- Email: [email protected]
Common pathogenic mechanism in patients with dropped head syndrome caused by different mutations in the MYH7 gene
Gene 697 (2019) 159–164
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Common pathogenic mechanism in patients with dropped head syndrome caused by different mutations in the MYH7 gene
T
⁎
Yulia Surikovaa, , Alexandra Filatovab, Margarita Polyaka, Mikhail Skoblovb,c, Elena Zaklyazminskayaa,d a
Medical Genetics Laboratory, Petrovsky Russian Research Center of Surgery, Moscow 119991, Russia Laboratory of Functional Genomics, Research Centre for Medical Genetics, Moscow 115522, Russia c School of Biomedicine, Far Eastern Federal University, Vladivostok 690090, Russia d Pirogov Russian National Research Medical University, Moscow 117997, Russia b
A R T I C LE I N FO
A B S T R A C T
Keywords: MYH7 Dilated cardiomyopathy Exon-skipping MYH7-related myopathy Splicing Dropped head syndrome Floppy head syndrome Congenital myopathy
Mutations in the MYH7 gene are the source of an allelic series of diseases, including various cardiomyopathies and skeletal myopathies that usually manifest in adulthood. We observed a 1.5 y.o. male patient with congenital weaknesses of the axial muscles, “dropped head” syndrome, and dilated cardiomyopathy. The clinical evaluation included medical history, an echocardiogram, electromyography, and a histopathological study. The genetic evaluation included whole exome sequencing. Muscle biopsy samples from the proband were used for mRNA extraction. We revealed a novel genetic variant c.5655 + 5G > C in the MYH7 gene. The analysis of the cDNA showed an in-frame skipping of exon 38 (p.1854_1885del). This variant and two previously published mutations (c.5655G > A and c.5655 + 1G > A), also presumably leading to exon 38 skipping, were studied by expression analysis in the HEK293T cell line transfected with 4 plasmids containing the MYH7 minigene (wt, c.5655G > C, c.5655 + 1G > A and c.5655 + 5G > A). A quantitative difference in expression was shown for cell lines with each of the three mutant plasmids. All mutation carriers had a similar phenotype and included congenital axial myopathy and variable cardiac involvement. Prominent dropped head syndrome was mentioned in all patients. Early-onset axial myopathy with a dropped head syndrome is a distinct clinical entity within MYH7-related disorders. We suggest that mutations in the MYH7 gene affecting the C-terminal domain of beta-myosin heavy chain should also be considered as a possible cause in cases of early-onset myopathy with “dropped head” syndrome.
1. Introduction The MYH7 gene encodes the beta heavy chain subunit of cardiac myosin. There is only one isoform expressed predominantly in the ventricle of normal human heart and in the slow-twitch type I muscle fibres in skeletal muscle tissues (Lamont et al., 2014). Currently, seven different phenotypes related to the MYH7 mutations are presented in the OMIM database, and most of them transmit by autosomal dominant mode of inheritance [MIM: 160760]. The clinical phenotype varies but usually includes cardiac and/or skeletal muscle involvement with adultonset manifestation (Hedera et al., 2003; Yang et al., 2015; He and Gu, 2017; Meredith et al., 2004). Pathogenic variants affecting head and
neck domains of the protein often exhibit a cardiac presentation, and mutations localized in the coiled-coil tail of the beta-myosin more often lead to a predominantly myopathic feature (Lamont et al., 2006). More than 200 pathogenic and likely pathogenic variants in the MYH7 gene are registered in the ClinVar database (Web Resources). Manifestation of the diseases caused by pathogenic variants in the MYH7 gene is broad and may vary significantly even among family members (Lamont et al., 2014). The clinical appearance manifests either in childhood or adulthood, but variants in the MYH7 gene are not usually considered as possible causes of congenital myopathy or myopathy with drop head syndrome (Lamont et al., 2014; Pajusalu et al., 2016; Fiorillo et al., 2016; North et al., 2014; Karaoglu et al., 2017).
Abbreviations: CK, creatine phosphokinase; DCM, dilated cardiomyopathy; ECG, electrocardiography; EF, ejection fraction; EMG, electromyography; LV, left ventricular; LVED, left ventricle end-diastolic diameter; NGS, next-generation sequencing; NIV, noninvasive ventilation; LVNC, left ventricular non-compaction cardiomyopathy; qPCR, quantitative polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction; SNV, single-nucleotide variant; WT, wildtype ⁎ Corresponding author at: Medical Genetics Laboratory, Petrovsky Russian Research Center of Surgery, 119991, Abrikosovsky 2, Moscow, Russia. E-mail address: [email protected] (Y. Surikova). https://doi.org/10.1016/j.gene.2019.02.011 Received 2 October 2018; Received in revised form 24 January 2019; Accepted 6 February 2019 Available online 19 February 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 697 (2019) 159–164
Y. Surikova, et al.
biopsy samples of the proband and his father. RT-PCR following Sanger sequencing of target cDNA fragments was performed with the following oligoprimers: 3F (5′- GGAGATTCGGAGATGGCAG -3′), 4-5R (5′- ATCA GTACATGCTGACAGACAGAGAA -3′), 36-37F (5′- ACGGATGCCGCCAT GAT -3′) and 39R (5′- ACGAAGGGCTTGAATGAGGAG-3′). Paternity and maternity were confirmed by multiplex STR typing of 15 loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818, and FGA), in addition to a gender identification marker, amelogenin, by 10% PAAG electrophoresis. Functional analysis. Functional analysis of the splicing variants was performed using an expression system in model cell line HEK293T. The genome region containing exon 37 to 39 of the MYH7 gene was amplified from DNA of the patient and cloned into the BglII/SalI sites of the pSplPIG vector (kindly provided by Dr. K.A. Lukyanov) (Gurskaya et al., 2012). The resulting plasmid with wild-type (WT) or c.5655 + 5G > C were confirmed by Sanger sequencing. Plasmids with variants c.5655G > A or c.5655 + 1G > A were created by site-directed mutagenesis. The constructs generated were transfected into the HEK293T cells. After isolation of RNA and cDNA synthesis, we carried out PCR analysis. For detection of transcripts with and without exon 38, we amplified the minigene cDNA locus from exon 37 to the plasmid-specific region and analysed results by gel electrophoresis. We performed qPCR with EvaGreen® Dye for expression analysis for the MYH7 gene isoforms. For selective amplification of full-length and Δ38 isoforms we used common forward primer 37F and specific reverse primer spanning appropriate exon-exon boundary (38/39R for full-length, 37/39R for Δ38). We normalized the expression level of different MYH7 isoforms to the reference plasmid-specific neomycin phosphotransferase (npt) transcript. All the experiments were carried out with at least 5 replicates, and the data were analysed using a paired Mann-Whitney U Test.
