- Email: [email protected]
Comparative analysis of marine and freshwater viral haemorrhagic septicaemia virus (VHSV) isolates antagonistic activity
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Comparative analysis of marine and freshwater viral haemorrhagic septicaemia virus (VHSV) isolates antagonistic activity
T
Juan Gémez-Mataa,b, Daniel Álvarez-Torresa,b, Esther García-Rosadob, M. Carmen Alonsob, Julia Béjara,* a Universidad de Málaga, Instituto de Biotecnología y Desarrollo Azul, IBYDA, Área De Genética, Departamento de Biología Celular, Genética y Fisiología, Facultad de Ciencias, 29071, Málaga, Spain b Universidad de Málaga, Instituto de Biotecnología y Desarrollo Azul, IBYDA Departamento de Microbiología, Facultad de Ciencias, 29071, Málaga, Spain
A R T I C LE I N FO
A B S T R A C T
Keywords: VHSV Antagonistic activity IFN I Mx RTG-2 SAF-1 Solea senegalensis
Viral Haemorrhagic Septicaemia Virus (VHSV) isolates virulent to marine fish species can replicate in freshwater species, although producing little or no mortality. Conversely, isolates from freshwater fish do not cause disease in marine species. An inverse relationship between VHSV virulence and host mx gene up-regulation has been described for several fish species, suggesting that differences between the antagonistic activity exerted by these isolates might be involved in the outcome of infections. In this study, the antagonistic activity against the type I interferon system of two representative marine and freshwater VHSV isolates has been characterised using RTG2 cells stably transfected with the luciferase gene under the control of the Senegalese sole mx (ssmx) promoter, RTG pssmx-luc cells. Both isolates exerted a dose-dependent negative effect on the activation of ssmx promoter, showing a notably different minimal viral dose to exert the antagonism. In particular, an inverse relationship between the minimal MOI required and the viral virulence to sole has been recorded, which suggests this parameter as a possible in vivo VHSV virulence marker. Furthermore, the quantification of the endogenous inf I, mx1 and mx3 mRNA has demonstrated differences between both isolates in their antagonistic activity. Besides, a different nv RNA kinetics, which seems to depend on specific cellular factors, has been recorded for both isolates. This knowledge could contribute to the development of efficient tools to fight against viral infections in fish farming. For that purpose, the RTG pssmx-luc cells may be a suitable in vitro tool to identify the molecular mechanisms underlying VHSV-host interactions.
1. Introduction
and freshwater VHSV isolates by serological methods; therefore, understanding virulence mechanisms and the identification of specific virulence markers for VHSV isolates is crucial to improve prophylactic strategies, particularly in fish farming. As all vertebrates, fish have an effective antiviral response mediated by type I interferon (IFN I). Briefly, recognition of viral elements by infected cells activates the synthesis of type I IFNs, which bind to receptors in neighbouring cells, leading to the activation of the JAK-STAT signalling pathway, and the eventual transcription of IFN-stimulated genes (ISG) [9]. The expression of ISGs, that occurs under a complex spatial and temporal regulation [10], generates an antiviral and immunoregulatory state in cells. Viruses have evolved multiple strategies to block this host immune response, and, actually, most viruses can affect different stages of the IFN response (reviewed in [11]). One of the most common mechanisms is ISG transcription inhibition. Disclosing the mechanisms governing the activation of ISG transcription by the
Viral Haemorrhagic Septicaemia Virus (VHSV), Novirhabdovirus genus, Rhabdoviridae family, is responsible for an important disease affecting a notably broad range of marine and freshwater fish species [1]. Its non-segmented, negative-sense, single-stranded RNA genome contains 6 genes encoding nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), nonvirion protein (Nv), and RNAdependent RNA polymerase (L). The four VHSV genotypes and/or sublineages can be grouped into freshwater (genotypes Ia, Ic and IVb) and marine isolates (genotypes Ib, Id, Ie, II, III, IVa and IVc) [2]. Isolates from marine fish can replicate in freshwater species, although causing little or no mortality, and isolates from freshwater fish do not cause disease in marine species [1–5] [6–8]. Thus, the resistant species to each type of isolate, are viral reservoirs that represent a risk for the susceptible species. It is not possible to differentiate between marine
⁎
Corresponding author. E-mail address: [email protected] (J. Béjar).
https://doi.org/10.1016/j.cimid.2020.101426 Received 30 October 2019; Received in revised form 13 January 2020; Accepted 17 January 2020 0147-9571/ © 2020 Elsevier Ltd. All rights reserved.
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
supplemented with 10 % FBS, 4 mM L-glutamine and 100 U/mL penicillin, 100 μg/mL streptomycin (growth medium). RTG-2 cells were incubated at 20 °C, and SAF-1 cells at 25 °C.
IFN I system, and its inhibition by viral antagonistic activity, can help to understand virus-host interaction, and, therefore, the result of the infection, i.e. disease outcome. In VHSV, the non-structural Nv protein seems to be crucial for VHSV antagonistic activity [12,13], and the M protein has also been reported to interfere with host immune response [14]. Among ISGs, mx genes have been considered as markers of type I IFN response. Besides, mx transcription is blocked by several viruses; therefore, the level of mx induction has been related with the susceptibility/resistance of different fish species to specific viruses or viral isolates [15–17]. Previous studies have demonstrated that Senegalese sole (Solea senegalensis), one of the most promising species in the Mediterranean aquaculture, is highly susceptible to a marine VHSV isolate under experimental conditions, although it does not show disease symptoms after inoculation with a freshwater VHSV isolate [18, 19]. In addition, the marine VHSV isolate seems to be the only one that interferes with the sole antiviral response [19]. Therefore, the differential antagonism of the two VHSV isolates might be involved in their specific virulence to Senegalese sole. In this study, in order to contribute to understand VHSV-sole interaction, an RTG-2 cell line expressing luciferase under the control of Senegalese sole mx (ssmx) promoter (RTG pssmx-luc cells) was established and used to evaluate and compare the antagonistic effect of two VHSV isolates with different origin.
2.2. Establishment of the RTG pssmx-luciferase cell line For transfection, RTG-2 cells (80 % confluence) were trypsinized and resuspended (ca. 106 cells) in 100 μL of Nucleofector solution V (Lonza); afterwards, 1 μg of the pGL4-Luc + promssmx-F2 plasmid [23] was added, and cells were immediately transfected using an Amaxa NucleofectorR (Lonza, T-030 program). Transfected cells were seeded on 25-cm2 flasks and cultured in L-15 growth medium with dihydrochloride of puromycin (2 μg/mL, Gibco) for several weeks, until no cell death was observed. After selection, the genomic integration of the plasmid was confirmed by genomic PCR amplification and sequencing of the ssmx promoter according to Alvarez-Torres et al. [23]. This cell population was called RTG pssmx-luc. 2.3. Quantification of viral genes in RTG pssmx-luc and SAF-1 cells VHSV nucleoprotein (n) and nonvirion protein (nv) genes were quantified by qPCR. For that, RTG pssmx-luc and SAF-1 cells were grown on 24-well cell culture plates (Nunc) in L-15 growth medium until 80 % confluence. Afterwards, cells were washed twice with PBS, and inoculated with each isolate at a multiplicity of infection (MOI) of 0.1 in L-15 medium supplemented with 4 mM L-glutamine and 100 U/ mL penicillin, 100 μg/mL streptomycin (inoculation medium). After 1 -h adsorption at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate, viral suspensions were removed and replaced by L-15 maintenance medium. Inoculated cells were incubated at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate. Total RNA was extracted at 12, 24 and 36 h post-inoculation (h p.i.) from RTG pssmx-luc cells; and at 24, 48 and 72 h p.i. from SAF-1 cells, in triplicate, using the EZNA total RNA kit I (Omega). After RNA treatment with DNase (DNase I recombinant RNase-free, Sigma), cDNA was synthesized with the Transcriptor First Strand cDNA Synthesis Kit (Roche), using 500 ng of RNA and random primers. Real-time PCR reactions were performed in 20-μL mixtures containing 10 μL of 2x LightCycler 480 SYBR Green I Master mix (Roche), 1 μL of each primer (Table 1, 10 μM final concentration), and 2 μL of cDNA. Amplifications were conducted in 96-well plates with a LightCycler 96 (Roche). The cycling profile was 10 min at 95 °C, following by 45 cycles of 10 s at 95 °C, 10 s at 60 °C and 10 s at 72 °C, and a final step of 10 s at 95 °C and 1 min at 65 °C. Data were analyzed with the comparative Ct method, obtaining relative values (Rv) to the endogenous eF1α transcription factor (Table 1) according to the formula Rv = 2−ΔCt. Mean values were statistically analyzed by one-way
2. Material and methods 2.1. Virus propagation and cell culture Two VHSV isolates were used in this study: (1) VHSV Sm2897 (genotype III, obtained from turbot, Scophthalmus maximus), a marine isolate highly virulent to Senegalese sole (70 % mortality); and (2) VHSV DK-F1 (genotype I, obtained from rainbow trout, Oncorhynchus mykiss), a freshwater isolate less virulent to Senegalese sole (4 % mortality) [19]. Both isolates were propagated on BF-2 cells incubated at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate, in Leibowitz L-15 medium (Gibco) supplemented with 2 % foetal bovine serum (FBS, Lonza), 4 mM L-glutamine (Gibco), and 100 U/mL penicillin, 100 μg/mL streptomycin (Sigma) (maintenance medium). Cultures displaying extensive cytopathic effects (CPEs) were harvested and centrifuged at 5000 x g for 10 min at 4 °C. Viral suspensions were titrated by the 50 % tissue culture infective dose (TCID50) method [20] and stored at −80 °C until used. The RTG-2 cell line, derived from gonad tissue of rainbow trout [21], and the SAF-1 cell line, derived from gilt-head sea bream (Sparus aurata) fin [22], were cultured on 25-cm2 flasks (Nunc) in L-15 medium Table 1 Primers used in this study.
VHSV n gene Freshwater VHSV nv Marine VHSV nv R. trout ifn I R. trout mx1 R. trout mx3 R. trout elongation factor 1α Seabream elongation factor 1α
Name
Primer sequence (5´-3´)
Accession No.
