Comparative and genetic analysis of the porcine glucocerebrosidase (GBA) gene

Comparative Biochemistry and Physiology, Part B 138 (2004) 377 – 383 www.elsevier.com/locate/cbpb

Comparative and genetic analysis of the porcine glucocerebrosidase (GBA) gene Antonı´n Stratil a,*, Daniel Wagenknecht a, Mario Van Poucke b, Svatava Kubı´cˇkova´ c, Heinz Bartenschlager d, Petra Musilova´ c, Jirˇ´ı Rubesˇ c, Hermann Geldermann d, Luc J. Peelman b a

Department of Genetics, Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Rumburska´ 89, 277 21 Libeˇchov, Czech Republic b Department of Animal Nutrition, Genetics, Breeding and Ethology, Faculty of Veterinary Medicine, Ghent University, Heidestraat 19, B-9820 Merelbeke, Belgium c Veterinary Research Institute, Hudcova 70, 621 32 Brno, Czech Republic d Department of Animal Breeding and Biotechnology, Institute of Animal Husbandry and Breeding, University of Hohenheim, Garbenstrasse 17, D-70593 Stuttgart, Germany Received 28 January 2004; received in revised form 29 April 2004; accepted 30 April 2004

Abstract The genomic sequence of the porcine (Sus scrofa) glucocerebrosidase (GBA) gene (f 5.7 kb), encoding glucocerebrosidase (glucosylceramidase; acid beta-glucosidase; EC 3.2.1.45), was determined and compared with human (Homo sapiens) GBA and GBAP (pseudogene). The porcine gene harbours 11 exons and 10 introns, and the genomic organization is identical with human GBA. The exon sequences, coding for signal peptide and mature protein, show 81% and 90% sequence identity, respectively, with the corresponding human GBA sequences. Short interspersed elements, SINEs (PREs), are present in introns 2, 4 and 7. There is no evidence of a pseudogene in pig. The deduced protein sequence of GBA consists of 39 amino acids of signal peptide (long form) and 497 amino acids of the mature protein; the latter shows 90% sequence identity with the human protein. Four polymorphisms were observed within the porcine gene: insertion/ deletion of one of the two SINEs (PREs) in intron 2 (locus PREA); deletion of a 37- to 39-bp stretch in intron 4 (one direct repeat and 5Vend of PRE); deletion of a 47-bp stretch in the middle part of PRE in intron 4 (locus PREB); and single-base transition (C – T) in intron 6 (locus HaeIII – RFLP). GBA was assigned to chromosome 4q21 by FISH and was localized to the same region by linkage analysis and RH mapping, i.e., to the chromosome 4 segment where quantitative trait loci for growth and some carcass traits are located. D 2004 Elsevier Inc. All rights reserved. Keywords: Acid beta-glucosidase; Fluorescence in situ hybridization; Gene mapping; Gene organization; Glucosylceramidase; Polymorphism; PRE; SINE; Sus scrofa

1. Introduction Glucocerebrosidase (GBA; glucosylceramidase; acid beta-glucosidase; EC 3.2.1.45), a lysosomal membrane protein that cleaves the O-beta-D-glucosidic linkage of glucosylceramide and aryl-beta-glucosides, is encoded by the GBA gene which is located on chromosome 1q21 in humans (Shafit-Zagardo et al., 1981; Barneveld et al., 1983; Ginns et al., 1985). The human (Homo sapiens) glucocer-

* Corresponding author. Tel.: +420-315-639-531; fax: +420-315-639510. E-mail address: [email protected] (A. Stratil). 1096-4959/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2004.04.021

ebrosidase cDNA was first cloned and sequenced by Sorge et al. (1985) and Tsuji et al. (1986), and the genomic sequence as well as genomic organization of the gene (GBA) and pseudogene (GBAP) was determined by Horowitz et al. (1989). The presence of the pseudogene, which shows 96% sequence identity with the functional gene and is located approximately 16 kb downstream from this, complicates the study of GBA in humans. Both the gene and the pseudogene contain 11 exons and 10 introns, but they differ in length (GBA is f 7.6-kb long, while GBAP is f 5.7-kb long). In exon 9 of GBAP, a 55-bp deletion occurs (Horowitz et al., 1989) and exactly the same deletion is found in GBA of some Gaucher’s disease patients (Beutler and Gelbart, 1993). The pseudogene is consistently tran-

