Comparative Genetic and Physiological Studies of the MAP Kinase Mpk1p from Kluyveromyces lactis and Saccharomyces cerevisiae

doi:10.1006/jmbi.2000.3916 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 300, 743±758

Comparative Genetic and Physiological Studies of the MAP Kinase Mpk1p from Kluyveromyces lactis and Saccharomyces cerevisiae Lutz Kirchrath1, Anja Lorberg2, Hans-Peter Schmitz2, Ute Gengenbacher2 and JuÈrgen J. Heinisch2* 1

Amersham Pharmacia Biotech Munzinger-Str. 9 79021, Freiburg, FRG 2 Institut fuÈr Mikrobiologie Heinrich-Heine-UniversitaÈt DuÈsseldorf UniversitaÈtsstr.1 Geb.: 26.12, D-40225 DuÈsseldorf, FRG

MAP kinases are essential components of signal transduction pathways in yeasts and higher eukaryotes. Here, we report on the isolation of the gene encoding the MAP kinase KlMpk1p by complementation of the respective Saccharomyces cerevisiae deletion mutant with a genomic library from Kluyveromyces lactis. Sequencing revealed the presence of an open reading frame capable of encoding a protein of 520 amino acid residues with a deduced molecular mass of 59.726 Da. The deduced protein sequence displayed a high degree of similarity to known MAP kinases from yeast to man, with an overall identity of 70 % to ScMpk1p. Onehybrid analysis demonstrated the presence of a cryptic transcriptional activation domain in the C-terminal part of the protein. Deletion of this sequence in ScMpk1p resulted in a reduced MAP kinase activity (measured by an indirect assay), an increased sensitivity towards caffeine and an increased resistance against Calco¯uor white. Complete deletion mutants of Klmpk1 display an osmo-remedial phenotype on rich medium, but are capable of growth in the absence of osmotic stabilization on synthetic medium. As Scmpk1 deletion mutants, they are sensitive to cell surface destabilizing agents such as Calco¯uor white and SDS, and growth is inhibited in the presence of 5 mM caffeine. Overexpression of KlMPK1 did not produce a growth defect in S. cerevisiae or in K. lactis. # 2000 Academic Press

*Corresponding author

Keywords: signal transduction; protein kinase C pathway; MAP kinases; yeast; cellular integrity

Introduction Responses to extracellular signals in eukaryotic organisms are frequently mediated by the action of protein kinase cascades, resulting in changes in transcriptional activity of a set of target genes. In the yeast Saccharomyces cerevisiae, a variety of such responses (like pheromone action, pseudohyphal development, reaction to either hyper- or hypoosmotic growth conditions, and induction of sporulation) are transmitted by MAP kinases (for recent reviews, see Widmann et al., 1999; Gustin et al., 1998; Banuett, 1998). In this context cellular integrity and the response to high temperature and hypoosmotic conditions are mediated by the sole yeast homologue of mammalian protein kinase C (Pkc1p), which triggers a phosphorylation cascade E-mail address of the corresponding author: [email protected] 0022-2836/00/040743±16 $35.00/0

involving sequentially Bck1p, Mkk1p/Mkk2p and Mpk1p (reviewed by Heinisch et al., 1999). The gene MPK1/SLT2, encoding the MAP kinase of this pathway in S. cerevisiae, has been isolated and characterized by several groups (Torres et al., 1991; Lee et al., 1993; Martin et al., 1993; Mazzoni et al., 1993). Null mutants were reported to cause a growth defect at 37  C (Martin et al., 1993) and an impairment in polarized cell growth (Mazzoni et al., 1993). Mpk1p was placed in a signalling cascade downstream of protein kinase C, with defects in either of the intermediate components resulting in cell lysis at elevated temperatures, which can be counteracted by osmotic stabilization (i.e. addition of 1 M sorbitol to the medium; Lee et al., 1993). Mpk1p is activated after heat-shock (Kamada et al., 1995; Zarzov et al., 1996) and by compounds like caffeine and Calco¯uor white (Ketela et al., 1999; Martin et al., 2000). The pathway was shown to be activated upon hypotonic shock (Davenport et al., # 2000 Academic Press

744 1995). It proved to be involved in cell-cycle regulation (Marini et al., 1996), control of bud emergence (Gray et al., 1997) and mating (Buehrer & Errede, 1997). Recently, Mpk1p has been implicated in the control of mitosis and calcineurin signalling (Mizunuma et al., 1998). It has been postulated that the phosphorylated, hence active, form of Mpk1p is localized in the nucleus (Mattisson et al., 1999). Deactivation of Mpk1p activity has been proposed to be mediated by a speci®c phosphatase, which is encoded by the MSG5 gene (Martin et al., 2000). Despite the large number of processes controlled directly or indirectly by Mpk1p, only two targets of this MAP kinase have been described so far. Thus Rlm1p, a member of the MADS box transcription factors, was isolated as a suppressor of a hyperactive allele of MKK1 (Watanabe et al., 1995) and shown to be a direct target of Mpk1p (Dodou & Treisman, 1997; Watanabe et al., 1997). SBF (a transcriptional activation complex consisting of Swi4p and Swi6p) was described as another Mpk1p target, providing the relation to cell-cycle control (Madden et al., 1997). The function in maintenance of cellular integrity was further con®rmed by the ability of multicopy vectors carrying MPK1 to complement the phenotypes of bck1 null mutants (Lee et al., 1993), and partially the defects caused by a slg1 (ˆhcs77, ˆ wsc1) deletion (Jacoby et al., 1998), with SLG1 encoding a putative sensor of the Pck1p-mediated pathway located at the cell surface (Gray et al., 1997; Verna et al., 1997). A second putative sensor with structural similarities to Slg1p, which is encoded by MID2, has been described recently (Rajavel et al., 1999; Ketela et al., 1999). The Mpk1p domain structure has been studied in some detail. It contains at the N-terminal end a glycine-rich region thought to constitute the ATPbinding site, followed in the more central part of the protein by a TEY sequence carrying the phosphorylation targets, a DEP motif at the end of the conserved kinase domain, followed by a glutamine-rich region and a stretch of 16 consecutive glutamine residues (see Soler et al., 1995, and references therein). Mpk1p is activated by phosphorylation of the tyrosine residue mentioned above, by a redundant pair of protein kinases encoded by MKK1/MKK2 (Irie et al., 1993). The C-terminal end of the protein containing the glutamine-rich stretch was shown to be capable of transcriptional activation when fused to the Gal4p DNA-binding domain. On the other hand, it seemed to be dispensable for Mpk1p function in vivo (Soler et al., 1995). For the milk yeast, Kluyveromyces lactis, little is known about signal transduction mechanisms involving MAP kinase cascades. We have recently succeeded in isolating the K. lactis gene encoding a homologue of BCK1 (called KlBCK1; Jacoby et al., 1999). To our surprise, null mutants in Klbck1 did not result in any phenotype resembling the cellwall defects observed for the respective mutants in

K. lactis MAP Kinase

S. cerevisiae. This could be explained either by redundancies in the pathway or by a completely different function for this conserved kinase cascade in K. lactis. To shed some light on this puzzling behaviour, we decided to clone and characterize the K. lactis homologue of MPK1. As Klmpk1 null mutants, in contrast to Klbck1 deletions, are sensitive to caffeine and Calco¯uor white, the results presented here suggest a similar function for the MAP kinase in K. lactis and S. cerevisiae.