Reference
VHSV-F1 VHSV-R1 NvF1-F NvF1-R NvSm-F NvSm-R IFN-1-F IFN-1-R Mx-1-F Mx-1-R Mx-3-F Mx-3-R RTeF1α-F RTeF1α-R SeF1α-F SeF1α-R
AAGGCCCTCTATGCGTTCATC GGTGAACAACCCAATCATGGT GACTTTGATCGGTCGGACAT AGCACATGGAGGTGAGGAAG TGATCACACACAGGCTCACA CATCCAAGATCCTGGGAAGA AAAACTGTTTGATGGGAATATGAAA CGTTTCAGTCTCCTCTCAGGTT GGTTGTGCCATGCAACGTT GGCTTGGTCAGGATGCCTAAT AGCTCAAACGCCTGATGAAG3 TGAATATGTCTGTTATCCTCCAAA GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC ATTGTCAAACTGCACCCACA GCTCAACAGCCTTGATGACA
AJ23396
[24]
2
This study
NM_001124531
[25]
NM_001171901 U47946.1 AF498320 AF184170
[26]
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
increased at 48 h p.i. (relative value = 0.049), reaching the maximum value at 72 h p.i. (relative value = 0.084) (Fig. 1B). In contrast, the freshwater isolate n RNA only increased at 72 h p.i. (relative value = 0.048), reaching a lower level than n RNA from the marine virus, thus suggesting that this isolate replicates more slowly in SAF-1 cells.
analysis of variance (ANOVA). Differences of P < 0.05 were considered statistically significant. 2.4. Evaluation of the antagonistic effect of VHSV isolates RTG pssmx-luc cells were grown on 24-well cell culture plates in L-15 growth medium until 80 % confluence. Afterwards, cells were washed twice with PBS, and 3 wells per isolate were inoculated as described above, at 0.1 MOI for the marine isolate, and at 0.1 and 0.8 MOI for the freshwater isolate. Then, polyinosinic:polycytidylic acid (poly I:C) was added to the infected cells (10 μg/mL, final concentration) at 12 or 24 h p.i. for the freshwater isolate and the marine isolate, respectively, and finally luciferase activity was measured 12 h after poly I:C addition. In this regard, luciferase activity was measured at the time point at which the highest viral RNA relative value was recorded (24 or 36 h p.i., for the freshwater and the marine isolate, respectively). For that, 100 μL of Luciferase Assay Reagent II (Promega) were added to each well, and light emission (Relative Light Units, RLU) of 20 μL of the cellular lysates obtained was determined with continuous measurements every 2 s during 10 s, using a GloMax 96 Microplate Luminometer (Promega). Uninfected cells stimulated with poly I:C were used as positive control of the ssmx promoter stimulation. Infected cells nonstimulated with poly I:C, and cells unstimulated and uninfected were used as negative controls. Data were statistically analyzed with the two-way ANOVA test. Differences of P < 0.05 were considered significant. To evaluate the effect of different viral doses on the antagonistic effect of each VHSV isolate, the above described experiment was repeated with cells inoculated with the following MOIs: 0.0125, 0.025, 0.05 and 0.1 MOI for the marine isolate; and 0.1, 0.4, 0.8 and 1 MOI for the freshwater isolate.
3.3. VHSV antagonistic effect It is well established that poly I:C quickly induces an antiviral state in cells. Actually, poly I:C stimulated the ssmx promoter, producing an increase in luciferase activity 12 h after treatment (RLU values from 1.7 × 105 to 4.1 × 105) (Fig. 2 A, B and C). In contrast, VHSV isolates did not activate the promoter and, consequently, luciferase activity remained at its basal level (Fig. 2 A, B and C). Therefore, to evaluate the putative antagonistic activity of VHSV isolates on the ssmx promoter, cells were first inoculated with each isolate and, to measure luciferase activity at the time point of maximum level of viral RNA, poly I:C was added at 12 h or 24 h after the inoculation with the freshwater or the marine isolate, respectively; then, luciferase was measured 12 h later. Results showed that the marine VHSV interfered with the stimulation triggered by poly I:C, causing a significant reduction (77 %, P < 0.05) of the luciferase activity (Fig. 2A), which indicates an antagonistic effect of this isolate on ssmx promoter activity. In contrast, when cells were inoculated with the freshwater isolate at the same MOI (0.1), the presence of the virus did not affect the stimulation caused by poly I:C (Fig. 2B), which suggests that this isolate does not show antagonistic effect on ssmx promoter. In order to confirm that the absence of antagonistic activity was not due to an insufficient amount of virus, cells were inoculated with the freshwater isolate at a higher MOI (0.8), which resulted in a significant reduction (83 %, P < 0.05) of the induction triggered by poly I:C (Fig. 2C). Hence, both VHSV isolates antagonize the response of the ssmx promoter, although a higher viral concentration of the freshwater isolate is necessary to detect this effect.
2.5. Quantification of the endogenous (RTG-cells) ifn I and mx gene transcription RTG-2 pssmx-luc cells were grown, inoculated at 0.1 and 1 MOI with each VHSV isolate, and stimulated with poly I:C as described above. RNA was extracted at 4 or 12 h after poly I:C treatment to quantify transcription of endogenous ifn I or mx (mx1 and mx3), respectively. Then, cDNA was synthesized, qPCR reactions were performed, and data were analyzed as described above. Primers used are shown in Table 1 [25,26].
3.4. Effect of viral dose on the antagonistic activity of VHSV isolates To further characterize the influence of the viral dose on the antagonistic activity, RTG pssmx-luc cells were inoculated at different MOIs before adding poly I:C (Fig. 3). Luciferase activity decreased significantly (P < 0.05) in cells inoculated with the marine isolate and treated with poly I:C (RLU = 0.15x105 to 1.2 × 105) compared to the poly I:C-induced mx promoter activity (RLU = 1.7 × 105), even with the lowest MOI tested (0.0125, 33 % reduction). In addition, a clear dose-dependent effect was observed, with a maximum interference around 100 % (98 % Fig. 3A) at the highest MOI tested (0.1). Regarding the freshwater isolate (Fig. 3B), a dose-dependent effect was also recorded; however, the lowest MOI required to significantly reduce the poly I:C-induced ssmx promoter activity was 0.4 (53 % reduction), and the maximum interference detected was in cells inoculated at 1 MOI (87 %, Fig. 3B).
3. Results 3.1. Establishment of the RTG pssmx-luc cell line After several weeks of selection, a cell population with similar morphology and growth rate than the original RTG-2 cell line was obtained (data not shown). Once the genomic integration of the plasmid was confirmed, this cell population was called RTG pssmx-luc and used to evaluate antagonistic activity of VHSV isolates.
3.5. Transcription quantification of endogenous ifn I and mx genes 3.2. Viral genome replication in RTG pssmx-luc and SAF-1 cells In order to determine if the interference occurs by inhibition of ifn I transcription, RTG-2 ifn I mRNA was quantified in cells inoculated and subsequently stimulated with poly I:C. Results showed statistically similar relative values of ifn I transcription in poly I:C-treated cells and in (infected + poly I:C)-treated cells, for both VHSV isolates, regardless of the MOI analyzed (P < 0.05, Fig. 4 A and B). Therefore, the antagonistic effect on ifn I transcription was discarded for both VHSV isolates. To determine if viruses are antagonizing the ISG signalling pathway, RTG-2 mx1 and mx3 mRNA were quantified. Transcription of these genes in cells inoculated with the marine isolate (0.1 and 1 MOI) and subsequently treated with poly I:C was statistically similar (P < 0.05) to the transcription recorded in cells stimulated only with poly I:C (Fig. 5
Quantification of the nucleoprotein-coding RNA was used to characterize viral replication in RTG pssmx-luc and SAF-1 cells. In RTG pssmx-luc cells, the marine isolate RNA was first detected at 24 h p.i. (relative value = 18.9), and the maximum relative value was obtained at 36 h p.i. (relative value = 34.1) (Fig. 1A). In these cells, the freshwater isolate genome was detected at 24 h p.i. (relative value = 29), whereas at 36 h p.i., n-coding RNA could not be measured due to the destruction of the cell monolayer. Thus, the freshwater isolate genome replicates faster than the marine VHSV genome in these cells, although maximum RNA relative values were statistically similar for both isolates (P < 0.05). In SAF-1 cells inoculated with the marine isolate, n-coding RNA 3
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 1. Relative quantification of the VHSV nucleoprotein (n) and nonvirion protein (nv) genes in RTG-2 pssmx-luc (A and C), and SAF-1 (B and D) cells inoculated with the marine (white) at 20 °C, or the freshwater (grey) VHSV isolate at 15 °C. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
4. Discussion
A and B). In contrast, cells inoculated with the freshwater isolate at 1 MOI and treated with poly I:C, showed lower relative values of mx1 and mx3 mRNA than cells treated only with poly I:C (47 and 56 % reduction, respectively) (P < 0.05, Fig. 5 C and D). Thus, the freshwater VHSV isolate interfered with the response of the endogenous mx genes, whereas the marine isolate seems not to affect the mx response in RTG-2 cells. In consequence, the interference of the marine isolate might be promoter specific, as this isolate do not apparently affect the ISG signalling pathway.