Frameshift variants and SNVs affecting canonical splicing site dinucleotides (+ − 1, + − 2) are usually considered as loss-of-function variants (Richards et al., 2015). However, it is known that premature stop codons in some genes encoding sarcomeric proteins, i.e., in the MYH7 gene, are highly tolerated (Richards et al., 2015; Cooper et al., 2013). Interpretation of intronic variants located outside the two ultraconservative positions at both the 5′ (donor) and 3′ (acceptor) splice sites is challenging. Functional interpretation of intronic variants should be done with caution and requires functional confirmation of any clinical significance (either “benign” or “pathogenic”) predicted by in silico tools (Richards et al., 2015). The main goal of genetic counselling is to provide complete information about the patient's disease and how it will progress. This prognosis can be extracted from groups of patients with the same variant and disease. For example, long QT syndrome type 1 is caused by the mutation p. A341V in the KCNQ1 gene. This variant shows high clinical severity regardless of the ethnic origin of the afflicted families (Crotti et al., 2007). Sometimes different mutations in the same gene result in a similar pathogenic mechanism leading to high uniformity of clinical manifestation. For example, some pathogenic non-missense variants in the LMNA gene cause a highly consistent cardiac phenotype starting at the 5th decade of life (Wong et al., 2016). Meanwhile, carriers of the common Leiden mutation in the FV gene display a wide range of phenotypic variability from asymptomatic carriage to recurrent venous thrombosis and/or pregnancy loss (Kujovich, 2011). Lack of reliable data about phenotype-genotype correlation for many genes such as MYH7, which have no “hot spots” or founder mutation, results partly from the uniqueness of a particular variant, uniqueness of a particular patient/family, and lack of material for comparison. That is why we found it so important to compare experimental and clinical data from a couple of patients with pathogenic variants in the MYH7 gene that look different but presumably have the same molecular mechanism.
3. Results 2. Methods Clinical case. We observed a male proband with sporadic case of congenital muscular weakness, delayed motor development and decreased cardiac pump function from 7 months of age. The follow-up period was 4 years. He was born after the pregnancy became complicated with a miscarriage risk. The congenital generalized muscular hypotonia was initially explained by perinatal encephalopathy. Parents were not consanguineous, and no case of progressive muscular disorders and cardiomyopathy was observed in the family. The milestones of his motor development and cardiac function are summarized in Table 1. At 3,5 months old, the proband could still not hold up his head and had low muscle tone. At 5 months old, he could not roll over, and muscle weaknesses became more pronounced in the neck and arms. Metabolic disorders and infections were excluded. The patient started to roll over at 7 months old and was found to have left ventricular dilatation. Total creatine phosphokinase in blood tests was consistently
Clinical evaluation. This study was performed in accordance with the Helsinki declaration and local ethics committee. Data obtained from proband included medical history, biochemical analysis of blood, 12‑lead resting ECG, transthoracic echocardiogram, electromyography, and histopathological examination of the muscles. Genetic analysis. Genomic DNA was extracted from the white blood cells of the proband and his parents by standard method. Mutational screening in the proband's DNA was performed by whole exome sequencing. We used NextGene V2.3.4 (Softgenetics, State College, PA, USA) and compared the resulting data with the UCSC database for presumably disease-causing variant identification. Confirmation of the genetic finding in the proband's DNA sample and cascade familial screening for his parents and siblings was performed by PCR-based bidirectional Sanger sequencing with a set of the original intronic oligoprimers. To confirm the presence of abnormal MYH7 transcript in vivo, total RNA was extracted from the muscle
Table 1 Proband's clinical Information with follow-up period during 4 years. EF - ejection fraction, LVED - left ventricle end-diastolic diameter. Age
Weight, kg
Height, sm
Cardiological parameters Development
5 m.o 6 m.o 1 y.o 1 y. 3 m. 2 y.o 2,5 y.o. 3,5 y.o. 4 y.o.
6,5 8,2 9,0 (10–25 percentile) 9,0 (3 percentile) 10,2 (3 percentile) 11,2 (< 3 percentile) 12,8 (10 percentile) 14 (10 percentile)
62 73 79,5 80 86 87 96 104
EF (Teicholz), %
EF (Simpson),%
LVED, mm (N)
N 54,3 53,0 48 58 58 59,1 56
N 48,1 43 42 45 No data 49,5 No data
N 34,0 (31) 35,6 (31) 35 (31) 36 (32) 37 (32) 38,4 (34) No data
160
Couldn't hold his head and turn over Couldn't hold his head; could roll over Couldn't hold his head, couldn't sit; could roll over No data Could stand, but held his head weakly Could sit, could stand and walk if head is supported. Start to walk if head is supported Start to walk if head is supported
Gene 697 (2019) 159–164
Y. Surikova, et al.
analysis predicted splicing alteration with a high probability; however, at this stage, the new genetic variant can be classified as “likely pathogenic” with PS2 and PM2 levels of evidence according to the ACMG Standards and Guidelines (Richards et al., 2015). Functional analysis. To prove significance of this genetic variant we performed non-quantitative RT-PCR with cDNA sequencing of the proband's and his healthy father muscle biopsy samples. Sanger sequencing of the target cDNA fragment from the proband revealed the in-frame skipping of the exon 38 (Fig. 2). The proband's cDNA was thought to translate into a protein lacking 32 amino acids in the myosin tail. We were able to detect only the full-length variant of MYH7 in the cDNA sample from the healthy father. Earlier studies described two additional genetic variants of the MYH7 gene in close proximity to our finding: c.5655G > A (synonymous mutation) and c.5655 + 1G > A (Pajusalu et al., 2016; Fiorillo et al., 2016). These variants were also predicted to affect exon 38 splicing (Fig. 3A). We have suggested that the clinical variability in patients with those variants may be explained by different expression of mutant alleles. To validate this hypothesis, we used a minigene system. RT-PCR analysis of the minigene expressed transcripts revealed two products corresponding full-length transcript and an alternatively spliced product without exon 38 (Δ38) (Fig. 4A). We revealed that the WT-minigene expressed the full-length transcript and a small amount of the Δ38 transcript, whereas all mutant minigenes expressed only the Δ38 transcript. In addition, we performed qPCR analysis of the minigene expressed transcripts to determine whether there is a difference in the expression level of the aberrant isoform among the different variants at the same splice site. For this purpose we used isoform-specific primers: 38/39R for the full-length transcript and 37/39R for the Δ38 transcript (Fig. 3B). To demonstrate that the quantitative differences are not related to the amount of plasmid in each case, we normalized the expression level to a reference plasmid-specific neomycin-phosphotransferase (npt) transcript. In addition, we validated that the expression level of this npt transcript is the same in all test samples (data not shown). We found that all mutated minigenes had a highly significant increase of the Δ38 isoform and an absence of the full-length transcript. In addition, there was a small but significant difference in the expression level of the Δ38 transcripts for the c.5655G > A and c.5655 + 5G > C constructs (Fig. 4B).