Results Isolation of KlMPK1 S. cerevisiae mutants with a deletion in the MPK1 coding sequence show impaired growth at 30  C (even more pronounced at 37  C) in the absence of osmotic stabilization and are sensitive to caffeine. We used the latter phenotype to isolate a complementing clone from a K. lactis genomic library (see Experimental Procedures for details). Transformants were shown to grow in the absence of osmotic stabilization and on YEPD/5 mM caffeine. The complementing plasmid was termed KEp6KlMPK1 and was used for further analysis (see Figure 1 for a restriction map). Digestion with SalI and re-ligation resulted in a clone (termed KlMPK1-SR) not able to complement the mpk1 deletion, suggesting that the complementing sequence was either disrupted or completely absent from this clone. Further subcloning in the S. cerevisiae/ E. coli shuttle vector YEp352 revealed that the complementing sequence was contained within a 3.4 kb EcoRI/BamHI fragment. The latter subclone (pJJH576) conferred better growth to YJJ3-2A than did the original isolate KEp6-KlMPK1 (data not shown). This may be attributed to the use of the 2mm vector YEp352, which leads to a more stable inheritance in S. cerevisiae than the KEp6 vector usually used for propagation in K. lactis. Sequence analysis of KlMPK1 By subcloning into suitable vectors and the use of custom-made oligonucleotides, we determined the complete sequence of the EcoRI/BamHI fragment (GenBank accession number AF226711; note that part of the sequence, spanning codons 246329, has been entered into the databases as a random sequence tag, accession number AJ229877, by Ozier-Kalogeropoulos et al., 1998). We found an open reading frame with the capacity to code for a protein of 520 amino acid residues, with a molecular mass of 59,726 Da. The results of an alignment of the deduced amino acid sequences between this open reading frame and some selected MAP kinases are given in Figure 2(a). The deduced amino acid sequences of ScMpk1p and KlMpk1p showed a high level of overall identity (70 %), with the N-terminal two-thirds of the protein displaying an 85 % amino acid identity. For this reason, and its ability to complement the defects of the

K. lactis MAP Kinase

745

Figure 1. (a) Restriction map of genomic fragment isolated from the KEp6-based library. SalI and HindIII at the borders designate sites of the vector to indicate the orientation of the genomic DNA insertion. The EcoRI/BamHI fragment used for sequencing and subcloned into YEp352 to yield pJJH576 is shaded and enlarged. Black arrows indicate the respective open reading frames throughout the Figure. (b) Expression cassette of KlMPK1 under the control of the GAL1/10 promoter. GAL1/10p ˆ GAL1/10-promoter. (c) Fragments of KlMPK1 tested for transcriptional activation in the one-hybrid assay. Vectors carrying the respective insertions are given in parentheses. Identical segments of KlMPK1 are vertically aligned and shaded in gray. Flanking regions to KlMPK1 are not drawn according to scale. Also compare with Figure 2 for protein domains. ADH1p ˆ ADH1 promoter. Vector designations are given, with the basic vectors carrying the respective insertions given in parentheses.

S. cerevisiae mpk1 deletion, we decided to call the encoding gene KlMPK1. It should be noted that all amino acid residues with functional signi®cance in ScMpk1p are completely conserved in KlMpk1p (Figure 2(b)). These conserved sequences include the glycine-rich region in the N terminus, believed to constitute the ATP-binding site (from 32 to 37), and the TEY sequence (position 192 to 194) containing the threonine and the tyrosine residues shown to be the

phosphorylation target of the upstream MAP kinase kinases. A DEP sequence, characteristic for ScMpK1p is found at position 328 to 330. It is interesting that the C-terminal third of the protein is less conserved, yet it still contains a glutamine-rich region at the boundary to the highly conserved kinase domain, although the 16Q stretch of ScMpk1p is reduced to ®ve consecutive glutamine residues in the K. lactis sequence (positions 372 to 376).

746

K. lactis MAP Kinase

Figure 2 (legend opposite)

747

K. lactis MAP Kinase

Construction of Klmpk1 deletion mutants In order to gain some insight into the function of KlMpk1p, we constructed a deletion mutant substituting the open reading frame of the encoding gene (except for the ®rst 17 and the last 27 codons) for the URA3 marker from S. cerevisiae. This was achieved by using the diploid K. lactis strain KLD1 as a recipient for transformation with a PCR product containing 45 bp of homology to KlMPK1 at each end (Figure 3). Transformants were selected for uracil prototrophy. About 50 clones were obtained on this medium, 12 of which were subjected to PCR analysis to con®rm the expected deletion. Only one of the transformants yielded the expected bands (not shown). After sporulation and tetrad analysis, segregants were allowed to grow on YEPD supplemented with 0.5 M KCl for osmotic stabilization. Out of ten tetrads segregated, eight germinated in four viable spores on YEPD/ KCl at 30  C. Variations in colony size in this experiment did not correlate with the Klmpk1 null mutant allele but rather with requirements for adenine and/or amino acid residues. One complete tetrad (HK14-1A to HK14-1D) and two segregants carrying the deletion (HK14-2A and HK14-2B) were again tested by PCR and Southern analyses (Figure 3). Both methods con®rmed the correct deletion of the KlMPK1 gene in the haploid K. lactis genome. No additional band was observed in the Southern analysis under low stringency conditions. Phenotypic analysis of Klmpk1 deletions In the tetrad analysis described above, cells were also replica-plated onto a variety of media. It turned out that strains carrying the Klmpk1 deletion did not grow on YEPD without osmotic stabilization at 30  C. It is surprising that they did grow on synthetic medium containing 2 % (w/v) glucose, even in the absence of osmotic stabilization by 0.5 M KCl. To further investigate these phenotypes, dilution series were prepared from selected segregants and tested for their ability to grow under different conditions (Figure 4). Segregants carrying the Klmpk1 deletion did not grow on rich medium at 25  C or 30  C. This phenotype was independent of the carbon source used for growth (i.e. glucose, galactose or glycerol/ethanol; data not shown). On synthetic media, strains grew both at 25 and 30  C, although some segregants carrying the deletion were slightly impaired. On the other hand, none of the deletion mutants was able to grow at 37  C on any of the media tested. Growth was inhibited also on synthetic media by

the addition of Calco¯uor white, caffeine or SDS (Figure 4 and data not shown). Further investigation of the inability of the Klmpk1 null mutants to grow on rich media revealed that neither yeast extract nor peptone inhibited growth when added to synthetic medium with glucose as a carbon source. Instead, addition of yeast nitrogen base with ammonium sulfate to YEPD restored growth of these strains. A detailed analysis of the ingredients in this medium revealed that addition of 0.5 % (w/v) ammonium sulfate to YEPD was suf®cient to fully restore growth of the null mutants (data not shown). Overexpression of KlMPK1 in S. cerevisiae Overexpression of ScMPK1 under the control of the GAL1/10 promoter in S. cerevisiae results in a reduced growth rate (Mizunuma et al., 1998). Therefore we constructed a clone carrying the KlMPK1 gene under the control of this promoter carried on an S. cerevisiae/Escherichia coli shuttle vector (pJJH803) using PCR (Figure 1(b); see Experimental Procedures for details). To con®rm that indeed a functional KlMpk1p under galactose control is produced, we ®rst transformed S. cerevisiae strain YJJ3-2A (slt2::LEU2 ura3) with the respective vector. Transformants were selected for uracil prototrophy on medium supplemented with 1 M sorbitol and containing 2 % glucose as a carbon source. They were shown to grow without osmotic stabilization after induction on galactose on media containing 7 mM caffeine and on rich media at 37  C. Neither these transformants nor transformants of a wild-type strain (HD56-5A) showed a detectable growth defect on inducing galactose medium. Transformation of Klmpk1 null mutants (HK14-1A, HK14-1B) with a K. lactis centromeric vector carrying the same construct (pJJH806) resulted in complementation for growth on rich medium with galactose as a carbon source and on caffeine under inducing conditions. Transformants were also pregrown on glucose media selecting for plasmid maintenance and then transferred to galactose media for 14 hours prior to preparation of crude extracts for immunological detection of KlMpk1p. The results shown in Figure 5 provide evidence that the protein is indeed overproduced under these conditions. Due to the fact that ScMpk1p antibodies had to be used, the K. lactis protein is detectable only upon overproduction both in K. lactis and in S. cerevisiae (note that the homologous ScMpk1p gives a stronger signal, although only one-®fth of total protein was loaded). To assess the in¯uence of KlBck1p on

Figure 2. (a) Comparison of the deduced amino acid sequences of KlMpk1p with a subset of MAP kinases from different sources. Identical amino acid residues are shown in inverse print. Organisms of origin and accession numbers are: KlMPK1p, K. lactis (AF226711); ScMPK1p, S. cerevisiae (X59262); CaMKC1, Candida albicans (X76708); ScHOG1, S. cerevisiae (X89514); ScFus3, S. cerevisiae (X69572); HmERK1, Homo sapiens (Z11695). (b) A representation of the similarity between ScMpk1p and KlMpk1p. The positions of characteristic sequences discussed in the text are indicated.