In this study, the antagonistic activity of VHSV isolates of marine and freshwater origin has been studied in RTG pssmx-luc cells, the stable reporter system developed ad hoc that has been proven to be useful to characterize virus-host interaction. Actually, ssmx promoter response to poly I:C in RTG pssmx-luc cells was similar to that obtained in previous transient transfection experiments [23], indicating that the vector integration did not affect the IFN response pathway in RTG-2 cells. This kind of stable in vitro reporter systems had been previously used to evaluate the response of fish mx promoters to type I IFN, or to viral infections [13,27,28]; furthermore, these systems have also been described as valuable tools to measure viraemia in fish serum [29]; or, as in this study, to characterize the blocking of mx transcription by viral infections [15]; Jorgensen et al., 2007; [28,30]. In the present study, it is especially interesting to have an mx promoter from a marine fish species integrated in a cell line derived from a freshwater species, which makes possible to evaluate the effect of marine and freshwater isolates on both, the endogenous (RTG-cells) and the exogenous (sole) mx promoters at the same time. According to our results, both isolates interfere with Senegalese sole mx induction triggered by poly I:C in a dose-dependent way, although showing some differences. Specifically, the minimal MOI required to exert this antagonistic activity over the sole mx promoter is inversely related with the viral virulence to sole (0.0125 MOI for the marine
3.6. Implication of viral nv gene in antagonistic activity Viral nv-coding RNA was quantified in order to determine if differences between the antagonistic activity of VHSV isolates were related with this gene. In RTG pssmx-luc cells inoculated with the marine isolate, nv relative values showed a single peak at 36 h p.i. (relative value = 148.6) (Fig. 1C), thus it seems to be delayed with respect to the n gene (Fig. 1A), which shows a significant increase at 24 h p.i. In contrast, the maximum level of the freshwater isolate nv RNA was recorded at 24 h p.i. (relative value = 157.6), which is the same profile observed for the n gene (Fig. 1A and C). In SAF-1 cells, the profile of nv and n RNA from both isolates was similar (Fig. 1B and D), with maximum RNA relative values at 72 h p.i.; however, the freshwater isolate relative value was significantly lower (0.45) than the marine isolate relative value (0.68, P < 0.05). 4
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 2. Luciferase activity in RTG-2-pssmx cells inoculated with VHSV isolates and subsequently stimulated with poly I:C. Quantification was performed at the time point of maximum RNA accumulation for each isolate. (A) Luciferase activity 36 h after inoculation with the marine isolate (0.1 MOI) and 12 h after poly I:C treatment; (B) Luciferase activity 24 h after inoculation with the freshwater isolate (0.1 MOI) and 12 h after poly I:C treatment; (C) Luciferase activity at 24 h after inoculation with the freshwater isolate (0.8 MOI) and 12 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls are non-inoculated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
Fig. 3. Antagonistic effect of both VHSV isolates on the ssmx promoter activity in RTG pssmx-luc cells inoculated at different MOIs and subsequently stimulated with poly I:C; (A) cells inoculated with the marine VHSV isolate; luciferase activity was measured 36 h after the infection and 12 h after poly I:C treatment (B) cells inoculated with the freshwater VHSV; luciferase activity was measured 24 h after the infection and 12 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
transcription after inoculation with a viral isolate virulent to trout in a dose-dependent way. As in the present work, this interference was recorded at a very low viral dose. Therefore, minimal MOI that causes viral interference on the mx promoters could be considered as a virulence marker for VHSV isolates, and the cell line developed in this study could be a tool to evaluate this interference. To our knowledge, the present study is the first report showing antagonism of a freshwater VHSV isolate against a marine species mx promoter.
isolate, highly virulent to sole, versus 0.4 MOI for the freshwater isolate, non-virulent to sole). In a previous study, Cano et al. [30] tested different VHSV isolates in RTG-2 cells, reporting interference on mx 5
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 4. Relative quantification of endogenous ifn I gene transcription in RTG-2 cells inoculated with the marine (A) or the freshwater (B) VHSV isolates, and subsequently stimulated with poly I:C. Poly I:C was added 24 h after inoculation with the marine isolate and 12 h after inoculation with the freshwater isolate. Quantification was performed 4 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
evidenced that the antagonistic effect of the marine isolate on the sole mx is promoter-specific, since no interference with the RTG-2 mx1 and mx3 transcription was recorded, even when cells were inoculated at high MOI (0.8), which indicates that none of the cellular factors involved in the ISG signalling cascade were affected. In contrast, the freshwater isolate interfered with the induction of RTG-2 mx1 and mx3 genes triggered by poly I:C, which agrees with previous reports [30]. Therefore, the present study describes a differential modulation of mx expression occurring at promoter level, which had been observed previously for other virus-host systems [37–39] [28, 30]. Actually, the structural diversity of fish mx promoters supports a tight transcriptional control of mx, which has been suggested to be due to its crucial role in fish antiviral defence [40]. The relationship between the virulence of viral pathogens to a specific host and their ability to block mx promoters in that host, points to the pathogen-host coevolution process as a key element in this interaction, as it has also been suggested for mx coding region and its antiviral specificity [41,42]. In addition, the identification of mx promoter sequence motif(s) responsible for their differential sensitivity to VHSV antagonistic activity and the putative variability of these regions might lead to the identification of allelic variants related with resistance/sensitivity to VHSV antagonistic activity, which can be used in selective breeding. Actually, several quantitative trait loci (QTL) related to resistance to VHSV have been identified in trout, and one of them mapped very close to mx [43]. It has been previously reported that the non-structural VHSV Nv protein is crucial for VHSV antagonistic activity [12, 13]. Actually,
Considering our results, it is possible to suggest that the known inverse relationship between viral virulence and host mx-upregulation [13,27,30,31] could be a consequence of a differential antagonistic activity; that is, isolates with low virulence to a specific fish species could show low or none antagonistic activity against the IFN system of that fish species (and therefore high mx induction), or, as it has been shown in this study, they could require a higher viral concentration to exert the antagonistic effect. In contrast, virulent isolates would present a potent antagonistic activity (low mx induction), which would be significant even at quite low viral concentration. In order to get more insight into the antagonistic activity of the two VHSV isolates considered, endogenous (RTG-2 cells) ifn I, mx1 and mx3 transcription was quantified. This analysis demonstrated that none of the isolates tested interferes with ifn I transcription, and, therefore, the antagonistic effect recorded on the sole mx promoter occurs downstream the IFN I synthesis (either affecting the ISG signalling pathway or the specific promoter activation). However, previous studies showed inhibition of the ifn I transcription in trout by VHSV isolates virulent to that species [13,32,33,34]; Biachessi et al., 2017). In our system it might be possible that the absence of interference with ifn I transcription was due to the low levels of Nv at that time point, it could occur later, when Nv levels are higher. In any case, these discrepancies indicate that VHSV might present different mechanisms to evade the host immune system, which could be differentially activated depending on the isolate and/or the host [35,36]. The analysis of the endogenous mx1 and mx3 transcription 6
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 5. Relative quantification of endogenous mx1 and mx3 gene transcription in RTG-2 cells inoculated with the marine (A, B) or the freshwater (C, D) VHSV isolate, and subsequently stimulated with poly I:C. Quantification was performed 12 h after poly I:C addition; 36 h after the marine isolate inoculation and 24 h after the freshwater isolate inoculation, the time points of maximum RNA accumulation of each isolate. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
that the minimal viral dose required to detect this interference may be a possible virulence marker for VHSV isolates. After proper validation with a suitable number of different isolates, RTG pssmx-luc cells would be an appropriate in vitro tool for this application without requiring experimental infections. Besides, this experimental system can also help to identify the molecular mechanisms underlying nv transcriptional control, and mx promoters sensitivity to VHSV isolates antagonistic activity, which could allow the identification of genetic variants with increased resistance to VHSV antagonistic activity for selective breeding.
several studies demonstrate that Nv inhibits IFN system response, including mx activation [32,13,33, 34,44,45]. Thus, VHSV nv gene was quantitatively analyzed in comparison with the n gene, which has been classically used to evaluate viral replication. The kinetics of both viral genes in RTG pssmx-luc cells inoculated with the freshwater isolate was similar. In contrast, a delayed increase of the marine isolate nv RNA was recorded in these cells in comparison with the n gene. Previously, Kim and Kim [13] also reported a delay in nv RNA accumulation of a VHSV isolate presenting mutations before and after the nv open reading frame, causing increased mx induction, and reduced virulence, probably due to a lower antagonistic activity. Thus, similarly, the different nv RNA pattern recorded for the two VHSV isolates in RTG pssmx-luc cells might be related with their differential antagonistic activity. In order to test if the observed results were reproducible in a different model, both VHSV isolates were inoculated in SAF-1 cells. The replication of both isolates, analyzed by quantification of the n gene, was lower on SAF-1 than on RTG-2 cells. However, whereas in RTG-2 cells the replication of the freshwater isolate was faster, in SAF-1 cells the opposite situation was observed, which is in agreement with previous reports [8,30]. In SAF-1 cells inoculated with the marine isolate, the kinetics of n and nv genes was similar, in contrast with the delay recorded in RTG-2 cells, which suggests the involvement of cellular factors. Actually, the role of cellular factors in virus-host interaction has been previously highlighted in experiments using different cell lines [15,46,24,30]. Complementary models that allow reciprocal experiments yield a broader understanding of the processes under study, and our results point to nv regulation as an interesting point to follow in order to understand VHSV-host interaction, in which cell-specific factors are apparently involved. In conclusion, this study reveals differences in the dose-dependent antagonistic activity of both, marine and freshwater VHSV isolates that might be involved in their differential virulence. This result suggests
