3-TK-LUC containing PPAR response element was kindly provided by Dr. Ronald M. Evans [15]. Luciferase assays were performed with C2C12 cells in 48well plates cotransfected with PPREX3-TK-LUC (0.05 g/well) and pSV40--gal (0.05 g/well) using Lipofectamine 2000 (Invitrogen). After transfection for 24 h, the cells were treated with CA-4 in fresh medium at the indicated doses for an additional 24 h, and then the cells were harvested and measured with a luciferase assay kit (Promega) and normalized to -galactosidase activity.
3.2. AMPK activation by CA-4 accompanied with phosphorylation of acetyl-CoA carboxylase (ACC) and downregulation of intracellular ATP level To further confirm the stimulating effect of CA-4 on AMPK signaling pathway, we treated C2C12 myotubes with CA-4 and examined the phosphorylation levels of AMPK and ACC. ACC is a well-characterized downstream effector of AMPK pathway [17,18]. As expected, CA-4 stimulated AMPK and ACC phosphorylation in a dose-dependent manner (Fig. 2A). CA-4 at the concentration of 10 M led to about 4-fold and 5-fold stimulation in AMPK and ACC phosphorylation, respectively (Fig. 2B). In addition, we also
320
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
Fig. 1. The effect of resveratrol and its structural analogs on AMPK activation. (A) Resveratrol, piceatannol and CA-4 induced AMPK phosphorylation. After treatment with resveratrol, polydatin, piceatannol, TSG, erianin or CA-4 at a dose of 10 M for 24 h, HepG2 cells were harvested for western blot using antibodies against phosphorylated AMPK (p-AMPK), AMPK or actin. (B) AMPK phosphorylation levels were qualified after normalization with actin. ** p < 0.01 versus vehicle-treated cells. In this and all other figures, error bars represent S.D. (C) Chemical structures of resveratrol, polydatin, piceatannol, TSG, erianin and CA-4.
examined other energy balance related proteins including PGC-1␣ and GSK3. Similar with AMPK and ACC, GSK3 phosphorylation was also increased by CA-4. However, no significant changes were observed in PGC-1␣ protein level (Fig. 2A and B). AICAR, a wellknown AMPK activator, was used as a positive control. As shown in Fig. 2C and D, AICAR at the concentration of 500 M led to about 5-fold and 8-fold stimulation in AMPK and ACC phosphorylation, respectively in C2C12 myotubes. CA-4 had a weaker effect on AMPK and ACC phosphorylation than AICAR, but activated AMPK and ACC at a much lower concentration. Meanwhile neither AICAR nor CA-4 had effect on the PGC-1␣ protein level. Similarly, we found that the phosphorylation level of AMPK and ACC were also upregulated by CA-4 in adipocytes (Fig. 2E and F). These results showed that CA4 activated the AMPK accompanied with ACC phosphorylation in different cells. The decrease of ATP level has been reported to activate AMPK signaling pathway [19]. To elucidate the potential mechanism responsible for CA-4 induced activation of AMPK, we investigated whether CA-4 affected the intracellular ATP level. Thus, we treated C2C12 myotubes with CA-4 ranging from 0.1 to 30 M for 1 h and determined intracellular ATP level. As shown in Fig. 2G, no significant change in ATP level was observed at dose of 0.1 M, but there was a significant decrease of ATP levels in the cells treated with CA-4 at the doses of 0.3–30 M. Next, we treated cells with 10 M CA-4 with different time courses. As shown in Fig. 2H, ATP level was downregulated by CA-4 in a time-dependent manner. These
results demonstrated that CA-4 treatment activates the AMPK signaling pathway including the phosphorylation of AMPK and ACC and the decrease of intracellular ATP level. 3.3. CA-4 activates PPAR transcriptional activity Previous studies showed that the effect of AMPK on lipid and glucose metabolism is at least partially mediated by activation of PPARs [20–22]. As an AMPK activator, probably CA-4 may also activate PPARs. To address this hypothesis, we transfected C2C12 cells with luciferase reporter construct driven by PPAR response element and examined the effect of CA-4 on PPAR transcriptional activity. As shown in Fig. 3A, troglitazone, a PPAR agonist, markedly activated the luciferase activity, meanwhile resveratrol and CA-4 at concentration of 1 and 10 M had similar effect on PPAR transcriptional activity. AICAR had no significant effect on PPAR transcriptional activity in C2C12 cells (Fig. 3A). To further investigate the effect of CA-4 on PPRE reporter, we examined CA-4 ranging from 0.1 to 30 M. As shown in Fig. 3B, CA-4 upregulated the luciferase activity in a dose-dependent manner. Our data showed that CA-4 could activate PPAR transcriptional activity. 3.4. CA-4 improves glucose metabolism in db/db mice Since both AMPK and PPAR are closely related to glucose metabolism and insulin sensitivity [23–26] and resveratrol