normal. The electromyography showed features of myopathy. Histological examination of the muscle revealed unspecified muscle atrophy. He had pronounced weakness in the neck and shoulder girdle muscles with signs of dropped head syndrome and weakness in the gluteal and quadriceps muscles; however, he was able to stand with support. Extensive neuro-muscular rehabilitation was performed including ongoing massage, exercises, and swimming in a pool. The patient became ambulant at 3 y.o., and scoliosis had appeared. The neck muscles seem to be the weakest muscular group, and the patient needed constant additional head support when walking or sitting. Moderate left ventricular dilation with preserved ejection fraction (EF) was first mentioned at 7 months of age and was slowly progressing. At this time, the proband was diagnosed with DCM, as ejection fraction of the LV was 45% without any sign of heart failure. No breathing or swallowing difficulties were detected. Emotional and intellectual development was completely preserved. Genetic analysis. The NGS analysis identified a novel genetic variant c.5655 + 5G > C [RefSeq NM_000257.3] in the MYH7 gene in the proband. This variant wasn't described in available databases. De novo status was assumed by the family history and confirmed by absence of the variant in the parent's and healthy sibling's DNA samples (Fig. 1) as well as by paternity and maternity confirmation by STR typing. Multiple alignment shows that this region is highly conserved through different species. The potential influence of c.5655 + 5G > C on the splice site probability was studied with two independent tools as recommended by ACMG Standards and Guidelines (NetGene2 and NNSPLICE software) (Richards et al., 2015). Both bioinformatic resources had predicted the disruption of a canonical donor splice site. In silico
4. Phenotype-genotype correlation We compared the clinical characteristics of the patients with different genomic but identical mRNA changes (Table 2). Patients descriptions occurred at different ages with various follow-up periods which greatly impairs the genotype-phenotype correlation. However, we were able to observe many similar features. All cases were sporadic, and presumably independent mutational events occurred in each family. De novo status of the variants was clearly confirmed in all carriers (Pajusalu et al., 2016; Fiorillo et al., 2016). The genomic region [NC_000014.8:g.23883211_23883216; GRCh37.p13] including the donor splice site flanking exon 38 might represents an area where exon-skipping is a common pathogenic mechanism. The onset of myopathy was congenital in all cases, which is not common for MYH7-related disorders. The pattern of the muscular weaknesses was also similar: predominant axial hypotonia with a strong neck involvement. Respiratory dysfunction was described only for 1 patient at 7 y.o. (Fiorillo et al., 2016), but it is difficult to conclude whether is this feature consistent because of the younger age of the other patients. Three patients had cardiac symptoms (Pajusalu et al., 2016; Fiorillo et al., 2016). The spectrum of cardiac symptoms included conduction defects and different variants of cardiac remodelling: dilated cardiomyopathy and left ventricular non-compaction.
Fig. 1. Proband's pedigree. Squares and circles indicate males and females, respectively. Open symbols indicate healthy family members, black square is a proband. The arrow indicates the genetic variant c.5655 + 5G > C in the MYH7 gene. 161
Gene 697 (2019) 159–164
Y. Surikova, et al.
Fig. 2. A. Agarose gel electrophoresis of amlified fragments from the proband's and his healthy father's cDNA obtained from muscle biopsy. WT – wild type, Δ38 – amplicon with skipping of the exon 38 in the MYH7 gene. B. The sequence of the MYH7 gene of the patient cDNA. Squares mark the boundaries of exons, the arrow indicates absence of the 38 exon.
Fig. 3. Functional analysis of mutations affecting exon 38 splicing. (A) MYH7 exon 38 donor splice site is weak splice-site. A sequence logo of all canonical human donor slice sites, the height of the letters is proportional to the frequency of the corresponding nucleotide in this position (Hedera et al., 2003) (top) and alignment of MYH7 exon 38 donor splice site: wild-type and with the investigated mutations(c.5655G > A, c.5655 + 1G > A, c.5655 + 5G > C) (mutation is underlined). (B) Primer's scheme for amplification of minigene cDNA: for total amplification - 37F and plR, for selective amplification of the full-length transcript - 37F and 38.39R, for selective amplification of theΔ38 transcript - 37F and 37.39R.
5. Discussion
obligatory included as loss-of-function annotations, while others nearby are most often ignored in such annotations (Zhang et al., 2018). The experimental data demonstrate that a new intronic variant c.5655 + 5G > C in the MYH7 gene leads to breaking the donor splice site (Fig. 2), resulting in the skipping of exon 38 in the mRNA
Newly describes genetic variant c.5655 + 5G > C occurs in intronic area of the MYH7 gene deeper than so-called “canonical” splice bases [−2, −1, +1, +2]. Changes in these essential positions are
Fig. 4. Functional analysis of mutations affecting exon 38 splicing. (А) Gel electrophoresis (amplified using 37F and plR primers) revealed two products corresponding full-length transcript and alternatively spliced product without exon 38 (Δ38). (В) Relative expression of two isoforms: full-length (amplified using 37F and 38.39R primers) and Δ38 (amplified using 37F and 37.39R primers) in HEK293T cells treated by equal amount of different minigene constructions (wilt type (wt), c.5655G > A, c.5655 + 1G > A, c.5655 + 5G > C) and normalized to plasmid-specific npt transcript. Asterisks indicate significant difference from the wild-type minigene construction (using paired Mann-Whitney U Test, p-value ** < 0,005) and pairwise difference between samples (using paired Mann-Whitney U Test, pvalue * < 0,05). 162
Gene 697 (2019) 159–164
Y. Surikova, et al.
Table 2 Comparison of clinical manifestations in patients with variants c.5655 + 5G > C, c.5655G > A or c.5655 + 1G > A in the MYH7 gene. NIV-noninvasive ventilation, LVNC – left ventricular non-compaction cardiomyopathy, DCM - dilated cardiomyopathy. №
1
2
3
4
Sex Age, y.o. Family history Onset of symptoms Weakness distribution Floppy head Scoliosis Respiratory involvement Cardiac involvement CK U/I EMG Muscle biopsy Mutation Reference
F 18 No Congenital Axial and distal lower limb Not mentionted Yes (severe) Yes (NIV needed from age 7) Left bundle block Normal Myopathic Unspecific c.5655G > A Fiorillo et al., 2016
M 1.9 No Congenital Axial Predominant No data No No Normal Myopathic Fiber-type disproportion with no inclusion c.5655G > A Pajusalu et al., 2016
M 8 No Congenital Axial Predominant Yes No LVNC Normal Myopathic Minicores c.5655 + 1G > A Fiorillo et al., 2016
M 4 No Congenital Axial Predominant Yes (moderate) No DCM Normal Myopathic Unspecific muscle atrophy c.5655 + 5G > C This study
6. Conclusion
(NM_000257.3:c.5560_5655del). Two previously described genomic variants (c.5655G > A and c.5655 + 1G > A) caused the same qualitative effect on the mRNA (Pajusalu et al., 2016; Fiorillo et al., 2016). This mutant mRNA translates into the shorter myosin isoform lacking 32 amino acids (NP_000248:p.1854_1885del) in the coiled-coil domain of myosin-7. It might influence folding and affect titin interaction. Detection of the Δ38-MYH7 cDNA allowed us to reclassify c.5655 + 5G > C variant as pathogenic with a PS3 level of evidence in addition to the de novo status with the paternity and maternity confirmed according to the ACMG Standards and Guidelines (Richards et al., 2015). This experimental data shows that additional “near-splice-site” positions are important for the normal splicing. In Zhang et al. (2018) study was shown that a specific reference allele is more intolerant for the mutational alteration than others in the same positions (Zhang et al., 2018). It was specifically pointed out that “G” nucleotide in +5 position of the donor splice site (D + 5) is significantly less tolerant of mutations than are the other three reference bases at this +5 position (Zhang et al., 2018). We investigated the quantitative effect of these variants on the splicing efficiency of the exon 38 using a minigene system. We showed that the WT minigene construction produced mostly full-length transcript, but surprisingly we also detected small amount of the Δ38 transcript. This phenomenon could be explained by two possible ways. One way is that the donor splice site of the exon 38 in the MYH7 gene contains 3 non-consensus nucleotides in the c.5653, c.5654, c.5655 + 3 positions and this is a constitutively weak splice site (Fig. 3A). It allows alternative splicing, and a small amount of the Δ38 transcript might be detected in healthy individuals. However, we failed to detect Δ38 transcript in the total cDNA samples of the healthy proband's father and unrelated control samples (data not shown). Another possibility is that our model system has its own limitation coming from the partial gene sequence introduced into the minigene, and the non-myocyte cellular context might facilitate alternative splicing. We have shown also a quantitative difference between transcripts from minigene constructs containing alterations in the c.5653, c.5654, and c.5655 + 3 positions. We speculate that exact nucleotide consequence within alternative splice site might influence efficiency of transcription. With a limited number of patients and lack of clinical data, this quantitative difference cannot be reliably assigned to any particular clinical manifestation. Further investigation is needed to clarify a role of particular genetic alteration, transcription efficiency, and clinical phenotype.
