Common secondary structures for the second internal transcribed spacer pre-rRNA of two subfamilies of trichostrongylid nematodesfn1

International Journal for Parasitology 17 "0887# 0654Ð0662

Common secondary structures for the second internal transcribed spacer pre!rRNA of two subfamilies of trichostrongylid nematodes0 Neil B[ Chiltona\b\\ Herve Hosteb\ Lisa A[ Newtona\ Ian Beveridgea\ Robin B[ Gassera a

Department of Veterinary Science\ The University of Melbourne\ 149 Princes Highway\ Werribee\ Victoria 2929\ Australia b INRA!CR Tours\ Station de Pathologie Aviaire et de Parasitologie\ F26279\ Nouzilly\ France Received 29 March 0887^ received in revised form 4 June 0887^ accepted 4 June 0887

Abstract Sequences of the second internal transcribed spacer ribosomal DNA for the parasitic trichostrongylid nematodes Trichostrongylus probolurus\ Trichostrongylus rugatus and Camelostrongylus mentulatus were compared with previously published sequences for _ve other species within the genus Trichostrongylus[ The secondary structures of the second internal transcribed spacer pre!rRNA for these nematodes were predicted using an energy minimisation method[ The results indicate that a common secondary structure of the second internal transcribed spacer of these nematodes is maintained despite distinct di}erences in primary sequence between species[ Sequence di}erences among Trichostrongylus species ranged from 0[2 to 6[5)\ but each species di}ered by 11Ð15) in sequence when compared with C[ mentulatus which belongs to a di}erent subfamily[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ Keywords] Ribosomal pre!rRNA^ Second internal transcribed spacer^ Nematodes^ Secondary structure model^ Trichostrongylidae^ Trichostrongylus^ Camelostrongylus

0[ Introduction The nuclear ribosomal DNA "rDNA# of eukaryotes normally consists of several hundred tandemly repeated copies of the transcription unit and non!

0 Note] Sequences reported in this paper are available in the EMBL\ GenBankTM and DDJB databases "GenBank accession numbers Y03706\ Y03707 and Y03708#[  Corresponding author[ Present address] Department of Vet! erinary Science\ The University of Melbourne\ 149 Princes High! way\ Werribee\ Victoria 2929\ Australia[ Tel] 50!2!86317180^ Fax] 50!2!86309390^ e!mail] nbcÝclyde[its[unimelb[edu[au[

transcribed spacer ð0Ł[ The transcription unit com! prises the rRNA genes "07S\ 4[7S and 17S#\ the external transcribed spacer "ETS#\ and the _rst and second internal transcribed spacers "ITS!0 and ITS! 1#[ The ITS!1 has been shown to be useful in study! ing the systematics of parasitic nematodes\ e[g[\ in providing genetic markers to distinguish mor! phologically well!de_ned species ð1Ð5Ł and cryptic species ð6Ł\ and for phylogenetic reconstruction ð7Ł[ However\ the reliability of any phylogeny derived from molecular data depends on the accuracy of the sequence alignment ð8Ł[ Several authors have suggested that sequence alignments should take the

9919!6408:87:,08[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ All rights reserved[ PII] S 9 9 1 9 ! 6 4 0 8 " 8 7 # 9 9 0 1 8 ! 4