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
321
Fig. 2. AMPK activation by CA-4 accompanied with phosphorylation of ACC and downregulation of intracellular ATP level. (A) CA-4 stimulated phosphorylation of AMPK, ACC and GSK3. After treatment with CA-4 at the indicated doses for 12 h, C2C12 myotubes were harvested for western blot using antibodies against phosphorylated AMPK (p-AMPK), phosphorylated ACC (p-ACC), PGC-1␣, phosphorylated GSK3 (p-GSK3) or actin. (B) Quantification of the protein levels of p-AMPK, p-ACC, PGC-1␣ and p-GSK3. * p < 0.05, ** p < 0.01 versus vehicle treated control in each group. (C) Both CA-4 and AICAR induced phosphorylation of AMPK and ACC. After treating with 10 M CA-4 or 500 M AICAR for 12 h, C2C12 myotubes were harvested for Western blot. (D) Quantification of the protein levels of p-AMPK, p-ACC and PGC-1␣. ** p < 0.01 versus vehicle treated control in each group. (E) CA-4 stimulated phosphorylation of AMPK and ACC in adipocytes. After cultured in serum-free medium for 16 h, 3T3-L1 adipocytes were treated with CA-4 at the indicated doses for 12 h, then the cells were harvested for Western blot. (F) Quantification of the protein levels of p-AMPK and p-ACC. * p < 0.05, ** p < 0.01 versus vehicle treated control in each group. (G) CA-4 downregulated the intracellular ATP level in C2C12 myotubes in a dose-dependent manner. After treating with CA-4 at the indicated doses for 1 h, C2C12 myotubes were harvested for ATP assay. * p < 0.05, ** p < 0.01 versus vehicle-treated cells. (H) The time-dependent effect of CA-4 on intracellular ATP level in C2C12 myotubes. C2C12 myotubes were treated with 10 M CA-4 for the indicated times. * p < 0.05, ** p < 0.01 versus vehicle-treated cells.
improves glucose homeostasis [10]. Thus, we postulate that CA4 may also affect glucose metabolism and insulin sensitivity. To test this speculation, we administered CA-4 to diabetic db/db mice and detected blood glucose level. The fasting blood glucose level in CA-4-treated mice was significantly lower than the vehicle group (Fig. 4A). While there was no significant difference in body weight and food intake between the two groups (data not shown). To confirm the effect of CA-4 on AMPK signaling in vivo, we measured protein levels of phosphorylated AMPK and ACC
from the livers of mice treated with or withour CA-4. As shown in Fig. 4B and C, CA-4 stimulated phosphorylation of AMPK and ACC in vivo. In consistent with the in vitro results, PGC-1 protein level in liver was also not affected by CA-4 treatment. The improved fasting blood glucose level in CA-4 administered mice may result from turning off the extra gluconeogenesis. To study the effect of CA-4 on glucogenesis, we examined the expression of key gluconeogenic enzyme gene, glucose-6-phosphatase (G6Pase) and phosphoenolpyruvate carboxylase (PEPCK) in liver. The mRNA lev-
322
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
4. Discussion
Fig. 3. CA-4 activated PPAR transcriptional activity. (A) After transfection with reporter constructs for 24 h, C2C12 cells were treated with vehicle, resveratrol, CA-4 at the indicated doses, troglitazone at 5 M or AICAR at 500 M for 24 h. Then the cells were harvested for luciferase assay. *p < 0.05, **p < 0.01 versus vehicle-treated cells. (B) Dose–response of CA-4 on PPAR transcriptional activity. **p < 0.01 versus vehicle-treated cells.
els of PEPCK and G6Pase were significantly downregulated by CA-4 (Fig. 4D and E). These findings showed that CA-4 induces AMPK activation and improves glucose metabolism in diabetic db/db mice.