378

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383

scribed, and in some cases, the level of transcription is equal to that of the functional gene (Sorge et al., 1990). However, the pseudogene harbours many point mutations and deletions that preclude it from directing synthesis of active protein (Beutler, 1993). In the human gene, numerous mutations have been described that lead to an inherited glucocerebrosidase deficiency resulting in the accumulation of glucocerebroside in various tissues, a disorder known as Gaucher’s disease (Beutler, 1993). Specific precautions are needed to avoid incidental coinvestigation of the pseudogene (Tayebi et al., 1996; Finckh et al., 1998) not only in human but also in animal species. In fact, it would be practically impossible to conclude whether the gene or pseudogene was approached without the prior knowledge of the sequence. A human GBA cDNA probe was used to search for RFLPs in porcine (Sus scrofa) GBA, and the gene was mapped to the chromosome 4 linkage group ATP1B1 – GBA – EAL (Marklund et al., 1993; Archibald et al., 1995). GBA is located in a chromosome region where QTLs for growth and some carcass traits have been found (Andersson et al., 1994; Andersson-Eklund et al., 1998; Walling et al., 2000; De Koning et al., 2001; Malek et al., 2001; Geldermann et al., 2003). However, no sequence information on porcine GBA was available prior to the present study. In humans, at least six other genes and two pseudogenes are located in the 75-kb region containing GBA (Winfield et al., 1997). The knowledge of genes in the homologous region in pigs, their structures, chromosomal and linkage positions, is important for comparative genomics and should facilitate the search for candidate or causative genes for growth and carcass traits. The aim of the present study was to sequence and study the organization of the porcine GBA gene and to compare it with the human GBA and GBAP, to search for polymorphisms by using polymerase chain reaction (PCR) and

PCR – RFLP and to study chromosomal assignment and genetic mapping.

2. Materials and methods 2.1. Polymerase chain reaction (PCR) amplification of the GBA gene The porcine (Sus scrofa) GBA gene was amplified using three pairs of PCR primers (1F-1R, 2F-2R and 3F-3R) that were designed based on the human GBA sequence (Horowitz et al., 1989; Winfield et al., 1997; EMBL accession numbers J03059; AF023268; NCBI NM_000157) as well as from the porcine sequence that we determined (EMBL AJ575649). Another pair of primers (4F-4R) was used to identify a BAC clone (Rogel-Gaillard et al., 1999) containing GBA, and two other pairs of primers (5F-2R and 6F-6R) were used to study polymorphisms. The primers and some additional information are presented in Table 1. PCR was performed with LA polymerase (Top Bio; Prague, Czech Republic), except for the 5F-2R and 4F-4R combinations when Taq polymerase was used. PCR with primers 3F-3R produced 4 – 5 fragments. 2.2. Cloning and sequencing The PCR fragments from a Large White pig (LW21), obtained with primers 1F-1R, 2F-2R and 3F-3R, were subcloned in pUC18 (SureClone Ligation Kit; Pharmacia Biotech; Uppsala, Sweden), pBluescript or pT-Advantage (Clontech; Palo Alto, CA, USA) and were sequenced using an ALFexpress Sequencing System (Pharmacia Biotech). Four fragments were cloned from the 3F-3R PCR product and a fragment corresponding to GBA was identified by sequencing. Several fragments from other pigs, obtained with different PCR primers, were also cloned and sequenced to study polymorphic differences. The fragment containing

Table 1 PCR primers used for amplification of porcine GBA gene, study of polymorphism and RH mapping Primer

Sequence (5V– 3V)

Location

Fragment size (bp)

MgCl2 (mM)

Ta (jC)

1F 1R 2F 2R 3F 3R 4F 4R 5F 2R 6F 6R

CTCACAGGATTGCTTCTACTT GATCACTGGCATGATTTAGTT TCAGCCGCTATGAGAGTACAC GGCGGACATTGTGGTGAGTAC CTTTCTGGCCATGATCACTCATAC CCTGCTGTGCCCTCTTTAGTC TAAGCGAGCCAAGGAGGA GCTATACCCACCCCACCA CCAGACCTGGGCCAGATACTT see above TTGGCCCTGACTTAGACATAA GCACCCGGATGATATTGTA

human exon 2 porcine intron 3 human exon 3 human exon 7 porcine intron 6 human exon 11 porcine intron 2 porcine intron 2 human exon 6

1185a

2.0

55

2061a

1.5

55

2370b

2.0

55

151

2.0

60

455

2.0

57

404a

2.5

55

a b

porcine intron 4 porcine exon 5

In fragments 1F-1R, 2F-2R and 6F-6R, length polymorphisms were found (see the Results section). About 4 – 5 fragments were amplified, but only the 2370-bp fragment corresponded to GBA (determined by sequencing).