0655

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

secondary structure into account in order to com! pare homologous characters ð09Ð01Ł[ The secondary structure of rRNA molecules is dependent on the primary sequence and is related to their function within a ribosome ð02Ł[ Generalised secondary structure models have been proposed for each rRNA gene because of the relatively conserved nature of the primary sequence even among dis! tantly!related organisms "e[g[ ð03Ð06Ł#[ The internal transcribed spacers are removed prior to the for! mation of the mature rRNA molecules[ Although their precise function"s# have yet to be established\ it has been postulated that they play an important role in precursor rRNA processing and ribosome biogenesis ð07Ð19Ł\ and that their secondary struc! tures are important in this process ð08\ 10Ł[ Sec! ondary!structure models have been proposed for the pre!rRNA of the internal transcribed spacers of a variety of organisms\ including yeast ð10Ł\ trema! todes ð19\ 11Ł\ insects ð12Ð15Ł and mammals ð05\ 16Ł[ In contrast to the rRNA genes\ there is little conservation of the secondary structure of the ITS! 0 and ITS!1 among these organisms ð15Ł\ perhaps re~ecting the greater sequence divergence in these spacer regions ð19\ 12\ 17Ł[ For instance\ we have previously demonstrated that _ve species of para! sitic nematode of the genus Trichostrongylus could be di}erentiated from one another because of di}erences in their ITS!1 sequences ð2Ł\ whereas only one of these species had a di}erent 4[7S rDNA sequence with respect to the other species in the genus ð18Ł[ There has been no attempt to determine whether there is a common secondary structure for the ITS! 1 in any species of parasitic nematode[ Therefore\ in this paper we used an energy minimisation approach to predict the secondary structures of the ITS!1 pre!rRNA for seven species of Tricho! strongylus and for Camelostrongylus mentulatus\ a species belonging to a di}erent subfamily within the Trichostrongylidae[ We also discuss the evol! utionary implications of the proposed secondary model for the trichostrongylid nematodes[ 1[ Materials and methods Trichostrongylus probolurus and Trichostrongylus rugatus "subfamily Trichostrongylinae# were

obtained from the small intestine of sheep from Kokatha "South Australia# and Strathalbyn "South Australia#\ respectively\ while C[ mentulatus "subfa! mily Ostertagiinae# was obtained from the stomach of a captive camel at the Melbourne Zoo "Werribee\ Victoria#[ Males of the two Trichostrongylus species and C[ mentulatus were identi_ed according to Nagaty ð29Ł and Gibbons and Khalil ð20Ł\ respec! tively[ Genomic DNA was isolated from a single adult male worm of each species by sodium dodecyl sulphate and Proteinase K "Boehringer! Mannheim# treatment\ phenol:chloroform:iso! propanol extraction\ ethanol precipitation and puri_cation with Prep!A!GeneTM "BioRad# ð21Ł[ The ITS!1 region including primer ~anking sequence "19 bp at the 2? end of the 4[7S and 69 bp at the 4? end of the 17S rDNA# was ampli_ed by PCR ð22Ł from genomic DNA "¼09 ng template# using 099 pmol of each oligonucleotide primer\ NC0 4?!ACGTCTGGTTCAGGGTTGTT!2? " for! ward# and NC1 4?!TTAGTTTCTTTTCCTC! CGCT!2? "reverse#[ Reactions were carried out in 49 ml volumes under the following conditions as described in Hoste et al[ ð2Ł[ Cycle sequencing of the ITS!1 for each species was performed on Qiagen "Diagen\ Germany# column puri_ed PCR products as in Gasser et al[ ð21Ł using the Gibco BRL kit "cat[ No[ 7085SB# with primer NC0 or NC1[ The sequences of these three species were aligned manu! ally with those of Trichostrongylus colubriformis\ Trichostrongylus vitrinus\ Trichostrongylus axei\ Trichostrongylus retortaeformis and Tricho! strongylus tenuis "GenBank accession numbers X67952ÐX67956^ ð2Ł#[ Pairwise comparisons were made of the level of sequence di}erences "D# between species using the formula D0−"M:L#\ where M is the number of alignment positions at which the two species have a base in common\ and L is the total number of alignment positions over which the two taxa are compared[ The MFold pro! gram "GenBank#\ based on an energy minimisation approach ð23\ 24Ł\ was used to predict the secondary structure of the ITS!1 and associated free energy values "DG# for each species[ As several studies have shown complementary base pairing of the 2? end of the 4[7S gene with the 4? end of the 17S gene in a variety of organisms "e[g[ ð25\ 26Ł#\ we constrained the same regions to base pair in the construction of

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

the secondary structure models for the tricho! strongylid nematodes\ which was found to decrease the DG for most species\ except T[ tenuis[ Hence\ for this species\ further constraints were imposed in the running of this program to obtain a common structure among all taxa examined[