CA-4 is a natural cis-stilbene which was originally isolated from the South African tree Combretum caffrum [27]. It is well characterized that CA-4 possesses potent antiproliferation effect in a variety of tumor cells by depolymerization of microtubule [28,29]. However, the effect of CA-4 on AMPK signaling pathway are largely unkown. In the present study, we found that, as well as resveratrol, CA-4 could stimulate AMPK phosphorylation in HepG2 cells (Fig. 1A and B). In addition, such activation on AMPK was also observed in CA-4-treated C2C12 myotubes and 3T3-L1 adipocytes (Fig. 2A and E), which further confirmed the activating effect of CA-4 on AMPK. Previous studies showed that AMPK activation is usually induced by the decrease of ATP level [19]. Our results showed that CA-4 significantly decreased intracellular ATP level (Fig. 2G and H). These data suggest that the stimulating effect of CA-4 on AMPK might result from reduction in ATP level. Resveratrol and piceatannol has similar effect as CA-4, but polydatin and erianin even have negative effect on AMPK activation. The different effect of these compounds should be due the different structure of each compound, and the underlying mechanisms need to be studied in the future. In addition, it should be noted that CA-4 at 30 M had weaker effect on PPAR transcriptional activity than CA-4 at 1 or 10 M (Fig. 3B). We found CA-4 at 50 or 100 M is toxic to cells (data not shown), which might be due to the dramatic decrease of ATP induced by high concentration of CA-4. ACC is an important downstream effector in AMPK signaling pathway, and activation of AMPK can increase ACC phosphorylation [30,31]. Our results showed that ACC phosphorylation was also enhanced with the increase of AMPK phosphorylation induced by CA-4. It has been demonstrated that PGC-1␣ gene expression is upregulated after AMPK activation induced by AICAR in skeletal muscle [20,32], suggesting PGC-1␣ is likely an important downstream target of AMPK. However, we found that neither AICAR nor CA-4 increased PGC-1␣ protein level in C2C12 skeletal muscle cells although AMPK was activated (Fig. 2C). CA-4 activated PPAR transcriptional activity, but the AMPK activator AICAR showed no effect
Fig. 4. CA-4 improved glucose metabolism in db/db mice. (A) The fasting blood glucose level in db/db mice was significantly improved by CA-4 when treated at a dose of 7.9 mg/kg/day, for 2 weeks. *p < 0.05. (B) The effect of CA-4 on phosphorylation level of AMPK and ACC in vivo. The protein levels of phosphorylated AMPK and ACC in the liver from mice treated with or without CA-4 were detected by Western blot. (C) The protein levels were quantitated after being normalized with actin. **p < 0.01 versus vehicle-treated group. (D) The mRNA levels of the indicated gluconeogenic genes from the livers of db/db mice with or without CA-4 treatment. (E) The mRNA levels were quantitated after being normalized with actin. *p < 0.05 versus vehicle-treated group.