Declaration of Competing Interest All authors declare they have no conflicts of interest Acknowledgements This study was funded by the project B5-2017 (project from Universidad de Málaga). References [1] H.F. Skall, N.J. Olesen, S. Mellergaard, Viral haemorrhagic septicaemia virus in marine fish and its implications for fish farming - a review, J. Fish Dis. 28 (2005) 509–529. [2] K. Einer-Jensen, P. Ahrens, R. Forsberg, N. Lorenzen, Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus, J. Gen. Virol. 85 (2004) 1167–1179. [3] H.F. Skall, N.J. Olesen, S. Mellergaard, Prevalence of viral haemorrhagic septicaemia virus in Danish marine fishes and its occurrence in new host species, Dis. Aquat. Organ 66 (2005) 145–151. [4] E.J. Emmenegger, C.H. Moon, P.K. Hershberger, G. Kurath, Virulence of viral hemorrhagic septicemia virus (VHSV) genotypes Ia, IVa, IVb, and IVc in five fish species, Dis. Aquat. Organ. 107 (2013) 99–111. [5] A.A. Schönherz, N. Lorenzen, K. Einer-Jensen, Inter-species transmission of viral hemorrhagic septicemia virus (VHSV) from turbot (Scophthalmus maximus) to
7
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
[27] B. Collet, P. Boudinot, A. Benmansour, C.J. Secombes, An Mx1 promoter-reporter system to study interferon pathways in rainbow trout, Dev. Comp. Immunol. 28 (2004) 793–801. [28] J.A. González-Mariscal, M.A. Fernández-Trujillo, M.C. Alonso, E. Garcia-Rosado, M.C. Alvarez, J. Béjar, Gilthead seabream (Sparus aurata) Mx gene promoters respond differentially to IPNV and VHSV infections in RTG-2 cells, Vet. Immunol. Immunopathol. 171 (2016) 73–80. [29] B. Collet, K. Urquhart, P. Noguera, K.H. Larsen, K. Lester, D. Smail, D. Bruno, A method to measure an indicator of viraemia in Atlantic salmon using a reporter cell line, J. Virol. Methods 191 (2013) 113–117. [30] I. Cano, B. Collet, C. Pereira, R. Paley, R. van Aerle, D. Stone, N.G.H. Taylor, In vivo virulence of viral haemorrhagic septicaemia virus (VHSV) in rainbow trout Oncorhynchus mykiss correlates inversely with in vitro Mx gene expression, Vet. Microbiol. 187 (2016) 31–40. [31] C. Carballo, E. Garcia-Rosado, J.J. Borrego, M.C. Alonso, SJNNV down-regulates RGNNV replication in European sea bass by the induction of the type I interferon system, Vet. Res. 47 (2016) 6. [32] M.K. Choi, C.H. Moon, M.S. Ko, U.H. Lee, W.J. Cho, S.J. Cha, J.W. Do, G.J. Heo, S.G. Jeong, Y.S. Hahm, A. Harmache, M. Bremont, G. Kurath, J.W. Park, A nuclear localization of the infectious haematopoietic necrosis virus NV protein is necessary for optimal viral growth, PLoS One 6 (2011) e22362. [33] M.S. Kim, K.H. Kim, The role of viral hemorrhagic septicemia virus (VHSV) NV gene in TNF-α and VHSV infection-mediated NF-κB activation, Fish Shellfish Immunol. 34 (2013) 1315–1319. [34] B. Chinchilla, P. Encinas, A. Estepa, J.M. Coll, E. Gomez-Casado, Transcriptome analysis of rainbow trout in response to non-virion (NV) protein of viral haemorrhagic septicaemia virus (VHSV), Appl. Microbiol. Biotechnol. 99 (2015) 1827–1843. [35] M.D. Audsley, G.W. Moseley, Paramyxovirus evasion of innate immunity: diverse strategies for common targets, World J. Virol. 2 (2013) 57–70. [36] S.M. Horner, Activation and evasion of antiviral innate immunity by hepatitis C virus, J. Mol. Biol. 426 (2014) 1198–1209. [37] C. Tafalla, V. Chico, L. Perez, J.M. Coll, A. Estepa, In vitro and in vivo differential expression of rainbow trout (Oncorhynchus mykiss) Mx isoforms in response to viral haemorrhagic septicaemia virus (VHSV) G gene, poly I:C and VHSV, Fish Shellfish Immunol. 23 (2007) 210–221. [38] M.A. Fernández-Trujillo, P. Novel, M. Manchado, M.P. Sepulcre, V. Mulero, J.J. Borrego, M.C. Alvarez, J. Béjar, Three Mx genes with differential response to VNNV infection have been identified in gilthead seabream (Sparus aurata), Mol. Immunol. 48 (2011) 1216–1223. [39] P. Novel, M.A. Fernandez-Trujillo, J.B. Gallardo-Galvez, I. Cano, M. Manchado, F. Buonocore, E. Randelli, G. Scapigliati, M.C. Alvarez, J. Bejar, Two Mx genes identified in European sea bass (Dicentrarchus labrax) respond differently to VNNV infection, Vet. Immunol. Immunopathol. 153 (2013) 240–248. [40] T. Wang, F. Liu, G. Tian, C.J. Secombes, T. Wang, Lineage/species-specific expansion of the Mx gene family in teleosts: differential expression and modulation of nine Mx genes in rainbow trout Oncorhynchus mykiss, Fish Shellfish Immunol. 90 (2019) 413–430. [41] A. Padhi, Pathogen-driven adaptive evolution of myxovirus resistance (Mx) genes in fishes, Biochem. Genet. 51 (2013) 626–634. [42] O. Haller, P. Staeheli, M. Schwemmle, G. Kochs, MxGTPases:dynamin like antiviral machines of innate immunity, Trends Microbiol. 23 (2015) 154–163. [43] E.R. Verrier, M. Dorson, S. Mauger, C. Torhy, C. Ciobotaru, C. Hervet, N. Dechamp, C. Genet, P. Boudinot, E. Quillet, Resistance to a rhabdovirus (VHSV) in rainbow trout: identification of a major QTL related to innate mechanisms, PLoSOne 8 (2013) e55302. [44] S. Biacchesi, E. Mérour, D. Chevret, A. Lamoureux, J. Bernard, M. Brémont, NV proteins of fish novirhabdovirus recruit cellular PPM1Bb protein phosphatase and antagonize RIG-I-Mediated IFN induction, Sci. Reports 7 (2017) 44025. [45] L. Baillon, E. Merour, J. Cabon, L. Louboutin, H. Quenault, F. Touzain, T. Morin, Y. Blanchard, S. Biacchesi, M. Bremont, A single amino acid change in the nonstructural NV protein impacts the virulence phenotype of viral hemorrhagic septicemia virus in trout, J. Gen. Virol. 98 (2017) 6. [46] A. Skjesol, T. Aamo, M.N. Hegseth, B. Robertsen, J.B. Jørgensen, The interplay between infectious pancreatic necrosis virus (IPNV) and the IFN system: IFN signaling is inhibited by IPNV infection, Virus Res. 143 (2009) 53–60.
rainbow trout (Onchorhynchus mykiss), J. Gen. Virol. 94 (2013) 869–875. [6] N. Sandlund, B. Gjerset, Ø. Bergh, I. Modahl, N.J. Olesen, R. Johansen, Screening for viral hemorrhagic septicemia virus in marine fish along the Norwegian coastal line, PLoS One 9 (2014) e108529. [7] I.S. Wallace, K. Donald, L.A. Munro, W. Murray, C.C. Pert, H. Stagg, M. Hall, N. Bain, A survey of wild marine fish identifies a potential origin of an outbreak of viral haemorrhagic septicaemia in wrasse, Labridae, used as cleaner fish on marine Atlantic salmon, Salmo salar L., farms, J. Fish Dis. 38 (2015) 515–521. [8] T. Ito, J. Kurita, K. Mori, N.J. Olesen, Virulence of viral haemorrhagic septicaemia virus (VHSV) genotype III in rainbow trout, Vet. Res. 47 (2016) 4. [9] B. Robertsen, The interferon system of teleost fish, Fish Shellfish Immunol. 20 (2006) 172–191. [10] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376–1387. [11] A. Garcia-Sastre, Ten strategies of interferon evasion by viruses, Cell Host Microbe 22 (2017) 176–184. [12] A. Ammayappan, V.N. Vakharia, Nonvirion protein of novirhabdovirus suppresses apoptosis at the early stage of virus infection, J. Virol. 85 (2011) 8393–8402. [13] M.S. Kim, K.H. Kim, Effects of NV gene knock-out recombinant viral hemorrhagic septicemia virus (VHSV) on Mx gene expression in Epithelioma papulosum cyprini (EPC) cells and olive flounder (Paralichthys olivaceus), Fish Shellfish Immunol. 32 (2012) 459–463. [14] Q. Ke, W. Weaver, A. Pore, B. Gorgoglione, J.H. Wildschutte, P. Xiao, B.S. Shepherd, A. Spear, K. Malathi, C.A. Stepien, V.N. Vakharia, D.W. Leaman, Role of viral hemorrhagic septicemia virus matrix (M) protein in suppressing host transcription, J. Virol. 91 (2017) e00279–17. [15] B. Collet, E.S. Munro, S. Gahlawat, F. Acosta, J. Garcia, C. Roemelt, J. Zou, C.J. Secombes, A.E. Ellis, Infectious pancreatic necrosis virus suppresses type I interferon signalling in rainbow trout gonad cell line but not in Atlantic salmon macrophages, Fish Shellfish Immunol. 22 (2007) 44–56. [16] J.B. Jørgensen, A. Johansen, M.N. Hegseth, J. Zou, B. Robertsen, B. Collet, C.J. Secombes, A recombinant CHSE-214 cell line expressing an Mx1 promoterreporter system responds to both interferon type I and type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish, Fish Shellfish Immunol. 23 (2007) 1294–1303. [17] B. Sun, I. Skjæveland, T. Svingerud, J. Zou, J. Jørgensen, B. Robertsen, Antiviral activity of salmonid gamma interferon against infectious pancreatic necrosis virus and salmonid alphavirus and its dependency on type I interferon, J. Virol. 85 (2011) 9188–9198. [18] C. Lopez-Vazquez, M. Conde, C.P. Dopazo, J.L. Barja, I. Bandin, Susceptibility of juvenile sole (Solea senegalensis) to marine isolates of viral haemorrhagic septicaemia virus from wild and farmed fishes, Dis. Aquat. Organ 93 (2011) 111–116. [19] D. Alvarez-Torres, A.M. Podadera, J. Béjar, I. Bandin, M.C. Alonso, E. GarciaRosado, Role of the IFN I system against the VHSV infection in juvenile Senegalese sole (Solea senegalensis), Vet. Res. 47 (2016) 3. [20] L.J. Reed, H. Muench, A simple method of estimating 50 per cent end-points, Am. J. Hyg. 1938 (27) (1938) 493–497. [21] K. Wolf, M.C. Quimby, Established eurythermic line of fish cells in vitro, Science 135 (1962) 1065–1066. [22] J. Béjar, J.J. Borrego, M.C. Alvarez, A continuous cell line from the cultured marine fish gilt-head seabream (Sparus aurata L.), Aquaculture 150 (1997) 143–153. [23] D. Alvarez-Torres, J. Béjar, B. Collet, M.C. Alonso, E. Garcia-Rosado, Structural and functional characterization of the Senegalese sole (Solea senegalensis) Mx promoter, Fish Shellfish Immunol. 35 (2013) 1642–1648. [24] D. Alvarez-Torres, M.C. Alonso, E. Garcia-Rosado, B. Collet, J. Béjar, Differential response of the Senegalese sole (Solea senegalensis) Mx promoter to viral infections in two salmonid cell lines, Vet. Immunol. Immunopathol. 161 (2014) 251–257. [25] N.A. Ballesteros, M. Alonso, S. Rodriguez Saint-Jean, S.I. Perez-Prieto, An oral DNA vaccine against infectious haematopoietic necrosis virus (IHNV) encapsulated in alginate microspheres induces dose-dependent immune responses and significant protection in rainbow trout (Oncorhynchus mykiss), Fish Shellfish Immunol. 45 (2015) 877–888. [26] R. Leiva-Rebollo, A.M. Labella, J.J. Borrego, D. Castro, Immune gene expression in gilthead seabream (Sparus aurata) after Lymphocystis disease virus (LCDV-Sa) challenge resulting in asymptomatic infection, J. Appl. Microbiol. (2019), https:// doi.org/10.1111/jam.14454.