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383

a part of exon 1, complete intron 1 and a part of exon 2 was obtained from a BAC clone (clone number 280D6; Large White pig; INRA, Jouy-en-Josas, France) that was identified by PCR with primers 4F-4R. The BAC clone was digested with BamHI, blotted onto a nylon membrane and probed with the PCR-generated probe (primers 4F-4R). The positive fragment was cloned and sequenced. 2.3. Detection of polymorphisms in PCR fragments The length polymorphism in PCR fragments 1F-1R was studied by 1.0% agarose gel electrophoresis of the PCR products. Two length polymorphisms in PCR fragments 6F-6R were studied by electrophoresis of the PCR fragments (2.0% agarose) and after digestion with BamHI (2.5% agarose) as well as by sequencing of the cloned 6F-6R PCR fragments (using TOPO TA Cloning Kit; Invitrogen; Carlsbad, CA, USA). Polymorphism in PCR fragments 5F-2R was analysed after double digestion with HaeIII/KpnI by electrophoresis in 2.5% agarose gel. The Hohenheim Meishan  Pie´ train (M  P) and Wild Boar  Pie´train (W  P) pedigrees (Geldermann et al., 1999) were used to study the inheritance of the polymorphisms. Allele frequencies were calculated for unrelated pigs of different breeds (Large White, Landrace, Pie´train, Black Pied Prestice, Czech Meat Pig, Hampshire and Meishan). 2.4. Linkage and radiation hybrid mapping Linkage mapping was performed in the Hohenheim M  P pedigree (Geldermann et al., 1999) using CRIMAP software package, version 2.4 (Green et al., 1990). The chrompic option was used to check the F2 generation for unlikely recombinants and potential genotyping errors. The INRA-University of Minnesota porcine Radiation Hybrid panel (IMpRH) was used for radiation hybrid mapping (Yerle et al., 1998; Hawken et al., 1999). A panel of 118 hybrid clones was screened by PCR using 5F-2R primers. The results were analyzed by the IMpRH mapping tool at the IMpRH server (http://imprh.toulouse.inra.fr).

379

2.5. Fluorescence in situ hybridization (FISH) The recombinant plasmid containing an f 2-kb PCR fragment (primers 2F-2R) was labeled with biotin-14-dATP by nick translation (Gibco BRL, Life Technologies; Rockville, MD, USA) and used for standard FISH (Trask, 1991). Immunodetection and amplification were performed using avidin-FITC and antiavidin biotin. Chromosomes were counterstained with propidium iodide and DAPI (Sigma; St. Louis, MO, USA) and were identified by help of computer-generated reverse DAPI banding.

3. Results and discussion 3.1. PCR amplification, subcloning and sequence analysis of GBA gene By using PCR primers 1F-1R, 2F-2R and 3F-3R in PCR on porcine genomic DNA, we were able to amplify overlapping fragments of GBA, from exon 2 to the 3VUTR in exon 11. We did not succeed in designing gene-specific primers to amplify the part of the gene covering exons 1 and 2 and intron 1; therefore, a fragment with this sequence was obtained from the BAC clone no. 280D6. The PCR fragments and the BAC fragment were subcloned and the complete sequence of 5687 bp was determined. The sequence (without the primer 3R sequence) was deposited in the EMBL database under accession number AJ575649. The sequence was compared with the human GBA gene and the exon/intron organization was deduced (Fig. 1), with 11 exons and 10 intervening introns confirmed in the porcine gene. All introns contain GT/AG consensus sequences for splicing. The sequence coding for the complete signal peptide and mature protein was determined. There are two ATG start codons in the signal sequence in exactly the same positions as in humans (Sorge et al., 1987), i.e., at 55 to 57 nt and 115 to 117 nt of the coding sequence, respectively, while in the mouse, only one ATG start codon (at 55 to 57 nt) is present (O’Neill et al., 1989). In humans, both ATG codons can be used to encode the enzyme. The two porcine ATG codons are in exon 1 and

Fig. 1. Diagram showing the genomic organization of porcine GBA gene. Exons are shown as open boxes and introns as horizontal lines. The sizes of exons and introns (in bp) are given. The solid boxes indicate the positions of SINEs (PREs) in introns 2, 4 and 7. *Length polymorphism (insertion/deletion) in introns 2 and 4. The positions of start codon, start of mature protein and stop codon are indicated.