F. Zhang et al. / Pharmacological Research 57 (2008) 318–323
(Fig. 3A). These results suggested that CA-4 signaling has some overlap with AICAR, but is different from AICAR. GSK3 is another protein closely related to glucose metabolism and energy balance [33,34]. Our results showed that GSK3 phosphorylation was also elevated in CA-4-treated cells (Fig. 2A). The increase in GSK3 phosphorylation might be a result of the activation of AMPK induced by CA-4. The fasting blood glucose level was significantly improved in diabetic db/db mice when treated with CA-4 (Fig. 4A). This observation is consistent with previous reports which showed that AMPK activation could increase insulin sensitivity and improve glucose tolerance in animal models of type 2 diabetes [6,35]. In addition to AMPK, PPARs are also closely related with insulin sensitivity and glucose metabolism. Chemical activation of PPARs induced by thiazolidinediones or genetic upregulation of PPARs is widely considered as effective approaches to improve insulin sensitivity [36]. Similarly, our results presented here also showed that CA-4 activates PPAR transcriptional activity. In addition, two key gluconeogenic enzyme genes, G6Pase and PEPCK in liver, were decreased by CA-4 (Fig. 4). Thus, AMPK and PPAR activation, and decrease of gluconeogenic genes induced by CA-4 provides the potential mechanisms for the improved glucose metabolism in CA-4-treated db/db mice. Taken together, this study demonstrated that CA-4 activates AMPK signaling pathway in HepG2 hepatocytes and C2C12 skeletal muscle cells. Moreover, probably by activating AMPK and/or PPAR, CA-4 improves glucose metabolism in diabetic db/db mice. These results suggested that resveratrol structural analogs, such as CA-4, can be potentially used for improving glucose metabolism, thereby preventing and treating type 2 diabetes. Acknowledgements This study was supported by grants from National Natural Science Foundation of China (30400083 and 30570558), the Chinese Academy of Sciences (KSCX2-2-25, KSCX2-YW-N-034 and KSCX1YW-02), National Basic Research Program of China (973 Program, 2006CB503900 and 2007CB914501), the Science and Technology Commission of Shanghai Municipality (06DZ19021), and the Knowledge Innovation Program of Shanghai Institutes for Biological Sciences (2007KIP103), Chinese Academy of Sciences. Q. Zhai is a scholar of the Hundred Talents Program from Chinese Academy of Sciences, and a scholar of the Shanghai Rising-Star Program from Science and Technology Commission of Shanghai Municipality. References [1] Wild S, Roglic G, Green A, Sicree R, King H. Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 2004;27:1047–53. [2] Yach D, Stuckler D, Brownell KD. Epidemiologic and economic consequences of the global epidemics of obesity and diabetes. Nat Med 2006;12:62–6. [3] Cohen ND, Shaw JE. Diabetes: advances in treatment. Intern Med J 2007;37:383–8. [4] Hardie DG. AMP-activated protein kinase as a drug target. Annu Rev Pharmacol Toxicol 2007;47:185–210. [5] Towler MC, Hardie DG. AMP-activated protein kinase in metabolic control and insulin signaling. Circ Res 2007;100:328–41. [6] Steinberg GR, Jorgensen SB. The AMP-activated protein kinase: role in regulation of skeletal muscle metabolism and insulin sensitivity. Mini Rev Med Chem 2007;7:519–26. [7] Waki H, Park KW, Mitro N, Pei L, Damoiseaux R, Wilpitz DC, et al. The small molecule harmine is an antidiabetic cell-type-specific regulator of PPARgamma expression. Cell Metab 2007;5:357–70.
323