2[ Results The lengths of the ITS!1 sequences of T[ pro! bolurus and T[ rugatus were identical "127 bp# and their G¦C contents were similar "23[9) and 20[8)\ respectively#[ There was no evidence from sequencing gels of polymorphism in the ITS!1 sequence of either species[ Figure 0 shows the alig! ned ITS!1 sequences of these two species with that for C[ mentulatus "length125 bp\ G¦C content16[4)# and the other _ve Tricho! strongylus species sequenced previously ð2Ł[ Di}er! ences in the sequence of the ITS!1 among Trichostrongylus species ranged from 0[2 to 6[5)\ while C[ mentulatus di}ered by 10[4Ð15[4) in sequence when compared with the seven species of Trichostrongylus[ Sequence di}erences in the ITS!1 among the eight species were found at 64 alignment positions\ 08 of which represented deletion: insertions in the sequence of one or more species[ Substitutions in ITS!1 sequence among Tricho! strongylus species occurred at 16 positions\ of which 12 "74[1)# were transitions "A³Ð×G\ n00^ C³Ð×T\ n01# and four were transversions[ At 22 alignment positions\ all species of Trichostrongylus possessed a di}erent nucleotide to that present in C[ mentulatus\ with 08 "46[5)# of these substitutions representing transitional changes "A³Ð×G\ n8^ C³Ð×T\ n09# and 03 transversions[ A folding analysis of the ITS!1 plus associated ~anking regions of the 4[7S and 17S rRNA genes of the seven Trichostrongylus species predicted a common secondary structure "Figure 1A# which represented the most energy e.cient shape for each species "DG values of −46[9\ −45[0\ −41[4\ −41[9\ −40[6 and −37[0 for T[ retortaeformis\ T[ axei\ T[ vitrinus\ T[ colubriformis\ T[ probolurus and T[ rugatus\ respectively#\ except T[ tenuis "DG value of −31[0 compared with the lowest DG value of −42[9#[ The central helix "I# is formed by the comp!

0656

lementary base pairing of the 2? end of the 4[7S gene with the 4? end of the 17S gene[ Six other helices are evident\ with at least 56) of the nucle! otides of the ITS!1 involved in base pairing\ mainly as AÐU or CÐG combinations\ with a small number of G=U appositions[ Of the 16 positions where there are sequence di}erences between Trichostrongylus species\ eight transitional changes "è0\ è2\ è8\ è01\ è03\ è05\ è07 and è14^ Fig[ 1A#\ three transversional changes "è7\ è06 and è18^ Fig[ 1A# and the one base deletion in the sequence of T[ axei "è08^ Fig[ 1A# occur either in loops\ bulges of helices and therefore do not alter the pairing arrangements of helices[ A transversional change in T[ tenuis "UÐ×G\ è23^ Fig[ 1A# results in a reduction of the size of helix V from 5 to 3 paired nucleotides[ A total of 00 transitional changes\ one on helix II "è04^ Fig[ 1A#\ two on helix IV "è5 and è00^ Fig[ 1A#\ three on helix VI "è19\ è10 and è12^ Fig[ 1A# and _ve on helix VII "è15\ è17\ è29\ è21 and è22^ Fig[ 1A#\ represent partial compensatory base changes in di}erent species "i[e[ substitutions on one side of a helix that maintain base pairing#[ Two transitional changes on helix IV of T[ tenuis "è6 and è09^ Fig[ 1A# represent a complete compensatory base change "i[e[ substitutions on both sides of a helix to maintain base pairing#\ whereas two transitional changes on helix VII "è16 and è20^ Fig[ 1A# rep! resent a complete compensatory base change in T[ colubriformis\ but only a partial compensatory change in T[ tenuis[ In relation to the sites of within!species sequence polymorphism\ four sites existed in T[ vitrinus\ two representing transversions "A³Ð×C\ è1^ A³Ð ×U\ è02^ Fig[ 1A# and three as pyrimidine tran! sitions "C³Ð×U\ è3\ è4 and è13^ Fig[ 1A# occurred either in loops and bulges[ For T[ axei\ the one polymorphic site on helix VI\ a purine transition "A³Ð×G^ è11^ Fig[ 1#\ represents a partial com! pensatory base pair change\ thereby not a}ecting the stability of the WatsonÐCrick base pairing in this helix[ The shape of the predicted secondary structure of the ITS!1 for C[ mentulatus "Figure 1B# is the same as that for Trichostrongylus\ despite 19Ð14) di}erences in primary sequences between the genera[ The energy value "DG# for the structure of C[ mentulatus is −29[2\ and 53) of the nucleotides