Genetic variants leading to the skipping of exon 38 in the MYH7 gene causes a particular MYH7-related phenotype: congenital myopathy with unusually early manifestation, axial hypotonia, and drop head syndrome. The clinical phenotype caused by different genomic variants but realized by the same molecular mechanism is highly consistent. MYH7 gene mutations should also be considered for DNA diagnostics in such patients. This exon38_38intron junction area might represent a hot spot for de novo pathogenic variants leading to this phenotype. Early manifestation, progressive natural history of disease, and “unaffected” pedigree might be misleading in respect to the mode of inheritance and overestimation of the recurrent risk if assessed as autosomal recessive. Thus, genetic counselling should be performed with caution in such sporadic cases. More attention should be paid for the interpretation of the genetic variants +/− 10 bp the 5′ and 3′ splice sites. Acknowledgement This work was supported by Russian Science Foundation grant №16-15-10421. References Cooper, D.N., Krawczak, M., Polychronakos, C., Tyler-Smith, C., Kehrer-Sawatzki, H., 2013. Where genotype is not predictive of phenotype: towards an understanding of the molecular basis of reduced penetrance in human inherited disease. Hum. Genet. 132 (10), 1077–1130. Crotti, L., Spazzolini, C., Schwartz, P.J., Shimizu, W., Denjoy, I., Schulze-Bahr, E., Zaklyazminskaya, E.V., Swan, H., Ackerman, M.J., Moss, A.J., et al., 2007. The common long-QT syndrome mutation KCNQ1/A341V causes unusually severe clinical manifestations in patients with different ethnic backgrounds: toward a mutationspecific risk stratification. Circulation. 116 (21), 2366–2375. Fiorillo, C., Astrea, G., Savarese, M., Cassandrini, D., Brisca, G., Trucco, F., Pedemonte, M., Trovato, R., Ruggiero, L., Vercelli, L., et al., 2016. MYH7-related myopathies: clinical, histopathological and imaging findings in a cohort of Italian patients. Orphanet J. Rare Dis. 11 (1), 91–115. Gurskaya, N.G., Staroverov, D.B., Zhang, L., Fradkov, A.F., Markina, N.M., Pereverzev, A.P., Lukyanov, K.A., 2012. Analysis of alternative splicing of cassette exons at singlecell level using two fluorescent proteins. Nucleic Acids Res. 40 (8), e57. He, Y.M., Gu, M.M., 2017. Research progress of myosin heavy chain genes in human genetic diseases. Yi Chuan 39 (10), 877–887. Hedera, P., Petty, E.M., Bui, M.R., Blaivas, M., Fink, J.K., 2003. The second kindred with autosomal dominant distal myopathy linked to chromosome 14q: genetic and clinical analysis. Arch. Neurol. 60 (9), 1321–1325. Karaoglu, P., Quizon, N., Pergande, M., Wang, H., Polat, A.I., Ersen, A., Özer, E., Willkomm, L., Hiz Kurul, S., Heredia, R., et al., 2017. Dropped head congenital muscular dystrophy caused by de novo mutations in LMNA. Brain Dev. 39 (4), 361–364. Kujovich, J.L., 2011. Factor V Leiden thrombophilia. Genet. Med. 13 (1), 1–16. Lamont, P., Laing, N.G., 2006. Laing Distal Myopathy. In: Adam, MP, Ardinger, HH, Pagon, RA (Eds.), GeneReviews® [Internet]. 1993-2019 University of Washington, Seattle, Seattle (WA) Oct 17 [Updated 2015 Mar 12]. https://www.ncbi.nlm.nih.
163
Gene 697 (2019) 159–164
Y. Surikova, et al.
Med. 17 (5), 405–424. Wong, Chun Ka, Chan, Pak Hei, Hai, Jo Jo, Lai, Wing Hon, Lau, Yee Man, Lee, Yee Ki, Wong, Lai Yung, Ho, Chung Yee, Huang, Dou, Cai, Zhu Jun, et al., 2016. Clinical course of non-missense LMNA mutation carriers with cardiac phenotype. Circ. Res. 23511. Yang, J., Zhu, M., Wang, Y., Hou, X., Wu, H., Wang, D., Shen, H., Hu, Z., Zou, J.v., 2015. Whole-exome sequencing identify a new mutation of MYH7 in a Chinese family with left ventricular noncompaction. Gene 558 (1), 138–142 1. Zhang, S., Samocha, K.E., Rivas, M.A., Karczewski, K.J., Daly, E., Schmandt, B., Neale, B.M., MacArthur, D.G., Daly, M.J., 2018. Base-specific mutational intolerance near splice sites clarifies the role of nonessential splice nucleotides. Genome Res. 28 (7), 968–974. https://doi.org/10.1101/gr.231902.117.
gov/books/NBK1433/. Lamont, P.J., Wallefeld, W., Hilton-Jones, D., Udd, B., Argov, Z., Barboi, A.C., Bonneman, C., Boycott, K.M., Bushby, K., Connolly, A.M., et al., 2014. Novel mutations widen the phenotypic spectrum of slow skeletal/β-cardiac myosin (MYH7) distal myopathy. Hum. Mutat. 35 (7), 868–879. Meredith, C., Herrmann, R., Parry, C., Liyanage, K., Dye, D.E., Durling, H.J., Duff, R.M., Beckman, K., de Visser, M., van der Graaff, M.M., et al., 2004. Mutations in the slow skeletal muscle fiber myosin heavy chain gene (MYH7) cause laing early-onset distal myopathy (MPD1). Am. J. Hum. Genet. 75, 703–708. North, K.N., Wang, C.H., Clarke, N., Jungbluth, H., Vainzof, M., Dowling, J.J., Amburgey, K., Quijano-Roy, S., Beggs, A.H., Sewry, C., et al., 2014. Approach to the diagnosis of congenital myopathies. Neuromuscul. Disord. 24 (2), 97–116. Pajusalu, S., Talvik, I., Noormets, K., Talvik, T., Põder, H., Joost, K., Puusepp, S., Piirsoo, A., Stenzel, W., Goebel, H.H., et al., 2016. De novo exonic mutation in MYH7 gene leading to exon skipping in a patient with early onset muscular weakness and fibertype disproportion. Neuromuscul. Disord. 26 (3), 236–239. Richards, S., Aziz, N., Bale, S., Bick, D., Das, S., Gastier-Foster, J., Grody, W.W., Hegde, M., Lyon, E., Spector, E., et al., 2015. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet.
Web resources ClinVar Database https://www.ncbi.nlm.nih.gov/clinvar/?term=MYH7%5Bgene%5D +Pathogenic. NetGene2 http://www.cbs.dtu.dk/services/NetGene2/. NNSPLICE software http://www.fruitfly.org/seq_tools/splice.html. OMIM https://www.omim.org/.