380

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383

2, respectively; coding of mature protein begins in exon 3 (deduced based on the human GBA sequence). The exon sequences coding for signal peptide contain 117 nt (long form) and sequences for mature protein harbour 1491 nt (stop codon is not included). The coding exon sequences have exactly the same lengths as of the humans’. The porcine sequences for signal peptide and mature protein show 81% and 90% identity with the human sequences (NCBI NM_000157), respectively. The identity of porcine coding sequence with the human pseudogene (GBAP; EMBL J03060; Horowitz et al., 1989) is 87%. The deduced signal peptide (long form) and mature protein contain 39 and 497 amino acids, respectively, and share 79% and 90% sequence identity, respectively, with the human protein. The positions of five potential glycosylation sites are conserved in the two species. In the porcine GBA, short interspersed elements, SINEs (PREs), are present in introns 2, 4 and 7 (EMBL AJ575649; AJ575650). In intron 2, either one or two PRE sequences were found (EMBL AJ575650; see below). Both PREs are inverted compared with the porcine consensus sequence (Brenig, 1999). The first PRE is not flanked by direct repeats and does not contain any poly(T) sequence. The second PRE is flanked by direct repeats (tccaagagaattttt) and contains a poly(T) sequence. A stretch of additional 65 nt, exhibiting repetitive motifs, is inserted after the poly(T). The PRE in intron 4 is also inverted and is flanked by an imperfect direct repeat (cat/ catcttggtcttt). In this PRE, two length polymorphisms were detected (see below). The PRE in intron 7 is also inverted and is flanked by an imperfect direct repeat (ccctgccc/tcaact). The positions of the porcine SINEs compare well with those of human SINEs (Alus): in intron 2, one Alu; in intron 4, two Alus; in intron 6, one complete Alu and the 5Vend of another inverted Alu sequence; and in intron 7, two Alus are present, while in human GBAP, one Alu sequence is present only in intron 7 (Horowitz et al., 1989). Porcine PREs and human Alus are two different classes of SINEs and have no evolutionary relationship. Similar positions in the two species can be explained by coincidence, probably as a consequence of unstable gene regions and/or absence of functional significance of the regions. Marklund et al. (1993) observed two constant restriction fragments (3.9 and 1.9 kb) and three different allelic fragments (1.45, 1.40 and 1.1 kb) after digestion of porcine genomic DNA with TaqI and hybridization with a human GBA cDNA probe (2.2 kb). The total length of the fragments varied between 6.90 and 7.25 kb (other short fragments were not observed). With the knowledge of the complete genomic sequence of porcine GBA, we can conclude that the total length of the RFLP fragments corresponds well with the total length of our GBA sequence, indicating that there is a single GBA gene in the pig. Moreover, when amplifying porcine GBA by several pairs of PCR primers we observed only frag-

ments with sequences corresponding to GBA. Based on these results and the results of the study of GBA polymorphism (see below), it can be concluded that a single GBA gene is most likely present in the pig and that a GBA pseudogene does not occur in this species. The mouse genome apparently does not contain a glucocerebrosidase pseudogene either (NCBI AY115108; O’Neill et al., 1989), while in humans and some primates (chimpanzee and gorilla), a pseudogene is present (Horowitz et al., 1989; Martı´nez-Arias et al., 2001). The primate pseudogene is also characterized by a 55-bp deletion in exon 9, as in humans. This indicates that the duplication of GBA happened during primate evolution. 3.2. Polymorphism, Mendelian inheritance and allele frequencies Polymorphisms were detected in three regions of the porcine gene by PCR and PCR –RFLP: (a) Insertion/deletion of a second SINE (PRE) plus 65 nt after the poly(T) stretch and one direct repeat in intron 2, corresponding to nucleotides 812 –1149 (i.e., 338 nt) of EMBL AJ575650 (locus PREA). This polymorphism was studied by PCR with primers 1F-1R and subsequent agarose gel electrophoresis (Fig. 2). An allele with two PRE sequences is designated L (for long; EMBL AJ575650) and the other allele with one PRE is designated S (for short; it is encompassed in the sequence of EMBL AJ575649). (b) Deletion of a 37- to 39-bp stretch in the 5V end of the SINE (PRE) in intron 4 (EMBL AJ575653) or deletion of a 47-bp stretch in the middle part of the PRE (EMBL AJ575654; locus PREB). PCR primers 6F-6R were used (Table 1) to study this region and 17 clones in total from six pigs were sequenced. Some base replacements and a small variation in the numbers of T bases (at the 5V end of the PRE) occurred as well. Sequences showing these indel polymorphisms are accessible in EMBL (AJ575649; AJ575651; AJ575652; AJ575653;