748

K. lactis MAP Kinase

Figure 3. Con®rmation of Klmpk1 deletions. (a) Genomic organization of the KlMPK1 wild-type and deletion loci. Small arrows give the positions of the oligonucleotides used for PCR con®rmation. (b) PCR con®rmation of deletions. The oligonucleotides KlMPK4 and KlMPK5 (compare (a) and Table 3) were used for ampli®cation of genomic DNA from the strains HK14-1A (1, Klmpk1::URA3), HK141B (2, Klmpk1::URA3), HK14-1C (3, KlMPK1), HK14-1D (4, KlMPK1), HK14-2A (5, Klmpk1::URA3), and HK14-2B (6, Klmpk1::URA3). The positions of the wild-type and the deleted fragments are indicated. (c) Southern analysis using a PCR-generated fragment carrying the complete KlMPK1 open reading frame as a probe (DNA was ampli®ed by PCR using the oligonucleotide pair KlMPK10/KlMPK11 and pJJH576 as a template). Genomic DNA of the strains (numbering as in (b)) was digested with HindIII (lefthand site) or EcoRV (right-hand site). As a size standard, lambdaDNA digested with EcoRI/HindIII was applied. Hybridization was performed at 57  C under low stringency conditions. Note that a weak, non-speci®c hybridization with a band (ns) of about 4kb is observed in both types of digestion.

KlMpk1p phosphorylation, we tested the K. lactis wild-type strain HK14-1D and the Klbck1 null mutant derivative KB6-2C
4 (Jacoby et al., 1999) for the level of phosphorylated KlMpk1p after a shift from 25  C to 37  C (Figure 5). The Klbck1 deletion showed no detectable bands, in contrast to the wild-type control, where a band was detectable already at 25  C showing an increase after a shift to 37  C (note that the ®lters were re-probed with anti-ScPfk as a loading control; data not shown). This result indicates that KlBck1p takes part in signalling to KlMpk1p at least in response to heat stress. One-hybrid analysis In previous studies, ScMpk1p was shown to contain a cryptic transcriptional activation domain in its C-terminal part (Soler et al., 1995). As the degree of amino acid similarity to KlMpk1p is lowest in

this part of the protein, we decided to test if its C-terminal end is able to activate transcription when fused to a DNA-binding domain. For this purpose, DNA-binding domain fusions in the pGBD vector series (James et al., 1996) were constructed, taking advantage of the internal SalI site of KlMPK1 as well as of the PstI site, located in front of the glutamine-rich region (Figure 1(c)). These, and the control constructs from S. cerevisiae, were transformed into the reporter strain PJ69-4A. In X-Gal overlay assays, all transformants carrying either ScMPK1 or KlMPK1 sequences turned blue. For quantitative measurements, we grew the transformants in synthetic medium with 2 % glucose as a carbon source and determined speci®c b-galactosidase activities in crude extracts prepared from such cultures (Table 1). The results clearly demonstrate that the C-terminal part of KlMpk1p contains a sequence capable of transcriptional activation, as does its S. cerevisiae counterpart. In fact, b-galacto-

K. lactis MAP Kinase

749

Figure 4. Phenotypes of Klmpk1 deletions. Strains were grown to early stationary phase in YEPD and diluted in series. Aliquots of 5ml were spotted onto the media indicated. Plates were incubated for three to ®ve days at 30  C, unless indicated otherwise. The same K. lactis strains (HK14-1A to HK14-2B, number 1-6 from top to bottom) were tested as those checked by Southern analysis in Figure 3.

sidase activities were about fourfold higher for the K. lactis constructs. Effects of a genomic C-terminal deletion in ScMPK1 As the phenotypes of complete mpk1 deletions are more pronounced in S. cerevisiae than in K. lactis, and genetic manipulations pose less problems in the former yeast, we used S. cerevisiae strains of two different genetic backgrounds for the

following investigations. In previous work, Soler et al. (1995) showed that a C-terminal deletion containing only the ®rst 322 amino acids of ScMpk1p on an episomal plasmid fully complemented a genomic mpk1 deletion for growth on media lacking osmotic stabilization. To further investigate if the C-terminal part of the protein is completely dispensable, we constructed the respective genomic deletion in ScMPK1 using a PCR strategy (see Experimental Procedures). When tested for various phenotypes characteristic of Scmpk1 mutants, the

750

K. lactis MAP Kinase Table 1. b-Galactosidase activities in one-hybrid constructs with MPK1 sequences fused to the Gal4p-DNA binding domain Construct (plasmid name)

Specific b-galactosidase activity (munits/mg protein)

pGBD-C1 ScSLT2 ScSLT2
N322a KlMPK1 (pJJH714) KlMPK1
N240 (pJJH712) KlMPK1
N327 (pJJH715)

9.3  0.8 92.6  26.2 227.1  10.6 332.3  34.3 463.9  15.9 662.7  40.0

The ScSLT2 constructs were kindly provided by Maria Molina (Soler et al., 1995). Speci®c activities were determined at least in duplicate (for the S. cerevisiae constructs) and in duplicate from each of two independent transformants for the K. lactis constructs.

Figure 5. Immunological detection of KlMpk1p. (a) Detection of phosphorylated KlMpk1p using phosphospeci®c antibodies against ScMpk1p (see Experimental Procedures for details). Crude extracts were prepared from wild-type strain HK14-1D and from the Klbck1 null mutant strain KB6-2C
4 after incubation at the temperatures indicated. Note that the isogenic KlBCK1 wildtype strain KB6-2C gave similar results as HK14-1D (not shown). (b) Overproduction of KlMpk1p in K. lactis. The wild-type strain HK14-1C (wt), the Klmpk1 null mutant HK14-1A transformed with the vector pCXJ20 without insertion (mpk1
) and a transformant with the plasmid pJJH806 (with KlMPK1 under GAL1 promoter control; mcMPK1) were grown for 14 hours at 30  C on galactose media selecting for plasmid maintenance, where necessary. After preparation of crude extracts, 200 mg of protein was loaded per slot and separated on a 10 % polyacrylamide gel prior to transfer to nitrocellulose. Bands were visualized after treatment with antiScMpk1p by chemiluminescence as described in Experimental Procedures. (c) Overproduction of KlMpk1p in S. cerevisiae. Crude extracts prepared from strain HD565A carrying YEp352 (wt), from YJJ3-2A carrying YEp352 (mpk1
) and from YJJ3-2A carrying pJJH803 (mcMPK1) were prepared, subjected to a polyacrylamide gel electrophoresis and transferred to a nitrocellulose ®lter. In the ®rst lane, 40 mg of protein were loaded, the other lanes contain 200 mg of protein. All ®lters were