8
Contents lists available at ScienceDirect
Comparative Immunology, Microbiology and Infectious Diseases journal homepage: www.elsevier.com/locate/cimid
Comparative analysis of marine and freshwater viral haemorrhagic septicaemia virus (VHSV) isolates antagonistic activity
T
Juan Gémez-Mataa,b, Daniel Álvarez-Torresa,b, Esther García-Rosadob, M. Carmen Alonsob, Julia Béjara,* a Universidad de Málaga, Instituto de Biotecnología y Desarrollo Azul, IBYDA, Área De Genética, Departamento de Biología Celular, Genética y Fisiología, Facultad de Ciencias, 29071, Málaga, Spain b Universidad de Málaga, Instituto de Biotecnología y Desarrollo Azul, IBYDA Departamento de Microbiología, Facultad de Ciencias, 29071, Málaga, Spain
A R T I C LE I N FO
A B S T R A C T
Keywords: VHSV Antagonistic activity IFN I Mx RTG-2 SAF-1 Solea senegalensis
Viral Haemorrhagic Septicaemia Virus (VHSV) isolates virulent to marine fish species can replicate in freshwater species, although producing little or no mortality. Conversely, isolates from freshwater fish do not cause disease in marine species. An inverse relationship between VHSV virulence and host mx gene up-regulation has been described for several fish species, suggesting that differences between the antagonistic activity exerted by these isolates might be involved in the outcome of infections. In this study, the antagonistic activity against the type I interferon system of two representative marine and freshwater VHSV isolates has been characterised using RTG2 cells stably transfected with the luciferase gene under the control of the Senegalese sole mx (ssmx) promoter, RTG pssmx-luc cells. Both isolates exerted a dose-dependent negative effect on the activation of ssmx promoter, showing a notably different minimal viral dose to exert the antagonism. In particular, an inverse relationship between the minimal MOI required and the viral virulence to sole has been recorded, which suggests this parameter as a possible in vivo VHSV virulence marker. Furthermore, the quantification of the endogenous inf I, mx1 and mx3 mRNA has demonstrated differences between both isolates in their antagonistic activity. Besides, a different nv RNA kinetics, which seems to depend on specific cellular factors, has been recorded for both isolates. This knowledge could contribute to the development of efficient tools to fight against viral infections in fish farming. For that purpose, the RTG pssmx-luc cells may be a suitable in vitro tool to identify the molecular mechanisms underlying VHSV-host interactions.
1. Introduction
and freshwater VHSV isolates by serological methods; therefore, understanding virulence mechanisms and the identification of specific virulence markers for VHSV isolates is crucial to improve prophylactic strategies, particularly in fish farming. As all vertebrates, fish have an effective antiviral response mediated by type I interferon (IFN I). Briefly, recognition of viral elements by infected cells activates the synthesis of type I IFNs, which bind to receptors in neighbouring cells, leading to the activation of the JAK-STAT signalling pathway, and the eventual transcription of IFN-stimulated genes (ISG) [9]. The expression of ISGs, that occurs under a complex spatial and temporal regulation [10], generates an antiviral and immunoregulatory state in cells. Viruses have evolved multiple strategies to block this host immune response, and, actually, most viruses can affect different stages of the IFN response (reviewed in [11]). One of the most common mechanisms is ISG transcription inhibition. Disclosing the mechanisms governing the activation of ISG transcription by the
Viral Haemorrhagic Septicaemia Virus (VHSV), Novirhabdovirus genus, Rhabdoviridae family, is responsible for an important disease affecting a notably broad range of marine and freshwater fish species [1]. Its non-segmented, negative-sense, single-stranded RNA genome contains 6 genes encoding nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), nonvirion protein (Nv), and RNAdependent RNA polymerase (L). The four VHSV genotypes and/or sublineages can be grouped into freshwater (genotypes Ia, Ic and IVb) and marine isolates (genotypes Ib, Id, Ie, II, III, IVa and IVc) [2]. Isolates from marine fish can replicate in freshwater species, although causing little or no mortality, and isolates from freshwater fish do not cause disease in marine species [1–5] [6–8]. Thus, the resistant species to each type of isolate, are viral reservoirs that represent a risk for the susceptible species. It is not possible to differentiate between marine
⁎
Corresponding author. E-mail address: [email protected] (J. Béjar).
https://doi.org/10.1016/j.cimid.2020.101426 Received 30 October 2019; Received in revised form 13 January 2020; Accepted 17 January 2020 0147-9571/ © 2020 Elsevier Ltd. All rights reserved.
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
supplemented with 10 % FBS, 4 mM L-glutamine and 100 U/mL penicillin, 100 μg/mL streptomycin (growth medium). RTG-2 cells were incubated at 20 °C, and SAF-1 cells at 25 °C.
IFN I system, and its inhibition by viral antagonistic activity, can help to understand virus-host interaction, and, therefore, the result of the infection, i.e. disease outcome. In VHSV, the non-structural Nv protein seems to be crucial for VHSV antagonistic activity [12,13], and the M protein has also been reported to interfere with host immune response [14]. Among ISGs, mx genes have been considered as markers of type I IFN response. Besides, mx transcription is blocked by several viruses; therefore, the level of mx induction has been related with the susceptibility/resistance of different fish species to specific viruses or viral isolates [15–17]. Previous studies have demonstrated that Senegalese sole (Solea senegalensis), one of the most promising species in the Mediterranean aquaculture, is highly susceptible to a marine VHSV isolate under experimental conditions, although it does not show disease symptoms after inoculation with a freshwater VHSV isolate [18, 19]. In addition, the marine VHSV isolate seems to be the only one that interferes with the sole antiviral response [19]. Therefore, the differential antagonism of the two VHSV isolates might be involved in their specific virulence to Senegalese sole. In this study, in order to contribute to understand VHSV-sole interaction, an RTG-2 cell line expressing luciferase under the control of Senegalese sole mx (ssmx) promoter (RTG pssmx-luc cells) was established and used to evaluate and compare the antagonistic effect of two VHSV isolates with different origin.
2.2. Establishment of the RTG pssmx-luciferase cell line For transfection, RTG-2 cells (80 % confluence) were trypsinized and resuspended (ca. 106 cells) in 100 μL of Nucleofector solution V (Lonza); afterwards, 1 μg of the pGL4-Luc + promssmx-F2 plasmid [23] was added, and cells were immediately transfected using an Amaxa NucleofectorR (Lonza, T-030 program). Transfected cells were seeded on 25-cm2 flasks and cultured in L-15 growth medium with dihydrochloride of puromycin (2 μg/mL, Gibco) for several weeks, until no cell death was observed. After selection, the genomic integration of the plasmid was confirmed by genomic PCR amplification and sequencing of the ssmx promoter according to Alvarez-Torres et al. [23]. This cell population was called RTG pssmx-luc. 2.3. Quantification of viral genes in RTG pssmx-luc and SAF-1 cells VHSV nucleoprotein (n) and nonvirion protein (nv) genes were quantified by qPCR. For that, RTG pssmx-luc and SAF-1 cells were grown on 24-well cell culture plates (Nunc) in L-15 growth medium until 80 % confluence. Afterwards, cells were washed twice with PBS, and inoculated with each isolate at a multiplicity of infection (MOI) of 0.1 in L-15 medium supplemented with 4 mM L-glutamine and 100 U/ mL penicillin, 100 μg/mL streptomycin (inoculation medium). After 1 -h adsorption at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate, viral suspensions were removed and replaced by L-15 maintenance medium. Inoculated cells were incubated at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate. Total RNA was extracted at 12, 24 and 36 h post-inoculation (h p.i.) from RTG pssmx-luc cells; and at 24, 48 and 72 h p.i. from SAF-1 cells, in triplicate, using the EZNA total RNA kit I (Omega). After RNA treatment with DNase (DNase I recombinant RNase-free, Sigma), cDNA was synthesized with the Transcriptor First Strand cDNA Synthesis Kit (Roche), using 500 ng of RNA and random primers. Real-time PCR reactions were performed in 20-μL mixtures containing 10 μL of 2x LightCycler 480 SYBR Green I Master mix (Roche), 1 μL of each primer (Table 1, 10 μM final concentration), and 2 μL of cDNA. Amplifications were conducted in 96-well plates with a LightCycler 96 (Roche). The cycling profile was 10 min at 95 °C, following by 45 cycles of 10 s at 95 °C, 10 s at 60 °C and 10 s at 72 °C, and a final step of 10 s at 95 °C and 1 min at 65 °C. Data were analyzed with the comparative Ct method, obtaining relative values (Rv) to the endogenous eF1α transcription factor (Table 1) according to the formula Rv = 2−ΔCt. Mean values were statistically analyzed by one-way
2. Material and methods 2.1. Virus propagation and cell culture Two VHSV isolates were used in this study: (1) VHSV Sm2897 (genotype III, obtained from turbot, Scophthalmus maximus), a marine isolate highly virulent to Senegalese sole (70 % mortality); and (2) VHSV DK-F1 (genotype I, obtained from rainbow trout, Oncorhynchus mykiss), a freshwater isolate less virulent to Senegalese sole (4 % mortality) [19]. Both isolates were propagated on BF-2 cells incubated at 20 °C for the marine isolate, or at 15 °C for the freshwater isolate, in Leibowitz L-15 medium (Gibco) supplemented with 2 % foetal bovine serum (FBS, Lonza), 4 mM L-glutamine (Gibco), and 100 U/mL penicillin, 100 μg/mL streptomycin (Sigma) (maintenance medium). Cultures displaying extensive cytopathic effects (CPEs) were harvested and centrifuged at 5000 x g for 10 min at 4 °C. Viral suspensions were titrated by the 50 % tissue culture infective dose (TCID50) method [20] and stored at −80 °C until used. The RTG-2 cell line, derived from gonad tissue of rainbow trout [21], and the SAF-1 cell line, derived from gilt-head sea bream (Sparus aurata) fin [22], were cultured on 25-cm2 flasks (Nunc) in L-15 medium Table 1 Primers used in this study.
VHSV n gene Freshwater VHSV nv Marine VHSV nv R. trout ifn I R. trout mx1 R. trout mx3 R. trout elongation factor 1α Seabream elongation factor 1α
Name
Primer sequence (5´-3´)
Accession No.