Fig. 2. Agarose gel electrophoresis (1.0%) showing length polymorphism in PCR fragments (amplified with primers 1F-1R) at PREA locus (SINE in intron 2) of porcine GBA. The genotypes (LL, LS, SS) are given at the top of each lane. M, marker GeneRuler 100 bp DNA Ladder Plus (MBI Fermentas; Vilnius, Lithuania); h, heteroduplex.

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383

381

Table 2 Allele frequencies at three loci (PREA, PREB and HaeIII – RFLP) of the porcine GBA gene Breed

Large White Landrace Pie´train Black Pied Prestice Czech Meat Pig Hampshire Meishan

n

14 12 19 7 14 6 12

PREA

PREB

HaeIII – RFLP

L

S

A

B

C

A

B

0.50 0.50 0.55 0.21 0.32 0.67 0.00

0.50 0.50 0.45 0.79 0.68 0.33 1.00

0.86 0.96 0.76 0.64 0.89 0.92 0.42

0.14 0.04 0.24 0.36 0.11 0.08 0.08

0.00 0.00 0.00 0.00 0.00 0.00 0.50

0.04 0.04 0.03 0.00 0.07 0.00 0.33

0.96 0.96 0.97 1.00 0.93 1.00 0.67

interpreted as a two-locus polymorphism, it is more convenient to apply a single-locus model. Here we designate the locus PREB, and alleles A (length, 404–

Fig. 3. (a) Agarose gel electrophoresis (2.0%; agarose Lachema; Brno, Czech Republic) showing length polymorphism in PCR fragments (primers 6F-6R) at PREB locus of porcine GBA. The genotypes (AA, BB, CC, AB, AC and BC) are given at the top of each lane. Homozygotes BB and CC cannot be distinguished under these conditions. The slowest bands in heterozygotes are heteroduplexes (h); they were not visible when NA agarose (Pharmacia Biotech; Uppsala, Sweden) was used. (b) Electrophoresis (2.5% agarose Lachema) of the same PCR products as in panel a, following digestion with BamHI. The genotypes are shown. In heterozygotes, heteroduplexes (h) are visible, except for the BC heterozygote (it can be overlapped with another band).

AJ575654). Electrophoretic separation of the PCR fragments alone and after BamHI digestion is shown in Fig. 3a,b. Although this genetic variation could be

Fig. 4. Agarose gel electrophoresis (2.5%) showing polymorphism in PCR fragments of GBA (primers 5F-2R) after digestion with HaeIII/KpnI (locus HaeIII – RFLP). The genotypes (AA, AB and BB) are shown at the top of the lanes. M, marker GeneRuler 100 bp DNA Ladder (MBI Fermentas); PCR, undigested PCR product. Additional short fragments (11, 27, 28 and 35 bp) are not visible on the gel.

Fig. 5. Comparison of the linkage and RH maps of the V-ATPase—ABCD3 region on chromosome 4q showing position of GBA. Distances in the linkage map are in Kosambi cM and in the IMpRH map in cR.