164
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Common pathogenic mechanism in patients with dropped head syndrome caused by different mutations in the MYH7 gene
T
⁎
Yulia Surikovaa, , Alexandra Filatovab, Margarita Polyaka, Mikhail Skoblovb,c, Elena Zaklyazminskayaa,d a
Medical Genetics Laboratory, Petrovsky Russian Research Center of Surgery, Moscow 119991, Russia Laboratory of Functional Genomics, Research Centre for Medical Genetics, Moscow 115522, Russia c School of Biomedicine, Far Eastern Federal University, Vladivostok 690090, Russia d Pirogov Russian National Research Medical University, Moscow 117997, Russia b
A R T I C LE I N FO
A B S T R A C T
Keywords: MYH7 Dilated cardiomyopathy Exon-skipping MYH7-related myopathy Splicing Dropped head syndrome Floppy head syndrome Congenital myopathy
Mutations in the MYH7 gene are the source of an allelic series of diseases, including various cardiomyopathies and skeletal myopathies that usually manifest in adulthood. We observed a 1.5 y.o. male patient with congenital weaknesses of the axial muscles, “dropped head” syndrome, and dilated cardiomyopathy. The clinical evaluation included medical history, an echocardiogram, electromyography, and a histopathological study. The genetic evaluation included whole exome sequencing. Muscle biopsy samples from the proband were used for mRNA extraction. We revealed a novel genetic variant c.5655 + 5G > C in the MYH7 gene. The analysis of the cDNA showed an in-frame skipping of exon 38 (p.1854_1885del). This variant and two previously published mutations (c.5655G > A and c.5655 + 1G > A), also presumably leading to exon 38 skipping, were studied by expression analysis in the HEK293T cell line transfected with 4 plasmids containing the MYH7 minigene (wt, c.5655G > C, c.5655 + 1G > A and c.5655 + 5G > A). A quantitative difference in expression was shown for cell lines with each of the three mutant plasmids. All mutation carriers had a similar phenotype and included congenital axial myopathy and variable cardiac involvement. Prominent dropped head syndrome was mentioned in all patients. Early-onset axial myopathy with a dropped head syndrome is a distinct clinical entity within MYH7-related disorders. We suggest that mutations in the MYH7 gene affecting the C-terminal domain of beta-myosin heavy chain should also be considered as a possible cause in cases of early-onset myopathy with “dropped head” syndrome.
1. Introduction The MYH7 gene encodes the beta heavy chain subunit of cardiac myosin. There is only one isoform expressed predominantly in the ventricle of normal human heart and in the slow-twitch type I muscle fibres in skeletal muscle tissues (Lamont et al., 2014). Currently, seven different phenotypes related to the MYH7 mutations are presented in the OMIM database, and most of them transmit by autosomal dominant mode of inheritance [MIM: 160760]. The clinical phenotype varies but usually includes cardiac and/or skeletal muscle involvement with adultonset manifestation (Hedera et al., 2003; Yang et al., 2015; He and Gu, 2017; Meredith et al., 2004). Pathogenic variants affecting head and
neck domains of the protein often exhibit a cardiac presentation, and mutations localized in the coiled-coil tail of the beta-myosin more often lead to a predominantly myopathic feature (Lamont et al., 2006). More than 200 pathogenic and likely pathogenic variants in the MYH7 gene are registered in the ClinVar database (Web Resources). Manifestation of the diseases caused by pathogenic variants in the MYH7 gene is broad and may vary significantly even among family members (Lamont et al., 2014). The clinical appearance manifests either in childhood or adulthood, but variants in the MYH7 gene are not usually considered as possible causes of congenital myopathy or myopathy with drop head syndrome (Lamont et al., 2014; Pajusalu et al., 2016; Fiorillo et al., 2016; North et al., 2014; Karaoglu et al., 2017).
Abbreviations: CK, creatine phosphokinase; DCM, dilated cardiomyopathy; ECG, electrocardiography; EF, ejection fraction; EMG, electromyography; LV, left ventricular; LVED, left ventricle end-diastolic diameter; NGS, next-generation sequencing; NIV, noninvasive ventilation; LVNC, left ventricular non-compaction cardiomyopathy; qPCR, quantitative polymerase chain reaction; RT-PCR, reverse transcription polymerase chain reaction; SNV, single-nucleotide variant; WT, wildtype ⁎ Corresponding author at: Medical Genetics Laboratory, Petrovsky Russian Research Center of Surgery, 119991, Abrikosovsky 2, Moscow, Russia. E-mail address: [email protected] (Y. Surikova). https://doi.org/10.1016/j.gene.2019.02.011 Received 2 October 2018; Received in revised form 24 January 2019; Accepted 6 February 2019 Available online 19 February 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 697 (2019) 159–164
Y. Surikova, et al.
biopsy samples of the proband and his father. RT-PCR following Sanger sequencing of target cDNA fragments was performed with the following oligoprimers: 3F (5′- GGAGATTCGGAGATGGCAG -3′), 4-5R (5′- ATCA GTACATGCTGACAGACAGAGAA -3′), 36-37F (5′- ACGGATGCCGCCAT GAT -3′) and 39R (5′- ACGAAGGGCTTGAATGAGGAG-3′). Paternity and maternity were confirmed by multiplex STR typing of 15 loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, vWA, TPOX, D18S51, D5S818, and FGA), in addition to a gender identification marker, amelogenin, by 10% PAAG electrophoresis. Functional analysis. Functional analysis of the splicing variants was performed using an expression system in model cell line HEK293T. The genome region containing exon 37 to 39 of the MYH7 gene was amplified from DNA of the patient and cloned into the BglII/SalI sites of the pSplPIG vector (kindly provided by Dr. K.A. Lukyanov) (Gurskaya et al., 2012). The resulting plasmid with wild-type (WT) or c.5655 + 5G > C were confirmed by Sanger sequencing. Plasmids with variants c.5655G > A or c.5655 + 1G > A were created by site-directed mutagenesis. The constructs generated were transfected into the HEK293T cells. After isolation of RNA and cDNA synthesis, we carried out PCR analysis. For detection of transcripts with and without exon 38, we amplified the minigene cDNA locus from exon 37 to the plasmid-specific region and analysed results by gel electrophoresis. We performed qPCR with EvaGreen® Dye for expression analysis for the MYH7 gene isoforms. For selective amplification of full-length and Δ38 isoforms we used common forward primer 37F and specific reverse primer spanning appropriate exon-exon boundary (38/39R for full-length, 37/39R for Δ38). We normalized the expression level of different MYH7 isoforms to the reference plasmid-specific neomycin phosphotransferase (npt) transcript. All the experiments were carried out with at least 5 replicates, and the data were analysed using a paired Mann-Whitney U Test.