Reference
VHSV-F1 VHSV-R1 NvF1-F NvF1-R NvSm-F NvSm-R IFN-1-F IFN-1-R Mx-1-F Mx-1-R Mx-3-F Mx-3-R RTeF1α-F RTeF1α-R SeF1α-F SeF1α-R
AAGGCCCTCTATGCGTTCATC GGTGAACAACCCAATCATGGT GACTTTGATCGGTCGGACAT AGCACATGGAGGTGAGGAAG TGATCACACACAGGCTCACA CATCCAAGATCCTGGGAAGA AAAACTGTTTGATGGGAATATGAAA CGTTTCAGTCTCCTCTCAGGTT GGTTGTGCCATGCAACGTT GGCTTGGTCAGGATGCCTAAT AGCTCAAACGCCTGATGAAG3 TGAATATGTCTGTTATCCTCCAAA GATCCAGAAGGAGGTCACCA TTACGTTCGACCTTCCATCC ATTGTCAAACTGCACCCACA GCTCAACAGCCTTGATGACA
AJ23396
[24]
2
This study
NM_001124531
[25]
NM_001171901 U47946.1 AF498320 AF184170
[26]
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
increased at 48 h p.i. (relative value = 0.049), reaching the maximum value at 72 h p.i. (relative value = 0.084) (Fig. 1B). In contrast, the freshwater isolate n RNA only increased at 72 h p.i. (relative value = 0.048), reaching a lower level than n RNA from the marine virus, thus suggesting that this isolate replicates more slowly in SAF-1 cells.
analysis of variance (ANOVA). Differences of P < 0.05 were considered statistically significant. 2.4. Evaluation of the antagonistic effect of VHSV isolates RTG pssmx-luc cells were grown on 24-well cell culture plates in L-15 growth medium until 80 % confluence. Afterwards, cells were washed twice with PBS, and 3 wells per isolate were inoculated as described above, at 0.1 MOI for the marine isolate, and at 0.1 and 0.8 MOI for the freshwater isolate. Then, polyinosinic:polycytidylic acid (poly I:C) was added to the infected cells (10 μg/mL, final concentration) at 12 or 24 h p.i. for the freshwater isolate and the marine isolate, respectively, and finally luciferase activity was measured 12 h after poly I:C addition. In this regard, luciferase activity was measured at the time point at which the highest viral RNA relative value was recorded (24 or 36 h p.i., for the freshwater and the marine isolate, respectively). For that, 100 μL of Luciferase Assay Reagent II (Promega) were added to each well, and light emission (Relative Light Units, RLU) of 20 μL of the cellular lysates obtained was determined with continuous measurements every 2 s during 10 s, using a GloMax 96 Microplate Luminometer (Promega). Uninfected cells stimulated with poly I:C were used as positive control of the ssmx promoter stimulation. Infected cells nonstimulated with poly I:C, and cells unstimulated and uninfected were used as negative controls. Data were statistically analyzed with the two-way ANOVA test. Differences of P < 0.05 were considered significant. To evaluate the effect of different viral doses on the antagonistic effect of each VHSV isolate, the above described experiment was repeated with cells inoculated with the following MOIs: 0.0125, 0.025, 0.05 and 0.1 MOI for the marine isolate; and 0.1, 0.4, 0.8 and 1 MOI for the freshwater isolate.
3.3. VHSV antagonistic effect It is well established that poly I:C quickly induces an antiviral state in cells. Actually, poly I:C stimulated the ssmx promoter, producing an increase in luciferase activity 12 h after treatment (RLU values from 1.7 × 105 to 4.1 × 105) (Fig. 2 A, B and C). In contrast, VHSV isolates did not activate the promoter and, consequently, luciferase activity remained at its basal level (Fig. 2 A, B and C). Therefore, to evaluate the putative antagonistic activity of VHSV isolates on the ssmx promoter, cells were first inoculated with each isolate and, to measure luciferase activity at the time point of maximum level of viral RNA, poly I:C was added at 12 h or 24 h after the inoculation with the freshwater or the marine isolate, respectively; then, luciferase was measured 12 h later. Results showed that the marine VHSV interfered with the stimulation triggered by poly I:C, causing a significant reduction (77 %, P < 0.05) of the luciferase activity (Fig. 2A), which indicates an antagonistic effect of this isolate on ssmx promoter activity. In contrast, when cells were inoculated with the freshwater isolate at the same MOI (0.1), the presence of the virus did not affect the stimulation caused by poly I:C (Fig. 2B), which suggests that this isolate does not show antagonistic effect on ssmx promoter. In order to confirm that the absence of antagonistic activity was not due to an insufficient amount of virus, cells were inoculated with the freshwater isolate at a higher MOI (0.8), which resulted in a significant reduction (83 %, P < 0.05) of the induction triggered by poly I:C (Fig. 2C). Hence, both VHSV isolates antagonize the response of the ssmx promoter, although a higher viral concentration of the freshwater isolate is necessary to detect this effect.
2.5. Quantification of the endogenous (RTG-cells) ifn I and mx gene transcription RTG-2 pssmx-luc cells were grown, inoculated at 0.1 and 1 MOI with each VHSV isolate, and stimulated with poly I:C as described above. RNA was extracted at 4 or 12 h after poly I:C treatment to quantify transcription of endogenous ifn I or mx (mx1 and mx3), respectively. Then, cDNA was synthesized, qPCR reactions were performed, and data were analyzed as described above. Primers used are shown in Table 1 [25,26].
3.4. Effect of viral dose on the antagonistic activity of VHSV isolates To further characterize the influence of the viral dose on the antagonistic activity, RTG pssmx-luc cells were inoculated at different MOIs before adding poly I:C (Fig. 3). Luciferase activity decreased significantly (P < 0.05) in cells inoculated with the marine isolate and treated with poly I:C (RLU = 0.15x105 to 1.2 × 105) compared to the poly I:C-induced mx promoter activity (RLU = 1.7 × 105), even with the lowest MOI tested (0.0125, 33 % reduction). In addition, a clear dose-dependent effect was observed, with a maximum interference around 100 % (98 % Fig. 3A) at the highest MOI tested (0.1). Regarding the freshwater isolate (Fig. 3B), a dose-dependent effect was also recorded; however, the lowest MOI required to significantly reduce the poly I:C-induced ssmx promoter activity was 0.4 (53 % reduction), and the maximum interference detected was in cells inoculated at 1 MOI (87 %, Fig. 3B).
3. Results 3.1. Establishment of the RTG pssmx-luc cell line After several weeks of selection, a cell population with similar morphology and growth rate than the original RTG-2 cell line was obtained (data not shown). Once the genomic integration of the plasmid was confirmed, this cell population was called RTG pssmx-luc and used to evaluate antagonistic activity of VHSV isolates.
3.5. Transcription quantification of endogenous ifn I and mx genes 3.2. Viral genome replication in RTG pssmx-luc and SAF-1 cells In order to determine if the interference occurs by inhibition of ifn I transcription, RTG-2 ifn I mRNA was quantified in cells inoculated and subsequently stimulated with poly I:C. Results showed statistically similar relative values of ifn I transcription in poly I:C-treated cells and in (infected + poly I:C)-treated cells, for both VHSV isolates, regardless of the MOI analyzed (P < 0.05, Fig. 4 A and B). Therefore, the antagonistic effect on ifn I transcription was discarded for both VHSV isolates. To determine if viruses are antagonizing the ISG signalling pathway, RTG-2 mx1 and mx3 mRNA were quantified. Transcription of these genes in cells inoculated with the marine isolate (0.1 and 1 MOI) and subsequently treated with poly I:C was statistically similar (P < 0.05) to the transcription recorded in cells stimulated only with poly I:C (Fig. 5
Quantification of the nucleoprotein-coding RNA was used to characterize viral replication in RTG pssmx-luc and SAF-1 cells. In RTG pssmx-luc cells, the marine isolate RNA was first detected at 24 h p.i. (relative value = 18.9), and the maximum relative value was obtained at 36 h p.i. (relative value = 34.1) (Fig. 1A). In these cells, the freshwater isolate genome was detected at 24 h p.i. (relative value = 29), whereas at 36 h p.i., n-coding RNA could not be measured due to the destruction of the cell monolayer. Thus, the freshwater isolate genome replicates faster than the marine VHSV genome in these cells, although maximum RNA relative values were statistically similar for both isolates (P < 0.05). In SAF-1 cells inoculated with the marine isolate, n-coding RNA 3
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 1. Relative quantification of the VHSV nucleoprotein (n) and nonvirion protein (nv) genes in RTG-2 pssmx-luc (A and C), and SAF-1 (B and D) cells inoculated with the marine (white) at 20 °C, or the freshwater (grey) VHSV isolate at 15 °C. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
4. Discussion
A and B). In contrast, cells inoculated with the freshwater isolate at 1 MOI and treated with poly I:C, showed lower relative values of mx1 and mx3 mRNA than cells treated only with poly I:C (47 and 56 % reduction, respectively) (P < 0.05, Fig. 5 C and D). Thus, the freshwater VHSV isolate interfered with the response of the endogenous mx genes, whereas the marine isolate seems not to affect the mx response in RTG-2 cells. In consequence, the interference of the marine isolate might be promoter specific, as this isolate do not apparently affect the ISG signalling pathway.
In this study, the antagonistic activity of VHSV isolates of marine and freshwater origin has been studied in RTG pssmx-luc cells, the stable reporter system developed ad hoc that has been proven to be useful to characterize virus-host interaction. Actually, ssmx promoter response to poly I:C in RTG pssmx-luc cells was similar to that obtained in previous transient transfection experiments [23], indicating that the vector integration did not affect the IFN response pathway in RTG-2 cells. This kind of stable in vitro reporter systems had been previously used to evaluate the response of fish mx promoters to type I IFN, or to viral infections [13,27,28]; furthermore, these systems have also been described as valuable tools to measure viraemia in fish serum [29]; or, as in this study, to characterize the blocking of mx transcription by viral infections [15]; Jorgensen et al., 2007; [28,30]. In the present study, it is especially interesting to have an mx promoter from a marine fish species integrated in a cell line derived from a freshwater species, which makes possible to evaluate the effect of marine and freshwater isolates on both, the endogenous (RTG-cells) and the exogenous (sole) mx promoters at the same time. According to our results, both isolates interfere with Senegalese sole mx induction triggered by poly I:C in a dose-dependent way, although showing some differences. Specifically, the minimal MOI required to exert this antagonistic activity over the sole mx promoter is inversely related with the viral virulence to sole (0.0125 MOI for the marine
3.6. Implication of viral nv gene in antagonistic activity Viral nv-coding RNA was quantified in order to determine if differences between the antagonistic activity of VHSV isolates were related with this gene. In RTG pssmx-luc cells inoculated with the marine isolate, nv relative values showed a single peak at 36 h p.i. (relative value = 148.6) (Fig. 1C), thus it seems to be delayed with respect to the n gene (Fig. 1A), which shows a significant increase at 24 h p.i. In contrast, the maximum level of the freshwater isolate nv RNA was recorded at 24 h p.i. (relative value = 157.6), which is the same profile observed for the n gene (Fig. 1A and C). In SAF-1 cells, the profile of nv and n RNA from both isolates was similar (Fig. 1B and D), with maximum RNA relative values at 72 h p.i.; however, the freshwater isolate relative value was significantly lower (0.45) than the marine isolate relative value (0.68, P < 0.05). 4
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 2. Luciferase activity in RTG-2-pssmx cells inoculated with VHSV isolates and subsequently stimulated with poly I:C. Quantification was performed at the time point of maximum RNA accumulation for each isolate. (A) Luciferase activity 36 h after inoculation with the marine isolate (0.1 MOI) and 12 h after poly I:C treatment; (B) Luciferase activity 24 h after inoculation with the freshwater isolate (0.1 MOI) and 12 h after poly I:C treatment; (C) Luciferase activity at 24 h after inoculation with the freshwater isolate (0.8 MOI) and 12 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls are non-inoculated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
Fig. 3. Antagonistic effect of both VHSV isolates on the ssmx promoter activity in RTG pssmx-luc cells inoculated at different MOIs and subsequently stimulated with poly I:C; (A) cells inoculated with the marine VHSV isolate; luciferase activity was measured 36 h after the infection and 12 h after poly I:C treatment (B) cells inoculated with the freshwater VHSV; luciferase activity was measured 24 h after the infection and 12 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
transcription after inoculation with a viral isolate virulent to trout in a dose-dependent way. As in the present work, this interference was recorded at a very low viral dose. Therefore, minimal MOI that causes viral interference on the mx promoters could be considered as a virulence marker for VHSV isolates, and the cell line developed in this study could be a tool to evaluate this interference. To our knowledge, the present study is the first report showing antagonism of a freshwater VHSV isolate against a marine species mx promoter.