382

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383

406 bp using 6F-6R primers; no deletion), B (length, 367 bp; deletion of the direct repeat and the bases at the 5Vend of PRE; in total, 37 –39 bp), and C (length, 358– 359 bp; deletion of 47 bp in the middle part of PRE). The differences in the lengths of the PCR fragments (allele A versus alleles B and C) are of sufficient magnitude to be detected in agarose gel electrophoresis. Moreover, when agarose from Lachema (Brno, Czech Republic) was used and electrophoresis was run for a longer time, clear heteroduplexes were observed in heterozygotes (having the slowest mobility). The heteroduplex is taken to mean a double-stranded fragment composed of two complementary strands, one of which harbours the deletion (i.e., alleles A + B and A + C ) or the deletions are in different positions in the two strands (i.e., B + C). Heteroduplexes also occurred when a mixture of DNAs from different homozygotes was used for PCR. Heteroduplexes were also present in the patterns of heterozygotes after digestion with BamHI (overlapping with another band apparently occurs in heterozygote BC ). (c) Single-base transition in intron 6 (nt 3285 C –T of EMBL AJ575649). This polymorphism was studied in the PCR fragment 5F-2R following digestion with HaeIII/KpnI and electrophoresis in agarose gel (Fig. 4; HaeIII reveals the polymorphism, KpnI removes overlapping of some bands). The locus is designated HaeIII –RFLP and alleles A (diagnostic fragment 190 bp) and B (the fragment is cut to 162- and 28-bp fragments). Codominant inheritance of all three polymorphisms was confirmed in the Hohenheim W  P and M  P pedigrees. Allele frequencies in the three loci in pigs of different breeds are presented in Table 2. No regularity in allele combinations could be observed in different breeds of pigs, indicating that the mutations happened in different periods of porcine evolution. 3.3. Mapping of porcine GBA The HaeIII/KpnI polymorphism was used to integrate the GBA gene in the linkage map of chromosome 4 in the Hohenheim M  P pedigree. A partial sex-averaged linkage map of the chromosome region of interest is shown in Fig. 5. A partial RH map for the same chromosome region is also shown in Fig. 5. GBA was most significantly linked to SW270 (31 cR; LOD = 11.91). The positions of some other genes are also shown in the map and both the linkage and RH maps are compared. It is confirmed that the entire segment corresponding to human chromosome 1 is inverted in the pig (Archibald et al., 1995; Blazˇkova´ et al., 2000; Rink et al., 2002) and the order of the genes is conserved in both species (except for IVL and CHRNB2). In FISH, a hybridization signal with the porcine GBA plasmid clone was observed on chromosome 4q21 (Fig. 6).

Fig. 6. Fluorescence in situ hybridization with the porcine GBA plasmid clone to a porcine metaphase. One double and one single signal are shown (indicated by arrows) on chromosome 4q21.

No paired signal was repeatedly detected on any other chromosomal region. Assignments of porcine GBA to chromosome 4q21 (FISH) and to chromosome 4 linkage group (linkage and RH mapping) are in good agreement with the heterologous chromosome painting showing the correspondence of the porcine chromosome 4 segment with the human chromosome 1 segment (Rettenberger et al., 1995; Fro¨nicke et al., 1996; Goureau et al., 1996). As GBA is localized in the QTL region of porcine chromosome 4 (Andersson et al., 1994; Geldermann et al., 2003), the polymorphisms detected can be used for association studies with these QTLs as well as for other genetic studies.

Acknowledgements We greatly appreciate Drs. Martine Yerle and Denis Milan (INRA, Castanet-Tolosan, France) for providing the IMpRH panel and Dr Patrick Chardon (INRA, Jouy-enJosas, France) for providing the BAC library. Dr. Michal Kopecˇny´ is thanked for useful discussions. We acknowledge the expert technical assistance of Marie Datlova´, Marc Mattheeuws and Dominique Vander Donckt. This research was supported by the Grant Agency of the Czech Republic (Grant no. 523/00/0669) and Grant Agency of the Ministry of Agriculture of the Czech Republic (MZE-M03-99-1).

References Andersson, L., Haley, C.S., Ellegren, H., Knott, S.A., Johansson, M., Andersson, K., Andersson-Eklund, L., Edfors-Lilja, I., Fredholm, M., Hansson, I., Hakansson, J., Lundstro¨m, K., 1994. Genetic mapping of quantitative trait loci for growth and fatness in pigs. Science 263, 1771 – 1774.