0657

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

Fig[ 0[ Alignment of the ITS!1 sequences and ~anking sequences of the 4[7S and 17S genes "shown in lower case# for seven species of Trichostrongylus and Camelostrongylus mentulatus[ Alignment positions identical to those of Trichostrongylus colubriformis are indicated by a dot[ Alignment gaps are indicated by dashes[ Nucleotides involved in base pairing of the pre!rRNA molecule are indicated by arrows in opposite orientation to the delimitating helices designated by the numbers IÐVII[ The sequences for the _ve species of Trichostrongylus determined previously have been corrected herein at alignment positions 106 and 107 for the accidental transposition of positions in Hoste et al[ ð2Ł[

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

0658

Fig[ 1[ "A# Predicted secondary structure of the ITS!1 for the seven species of Trichostrongylus[ Interspeci_c di}erences at speci_c sites are indicated by solid arrows\ whilst sites of within!species sequence polymorphism are indicated by open arrows[ Nucleotides in small letters represent part of either the 4[7S or 17S genes[ RA and:or G^ YC and:or U^ WU and:or A^ KU and:or G^ MA and:or C[ "B# Predicted secondary structure of the ITS!1 for Camelostrongylus mentulatus[ "C# Bases deleted "solid arrows# or substituted "open arrows# in the sequence of C[ mentulatus with respect to Trichostrongylus for the terminal end of helix VII[

0669

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

are involved in base pairing[ The 09 base deletion in the sequence of C[ mentulatus compared with Trichostrongylus species corresponds to a short! ening of the length of helix VII and increases the size of the end loop "Figure 1C#[ The eight positions in the sequence of C[ mentulatus representing base insertions "alignment positions 09\ 59\ 84\ 007\ 043\ 044\ 123 and 124^ Fig[ 0# occur either in end loops "è36 and è42^ Fig[ 1B#\ in bulges "è25\ è50\ è64 and è65^ Fig[ 1B# or are involved in base pairing "è38 and è51^ Fig[ 1B#[ At the 22 positions where C[ mentulatus possesses a di}erent base to that present in all seven species of Trichostrongylus\ three tran! sitions "è28\ è44 and è57^ Fig[ 1B# and 09 trans! versions "è26\ è27\ è39Ð31\ è35\ è43\ è48\ è55 and è56^ Fig[ 1B# occur in end loops or bulges[ Four purine transitional changes "è32\ è59\ è52 and è54^ Fig[ 1B#\ six pyrimidine transitional changes "è33\ è49\ è47\ è58\ è69 and è61^ Fig[ 1B#\ and _ve trans! versional changes "è24\ è34\ è37\ è62 and è63^ Fig[ 1B# represent partial compensatory base pair chan! ges[ Six transitional changes "è40\ è41\ è45\ è46\ è53 and è60^ Fig[ 1B# represent complete compensatory nucleotide changes[