C-terminal deletions were more sensitive to caffeine but more resistant to Calco¯uor white (Figure 6). To con®rm that the observed phenotypes are not speci®c for the genetic background of our strain, the C-terminal deletion construct was introduced into strain W303-1A. There, the parental strain is already more sensitive to caffeine (not growing above a concentration of 7 mM). The isogenic deletion increases this sensitivity at lower concentrations (5 mM) and also increases the resistance to Calco¯uor white (data not shown). These observations con®rmed the results obtained with the HD263 strain series. In addition, we used an indirect test for Mpk1p activity based on a lexA-Rlm1p fusion that activates a b-galactosidase reporter construct only after phosphorylation of the Rlm1p moiety by Mpk1p (see Experimental Procedures for details). The reporter plasmid pHPS100 was introduced into a wild-type strain (HD246-2A), a strain carrying the C-terminal Mpk1p deletion (HD246-2D), and a strain with a deletion of the entire open reading frame of ScMPK1 (MALY5-3A). As evident from the data presented in Table 2, growth at 37  C in the absence of osmotic stabilization led to a drastic increase in b-galactosidase activity in the wild-type strain, re¯ecting activation of the pathway. As expected, the Scmpk1 deletion mutant was not able to activate lacZ transcription in this assay. Interestingly, the strain carrying the C-terminal Mpk1p deletion showed only about 20 % of the b-galactosidase activity of the wild-type after heat treatment.

Discussion Cellular integrity and the response to hypoosmotic conditions in the yeast S. cerevisiae are ensured by a MAP kinase signal transduction pathway

re-probed with a polyclonal antiserum against phosphofructokinase (Arvanitidis & Heinisch, 1994) as a loading control (data not shown).

K. lactis MAP Kinase

751

Figure 6. Phenotypes of genomic C-terminal deletions of ScMPK1. Strains were grown to early stationary phase in YEPD (or YEPD with 1 M sorbitol in the case of MALY5-3A) and diluted in series. Strains used are, from top to bottom: HD246-2B (ScMPK1), HD246-2C (Scmpk1
C::SpHIS5), HD263-1A (ScMPK1), HD263-1D (Scmpk1
C::SpHIS5) and MALY5-3A (Scmpk1::LEU2). Aliquots of 5ml were spotted onto the media indicated. Plates were incubated for three to ®ve days at 30  C, unless indicated otherwise.

mediated by the yeast homologue of mammalian protein kinase C (Pkc1p; for a review, see Heinisch et al., 1999). In K. lactis we could show that the homologue of the target of Pkc1p in S. cerevisiae, the MAP kinase KlBck1p, is virtually dispensable for growth under a variety of conditions, including the presence of Calco¯uor white and caffeine (Jacoby et al., 1999). This was a somewhat surprising result, as the protein displays a high degree of similarity to its S. cerevisiae homologue, whose mutants display all the characteristic phenotypes expected from a defect in cell integrity signalling (Costigan et al., 1992; Lee & Levin, 1992). The work presented here followed two objectives: (i) to investigate whether other components of the Pkc1p pathway from S. cerevisiae are conserved in K. lactis and, if so; (ii) if they serve a function in the maintenance of cellular integrity or are involved in

unrelated signal transduction pathways in this yeast. We isolated a sequence from K. lactis and designated it KlMPK1 on the basis of the observations that it complements the phenotypic defects of an S. cerevisiae mpk1 deletion mutant and that it displays a high degree of identity in its deduced amino acid sequence to ScMPK1. Most notably, all amino acids thought to be of functional signi®cance, such as the putative ATP-binding site, the phosphorylation target sequence (TEY) and the DEP motif at the boundary to a glutamine-rich region, are identical between ScMpk1p and KlMpk1p. As the sequences differ most in the C-terminal third of the two proteins, it is tempting to speculate that a regulatory function with different speci®cities could be encoded there. However, no essential function could be attributed to this part of ScMpk1p, as a plasmid lacking the encod-

752

K. lactis MAP Kinase

Table 2. Indirect assessment of Mpk1p activity Strain

Relevant genotype

HD246-2A HD246-2D MALY5-3A HD246-2A HD246-2D MALY5-3A

MPK1 mpk1
C mpk1::LEU2 MPK1 mpk1
C mpk1::LEU2

Growth conditions

b-Galactosidase (munits/mg protein)

Sorbitol/25  C Sorbitol/25  C Sorbitol/25  C SC/37  C SC/37  C SC/37  C

31.0  6.8 5.2  0.9 <0.5 202.7  41.7 43.9  6.9 <0.5

Speci®c b-galactosidase activities were determined from crude extracts prepared from three independent transformants, each. Strains were grown as described in Experimental Procedures.

ing sequence was fully able to complement the defect of a Scmpk1 deletion (Soler et al., 1995); however, sensitivity to different drugs was not assessed in that work. Here, we observed quite distinct phenotypes (i.e. increased sensitivity to caffeine and increased resistance to calco¯uor white) of such a deletion as compared to the isogenic wild-type strain, when introduced at the original MPK1 locus. A difference in the action of caffeine as compared to other drugs activating the Pkc1p pathway was also observed by others (Martin et al., 2000), providing further hints to a differential mode of signal integration. In the absence of drugs, the C-terminal part of the protein may be dispensable under laboratory growth conditions and at elevated temperatures. In the light of these results, it seems peculiar that a cryptic transcriptional activation domain is encoded in the 30 -end both of ScMPK1 (Soler et al., 1995) and of KlMPK1 (this work), despite the low conservation in the deduced amino acid sequence. The functional conservation would argue in favour of an advantageous activity conferred by this part of Mpk1p in vivo for both yeasts. It is interesting to note that, for S. cerevisiae, Mpk1p has been suggested to act on a novel form of RNA polymerase II complexes containing Hpr1p as one of their subunits (Chang et al., 1999). The latter has also been found to induce a hyperrecombination phenotype (Piruat & Aguilera, 1998). As no evidence for a direct phosphorylation of the polymerase complex by ScMpk1p has been presented so far, it seems tempting to speculate that the C-terminal end of the kinase may be involved in a more direct interaction with the transcription complex. On the other hand, our data argue in favour of the kinase activity of ScMpk1p being dependent on the C-terminal part of the protein, as deletion of this part led to a reduction in Rlm1p phosphorylation in our indirect assay system. The Klmpk1 deletions displayed a phenotype somewhat intermediate between what was expected from the mutants in S. cerevisiae and what we observed previously for Klbck1 deletions: Klmpk1
strains do not grow on rich media in the absence of osmotic stabilization nor on synthetic media in the presence of Calco¯uor white, SDS or caffeine. In this context, they behave like Scmpk1 deletion strains. On the other hand, they grow on

synthetic media without osmotic stabilization if no drugs is added. When shifted to 37  C on synthetic complete medium without osmotic stabilization, they show cell lysis, as indicated by the liberation of alkaline phosphatase (data not shown). The latter phenotype indicates that KlMPK1 is indeed involved in the maintenance of cellular integrity in K. lactis. Yet, signalling of cellular integrity in K. lactis may involve other components, as those described for S. cerevisiae. This is suggested by the fact that growth on synthetic media at 30  C is not severely affected by the Klmpk1 deletion (in the context that low-stringency Southern analysis did not indicate the presence of a second, highly conserved MAP kinase of this type in K. lactis). However, one should keep in mind that even in S. cerevisiae the strength of phenotype in mpk1 deletions is somewhat dependent on the genetic background. On the other hand, the virtual lack of phenotypes in a Klbck1 deletion (Jacoby et al., 1999) would argue that at least this component of the pathway is not as important in K. lactis for signalling of cell surface defects as it is in S. cerevisiae. Yet the KlMpk1p phosphorylation assay presented here strongly suggests that KlBck1p takes part in the signalling process, at least in response to elevated temperatures, in K. lactis. The stronger phenotypes of the Klmpk1 deletion (in contrast to the Klbck1 deletion) then indicates that KlMpk1p may serve a crucial function even in its non-phosphorylated state. In S. cerevisiae, the ®nding that a pkc1 deletion results in more severe defects than seen from deletions of genes encoding further downstream components of the pathway led to the hypothesis that a parallel signalling pathway exists (Lee et al., 1993). This could also be the case for K. lactis, offering another explanation for the difference in phenotypes between Klbck1 and Klmpk1 null mutants. Our results presented here are compatible with the notion that such a parallel pathway may have a higher capacity in signalling in K. lactis than it does in S. cerevisiae. In this context, the Klmpk1 deletion mutants described here may well serve as a starting point to unravel the nature of such a pathway in milk yeast.