A. Stratil et al. / Comparative Biochemistry and Physiology, Part B 138 (2004) 377–383 Andersson-Eklund, L., Marklund, L., Lundstro¨m, K., Haley, C.S., Andersson, K., Hansson, I., Moller, M., Andersson, L., 1998. Mapping quantitative trait loci for carcass and meat quality traits in a Wild Boar  Large White intercross. J. Anim. Sci. 76, 694 – 700. Archibald, A.L., Haley, C.S., Brown, J.F., Couperwhite, S., McQueen, H.A., Nicholson, D., Coppieters, W., Van de Weghe, A., Stratil, A., Winterø, A.K., et al., 1995. The PiGMaP consortium linkage map of the pig (Sus scrofa). Mamm. Genome 6, 157 – 175. Barneveld, R.A., Keijzer, W., Tegelaers, F.P., Ginns, E.I., Geurts van Kessel, A., Brady, R.O., Barranger, J.A., Tager, J.M., Galjaard, H., Westerveld, A., Reuser, A.J., 1983. Assignment of the gene coding for human beta-glucocerebrosidase to the region q21 – q31 of chromosome 1 using monoclonal antibodies. Hum. Genet. 64, 227 – 231. Beutler, E., 1993. Gaucher disease as a paradigm of current issues regarding single gene mutations of humans. Proc. Natl. Acad. Sci. U. S. A. 90, 5384 – 5390. Beutler, E., Gelbart, T., 1993. Gaucher disease mutations in non-Jewish patients. J. Haematol. 85, 401 – 405. Blazˇkova´, P., Kopecˇny´, M., Fontanesi, L., Stratil, A., Davoli, R., Reiner, G., Geldermann, H., 2000. Linkage assignments of the porcine ATP1A2, ATP1B1 and V-ATPase (CGI-11) genes to chromosome 4. Anim. Genet. 31, 416 – 418. Brenig, B., 1999. Conserved nucleotide differences and subfamily structure of porcine short interspersed elements. Anim. Genet. 30, 120 – 125. De Koning, D.J., Rattink, A.P., Harlizius, B., Groenen, M.A.M., Brascamp, E.W., van Arendonk, J.A.M., 2001. Detection and characterization of quantitative trait loci for growth and reproduction traits in pigs. Livest. Prod. Sci. 72, 185 – 198. Finckh, U., Seeman, P., von Widdern, O.C., Rolfs, A., 1998. Simple PCR amplification of the entire glucocerebrosidase gene (GBA) coding region for diagnostic sequence analysis. DNA Seq. 8, 349 – 356. Fro¨nicke, L., Chowdhary, B.P., Scherthan, H., Gustavsson, I., 1996. A comparative map of the porcine and human genomes demonstrates ZOO-FISH and gene mapping-based chromosomal homologies. Mamm. Genome 7, 285 – 290. Geldermann, H., Moser, G., Mu¨ller, E., Beeckmann, P., Yue, G., Dragos, M., Bartenschlager, H., Cepica, S., Stratil, A., Schro¨ffel, J., 1999. Status of genome and QTL mapping in pigs—data of Hohenheim F2 families. Arch. Tierz., Dummerstorf 42, 67 – 81. Geldermann, H., Mu¨ller, E., Moser, G., Reiner, G., Bartenschlager, H., Cepica, S., Stratil, A., Kuryl, J., Moran, C., Davoli, R., Brunsch, C., 2003. Genome-wide linkage and QTL mapping in porcine F2 families generated from Pietrain, Meishan and Wild Boar crosses. J. Anim. Breed. Genet. 120, 363 – 393. Ginns, E.I., Choudary, P.V., Tsuji, S., Martin, B., Stubblefield, B., Sawyer, J., Hozier, J., Barranger, J.A., 1985. Gene mapping and leader polypeptide sequence of human glucocerebrosidase: implications for Gaucher disease. Proc. Natl. Acad. Sci. U. S. A. 82, 7101 – 7105. Goureau, A., Yerle, M., Schmitz, A., Riquet, J., Milan, D., Pinton, P., Frelat, G., Gellin, J., 1996. Human and porcine correspondence of chromosome segments using bidirectional chromosome painting. Genomics 36, 252 – 262. Green, P., Falls, K., Crooks, S., 1990. Documentation for CRI-MAP, Version 2.4. Washington Univ. School of Medicine, St. Louis, MO polycopy. Hawken, R.J., Murtaugh, J., Flickinger, G.H., Yerle, M., Robic, A., Milan, D., Gellin, J., Beattie, C.W., Schook, L.B., Alexander, L.J., 1999. A first-generation porcine whole-genome radiation hybrid map. Mamm. Genome 10, 824 – 830. Horowitz, M., Wilder, S., Horowitz, Z., Reiner, O., Gelbart, T., Beutler, E., 1989. The human glucocerebrosidase gene and pseudogene: structure and evolution. Genomics 4, 87 – 96. Malek, M., Dekkers, J.C.M., Lee, H.K., Baas, T.J., Rothschild, M.F., 2001.