3[ Discussion The ITS!1 sequences obtained for T[ probolurus and T[ rugatus are very similar in length "127 bp# and G¦C content "21Ð23)# to those of other spec! ies within the genus ð2Ł[ Nevertheless\ none of seven species of Trichostrongylus examined have an ident! ical ITS!1 sequence\ which provides further support to the conclusions made by Hoste et al[ ð2Ł that this rDNA spacer can be used in taxonomic and diagnostic studies of the parasitic trichostrongylid nematodes[ Comparison of the sequence data with those of other invertebrates shows that the G¦C contents of the ITS!1 sequences of the trichostrongylid nematodes are lower than those of mosquitoes "49Ð 48)^ ð13Ł#\ but greater than those of ~ies "19Ð14)^ ð15Ł#\ organisms for which secondary structure models have been proposed[ Sequences with a high G¦C content often have a greater probability of forming a secondary structure because GÐC hydro! gen bonds are thermodynamically more stable than

AÐU or G=U hydrogen bonds[ However\ Sch! lotterer et al[ ð15Ł demonstrated that a secondary structure could be predicted for the ITS!1 of Dro! sophila spp[ even though their sequences were A¦T rich[ In the present paper\ we were able to predict a secondary structure of the pre!rRNA ITS!1 which was common for trichostrongylid nematodes from two di}erent subfamilies\ which had sequences with a higher A¦T "¼54)# than G¦C content[ This structure had lowest DG value "i[e[ greatest ther! modynamic stability# for each species of Tricho! strongylus except T[ tenuis[ The proposed secondary structure model for the trichostrongylid nematodes Fig[ 1 was almost sym! metrical in shape\ consisting of the central helix "I#\ comprising the complementary base pairing of the 2? end of the 4[7S gene with the 4? end of the 17S gene\ and six other helices "IIÐVII#[ At least 56) of the nucleotides of the ITS!1 were involved in base pairing on these six helices[ Most base!paired positions involved AÐU or CÐG combinations\ with only a small number of the thermodynamically less stable G=U appositions[ The shape of the secondary structure of the ITS!1 pre!rRNA for the di}erent trichostrongylid nematodes was maintained despite signi_cant di}erences in primary sequence[ Of the 16 alignment positions where the ITS!1 sequence di}ered among Trichostrongylus species\ most changes represented transitions or transversions in the loops and bulges of the secondary structure and therefore had no e}ect on the stability of the WatsonÐCrick base pairing of the helices[ The sin! gle deletion in the sequence of T[ axei also occurred in an end!loop[ Also\ most "83)# of the sub! stitutional changes that occurred on helices rep! resented either partial or complete compensatory changes[ Only one transversional change at align! ment position 133 "Fig[ 0# in T[ tenuis "è21 Fig[ 1A# reduces the number of nucleotides involved in base pairing for helix V[ Moreover\ the secondary structure of the ITS!1 pre!rRNA of C[ mentulatus was very similar to that for the seven Tricho! strongylus species\ even though this species di}ered in sequence from the others by 10[4Ð15[4)[ The relative length of helix VII in C[ mentulatus was shorter than in the seven Trichostrongylus species and had a larger end loop because of a 09!nucleotide deletion in its sequence "Fig[ 1C#[ The end loop of

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662

helix VI was also larger for C[ mentulatus[ Other! wise\ although the sequence of C[ mentulatus di}ered signi_cantly from the seven species of Tricho! strongylus\ the length of the helices and hence the number of nucleotides involved in base pairing was maintained in C[ mentulatus by 09 partial and eight complete compensatory changes[ Thus\ in most instances\ sequence di}erences among species occurred as partial or complete complementary base pair changes on helices or within loops and bulges "i[e[ as unpaired nucleotides#[ This situation is there! fore analogous to that of the rRNA genes\ where sequence variation is restricted predominantly to positions outside the common core structure con! sidered essential for ribosome processing ð27Ł[ Within eukaryotic cells there are many {{copies|| of the RNA genes and their associated spacers ð28Ł and sequence polymorphism among copies within a single individual "intraindividual variation# does exists ð2\ 3\ 13\ 15\ 28Ł[ All polymorphic sites in the ITS!1 sequences of the Trichostrongylus species represented partial compensatory base pair changes on helices or occurred either in loops and bulges[ It is not known whether the variant copies of the pre! rRNA ITS!1 in the trichostrongylid nematodes are functional\ as van der Sande et al[ ð08Ł have shown that experimentally induced nucleotide deletions in the ITS!1 of yeast can prevent ribosome biogenesis[ It is believed that natural selection would act to remove variant copies "i[e[ concerted evolution ð39\ 30Ł#\ particularly those with mutations that reduce the stability of the secondary structure\ and hence the function of the region[ However\ as there are species!speci_c di}erences in primary sequence among trichostrongylid nematodes\ some intra! speci_c variation in primary sequence must be toler! ated\ at the same time maintaining the ITS!1 secondary structure[ For the helices\ this can be achieved by partial or total compensatory base chan! ges[ Most "74)# of the substitutions in ITS!1 sequences among Trichostrongylus species were tran! sitions\ which are likely to be more favourable than transversions for maintaining the stability of the heli! ces[ Thus\ with the acquisition of more sequence data from taxa within the Trichostrongyloidea\ it may be possible to establish whether variations in primary sequence are deleted:inserted or retained because of secondary structure constraints[