753

K. lactis MAP Kinase

Experimental Procedures Media and culture conditions Rich media were based on YEPD (1 % yeast extract and 2 % Bacto peptone, Difco) and supplemented with 2 % glucose. Yeast transformants were selected on minimal medium (0.67 % yeast nitrogen base, 2 % glucose) supplemented with amino acid residues, adenine and uracil as described Sherman et al. (1983), and the omission of uracil, histidine, leucine or tryptophan, when URA3, HIS3, LEU2 or TRP1 were used as selection markers. In all cases these markers originated from S. cerevisiae or Schizosaccharomyces pombe and were shown to complement the respective defects in K. lactis strains. For growth on plates, 1.5 % agar was added to the described media. Either 1 M sorbitol (for S. cerevisiae) or 0.5 M KCl (for K. lactis) were added for osmotic stabilization, as required. For growth of E. coli standard LB media, with addition of the appropriate antibiotics, were employed (Sambrook et al., 1989). For preparation of crude extracts from yeast, cells were grown in 20 ml cultures with shaking at 30  C to late logarithmic phase. Strains, librairies and oligonucleotides Oligonucleotides used in this work were purchased from MWG Biotech (Munich/Germany) and are listed in Table 3. S. cerevisiae strains used in this work are mostly isogenic derivatives of HD56-5A (MATa ura3-52 leu2-3,112 his3-11,15). The diploid strain DHD5 was constructed from HD56-5A by transient introduction of the HO gene. YJJ3-2A (MATa slt2::LEU2 ura352 leu2-3,112 his3-11,15) and MALY5-3A (MATa slt2::LEU2 ura3-52 leu2-3,112 his3-11,15 trp1::loxP), both carrying a deletion in the open reading frame of SLT2 (ˆMPK1) and differing only in a deletion at the TRP1 locus, were used as recipients for cloning of KlMPK1 and test for pathway activity with pHPS100 (see below), respectively. HD263 segregants were obtained from a cross of HD260-2A (MATa ura3-52 leu2-3,112 his3-11,15) and HD246-2C (MATa mpk1
C::SpHIS5 ura3-52 leu2-3,112 his3-11,15 trp1::loxP), followed by tetrad analysis. The segregants differ only in their mating types (MATa for HD263-1A, -1D, -2A, and MATa for HD263-2D) and in that they contain either a wild-type MPK1 gene (HD263-1A and -2A) or the C-terminal deletion construct (HD263-1D and -2D). For special purposes, some experiments were performed with S. cerevisiae strains non-isogenic to HD56-5A: W303-1A (MATa ade2-1 can1-100 trp1-1 ura3-1 his311,15 leu2-3,112) was employed as a different genetic background to introduce the C-terminal deletion in MPK1. VW1A (MATa ura3-52 leu2-3,112 his3
1 trp1289 MAL2-8C SUC2 GAL) was used to prepare genomic DNA as a PCR template (note that this strain is isogenic to the CEN.PK series used in the German genome analysis project). S. cerevisiae PJ69-4A (MATa trp1-901ura3-52 leu2-3,112 his3-200 gal4
gal80
LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ; James et al., 1996) was used as a one-hybrid reporter recipient strain. As K. lactis strains, we used derivatives of KB6-2C (a gift from Karin Breunig, described by Jacoby et al. (1999), and the diploid strain KLD1 obtained from a cross of MW270-7B (a leu2 uraA1-1 met1-1) and MW309-5B (a leu2 uraA1-1 met2-2 his2-2 ade2-1), kindly provided by

Micheline WeÂsolowski. For work with E. coli, strain DH5aF0 (Gibco/BRL) was used throughout. The genomic library constructed in KEp6 by WeÂsolowski-Louvel et al. (1988) was used for the isolation of KlMPK1 by direct complementation of the S. cerevisiae deletion mutant. For this purpose, strain YJJ3-2A (slt2::LEU2 ura3) was transformed with the KEp6-based library selecting for uracil prototrophy in the presence of 1 M sorbitol. About 50,000 transformants were then replica-plated onto YEPD containing 5 mM caffeine and incubated for two days at 30  C. Plasmids were recovered from four clones growing under these conditions. After ampli®cation in E. coli and restriction analysis, plasmids from two transformants, displaying identical restriction patterns, were isolated and retransformed into strain YJJ3-2A and shown to confer growth in the presence of 5 mM caffeine. Plasmid constructions The following plasmids were constructed to assess the function of KlMPK1 in S. cerevisiae and K. lactis: pJJH576 was obtained by subcloning the 3.4kb EcoRI/BamHI fragment from the clone originally isolated from the K. lactis genomic library into YEp352 (Hill et al., 1986). It contains the complete KlMPK1 coding sequence and its ¯anking regions. The plasmid pJJH803 contains the open reading frame of KlMPK1 ampli®ed by PCR with the oligonucleotide pair KlMPK10/KlMPK11 (Table 3) using pJJH576 as a template, under the control of the GAL1/10promoter. As a basis for this construction, the 2 mm vector YEp352 (Hill et al., 1986) was employed. To test the same construct in K. lactis, we subcloned the promoterKlMPK1 fusion as an EcoRI/Asp718 fragment into pUK21 (pJJH804). From there the sequence was isolated as an SpeI fragment and cloned into the single XbaI site of the K. lactis/E. coli shuttle vector pCXJ20 (Chen, 1996) to yield pJJH806. For one-hybrid studies, the pGBD-vector series (James et al., 1996) was employed. The plasmid pJJH712 was constructed by subcloning a BamHI/SalI fragment containing the C-terminal part of KlMPK1 from pJJH576 into pGBD-C1 restricted with BglII/SalI. To obtain pJJH714, pGBD-C1 was used again, this time linearized with BamHI and introducing the complete open reading frame of KlMPK1 as a BamHI fragment from the PCR product described for construction of pJJH803. Plasmid pJJH715 contains the 769 bp PstI fragment from pJJH576 subcloned into pGBD-C2 linearized with PstI. Finally, the C-terminal deletion construct for ScMPK1, pJJH718, was obtained by PCR ampli®cation of the HIS5 marker from S. pombe (complementing the his3 defect in S. cerevisiae) from plasmid pFA6HIS (Wach et al., 1997) with the oligonucleotide pair MPK1dQ-50 /MPK1dFA6-30 (Table 3). The PCR product was used for in vivo recombination with YEpSLT2 (containing the 3.2kb EcoRI fragment from pCSLT2r described below in YEp352), selecting for histidine prototrophy. Recombinant plasmids (designated pJJH719) were isolated from the yeast transformants, ampli®ed in E. coli and subcloned as an EcoRI fragment into pUK1921 (Heinisch, 1993) to yield pJJH718. To construct the mpk1 deletion in S. cerevisiae, MPK1 and its ¯anking regions were ®rst ampli®ed by PCR using the oligonucleotides pSLT2-5 and pSLT2-3 (Table 3) and genomic DNA of strain VW1A as a template. The resulting DNA was digested with EcoRI and cloned into pUC19 to yield pCSLT2r. From this, a 2.3kb EcoRI/SalI fragment was again cloned into pUC19 digested with