383

A molecular genome scan analysis to identify chromosomal regions influencing economic traits in the pig: I. Growth and body composition. Mamm. Genome 12, 630 – 636. Marklund, L., Wintero¨, A.K., Thomsen, P.D., Johansson, M., Fredholm, M., Gustafsson, U., Andersson, L., 1993. A linkage group on pig chromosome 4 comprising the loci for blood group L, GBA, ATP1B1 and three microsatellites. Anim. Genet. 24, 333 – 338. Martı´nez-Arias, R., Calafell, F., Mateu, E., Comas, D., Andre´s, A., Bertranpetit, J., 2001. Sequence variability of a human pseudogene. Genome Res. 11, 1071 – 1085. O’Neill, R.R., Tokoro, T., Kozak, C.A., Brady, R.O., 1989. Comparison of the chromosomal localization of murine and human glucocerebrosidase genes and of the deduced amino acid sequences. Proc. Natl. Acad. Sci. U. S. A. 86, 5049 – 5053. Rettenberger, G., Klett, C., Zechner, U., Kunz, J., Vogel, W., Hameister, H., 1995. Visualization of the conservation of synteny between humans and pigs by heterologous chromosomal painting. Genomics 26, 372 – 378. Rink, A., Santschi, E.M., Eyer, K.M., Roelofs, B., Hess, M., Godfrey, E.K., Karajusuf, E.K., Yerle, M., Milan, D., Beattie, C.W., 2002. A first-generation EST RH comparative map of the porcine and human genome. Mamm. Genome 13, 578 – 587. Rogel-Gaillard, C., Bourgeaux, N., Billault, A., Vaiman, M., Chardon, P., 1999. Construction of a swine BAC library: application to the characterization and mapping of porcine type C endoviral elements. Cytogenet. Cell Genet. 85, 205 – 211. Shafit-Zagardo, B., Devine, E.A., Smith, M., Arredondo-Vega, F., Desnick, R.J., 1981. Assignment of the gene for acid beta-glucosidase to human chromosome 1. Am. J. Hum. Genet. 33, 564 – 575. Sorge, J., West, C., Westwood, B., Beutler, E., 1985. Molecular cloning and nucleotide sequence of human glucocerebrosidase cDNA. Proc. Natl. Acad. Sci. U. S. A. 82, 7289 – 7293. Sorge, J.A., West, C., Kuhl, W., Treger, L., Beutler, E., 1987. The human glucocerebrosidase gene has two functional ATG initiator codons. Am. J. Hum. Genet. 41, 1016 – 1024. Sorge, J., Gross, E., West, C., Beutler, E., 1990. High level transcription of the glucocerebrosidase pseudogene in normal subjects and patients with Gaucher disease. J. Clin. Invest. 86, 1137 – 1141. Tayebi, N., Cushner, S., Sidransky, E., 1996. Differentiation of the glucocerebrosidase gene from pseudogene by long-template PCR: implications for Gaucher disease. Am. J. Hum. Genet. 59, 740 – 741. Trask, B.J., 1991. DNA sequence localization in metaphase and interphase cells by fluorescence in situ hybridization. Methods Cell Biol. 35, 3 – 35. Tsuji, S., Choudary, P.V., Martin, B.M., Winfield, S., Barranger, J.A., Ginns, E.I., 1986. Nucleotide sequence of cDNA containing the complete coding sequence for human lysosomal glucocerebrosidase. J. Biol. Chem. 261, 50 – 53. Walling, G.A., Visscher, P.M., Andersson, L., Rothschild, M.F., Wang, L., Moser, G., Groenen, M.A.M., Bidanel, J.-P., Cepica, S., Archibald, A.L., Geldermann, H., de Koning, D.J., Milan, D., Haley, C.S., 2000. Combined analyses of data from quantitative trait loci mapping studies: chromosome 4 effects on porcine growth and fatness. Genetics 155, 1369 – 1378. Winfield, S.L., Tayebi, N., Martin, B.M., Ginns, E.I., Sidransky, E., 1997. Identification of three additional genes contiguous to the glucocerebrosidase locus on chromosome 1q21: implications for Gaucher disease. Genome Res. 7, 1020 – 1026. Yerle, M., Pinton, P., Robic, A., Alfonso, A., Palvadeau, Y., Delcros, C., Hawken, R., Alexander, L., Beattie, C., Schook, L., Milan, D., Gellin, J., 1998. Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs. Cytogenet. Cell Genet. 82, 182 – 188.