0660

Establishment of a secondary structure model which is shared by two di}erent genera of parasitic trichotrongylid nematodes is of importance for any phylogenetic study of the Trichostrongyloidea because species with more divergent sequences could be aligned with greater con_dence\ thereby con_rming the homology of characters "i[e[ align! ment positions# in the phylogenetic analyses[ More! over\ since there is debate as to whether positions within helices and:or loops provide more phylo! genetic information "see ð09Ł#\ the secondary struc! ture model for trichostrongylid nematodes provides the opportunity to test the validity of character weighting "e[g[ positions in helices by 9[7^ ð09Ł# to infer the evolutionary relationships within the Trichostrongyloidea[ In addition\ if the present pre! dicted secondary structure model is applicable to other nematodes within the Order Strongylida\ the model would have signi_cant implications for studying the evolution\ structure and function of rRNA\ pre!RNA processing and for inferring the phylogenetic relationships of the Strongylida based on ITS!1 sequence data[

Acknowledgements Neil Chilton\ a visiting scientist at INRA CR Tours\ was a grateful recipient of a grant from Institut National de la Recherche Agronomique "France#[ Financial support for the project was pro! vided by the Australian Research Council and Department of Industry\ Science and Tourism[ We would like to thank Michael O|Callaghan for pro! viding some of the specimens used in this study[

References ð0Ł Hillis DM\ Dixon MT[ Ribosomal DNA] molecular evol! ution and phylogenetic inference[ Q Rev Biol 0880^55]300Ð 342[ ð1Ł Campbell AJD\ Gasser RB\ Chilton NB[ Di}erences in a ribosomal DNA sequence of Strongylus species allows identi_cation of single eggs[ Int J Parasitol 0884^14]248Ð 254[ ð2Ł Hoste H\ Chilton NB\ Gasser RB\ Beveridge I[ Di}erences in the second internal transcribed spacer "ribosomal DNA#