Frameshift variants and SNVs affecting canonical splicing site dinucleotides (+ − 1, + − 2) are usually considered as loss-of-function variants (Richards et al., 2015). However, it is known that premature stop codons in some genes encoding sarcomeric proteins, i.e., in the MYH7 gene, are highly tolerated (Richards et al., 2015; Cooper et al., 2013). Interpretation of intronic variants located outside the two ultraconservative positions at both the 5′ (donor) and 3′ (acceptor) splice sites is challenging. Functional interpretation of intronic variants should be done with caution and requires functional confirmation of any clinical significance (either “benign” or “pathogenic”) predicted by in silico tools (Richards et al., 2015). The main goal of genetic counselling is to provide complete information about the patient's disease and how it will progress. This prognosis can be extracted from groups of patients with the same variant and disease. For example, long QT syndrome type 1 is caused by the mutation p. A341V in the KCNQ1 gene. This variant shows high clinical severity regardless of the ethnic origin of the afflicted families (Crotti et al., 2007). Sometimes different mutations in the same gene result in a similar pathogenic mechanism leading to high uniformity of clinical manifestation. For example, some pathogenic non-missense variants in the LMNA gene cause a highly consistent cardiac phenotype starting at the 5th decade of life (Wong et al., 2016). Meanwhile, carriers of the common Leiden mutation in the FV gene display a wide range of phenotypic variability from asymptomatic carriage to recurrent venous thrombosis and/or pregnancy loss (Kujovich, 2011). Lack of reliable data about phenotype-genotype correlation for many genes such as MYH7, which have no “hot spots” or founder mutation, results partly from the uniqueness of a particular variant, uniqueness of a particular patient/family, and lack of material for comparison. That is why we found it so important to compare experimental and clinical data from a couple of patients with pathogenic variants in the MYH7 gene that look different but presumably have the same molecular mechanism.
3. Results 2. Methods Clinical case. We observed a male proband with sporadic case of congenital muscular weakness, delayed motor development and decreased cardiac pump function from 7 months of age. The follow-up period was 4 years. He was born after the pregnancy became complicated with a miscarriage risk. The congenital generalized muscular hypotonia was initially explained by perinatal encephalopathy. Parents were not consanguineous, and no case of progressive muscular disorders and cardiomyopathy was observed in the family. The milestones of his motor development and cardiac function are summarized in Table 1. At 3,5 months old, the proband could still not hold up his head and had low muscle tone. At 5 months old, he could not roll over, and muscle weaknesses became more pronounced in the neck and arms. Metabolic disorders and infections were excluded. The patient started to roll over at 7 months old and was found to have left ventricular dilatation. Total creatine phosphokinase in blood tests was consistently
Clinical evaluation. This study was performed in accordance with the Helsinki declaration and local ethics committee. Data obtained from proband included medical history, biochemical analysis of blood, 12‑lead resting ECG, transthoracic echocardiogram, electromyography, and histopathological examination of the muscles. Genetic analysis. Genomic DNA was extracted from the white blood cells of the proband and his parents by standard method. Mutational screening in the proband's DNA was performed by whole exome sequencing. We used NextGene V2.3.4 (Softgenetics, State College, PA, USA) and compared the resulting data with the UCSC database for presumably disease-causing variant identification. Confirmation of the genetic finding in the proband's DNA sample and cascade familial screening for his parents and siblings was performed by PCR-based bidirectional Sanger sequencing with a set of the original intronic oligoprimers. To confirm the presence of abnormal MYH7 transcript in vivo, total RNA was extracted from the muscle
Table 1 Proband's clinical Information with follow-up period during 4 years. EF - ejection fraction, LVED - left ventricle end-diastolic diameter. Age
Weight, kg
Height, sm
Cardiological parameters Development
5 m.o 6 m.o 1 y.o 1 y. 3 m. 2 y.o 2,5 y.o. 3,5 y.o. 4 y.o.
6,5 8,2 9,0 (10–25 percentile) 9,0 (3 percentile) 10,2 (3 percentile) 11,2 (< 3 percentile) 12,8 (10 percentile) 14 (10 percentile)
62 73 79,5 80 86 87 96 104
EF (Teicholz), %
EF (Simpson),%
LVED, mm (N)
N 54,3 53,0 48 58 58 59,1 56
N 48,1 43 42 45 No data 49,5 No data
N 34,0 (31) 35,6 (31) 35 (31) 36 (32) 37 (32) 38,4 (34) No data
160
Couldn't hold his head and turn over Couldn't hold his head; could roll over Couldn't hold his head, couldn't sit; could roll over No data Could stand, but held his head weakly Could sit, could stand and walk if head is supported. Start to walk if head is supported Start to walk if head is supported
Gene 697 (2019) 159–164
Y. Surikova, et al.
analysis predicted splicing alteration with a high probability; however, at this stage, the new genetic variant can be classified as “likely pathogenic” with PS2 and PM2 levels of evidence according to the ACMG Standards and Guidelines (Richards et al., 2015). Functional analysis. To prove significance of this genetic variant we performed non-quantitative RT-PCR with cDNA sequencing of the proband's and his healthy father muscle biopsy samples. Sanger sequencing of the target cDNA fragment from the proband revealed the in-frame skipping of the exon 38 (Fig. 2). The proband's cDNA was thought to translate into a protein lacking 32 amino acids in the myosin tail. We were able to detect only the full-length variant of MYH7 in the cDNA sample from the healthy father. Earlier studies described two additional genetic variants of the MYH7 gene in close proximity to our finding: c.5655G > A (synonymous mutation) and c.5655 + 1G > A (Pajusalu et al., 2016; Fiorillo et al., 2016). These variants were also predicted to affect exon 38 splicing (Fig. 3A). We have suggested that the clinical variability in patients with those variants may be explained by different expression of mutant alleles. To validate this hypothesis, we used a minigene system. RT-PCR analysis of the minigene expressed transcripts revealed two products corresponding full-length transcript and an alternatively spliced product without exon 38 (Δ38) (Fig. 4A). We revealed that the WT-minigene expressed the full-length transcript and a small amount of the Δ38 transcript, whereas all mutant minigenes expressed only the Δ38 transcript. In addition, we performed qPCR analysis of the minigene expressed transcripts to determine whether there is a difference in the expression level of the aberrant isoform among the different variants at the same splice site. For this purpose we used isoform-specific primers: 38/39R for the full-length transcript and 37/39R for the Δ38 transcript (Fig. 3B). To demonstrate that the quantitative differences are not related to the amount of plasmid in each case, we normalized the expression level to a reference plasmid-specific neomycin-phosphotransferase (npt) transcript. In addition, we validated that the expression level of this npt transcript is the same in all test samples (data not shown). We found that all mutated minigenes had a highly significant increase of the Δ38 isoform and an absence of the full-length transcript. In addition, there was a small but significant difference in the expression level of the Δ38 transcripts for the c.5655G > A and c.5655 + 5G > C constructs (Fig. 4B).