Table 3. Oligonucleotides used in this work Designation

Sequence (50 ! 30 )

pSLT2-50 pSLT2-30 KlMPK4 KlMPK5 KlMPK10 KlMPK11 KlmpkdURA-30 KlmpkdURA-50 MPK1dQ-50 MPK1dFA6-30

CTCAACTGGGCTAGCGGC GGGCTTCTCAGTGAATAC GAGTCACGTGCGCAATGACTGG GTATTCACTGAAGCTGCCAG GGCGGATCCATGAACGAATACGATGCGG CCTCGGATCCCGTATAGCAGAATCTGAGC GTTCTACAAAGAGAGTGGATGAAGCTATATACCAGACGGTTTCATTAAACTGGGTGATTGATTGAGCAAGCTAG ATGAACGAATACGATGCGGTAGATAGACACACTTTCAAAGTGTTTAATCAGGTGATTGATTGAGCAAGCTGGG GGCTGTTTGTGAGACAACCGCTATTAGAAGAGCAAAGGCAATTACAATTACATAATAGGCTCGTTTAAACTGGATGGCGG CTATGGTGATTCTATACTTCCCCGGTTACTTATAGTTTTTTGTCCGCTTCGTACGCTGCAGGTCGAC

Restriction sites introduced by PCR using the oligonucleotides are underlined. Oligonucleotides used exclusively for sequencing are not included.

755

K. lactis MAP Kinase the same enzymes, to give pCSLT2-ES. This plasmid was digested with NsiI/XbaI and the fragment carrying the coding sequence of MPK1 was substituted for an XbaI/ PstI fragment with the LEU2 marker obtained from pUCLEU2-E (a gift from Michael von Pein, DuÈsseldorf; carrying the yeast LEU2 gene with its ¯anking regions in pUC19, with the intrinsic EcoRI site modi®ed by in vitro mutagenesis). The resulting construct was named pSLT2::LEU2. A CEN/ARS vector containing both a lexA-RLM1 fusion and a lacZ reporter gene preceded by lexA binding sites, pHPS100, was constructed to assess Mpk1p activity. For this purpose, a 3.2kb SphI fragment of pBRLM1dN (Jacoby et al., 1999) was cloned into YCplac22 (Gietz & Sugino, 1988) to yield pHPS68. This vector was linearized with PstI and used to introduce two NsiI/ClaI fragments, one obtained from pHPS80 and the other from pHPS97. pHPS80 carries a ScaI/SacI fragment from a vector that carries ®ve lexA binding sites in front of the lacZ gene (described by Ruden et al. (1991), cloned into the ScaI/SacI site of YIp358R (Myers et al., 1986). To construct pHPS97, pBluescript SK‡ was digested with HincI/ClaI and ligated with a 2.0kb StuI/ ClaI fragment again derived from the vector carrying the ®ve lexA binding sites in front of the lacZ gene.

non-radioactive labelling and detection kit from Boehringer (Mannheim), using CSPD for detection on Kodak XAR X-ray ®lms and hybridization was carried out according to standard procedures (Southern, 1975) and instructions of the manufacturer. Low-stringency hybridizations were performed at 57  C, probes with homologous origin were hybridized at 68  C. Other genetic engineering techniques followed standard procedures (Sambrook et al., 1989).

Construction of null mutants

Data Bank accession code

The plasmid pSLT2::LEU2 was activated by digestion with HindIII prior to transformation of the diploid S. cerevisiae strain DHD5. YJJ3-2A is a segregant, obtained after sporulation and tetrad analysis, that carries the LEU2 marker and displays a growth defect at 37  C that can be counteracted by osmotic stabilization by adding 1 M sorbitol. Genomic C-terminal deletions of MPK1 in S. cerevisiae were constructed by transformation with pJJH718 digested with EcoRI and selecting for histidine prototrophy. For deletion of KlMPK1, the PCR method for directed substitution established for S. cerevisiae was used. For this purpose, the URA3 marker from S. cerevisiae was ampli®ed from plasmid YDp-U (Berben et al., 1991) with oligonucleotides containing ¯anking regions of KlMPK1 (KlmpkdURA-50 /KlmpkdURA-30 ; Table 3). The product was used for transformation of KLD1 with selection on medium lacking uracil. Correct integration was checked by PCR using the oligonucleotide pair KlMPK4/KlMPK5 (Table 3), and by Southern analysis using a fragment spanning the open reading frame as a probe. The diploid was sporulated (segregants were termed HK14) and checked again by Southern and PCR analyses.

The sequence has been deposited in GenBank under the accession number AF226711.

Genetic manipulations, transformations and DNA preparations E. coli was transformed by the method of Hanahan (1985). Yeasts were transformed by a variation of the freeze method (Klebe et al., 1983) adapted for different yeast species (Dohmen et al., 1991). Plasmid DNA was prepared from E. coli with the kit from Qiagen (Hilden/ Germany), according to the instructions of the manufacturer. To obtain a probe for hybridization experiments, the open reading frame of KlMPK1 was ampli®ed by PCR with the oligonucleotide pair KlMPK10/KlMPK11 (Table 3) using pJJH576 as a template. DNA hybridizations for homologous probes were carried out with the

Sequence analysis Sequencing was performed by the dideoxy-chain termination method (Sanger et al., 1977), using the Sequenase Version 2.0 from USB in conjunction with [35S]dATP. Alternatively, DNA sequences were obtained using the CY5TM AutoReadTM Sequencing Kit or the ALFexpressTM dATP Labelling Mix kit (Pharmacia Biotech). The universal and reverse primers for standard cloning vectors as well as custom-made oligonucleotides (MWG, Munich) were used. The DNA sequence of both strands was determined. The sequences obtained were analyzed using the CLUSTAL W program (Thompson et al., 1994) for amino acid sequence alignments.

Enzymatic analysis b-Galactosidase activities were determined with o-nitrophenyl-b-D-galactopyranoside (ONPG) as a substrate at 30  C as described (Heinisch et al., 1991). Speci®c activities are given in conventional munits/mg protein. Total protein concentration was measured as described by (Zamenhoff, 1957), with bovine serum albumin as a standard. For indirect assays of Mpk1p activity, transformants with pHPS100 (see above) were grown on synthetic medium, lacking tryptophan and supplemented with 1 M sorbitol, at 25  C overnight in 20 ml cultures with shaking. Cells were harvested by centrifugation, resuspended in 1 ml of the same medium and inoculated at an A600 of 0.5 in 20 ml of the same medium as well as in 20 ml of synthetic medium without osmotic stabilization. The former cultures were further incubated for ®ve hours at 25  C with shaking, the latter at 37  C also for ®ve hours with shaking. Cells were then harvested for the preparation of crude extracts and b-galactosidase assays. X-Gal overlay assays were performed by growing cells on plates with selective medium and pouring a mixture of 1 % (w/v) agarose, dissolved in 0.5 M sodium phosphate buffer (pH 7.0), 0.01 % (w/v) SDS and 0.1 mg/ml X-Gal (5-bromo-4-chloro-3-indolyl-b,D-galactopyranoside) cooled to 45  C on top. Blue colour development was monitored after 30 minutes, one hour and two hours incubation at 30  C. Immunological detection Detection of KlMpk1p and phosphorylated KlMpk1 was done as described by MartõÂn et al. (2000) but with slight modi®cations. For detection of overexpressed Mpk1p, cells were grown in 20 ml of synthetic complete medium, 2 % galactose supplemented with 1 M sorbitol