[8] Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, et al. Resveratrol improves health and survival of mice on a high-calorie diet. Nature 2006;444:337–42. [9] Zang M, Xu S, Maitland-Toolan KA, Zuccollo A, Hou X, Jiang B, et al. Polyphenols stimulate AMP-activated protein kinase, lower lipids, and inhibit accelerated atherosclerosis in diabetic LDL receptor-deficient mice. Diabetes 2006;55:2180–91. [10] Sun C, Zhang F, Ge XJ, Yan TT, Chen XM, Shi XL, et al. SIRT1 improves insulin sensitivity under insulin-resistant conditions by repressing PTP1B. Cell Metab 2007;6:307–19. [11] Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, et al. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature 2003;425:191–6. [12] Huang XF, Ruan BF, Wang XT, Xu C, Ge HM, Zhu HL, et al. Synthesis and cytotoxic evaluation of a series of resveratrol derivatives modified in C2 position. Eur J Med Chem 2007;42:263–7. [13] Zou Y, Zhong RQ, Zhang XJ, Zhou Y, Wang ZX, Lin HZ. The preparation of 3-hydroxy-4,3 ,4 ,5 -tetramethoxybibenzyl. Chinese Patent Office, 2006;200410077574.5. [14] Gaukroger K, Hadfield JA, Hepworth LA, Lawrence NJ, McGown AT. Novel syntheses of cis and trans isomers of combretastatin A-4. J Org Chem 2001;66:8135–8. [15] Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM. 15-Deoxydelta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell 1995;83:803–12. [16] Park CE, Kim MJ, Lee JH, Min BI, Bae H, Choe W, et al. Resveratrol stimulates glucose transport in C2C12 myotubes by activating AMP-activated protein kinase. Exp Mol Med 2007;39:222–9. [17] Park SH, Gammon SR, Knippers JD, Paulsen SR, Rubink DS, Winder WW. Phosphorylation-activity relationships of AMPK and acetyl-CoA carboxylase in muscle. J Appl Physiol 2002;92:2475–82. [18] Hardie DG, Pan DA. Regulation of fatty acid synthesis and oxidation by the AMP-activated protein kinase. Biochem Soc Trans 2002;30:1064–70. [19] Hardie DG, Hawley SA, Scott JW. AMP-activated protein kinase—development of the energy sensor concept. J Physiol 2006;574:7–15. [20] Lee WJ, Kim M, Park HS, Kim HS, Jeon MJ, Oh KS, et al. AMPK activation increases fatty acid oxidation in skeletal muscle by activating PPARalpha and PGC-1. Biochem Biophys Res Commun 2006;340:291–5. [21] Ravnskjaer K, Boergesen M, Dalgaard LT, Mandrup S. Glucose-induced repression of PPARalpha gene expression in pancreatic beta-cells involves PP2A activation and AMPK inactivation. J Mol Endocrinol 2006;36:289–99. [22] Leff T. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem Soc Trans 2003;31:224–7. [23] Musi N, Goodyear LJ. Targeting the AMP-activated protein kinase for the treatment of type 2 diabetes. Curr Drug Targets Immune Endocr Metabol Disord 2002;2:119–27. [24] Winder WW. AMP-activated protein kinase: possible target for treatment of type 2 diabetes. Diabetes Technol Ther 2000;2:441–8. [25] Kim HI, Cha JY, Kim SY, Kim JW, Roh KJ, Seong JK, et al. Peroxisomal proliferatoractivated receptor-gamma upregulates glucokinase gene expression in betacells. Diabetes 2002;51:676–85. [26] Sauma L, Stenkula KG, Kjolhede P, Stralfors P, Soderstrom M, Nystrom FH. PPARgamma response element activity in intact primary human adipocytes: effects of fatty acids. Nutrition 2006;22:60–8. [27] Pettit GR, Singh SB, Hamel E, Lin CM, Alberts DS, Garcia-Kendall D. Isolation and structure of the strong cell growth and tubulin inhibitor combretastatin A-4. Experientia 1989;45:209–11. [28] Young SL, Chaplin DJ. Combretastatin A4 phosphate: background and current clinical status. Expert Opin Investig Drugs 2004;13:1171–82. [29] West CM, Price P. Combretastatin A4 phosphate. Anticancer Drugs 2004;15:179–87. [30] Xue B, Kahn BB. AMPK integrates nutrient and hormonal signals to regulate food intake and energy balance through effects in the hypothalamus and peripheral tissues. J Physiol 2006;574:73–83. [31] Long YC, Zierath JR. AMP-activated protein kinase signaling in metabolic regulation. J Clin Invest 2006;116:1776–83. [32] Jorgensen SB, Wojtaszewski JF, Viollet B, Andreelli F, Birk JB, Hellsten Y, et al. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J 2005;19:1146–8. [33] Henriksen EJ, Dokken BB. Role of glycogen synthase kinase-3 in insulin resistance and type 2 diabetes. Curr Drug Target 2006;7:1435–41. [34] Handlon AL, Zhou H. Melanin-concentrating hormone-1 receptor antagonists for the treatment of obesity. J Med Chem 2006;49:4017–22. [35] Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism. Cell Metab 2005;1:15–25. [36] Brown JD, Plutzky J. Peroxisome proliferator-activated receptors as transcriptional nodal points and therapeutic targets. Circulation 2007;115:518–33.