normal. The electromyography showed features of myopathy. Histological examination of the muscle revealed unspecified muscle atrophy. He had pronounced weakness in the neck and shoulder girdle muscles with signs of dropped head syndrome and weakness in the gluteal and quadriceps muscles; however, he was able to stand with support. Extensive neuro-muscular rehabilitation was performed including ongoing massage, exercises, and swimming in a pool. The patient became ambulant at 3 y.o., and scoliosis had appeared. The neck muscles seem to be the weakest muscular group, and the patient needed constant additional head support when walking or sitting. Moderate left ventricular dilation with preserved ejection fraction (EF) was first mentioned at 7 months of age and was slowly progressing. At this time, the proband was diagnosed with DCM, as ejection fraction of the LV was 45% without any sign of heart failure. No breathing or swallowing difficulties were detected. Emotional and intellectual development was completely preserved. Genetic analysis. The NGS analysis identified a novel genetic variant c.5655 + 5G > C [RefSeq NM_000257.3] in the MYH7 gene in the proband. This variant wasn't described in available databases. De novo status was assumed by the family history and confirmed by absence of the variant in the parent's and healthy sibling's DNA samples (Fig. 1) as well as by paternity and maternity confirmation by STR typing. Multiple alignment shows that this region is highly conserved through different species. The potential influence of c.5655 + 5G > C on the splice site probability was studied with two independent tools as recommended by ACMG Standards and Guidelines (NetGene2 and NNSPLICE software) (Richards et al., 2015). Both bioinformatic resources had predicted the disruption of a canonical donor splice site. In silico
4. Phenotype-genotype correlation We compared the clinical characteristics of the patients with different genomic but identical mRNA changes (Table 2). Patients descriptions occurred at different ages with various follow-up periods which greatly impairs the genotype-phenotype correlation. However, we were able to observe many similar features. All cases were sporadic, and presumably independent mutational events occurred in each family. De novo status of the variants was clearly confirmed in all carriers (Pajusalu et al., 2016; Fiorillo et al., 2016). The genomic region [NC_000014.8:g.23883211_23883216; GRCh37.p13] including the donor splice site flanking exon 38 might represents an area where exon-skipping is a common pathogenic mechanism. The onset of myopathy was congenital in all cases, which is not common for MYH7-related disorders. The pattern of the muscular weaknesses was also similar: predominant axial hypotonia with a strong neck involvement. Respiratory dysfunction was described only for 1 patient at 7 y.o. (Fiorillo et al., 2016), but it is difficult to conclude whether is this feature consistent because of the younger age of the other patients. Three patients had cardiac symptoms (Pajusalu et al., 2016; Fiorillo et al., 2016). The spectrum of cardiac symptoms included conduction defects and different variants of cardiac remodelling: dilated cardiomyopathy and left ventricular non-compaction.
Fig. 1. Proband's pedigree. Squares and circles indicate males and females, respectively. Open symbols indicate healthy family members, black square is a proband. The arrow indicates the genetic variant c.5655 + 5G > C in the MYH7 gene. 161
Gene 697 (2019) 159–164
Y. Surikova, et al.
Fig. 2. A. Agarose gel electrophoresis of amlified fragments from the proband's and his healthy father's cDNA obtained from muscle biopsy. WT – wild type, Δ38 – amplicon with skipping of the exon 38 in the MYH7 gene. B. The sequence of the MYH7 gene of the patient cDNA. Squares mark the boundaries of exons, the arrow indicates absence of the 38 exon.
Fig. 3. Functional analysis of mutations affecting exon 38 splicing. (A) MYH7 exon 38 donor splice site is weak splice-site. A sequence logo of all canonical human donor slice sites, the height of the letters is proportional to the frequency of the corresponding nucleotide in this position (Hedera et al., 2003) (top) and alignment of MYH7 exon 38 donor splice site: wild-type and with the investigated mutations(c.5655G > A, c.5655 + 1G > A, c.5655 + 5G > C) (mutation is underlined). (B) Primer's scheme for amplification of minigene cDNA: for total amplification - 37F and plR, for selective amplification of the full-length transcript - 37F and 38.39R, for selective amplification of theΔ38 transcript - 37F and 37.39R.
5. Discussion
obligatory included as loss-of-function annotations, while others nearby are most often ignored in such annotations (Zhang et al., 2018). The experimental data demonstrate that a new intronic variant c.5655 + 5G > C in the MYH7 gene leads to breaking the donor splice site (Fig. 2), resulting in the skipping of exon 38 in the mRNA
Newly describes genetic variant c.5655 + 5G > C occurs in intronic area of the MYH7 gene deeper than so-called “canonical” splice bases [−2, −1, +1, +2]. Changes in these essential positions are
Fig. 4. Functional analysis of mutations affecting exon 38 splicing. (А) Gel electrophoresis (amplified using 37F and plR primers) revealed two products corresponding full-length transcript and alternatively spliced product without exon 38 (Δ38). (В) Relative expression of two isoforms: full-length (amplified using 37F and 38.39R primers) and Δ38 (amplified using 37F and 37.39R primers) in HEK293T cells treated by equal amount of different minigene constructions (wilt type (wt), c.5655G > A, c.5655 + 1G > A, c.5655 + 5G > C) and normalized to plasmid-specific npt transcript. Asterisks indicate significant difference from the wild-type minigene construction (using paired Mann-Whitney U Test, p-value ** < 0,005) and pairwise difference between samples (using paired Mann-Whitney U Test, pvalue * < 0,05). 162
Gene 697 (2019) 159–164
Y. Surikova, et al.
Table 2 Comparison of clinical manifestations in patients with variants c.5655 + 5G > C, c.5655G > A or c.5655 + 1G > A in the MYH7 gene. NIV-noninvasive ventilation, LVNC – left ventricular non-compaction cardiomyopathy, DCM - dilated cardiomyopathy. №
1
2
3
4
Sex Age, y.o. Family history Onset of symptoms Weakness distribution Floppy head Scoliosis Respiratory involvement Cardiac involvement CK U/I EMG Muscle biopsy Mutation Reference
F 18 No Congenital Axial and distal lower limb Not mentionted Yes (severe) Yes (NIV needed from age 7) Left bundle block Normal Myopathic Unspecific c.5655G > A Fiorillo et al., 2016
M 1.9 No Congenital Axial Predominant No data No No Normal Myopathic Fiber-type disproportion with no inclusion c.5655G > A Pajusalu et al., 2016
M 8 No Congenital Axial Predominant Yes No LVNC Normal Myopathic Minicores c.5655 + 1G > A Fiorillo et al., 2016
M 4 No Congenital Axial Predominant Yes (moderate) No DCM Normal Myopathic Unspecific muscle atrophy c.5655 + 5G > C This study
6. Conclusion
(NM_000257.3:c.5560_5655del). Two previously described genomic variants (c.5655G > A and c.5655 + 1G > A) caused the same qualitative effect on the mRNA (Pajusalu et al., 2016; Fiorillo et al., 2016). This mutant mRNA translates into the shorter myosin isoform lacking 32 amino acids (NP_000248:p.1854_1885del) in the coiled-coil domain of myosin-7. It might influence folding and affect titin interaction. Detection of the Δ38-MYH7 cDNA allowed us to reclassify c.5655 + 5G > C variant as pathogenic with a PS3 level of evidence in addition to the de novo status with the paternity and maternity confirmed according to the ACMG Standards and Guidelines (Richards et al., 2015). This experimental data shows that additional “near-splice-site” positions are important for the normal splicing. In Zhang et al. (2018) study was shown that a specific reference allele is more intolerant for the mutational alteration than others in the same positions (Zhang et al., 2018). It was specifically pointed out that “G” nucleotide in +5 position of the donor splice site (D + 5) is significantly less tolerant of mutations than are the other three reference bases at this +5 position (Zhang et al., 2018). We investigated the quantitative effect of these variants on the splicing efficiency of the exon 38 using a minigene system. We showed that the WT minigene construction produced mostly full-length transcript, but surprisingly we also detected small amount of the Δ38 transcript. This phenomenon could be explained by two possible ways. One way is that the donor splice site of the exon 38 in the MYH7 gene contains 3 non-consensus nucleotides in the c.5653, c.5654, c.5655 + 3 positions and this is a constitutively weak splice site (Fig. 3A). It allows alternative splicing, and a small amount of the Δ38 transcript might be detected in healthy individuals. However, we failed to detect Δ38 transcript in the total cDNA samples of the healthy proband's father and unrelated control samples (data not shown). Another possibility is that our model system has its own limitation coming from the partial gene sequence introduced into the minigene, and the non-myocyte cellular context might facilitate alternative splicing. We have shown also a quantitative difference between transcripts from minigene constructs containing alterations in the c.5653, c.5654, and c.5655 + 3 positions. We speculate that exact nucleotide consequence within alternative splice site might influence efficiency of transcription. With a limited number of patients and lack of clinical data, this quantitative difference cannot be reliably assigned to any particular clinical manifestation. Further investigation is needed to clarify a role of particular genetic alteration, transcription efficiency, and clinical phenotype.