isolate, highly virulent to sole, versus 0.4 MOI for the freshwater isolate, non-virulent to sole). In a previous study, Cano et al. [30] tested different VHSV isolates in RTG-2 cells, reporting interference on mx 5
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 4. Relative quantification of endogenous ifn I gene transcription in RTG-2 cells inoculated with the marine (A) or the freshwater (B) VHSV isolates, and subsequently stimulated with poly I:C. Poly I:C was added 24 h after inoculation with the marine isolate and 12 h after inoculation with the freshwater isolate. Quantification was performed 4 h after poly I:C treatment. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
evidenced that the antagonistic effect of the marine isolate on the sole mx is promoter-specific, since no interference with the RTG-2 mx1 and mx3 transcription was recorded, even when cells were inoculated at high MOI (0.8), which indicates that none of the cellular factors involved in the ISG signalling cascade were affected. In contrast, the freshwater isolate interfered with the induction of RTG-2 mx1 and mx3 genes triggered by poly I:C, which agrees with previous reports [30]. Therefore, the present study describes a differential modulation of mx expression occurring at promoter level, which had been observed previously for other virus-host systems [37–39] [28, 30]. Actually, the structural diversity of fish mx promoters supports a tight transcriptional control of mx, which has been suggested to be due to its crucial role in fish antiviral defence [40]. The relationship between the virulence of viral pathogens to a specific host and their ability to block mx promoters in that host, points to the pathogen-host coevolution process as a key element in this interaction, as it has also been suggested for mx coding region and its antiviral specificity [41,42]. In addition, the identification of mx promoter sequence motif(s) responsible for their differential sensitivity to VHSV antagonistic activity and the putative variability of these regions might lead to the identification of allelic variants related with resistance/sensitivity to VHSV antagonistic activity, which can be used in selective breeding. Actually, several quantitative trait loci (QTL) related to resistance to VHSV have been identified in trout, and one of them mapped very close to mx [43]. It has been previously reported that the non-structural VHSV Nv protein is crucial for VHSV antagonistic activity [12, 13]. Actually,
Considering our results, it is possible to suggest that the known inverse relationship between viral virulence and host mx-upregulation [13,27,30,31] could be a consequence of a differential antagonistic activity; that is, isolates with low virulence to a specific fish species could show low or none antagonistic activity against the IFN system of that fish species (and therefore high mx induction), or, as it has been shown in this study, they could require a higher viral concentration to exert the antagonistic effect. In contrast, virulent isolates would present a potent antagonistic activity (low mx induction), which would be significant even at quite low viral concentration. In order to get more insight into the antagonistic activity of the two VHSV isolates considered, endogenous (RTG-2 cells) ifn I, mx1 and mx3 transcription was quantified. This analysis demonstrated that none of the isolates tested interferes with ifn I transcription, and, therefore, the antagonistic effect recorded on the sole mx promoter occurs downstream the IFN I synthesis (either affecting the ISG signalling pathway or the specific promoter activation). However, previous studies showed inhibition of the ifn I transcription in trout by VHSV isolates virulent to that species [13,32,33,34]; Biachessi et al., 2017). In our system it might be possible that the absence of interference with ifn I transcription was due to the low levels of Nv at that time point, it could occur later, when Nv levels are higher. In any case, these discrepancies indicate that VHSV might present different mechanisms to evade the host immune system, which could be differentially activated depending on the isolate and/or the host [35,36]. The analysis of the endogenous mx1 and mx3 transcription 6
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
Fig. 5. Relative quantification of endogenous mx1 and mx3 gene transcription in RTG-2 cells inoculated with the marine (A, B) or the freshwater (C, D) VHSV isolate, and subsequently stimulated with poly I:C. Quantification was performed 12 h after poly I:C addition; 36 h after the marine isolate inoculation and 24 h after the freshwater isolate inoculation, the time points of maximum RNA accumulation of each isolate. Inoculated cells were incubated at 20 °C or 15 °C for the marine and freshwater isolates, respectively. Negative controls (C-) are non-treated cells. Bars indicate mean + standard deviation (SD) obtained from three different samples. Different letters indicate significant differences between columns, P < 0.05.
that the minimal viral dose required to detect this interference may be a possible virulence marker for VHSV isolates. After proper validation with a suitable number of different isolates, RTG pssmx-luc cells would be an appropriate in vitro tool for this application without requiring experimental infections. Besides, this experimental system can also help to identify the molecular mechanisms underlying nv transcriptional control, and mx promoters sensitivity to VHSV isolates antagonistic activity, which could allow the identification of genetic variants with increased resistance to VHSV antagonistic activity for selective breeding.
several studies demonstrate that Nv inhibits IFN system response, including mx activation [32,13,33, 34,44,45]. Thus, VHSV nv gene was quantitatively analyzed in comparison with the n gene, which has been classically used to evaluate viral replication. The kinetics of both viral genes in RTG pssmx-luc cells inoculated with the freshwater isolate was similar. In contrast, a delayed increase of the marine isolate nv RNA was recorded in these cells in comparison with the n gene. Previously, Kim and Kim [13] also reported a delay in nv RNA accumulation of a VHSV isolate presenting mutations before and after the nv open reading frame, causing increased mx induction, and reduced virulence, probably due to a lower antagonistic activity. Thus, similarly, the different nv RNA pattern recorded for the two VHSV isolates in RTG pssmx-luc cells might be related with their differential antagonistic activity. In order to test if the observed results were reproducible in a different model, both VHSV isolates were inoculated in SAF-1 cells. The replication of both isolates, analyzed by quantification of the n gene, was lower on SAF-1 than on RTG-2 cells. However, whereas in RTG-2 cells the replication of the freshwater isolate was faster, in SAF-1 cells the opposite situation was observed, which is in agreement with previous reports [8,30]. In SAF-1 cells inoculated with the marine isolate, the kinetics of n and nv genes was similar, in contrast with the delay recorded in RTG-2 cells, which suggests the involvement of cellular factors. Actually, the role of cellular factors in virus-host interaction has been previously highlighted in experiments using different cell lines [15,46,24,30]. Complementary models that allow reciprocal experiments yield a broader understanding of the processes under study, and our results point to nv regulation as an interesting point to follow in order to understand VHSV-host interaction, in which cell-specific factors are apparently involved. In conclusion, this study reveals differences in the dose-dependent antagonistic activity of both, marine and freshwater VHSV isolates that might be involved in their differential virulence. This result suggests
Declaration of Competing Interest All authors declare they have no conflicts of interest Acknowledgements This study was funded by the project B5-2017 (project from Universidad de Málaga). References [1] H.F. Skall, N.J. Olesen, S. Mellergaard, Viral haemorrhagic septicaemia virus in marine fish and its implications for fish farming - a review, J. Fish Dis. 28 (2005) 509–529. [2] K. Einer-Jensen, P. Ahrens, R. Forsberg, N. Lorenzen, Evolution of the fish rhabdovirus viral haemorrhagic septicaemia virus, J. Gen. Virol. 85 (2004) 1167–1179. [3] H.F. Skall, N.J. Olesen, S. Mellergaard, Prevalence of viral haemorrhagic septicaemia virus in Danish marine fishes and its occurrence in new host species, Dis. Aquat. Organ 66 (2005) 145–151. [4] E.J. Emmenegger, C.H. Moon, P.K. Hershberger, G. Kurath, Virulence of viral hemorrhagic septicemia virus (VHSV) genotypes Ia, IVa, IVb, and IVc in five fish species, Dis. Aquat. Organ. 107 (2013) 99–111. [5] A.A. Schönherz, N. Lorenzen, K. Einer-Jensen, Inter-species transmission of viral hemorrhagic septicemia virus (VHSV) from turbot (Scophthalmus maximus) to