0661

ð3Ł

ð4Ł

ð5Ł

ð6Ł

ð7Ł

ð8Ł ð09Ł

ð00Ł

ð01Ł

ð02Ł ð03Ł

ð04Ł

ð05Ł

ð06Ł

ð07Ł

ð08Ł

ð19Ł

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662 between _ve species of Trichostrongylus[ Int J Parasitol 0884^14]64Ð79[ Gasser RB\ Nansen P\ Guldberg P[ Fingerprinting sequence variation in ribosomal DNA of parasites by DGGE[ Mol Cell Probes 0885^09]88Ð094[ Hung G!C\ Jacobs DE\ Krecek RC\ Gasser RB\ Chilton NB[ Strongylus asini "Nematoda\ Strongyloidea#] genetic relationhips with other Strongylus species determined by ribosomal DNA[ Int J Parasitol 0885^15]0396Ð0300[ Hung G!C\ Chilton NB\ Beveridge I\ Gasser RB[ Molecular delineation of Cyclicocyclus nassatus from C[ ashworthi "Nematoda] Strongylida#[ Int J Parasitol 0886^16]590Ð594[ Chilton NB\ Gasser RB\ Beveridge I[ Di}erences in a ribosomal DNA sequence of morphologically indis! tinguishable species within the Hypodontus macropi com! plex "Nematoda] Strongyloidea#[ Int J Parasitol 0884^14]536Ð540[ Chilton NB\ Gasser RB\ Beveridge I[ Phylogenetic relation! ships of Australian strongyloid nematodes inferred from ribosomal DNA sequence data[ Int J Parasitol 0886^16]0370Ð0383[ Felsenstein J[ Phylogenies from molecular sequences^ infer! ence and reliability[ Annu Rev Genet 0877^11]410Ð454[ Dixon MT\ Hillis DM[ Ribosomal RNA secondary struc! ture] compensatory mutations and implictions for phylo! genetic analysis[ Mol Biol Evol 0882^09]145Ð156[ Wheeler C\ Honeycutt RL[ Paired sequence di}erence in ribosomal RNAs] evolutionary and phylogenetic impli! cations[ Mol Biol Evol 0877^4]89Ð85[ Hickson RE\ Simon C\ Cooper A\ Spicer GS\ Sullivan J\ Penny D[ Conserved motifs\ alignment\ and secondary structure for the third domain of animal 01S rRNA[ Mol Biol Evol 0885^02]049Ð058[ Noller HF[ Structure of ribosomal RNA[ Annu Rev Biochem 0873^42]008Ð051[ Stiegler P\ Carbon P\ Ebel J!P\ Ehresmann C[ A general secondary!structure model for prokaryotic and eukaryotic RNAs of the small ribosomal subunits[ Eur J Biochem 0870^019]376Ð384[ Woese CR\ Gutell R\ Gupta R\ Noller HF[ Detailed analy! sis of the higher!order structure of 05S!like ribosomal ribo! nucleic acids[ Microbiol Rev 0872^36]510Ð558[ Michot B\ Hassouna N\ Bachellerie J!P[ Secondary struc! ture of mouse 17S rRNA and general model for the folding of the large rRNA in eukaryotes[ Nucleic Acids Res 0873^01]3148Ð3168[ Michot B\ Bachellerie J!P[ Comparisons of large subunit rRNAs reveal some eukaryote!speci_c elements of sec! ondary structure[ Biochimie 0876^58]00Ð12[ Musters W\ Boon K\ van der Sande CAFM\ van Heeri! kuizen H\ Planta RJ[ Functional analysis of transcribed spacers of yeast ribosomal DNA[ EMBO J 0889^8]2878Ð 2885[ van der Sande CAFM\ Kwa M\ van Nues RW\ van Heeri! khuizen H\ Raue HA\ Planta RJ[ Functional analysis of internal transcribed spacer 1 of Saccharomyces cerevisiae ribosomal DNA[ J Mol Biol 0881^112]788Ð809[ Michot B\ Depres L\ Bonhomme F\ Bachellerie J!P[ Con!