Genetic variants leading to the skipping of exon 38 in the MYH7 gene causes a particular MYH7-related phenotype: congenital myopathy with unusually early manifestation, axial hypotonia, and drop head syndrome. The clinical phenotype caused by different genomic variants but realized by the same molecular mechanism is highly consistent. MYH7 gene mutations should also be considered for DNA diagnostics in such patients. This exon38_38intron junction area might represent a hot spot for de novo pathogenic variants leading to this phenotype. Early manifestation, progressive natural history of disease, and “unaffected” pedigree might be misleading in respect to the mode of inheritance and overestimation of the recurrent risk if assessed as autosomal recessive. Thus, genetic counselling should be performed with caution in such sporadic cases. More attention should be paid for the interpretation of the genetic variants +/− 10 bp the 5′ and 3′ splice sites. Acknowledgement This work was supported by Russian Science Foundation grant №16-15-10421. References Cooper, D.N., Krawczak, M., Polychronakos, C., Tyler-Smith, C., Kehrer-Sawatzki, H., 2013. Where genotype is not predictive of phenotype: towards an understanding of the molecular basis of reduced penetrance in human inherited disease. Hum. Genet. 132 (10), 1077–1130. Crotti, L., Spazzolini, C., Schwartz, P.J., Shimizu, W., Denjoy, I., Schulze-Bahr, E., Zaklyazminskaya, E.V., Swan, H., Ackerman, M.J., Moss, A.J., et al., 2007. The common long-QT syndrome mutation KCNQ1/A341V causes unusually severe clinical manifestations in patients with different ethnic backgrounds: toward a mutationspecific risk stratification. Circulation. 116 (21), 2366–2375. Fiorillo, C., Astrea, G., Savarese, M., Cassandrini, D., Brisca, G., Trucco, F., Pedemonte, M., Trovato, R., Ruggiero, L., Vercelli, L., et al., 2016. MYH7-related myopathies: clinical, histopathological and imaging findings in a cohort of Italian patients. Orphanet J. Rare Dis. 11 (1), 91–115. Gurskaya, N.G., Staroverov, D.B., Zhang, L., Fradkov, A.F., Markina, N.M., Pereverzev, A.P., Lukyanov, K.A., 2012. Analysis of alternative splicing of cassette exons at singlecell level using two fluorescent proteins. Nucleic Acids Res. 40 (8), e57. He, Y.M., Gu, M.M., 2017. Research progress of myosin heavy chain genes in human genetic diseases. Yi Chuan 39 (10), 877–887. Hedera, P., Petty, E.M., Bui, M.R., Blaivas, M., Fink, J.K., 2003. The second kindred with autosomal dominant distal myopathy linked to chromosome 14q: genetic and clinical analysis. Arch. Neurol. 60 (9), 1321–1325. Karaoglu, P., Quizon, N., Pergande, M., Wang, H., Polat, A.I., Ersen, A., Özer, E., Willkomm, L., Hiz Kurul, S., Heredia, R., et al., 2017. Dropped head congenital muscular dystrophy caused by de novo mutations in LMNA. Brain Dev. 39 (4), 361–364. Kujovich, J.L., 2011. Factor V Leiden thrombophilia. Genet. Med. 13 (1), 1–16. Lamont, P., Laing, N.G., 2006. Laing Distal Myopathy. In: Adam, MP, Ardinger, HH, Pagon, RA (Eds.), GeneReviews® [Internet]. 1993-2019 University of Washington, Seattle, Seattle (WA) Oct 17 [Updated 2015 Mar 12]. https://www.ncbi.nlm.nih.
163
Gene 697 (2019) 159–164
Y. Surikova, et al.
Med. 17 (5), 405–424. Wong, Chun Ka, Chan, Pak Hei, Hai, Jo Jo, Lai, Wing Hon, Lau, Yee Man, Lee, Yee Ki, Wong, Lai Yung, Ho, Chung Yee, Huang, Dou, Cai, Zhu Jun, et al., 2016. Clinical course of non-missense LMNA mutation carriers with cardiac phenotype. Circ. Res. 23511. Yang, J., Zhu, M., Wang, Y., Hou, X., Wu, H., Wang, D., Shen, H., Hu, Z., Zou, J.v., 2015. Whole-exome sequencing identify a new mutation of MYH7 in a Chinese family with left ventricular noncompaction. Gene 558 (1), 138–142 1. Zhang, S., Samocha, K.E., Rivas, M.A., Karczewski, K.J., Daly, E., Schmandt, B., Neale, B.M., MacArthur, D.G., Daly, M.J., 2018. Base-specific mutational intolerance near splice sites clarifies the role of nonessential splice nucleotides. Genome Res. 28 (7), 968–974. https://doi.org/10.1101/gr.231902.117.
gov/books/NBK1433/. Lamont, P.J., Wallefeld, W., Hilton-Jones, D., Udd, B., Argov, Z., Barboi, A.C., Bonneman, C., Boycott, K.M., Bushby, K., Connolly, A.M., et al., 2014. Novel mutations widen the phenotypic spectrum of slow skeletal/β-cardiac myosin (MYH7) distal myopathy. Hum. Mutat. 35 (7), 868–879. Meredith, C., Herrmann, R., Parry, C., Liyanage, K., Dye, D.E., Durling, H.J., Duff, R.M., Beckman, K., de Visser, M., van der Graaff, M.M., et al., 2004. Mutations in the slow skeletal muscle fiber myosin heavy chain gene (MYH7) cause laing early-onset distal myopathy (MPD1). Am. J. Hum. Genet. 75, 703–708. North, K.N., Wang, C.H., Clarke, N., Jungbluth, H., Vainzof, M., Dowling, J.J., Amburgey, K., Quijano-Roy, S., Beggs, A.H., Sewry, C., et al., 2014. Approach to the diagnosis of congenital myopathies. Neuromuscul. Disord. 24 (2), 97–116. Pajusalu, S., Talvik, I., Noormets, K., Talvik, T., Põder, H., Joost, K., Puusepp, S., Piirsoo, A., Stenzel, W., Goebel, H.H., et al., 2016. De novo exonic mutation in MYH7 gene leading to exon skipping in a patient with early onset muscular weakness and fibertype disproportion. Neuromuscul. Disord. 26 (3), 236–239. Richards, S., Aziz, N., Bale, S., Bick, D., Das, S., Gastier-Foster, J., Grody, W.W., Hegde, M., Lyon, E., Spector, E., et al., 2015. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet.
Web resources ClinVar Database https://www.ncbi.nlm.nih.gov/clinvar/?term=MYH7%5Bgene%5D +Pathogenic. NetGene2 http://www.cbs.dtu.dk/services/NetGene2/. NNSPLICE software http://www.fruitfly.org/seq_tools/splice.html. OMIM https://www.omim.org/.
164