7
Comparative Immunology, Microbiology and Infectious Diseases 69 (2020) 101426
J. Gémez-Mata, et al.
[27] B. Collet, P. Boudinot, A. Benmansour, C.J. Secombes, An Mx1 promoter-reporter system to study interferon pathways in rainbow trout, Dev. Comp. Immunol. 28 (2004) 793–801. [28] J.A. González-Mariscal, M.A. Fernández-Trujillo, M.C. Alonso, E. Garcia-Rosado, M.C. Alvarez, J. Béjar, Gilthead seabream (Sparus aurata) Mx gene promoters respond differentially to IPNV and VHSV infections in RTG-2 cells, Vet. Immunol. Immunopathol. 171 (2016) 73–80. [29] B. Collet, K. Urquhart, P. Noguera, K.H. Larsen, K. Lester, D. Smail, D. Bruno, A method to measure an indicator of viraemia in Atlantic salmon using a reporter cell line, J. Virol. Methods 191 (2013) 113–117. [30] I. Cano, B. Collet, C. Pereira, R. Paley, R. van Aerle, D. Stone, N.G.H. Taylor, In vivo virulence of viral haemorrhagic septicaemia virus (VHSV) in rainbow trout Oncorhynchus mykiss correlates inversely with in vitro Mx gene expression, Vet. Microbiol. 187 (2016) 31–40. [31] C. Carballo, E. Garcia-Rosado, J.J. Borrego, M.C. Alonso, SJNNV down-regulates RGNNV replication in European sea bass by the induction of the type I interferon system, Vet. Res. 47 (2016) 6. [32] M.K. Choi, C.H. Moon, M.S. Ko, U.H. Lee, W.J. Cho, S.J. Cha, J.W. Do, G.J. Heo, S.G. Jeong, Y.S. Hahm, A. Harmache, M. Bremont, G. Kurath, J.W. Park, A nuclear localization of the infectious haematopoietic necrosis virus NV protein is necessary for optimal viral growth, PLoS One 6 (2011) e22362. [33] M.S. Kim, K.H. Kim, The role of viral hemorrhagic septicemia virus (VHSV) NV gene in TNF-α and VHSV infection-mediated NF-κB activation, Fish Shellfish Immunol. 34 (2013) 1315–1319. [34] B. Chinchilla, P. Encinas, A. Estepa, J.M. Coll, E. Gomez-Casado, Transcriptome analysis of rainbow trout in response to non-virion (NV) protein of viral haemorrhagic septicaemia virus (VHSV), Appl. Microbiol. Biotechnol. 99 (2015) 1827–1843. [35] M.D. Audsley, G.W. Moseley, Paramyxovirus evasion of innate immunity: diverse strategies for common targets, World J. Virol. 2 (2013) 57–70. [36] S.M. Horner, Activation and evasion of antiviral innate immunity by hepatitis C virus, J. Mol. Biol. 426 (2014) 1198–1209. [37] C. Tafalla, V. Chico, L. Perez, J.M. Coll, A. Estepa, In vitro and in vivo differential expression of rainbow trout (Oncorhynchus mykiss) Mx isoforms in response to viral haemorrhagic septicaemia virus (VHSV) G gene, poly I:C and VHSV, Fish Shellfish Immunol. 23 (2007) 210–221. [38] M.A. Fernández-Trujillo, P. Novel, M. Manchado, M.P. Sepulcre, V. Mulero, J.J. Borrego, M.C. Alvarez, J. Béjar, Three Mx genes with differential response to VNNV infection have been identified in gilthead seabream (Sparus aurata), Mol. Immunol. 48 (2011) 1216–1223. [39] P. Novel, M.A. Fernandez-Trujillo, J.B. Gallardo-Galvez, I. Cano, M. Manchado, F. Buonocore, E. Randelli, G. Scapigliati, M.C. Alvarez, J. Bejar, Two Mx genes identified in European sea bass (Dicentrarchus labrax) respond differently to VNNV infection, Vet. Immunol. Immunopathol. 153 (2013) 240–248. [40] T. Wang, F. Liu, G. Tian, C.J. Secombes, T. Wang, Lineage/species-specific expansion of the Mx gene family in teleosts: differential expression and modulation of nine Mx genes in rainbow trout Oncorhynchus mykiss, Fish Shellfish Immunol. 90 (2019) 413–430. [41] A. Padhi, Pathogen-driven adaptive evolution of myxovirus resistance (Mx) genes in fishes, Biochem. Genet. 51 (2013) 626–634. [42] O. Haller, P. Staeheli, M. Schwemmle, G. Kochs, MxGTPases:dynamin like antiviral machines of innate immunity, Trends Microbiol. 23 (2015) 154–163. [43] E.R. Verrier, M. Dorson, S. Mauger, C. Torhy, C. Ciobotaru, C. Hervet, N. Dechamp, C. Genet, P. Boudinot, E. Quillet, Resistance to a rhabdovirus (VHSV) in rainbow trout: identification of a major QTL related to innate mechanisms, PLoSOne 8 (2013) e55302. [44] S. Biacchesi, E. Mérour, D. Chevret, A. Lamoureux, J. Bernard, M. Brémont, NV proteins of fish novirhabdovirus recruit cellular PPM1Bb protein phosphatase and antagonize RIG-I-Mediated IFN induction, Sci. Reports 7 (2017) 44025. [45] L. Baillon, E. Merour, J. Cabon, L. Louboutin, H. Quenault, F. Touzain, T. Morin, Y. Blanchard, S. Biacchesi, M. Bremont, A single amino acid change in the nonstructural NV protein impacts the virulence phenotype of viral hemorrhagic septicemia virus in trout, J. Gen. Virol. 98 (2017) 6. [46] A. Skjesol, T. Aamo, M.N. Hegseth, B. Robertsen, J.B. Jørgensen, The interplay between infectious pancreatic necrosis virus (IPNV) and the IFN system: IFN signaling is inhibited by IPNV infection, Virus Res. 143 (2009) 53–60.
rainbow trout (Onchorhynchus mykiss), J. Gen. Virol. 94 (2013) 869–875. [6] N. Sandlund, B. Gjerset, Ø. Bergh, I. Modahl, N.J. Olesen, R. Johansen, Screening for viral hemorrhagic septicemia virus in marine fish along the Norwegian coastal line, PLoS One 9 (2014) e108529. [7] I.S. Wallace, K. Donald, L.A. Munro, W. Murray, C.C. Pert, H. Stagg, M. Hall, N. Bain, A survey of wild marine fish identifies a potential origin of an outbreak of viral haemorrhagic septicaemia in wrasse, Labridae, used as cleaner fish on marine Atlantic salmon, Salmo salar L., farms, J. Fish Dis. 38 (2015) 515–521. [8] T. Ito, J. Kurita, K. Mori, N.J. Olesen, Virulence of viral haemorrhagic septicaemia virus (VHSV) genotype III in rainbow trout, Vet. Res. 47 (2016) 4. [9] B. Robertsen, The interferon system of teleost fish, Fish Shellfish Immunol. 20 (2006) 172–191. [10] J. Zou, C.J. Secombes, Teleost fish interferons and their role in immunity, Dev. Comp. Immunol. 35 (2011) 1376–1387. [11] A. Garcia-Sastre, Ten strategies of interferon evasion by viruses, Cell Host Microbe 22 (2017) 176–184. [12] A. Ammayappan, V.N. Vakharia, Nonvirion protein of novirhabdovirus suppresses apoptosis at the early stage of virus infection, J. Virol. 85 (2011) 8393–8402. [13] M.S. Kim, K.H. Kim, Effects of NV gene knock-out recombinant viral hemorrhagic septicemia virus (VHSV) on Mx gene expression in Epithelioma papulosum cyprini (EPC) cells and olive flounder (Paralichthys olivaceus), Fish Shellfish Immunol. 32 (2012) 459–463. [14] Q. Ke, W. Weaver, A. Pore, B. Gorgoglione, J.H. Wildschutte, P. Xiao, B.S. Shepherd, A. Spear, K. Malathi, C.A. Stepien, V.N. Vakharia, D.W. Leaman, Role of viral hemorrhagic septicemia virus matrix (M) protein in suppressing host transcription, J. Virol. 91 (2017) e00279–17. [15] B. Collet, E.S. Munro, S. Gahlawat, F. Acosta, J. Garcia, C. Roemelt, J. Zou, C.J. Secombes, A.E. Ellis, Infectious pancreatic necrosis virus suppresses type I interferon signalling in rainbow trout gonad cell line but not in Atlantic salmon macrophages, Fish Shellfish Immunol. 22 (2007) 44–56. [16] J.B. Jørgensen, A. Johansen, M.N. Hegseth, J. Zou, B. Robertsen, B. Collet, C.J. Secombes, A recombinant CHSE-214 cell line expressing an Mx1 promoterreporter system responds to both interferon type I and type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish, Fish Shellfish Immunol. 23 (2007) 1294–1303. [17] B. Sun, I. Skjæveland, T. Svingerud, J. Zou, J. Jørgensen, B. Robertsen, Antiviral activity of salmonid gamma interferon against infectious pancreatic necrosis virus and salmonid alphavirus and its dependency on type I interferon, J. Virol. 85 (2011) 9188–9198. [18] C. Lopez-Vazquez, M. Conde, C.P. Dopazo, J.L. Barja, I. Bandin, Susceptibility of juvenile sole (Solea senegalensis) to marine isolates of viral haemorrhagic septicaemia virus from wild and farmed fishes, Dis. Aquat. Organ 93 (2011) 111–116. [19] D. Alvarez-Torres, A.M. Podadera, J. Béjar, I. Bandin, M.C. Alonso, E. GarciaRosado, Role of the IFN I system against the VHSV infection in juvenile Senegalese sole (Solea senegalensis), Vet. Res. 47 (2016) 3. [20] L.J. Reed, H. Muench, A simple method of estimating 50 per cent end-points, Am. J. Hyg. 1938 (27) (1938) 493–497. [21] K. Wolf, M.C. Quimby, Established eurythermic line of fish cells in vitro, Science 135 (1962) 1065–1066. [22] J. Béjar, J.J. Borrego, M.C. Alvarez, A continuous cell line from the cultured marine fish gilt-head seabream (Sparus aurata L.), Aquaculture 150 (1997) 143–153. [23] D. Alvarez-Torres, J. Béjar, B. Collet, M.C. Alonso, E. Garcia-Rosado, Structural and functional characterization of the Senegalese sole (Solea senegalensis) Mx promoter, Fish Shellfish Immunol. 35 (2013) 1642–1648. [24] D. Alvarez-Torres, M.C. Alonso, E. Garcia-Rosado, B. Collet, J. Béjar, Differential response of the Senegalese sole (Solea senegalensis) Mx promoter to viral infections in two salmonid cell lines, Vet. Immunol. Immunopathol. 161 (2014) 251–257. [25] N.A. Ballesteros, M. Alonso, S. Rodriguez Saint-Jean, S.I. Perez-Prieto, An oral DNA vaccine against infectious haematopoietic necrosis virus (IHNV) encapsulated in alginate microspheres induces dose-dependent immune responses and significant protection in rainbow trout (Oncorhynchus mykiss), Fish Shellfish Immunol. 45 (2015) 877–888. [26] R. Leiva-Rebollo, A.M. Labella, J.J. Borrego, D. Castro, Immune gene expression in gilthead seabream (Sparus aurata) after Lymphocystis disease virus (LCDV-Sa) challenge resulting in asymptomatic infection, J. Appl. Microbiol. (2019), https:// doi.org/10.1111/jam.14454.
8