756 for 14 hours. Cells were harvested and washed twice with 3 ml of 50 mM phosphate buffer (pH 7.0) prior to breakage with glass beads as described below. For detection of phosphorylated Mpk1p, strains were pregrown in YEPD supplemented with 1 M sorbitol overnight. Then cells were diluted to A600 ˆ 0.3 in 40 ml of medium. For pathway induction, cultures were grown in YEPD for four hours at 25  C and then shifted to 37  C for a further two hours. Control cells were diluted in YEPD supplemented with 1 M sorbitol and cultured for six hours at 25  C. Cells were harvested and washed with 2 ml of ice-cold distilled water. Crude extracts were prepared by vigorous shaking with glass beads (diam. 0.45-0.5 mm; B. Braun International GmbH) using an IKA-Vibrax-VXR for eight minutes at 4  C in 140 ml of lysis buffer (50 mM Tris-HCl (pH 7.5), 10 % (v/v) glycerol, 1 % (v/v) Triton X-100, 0.1 % (w/v) SDS, 150 mM NaCl, 50 mM NaF, 1 mM sodium orthovanadate, 50 mM b-glycerol phosphate, 5 mM sodium pyrophosphate, 5 mM EDTA, 1 mM phenylmethylsulfonyl¯uoride and tosylphenylalanine chloromethyl ketone, tosyllysine chloromethyl ketone, chymostatin, leupeptin, pepstatin A, antipain and aprotinin each at 25 mg/ml). Cell debris and glass beads were seperated by centrifugation for 15 minutes at 13,000 g. Then crude extracts were boiled with equal volumes of 2  Laemmli buffer for ®ve minutes at 96  C. For separation of proteins 7.5 % or 10 % (w/v) SDS polyacrylamide gels containing SDS were used and proteins were transferred to nitrocellulose membranes (Protan; Schleicher and Schuell). Phosphorylated Mpk1p was detected using phosphospeci®c p44/42 MAP kinase (Thr202/Tyr204) antibody (New England Biolabs, Inc.) diluted 1:2000 in the presence of 1 % non-fat milk powder in TBST (50 mM TrisHCl (pH 7.4), 150 mM NaCl, 0.1 % Tween 20) for 1.5 hours at room temperature as a primary antibody and anti-rabbit-POD (Jackson ImmunoResearch Laboratories, Inc.) diluted 1:10.000 in the presence of 1 % non-fat milk powder in TBST for one hour at room temperature as a secondary antibody. KlMpk1p was detected by using anti-Mpk1p (yM-19; Santa Cruz Biotechnology, Inc.) diluted 1:100 in the presence of 1 % non-fat milk powder in TBST for 1.5 hours at room temperature as a primary antibody and anti-goat-POD (Santa Cruz Biotechnology, Inc.) diluted 1:10,000 in the presence of 1 % non-fat milk powder in TBST for one hour at room temperature as a secondary antibody. For detection, SuperSignal1 West Dura Extended Duration Substrate (Pierce, Rockford, IL) was used for both proteins. For re-probing, a polyclonal anti-phosphofructokinase antiserum raised against Pfk from S. cerevisiae was applied using detection with BCIP/NBT as described by Arvanitidis & Heinisch (1994).

Acknowledgments We are grateful to JoÈrg Jacoby for his contributions in the initial cloning of the KlMPK1 gene. Thanks are due to Maria Molina for sending the S. cerevisiae one-hybrid constructs and to Micheline WeÁsolowski-Louvel and Karin Breunig for providing K. lactis strains and the genomic library. Rhoda Taylor-Mayer was kind enough to check the manuscript for ``Germanisms''. This work was funded by a grant from the Deutsche Forschungsgemeinschaft to J.J.H. (He1880/4-1).

K. lactis MAP Kinase

References Arvanitidis, A. & Heinisch, J. J. (1994). Studies on the function of yeast phosphofructokinase subunits by in vitro mutagenesis. J. Biol. Chem. 269, 8911-8918. Banuett, F. (1998). Signalling in the yeasts: an informational cascade with links to the ®lamentous fungi. Microbiol. Mol. Biol. Rev. 62, 249-274. Berben, G., Dumont, J., Gilliquet, V., Bolle, P.-A. & Hilger, F. (1991). The YDp plasmids: a uniform set of vectors bearing versatile gene disruption cassettes for Saccharomyces cerevisiae. Yeast, 7, 475-477. Buehrer, B. M. & Errede, B. (1997). Coordination of the mating and cell integrity mitogen-activated protein kinase pathways in Saccharomyces cerevisiae. Mol. Cell Biol. 17, 6517-6525. Chang, M., French-Cornay, D., Fan, H., Klein, H., Denis, C. L. & Jachning, J. A. (1999). A complex containing RNA polymerase II, Paf1p, Cdc73p, Hpr1p, and Ccr4p plays a role in protein kinase C signaling. Mol. Cell. Biol. 19, 1056-1067. Chen, X. J. (1996). Low- and high-copy-number shuttle vectors for replication in the budding yeast Kluyveromyces lactis. Gene, 172, 131-136. Costigan, C., Gehrung, S. & Snyder, M. (1992). A synthetic lethal screen identi®es SLK1, a novel protein kinase homolog implicated in yeast cell morphogenesis and cell growth. Mol. Cell. Biol. 12, 11621178. Davenport, K. R., Sohaskey, M., Kamada, Y., Levin, D. E. & Gustin, M. C. (1995). A second osmosensing signal transduction pathway in yeast. Hypotonic shock activates the PKC1 protein kinase-regulated cell integrity pathway. J. Biol. Chem. 270, 30157-30161. Dodou, E. & Treisman, R. (1997). The Saccharomyces cerevisiae MADS-box transcription factor Rlm1 is a target for the Mpk1 mitogen-activated protein kinase pathway. Mol. Cell. Biol. 17, 1848-1859. Dohmen, R. J., Strasser, A. W. M., HoÈner, C. B. & Hollenberg, C. P. (1991). An ef®cient transformation procedure enabling long-term storage of competent cells of various yeast genera. Yeast, 7, 691-692. Gietz, R. D. & Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene, 74, 527-534. Gray, J. V., Ogas, J. P., Kamada, Y., Stone, M., Levin, D. E. & Herskowitz, I. (1997). A role for the Pkc1 MAP kinase pathway of Saccharomyces cerevisiae in bud emergence and identi®cation of a putative upstream regulator. EMBO J. 16, 4924-4937. Gustin, M. C., Albertyn, J., Alexander, M. & Davenport, K. (1998). MAP kinase pathways in the yeast Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 62, 1264-1300. Hanahan, D. (1985). Techniques for transformation of E. coli. In DNA Cloning (Glover, P. M., ed.), vol. 1, IRL Press, Oxford. Heinisch, J. J. (1993). PFK2, ISP42, ERG2 and RAD14 are located on the right arm of chromosome XIII. Yeast, 9, 1103-1105. Heinisch, J., Vogelsang, K. & Hollenberg, C. P. (1991). Transcriptional control of yeast phosphofructokinase gene expression. FEBS Letters, 289, 77-82. Heinisch, J. J., Lorberg, A., Schmitz, H. P. & Jacoby, J. J. (1999). The protein kinase C-mediated MAP kinase pathway involved in the maintenance of cellular integrity in Saccharomyces cerevisiae. Mol. Microbiol. 32, 671-680.