ð10Ł

ð11Ł

ð12Ł

ð13Ł

ð14Ł

ð15Ł

ð16Ł

ð17Ł

ð18Ł

ð29Ł ð20Ł

ð21Ł

ð22Ł

ð23Ł

ð24Ł ð25Ł

ð26Ł

served secondary structures in the ITS1 of trematode pre! RNA[ FEBS Lett 0882^205]136Ð141[ van Nues RW\ Venema J\ Rientjes MJ\ Dirks!Mulder A\ Raue HA[ Processing of eukaryotic pre!rRNA] the role of the transcribed spacers[ Biochem Cell Biol 0884^62]678Ð 790[ Depres L\ Kruger GJ\ Imbert!Establet D\ Adamson ML[ ITS1 ribosomal RNA indicates Schistosoma hippopotami is a distinct species[ Int J Parasitol 0884^14]0498Ð0403[ Kwon O!Y\ Ishikawa H[ Nucleotide sequence and pre! sumed secondary structure of the internal transcribed spa! cers of rDNA of the pea aphid\ Acyrthosiphon pisum[ Comp Biochem Physiol 0881^092B]540Ð544[ Wesson DM\ Porter CH\ Collins FH[ Sequence and sec! ondary structure comparisons of ITS rDNA in mosquitoes "Diptera] Culicidae#[ Mol Phylogenet Evol 0881^0]142Ð158[ Fritz GN\ Conn J\ Cockburn A\ Seawright J[ Sequence analysis of the ribosomal DNA internal transcribed spacers within populations of Anopheles nuneztovari "Diptera] Cul! icidae#[ Mol Biol Evol 0883^00]395Ð305[ Schlotterer C\ Hauser M!T\ Haeseler von A\ Tautz D[ Comparative evolutionary analysis of rDNA ITS regions in Drosophila[ Mol Biol Evol 0883^00]402Ð411[ Gonzalez IL\ Chambers C\ Gorski JL\ Stambolian D\ Sch! mickel RD\ Sylvester JE[ Sequence and structure cor! relation of human ribosomal transcribed spacers[ J Mol Biol 0889^101]16Ð24[ Brown DD\ Wensink PC\ Jordan E[ A comparison of the ribosomal DNA|s of Xenopus laevis and Xenopus mulleri] the evolution of tandem genes[ J Mol Biol 0861^52]46Ð62[ Chilton NB\ Hoste H\ Hung G!C\ Beveridge I\ Gasser RB[ The 4[7S rDNA sequences of 07 species of bursate nematodes "Order Strongylida#] comparison with rhabditid and tylenchid nematodes[ Int J Parasitol 0886^16]008Ð013[ Nagaty HF[ The genus Trichostrongylus Looss\ 0894[ Ann Trop Med Parasitol 0821^15]346Ð407[ Gibbons LM\ Khalil LF[ A key for the identi_cation of genera of the nematode family Trichostrongylidae\ Leiper\ 0801[ J Helminthol 0871^45]074Ð122[ Gasser RB\ Hoste H\ Chilton NB\ Beveridge I[ Rapid sequ! encing of rDNA from single worms and eggs of parasitic helminths[ Nucleic Acids Res 0882^10]1414Ð1415[ Saiki RK\ Gelfand DH\ Sto}el S\ et al[ Primer!directed enzymatic ampli_cation of DNA with a thermostable DNA polymerase[ Science 0877^128]376Ð380[ Jaeger JA\ Turner DH\ Zuker M[ Improved predictions of secondary structures for RNA[ Proc Natl Acad Sci USA 0878^75]6695Ð6609[ Zuker M[ On _nding all suboptimal foldings of an RNA molecule[ Science 0878^133]37Ð41[ Furlong JC\ Maden BEH[ Patterns of major divergence between the internal transcribed spacers of ribosomal DNA in Xenopus borealis and Xenopus laevis\ and of minimal divergence within ribosomal coding regions[ EMBO J 0872^1]332Ð337[ Yeh L!CC\ Lee JC[ Structural analysis of the internal tran! scribed spacer 1 of the precursor ribosomal RNA from Saccharomyces cerevisae[ J Mol Biol 0889^100]588Ð601[

N[B[ Chilton et al[:International Journal for Parasitolo`y 17 "0887# 0654Ð0662 ð27Ł Raue HA\ Klootwijk J\ Musters W[ Evolutionary con! servation of structure and function of high molecular weight ribosomal RNA[ Prog Biophys Mol Biol 0877^40]66Ð018[ ð28Ł Carranza S\ Giribet G\ Ribera C\ Bagun½a J\ Riutort M[ Evidence that two types of 07S rDNA coexist in the genome

0662

of Dugesia "Schmidtea# mediterranea "Platyhelminthes\ Turbellaria\ Tricladida#[ Mol Biol Evol 0885^02]713Ð721[ ð39Ł Hillis DM\ Dixon MT[ Molecular evolution and phylo! genetic inference[ Q Rev Biol 0880^55]300Ð342[ ð30Ł Dover GA[ Molecular drive] a cohesive model of species evolution[ Nature 0871^188]000Ð006[