K. lactis MAP Kinase Hill, J. E., Myers, A. M., Koerner, T. J. & Tzagoloff, A. (1986). Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast, 2, 163-167. Irie, K., Takase, M., Lee, K. S., Levin, D. E., Araki, H., Matsumoto, K. & Oshima, Y. (1993). MKK1 and MKK2, which encode Saccharomyces cerevisiae mitogen-activated protein kinase-kinase homologs, function in the pathway mediated by protein kinase C. Mol. Cell Biol. 13, 3076-3083. Jacoby, J. J., Nilius, S. M. & Heinisch, J. J. (1998). A screen for upstream components of the yeast protein kinase C signal transduction pathway identi®es the product of the SLG1 gene. Mol. Gen. Genet. 258, 148-155. Jacoby, J. J., Kirchrath, L., Gengenbacher, U. & Heinisch, J. J. (1999). Characterization of KlBCK1, encoding a MAP kinase kinase kinase of Kluyveromyces lactis. J. Mol. Biol. 288, 337-352. James, P., Halladay, J. & Craig, E. A. (1996). Genomic libraries and a host strain designed for highly ef®cient two-hybrid selection in yeast. Genetics, 144, 1425-1436. Kamada, Y., Jung, U. S., Piotrowski, J. & Levin, D. E. (1995). The protein kinase C-activated MAP kinase pathway of Saccharomyces cerevisiae mediates a novel aspect of the heat shock response. Genes Dev. 9, 1559-1571. Ketela, T., Green, R. & Bussey, H. (1999). Saccharomyces cerevisiae Mid2p is a potential cell wall stress sensor and upstream activator of the PKC1-MPK1 cell integrity pathway. J. Bacteriol. 181, 3330-3340. Klebe, R. J., Harris, J. V., Sharp, Z. D. & Douglas, M. G. (1983). A general method for polyethylene-glycolinduced genetic transformation of bacteria and yeast. Gene, 25, 333-341. Lee, K. S. & Levin, D. E. (1992). Dominant mutations in a gene encoding a putative protein kinase (BCK1) bypass the requirement for a Saccharomyces cerevisiae protein kinase C homolog. Mol. Cell. Biol. 12, 172182. Lee, K. S., Irie, K., Gotoh, Y., Watanabe, Y., Araki, H., Nishida, E., Matsumoto, K. & Levin, D. E. (1993). A yeast mitogen-activated protein kinase homolog (Mpk1p) mediates signalling by protein kinase C. Mol. Cell. Biol. 13, 3067-3075. Madden, K., Sheu, Y. J., Baetz, K., Andrews, B. & Snyder, M. (1997). SBF cell cycle regulator as a target of the yeast PKC-MAP kinase pathway. Science, 275, 1781-1784. Marini, N. J., Meldrum, E., Buehrer, B., Hubberstey, A. V., Stone, D. E., Traynor, Kaplan A. & Reed, S. I. (1996). A pathway in the yeast cell division cycle linking protein kinase C (Pkc1) to activation of Cdc28 at START. EMBO J. 15, 3040-3052. Martin, H., Arroyo, J., Sanchez, M., Molina, M. & Nombela, C. (1993). Activity of the yeast MAP kinase homologue Slt2 is critically required for cell integrity at 37  C. Mol. Gen. Genet. 241, 177-184. Martin, U., Rodriguez-Pachon, J. M., Ruiz, C., Nombela, C. & Molina, M. (2000). Regulatory mechanisms for modulation of signaling through the cell integrity Slt2-mediated pathway in Saccharomyces cerevisiae. J. Biol. Chem. 275, 1511-1519. Mattisson, C. P., Spencer, S. S., Kresge, K. A., Lee, J. & Ota, I. M. (1999). Differential regulation of the cell wall integrity mitogen-activated protein kinase pathway in budding yeast by the protein tyrosine phosphatases Ptp2 and Ptp3. Mol. Cell. Biol. 19, 7651-7660.

757 Mazzoni, C., Zarzov, P., Rambourg, A. & Mann, C. (1993). The SLT2 (MPK1) MAP kinase homolog is involved in polarized cell growth in Saccharomyces cerevisiae. J. Cell Biol. 123, 1821-1833. Mizunuma, M., Hirata, D., Miyahara, K., Tsuchiya, E. & Miyakawa, T. (1998). Role of calcineurin and Mpk1 in regulating the onset of mitosis in budding yeast. Nature, 392, 303-306. Myers, A. M., Tzagoloff, A., Kinney, D. M. & Lusty, C. J. (1986). Yeast shuttle and integrative vectors with multiple cloning sites suitable for construction of lacZ fusions. Gene, 45, 299-310. Ozier-Kalogeropoulos, O., Malpertuy, A., Boyer, J., Tekaia, F. & Dujon, B. (1998). Random exploration of the Kluyveromyces lactis genome and comparison with that of Saccharomyces cerevisiae. Nucl. Acids Res. 26, 5511-5524. Piruat, J. I. & Aguilera, A. A. (1998). A novel yeast gene, THO2, is involved in RNA polII transcription and provides new evidence for transcriptional elongation-associated recombination. EMBO J. 17, 4859-4872. Rajavel, M., Philip, B., Buehrer, B. M., Errede, B. & Levin, D. E. (1999). Mid2 is a putative sensor for cell integrity signaling in Saccharomyces cerevisiae. Mol. Cell. Biol. 19, 3969-3976. Ruden, D. M., Ma, J., Li, Y., Wood, K. & Ptashne, M. (1991). Generating yeast transcriptional activators containing no yeast protein sequences. Nature, 350, 250-252. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd edit., Cold Spring Habor Laboratory Press, Cold Spring Harbor, NY. Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain-termination inhibitors. Proc. Natl Acad. Sci. USA, 74, 5463-5467. Sherman, F., Fink, G. R. & Hicks, J. B. (1983). Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Soler, M., Plovins, A., Martin, H., Molina, M. & Nombela, C. (1995). Characterization of domains in the yeast MAP kinase Slt2 (Mpk1) required for functional activity and in vivo interaction with protein kinases Mkk1 and Mkk2. Mol. Microbiol. 17, 833-842. Southern, E. M. (1975). Detection of speci®c sequences among DNA-fragments seperated by gel electrophoresis. J. Mol. Biol. 98, 503-517. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speci®c gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673-4680. Torres, L., Martin, H., Garcia, Saez M. I., Arroyo, J., Molina, M., Sanchez, M. & Nombela, C. (1991). A protein kinase gene complements the lytic phenotype of Saccharomyces cerevisiae lyt2 mutants. Mol. Microbiol. 5, 2845-2854. Verna, J., Lodder, A., Lee, K., Vagts, A. & Ballester, R. (1997). A family of genes required for maintenance of cell wall integrity and for the stress response in Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA, 94, 13804-13809. Wach, A., Brachat, A., Alberti, Segui C., Rebischung, C. & Philippsen, P. (1997). Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast, 13, 1065-1075.

758

K. lactis MAP Kinase

Watanabe, Y., Irie, K. & Matsumoto, K. (1995). Yeast RLM1 encodes a serum response factor-like protein that may function downstream of the Mpk1 (Slt2) mitogen-activated protein kinase pathway. Mol. Cell. Biol. 15, 5740-5749. Watanabe, Y., Takaesu, G., Hagiwara, M., Irie, K. & Matsumoto, K. (1997). Characterization of a serum response factor-like protein in Saccharomyces cerevisiae, Rlm1, which has transcriptional activity regulated by the Mpk1 (Slt2) mitogen-activated protein kinase pathway. Mol. Cell. Biol. 17, 2615-2623. WeÂsolowski-Louvel, M., Tanguy-Rougeau, C. & Fukuhara, H. (1988). A nuclear gene is required for the expression of the linear DNA-associated killer

system in the yeast Kluyveromyces lactis. Yeast, 4, 7181. Widmann, C., Gibson, S., Jarpe, M. B. & Johnson, G. L. (1999). Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol. Rev. 79, 143-180. Zamenhoff, S. (1957). Preparation and assay of deoxyribonucleic acid from animal tissue. Methods Enzymol. 3, 696-704. Zarzov, P., Mazzoni, C. & Mann, C. (1996). The SLT2(MPK1) MAP kinase is activated during periods of polarized cell growth in yeast. EMBO J. 15, 83-91.

Edited by J. Karn (Received 2 March 2000; received in revised form 5 June 2000; accepted 5 June 2000)