- Email: [email protected]
Comparative genomics identifies new alpha class genes within the avian glutathione S-transferase gene cluster
Gene 452 (2010) 45–53
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
Comparative genomics identifies new alpha class genes within the avian glutathione S-transferase gene cluster Ji Eun Kim a, Miranda M. Bauer b, Kristelle M. Mendoza b, Kent M. Reed b, Roger A. Coulombe Jr. a,⁎ a b
Department of Veterinary Sciences and Graduate Toxicology Program, Utah State University, Logan, UT 84322, USA Department of Veterinary and Biomedical Sciences, University of Minnesota, St. Paul, MN 55108, USA
a r t i c l e
i n f o
Article history: Received 15 September 2009 Received in revised form 2 November 2009 Accepted 3 November 2009 Available online 10 November 2009 Received by L. Marino-Ramirez Key words: Aflatoxin B1 Glutathione S-transferases Detoxification BAC Mapping SNP
a b s t r a c t Glutathione S-transferases (GSTs: EC2.5.1.18) are a superfamily of multifunctional dimeric enzymes that catalyze the conjugation of glutathione (GSH) to electrophilic chemicals. In most animals and in humans, GSTs are the principal enzymes responsible for detoxifying the mycotoxin aflatoxin B1 (AFB1) and GST dysfunction is a known risk factor for susceptibility towards AFB1. Turkeys are one of the most susceptible animals known to AFB1, which is a common contaminant of poultry feeds. The extreme susceptibility of turkeys is associated with hepatic GSTs unable to detoxify the highly reactive and electrophilic metabolite exo-AFB1-8,9-epoxide (AFBO). In this study, comparative genomic approaches were used to amplify and identify the α-class tGST genes (tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3 and tGSTA4) from turkey liver. The conserved GST domains and four α-class signature motifs in turkey GSTs (with the exception of tGSTA1.1 which lacked one motif) confirm the presence of hepatic α-class GSTs in the turkey. Four signature motifs and conserved residues found in α-class tGSTs are (1) xMExxxWLLAAAGVE, (2) YGKDxKERAxIDMYVxG, (3) PVxEKVLKxHGxxxL and (4) PxIKKFLXPGSxxKPxxx. A BAC clone containing the α-class GST gene cluster was isolated and sequenced. The turkey α-class GTS genes genetically map to chromosome MGA2 with synteny between turkey and human α-class GSTs and flanking genes. This study identifies the α-class tGST gene cluster and genetic markers (SNPs, single nucleotide polymorphisms) that can be used to further examine AFB1 susceptibility and resistance in turkeys. Functional characterization of heterologously expressed proteins from these genes is currently underway. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Glutathione S-transferases (GSTs; E.C.2.5.1.18), a superfamily of multifunctional dimeric proteins, are important phase II biotransformation enzymes involved in cellular detoxification and excretion of a variety of xenobiotic substances (Eaton and Bammler, 1999; Frova, 2006). Carcinogens, environmental toxins and products of oxidative stress are detoxified by GSTs which principally catalyze the conjugation of reactive, electrophilic atoms with reduced glutathione (GSH) (Konishi et al., 2005; Salinas and Wong, 1999). Because of their importance in disease resistance, cancer susceptibility, and responsiveness to drug therapy, mammalian GSTs have been intensively studied. GSTs are primarily cytosolic enzymes, but microsomal forms also exist (Kelner et al., 1996). Cytosolic GSTs exist as dimeric subunits of 23–30 k Da with an average length of 199–244 amino acids (Hayes and Pulford, 1995; Mannervik and Danielson, 1988). Each subunit is composed of two spatially distinct domains. The N-terminal domain I
Abbreviations: GST, glutathione S-transferase; AFB1, Aflatoxin B1; AFBO, exo-AFB18,9-epoxide; tGST, turkey glutathione S-transferase. ⁎ Corresponding author. Department of Veterinary Sciences, Utah State University, Logan, UT 84322, USA. Tel.: +1 435 7971598; Fax: +1 435 797 1601. E-mail address: [email protected] (R.A. Coulombe). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.11.001
has an α/β structure consisting of four β-strands and three α-helices. Domain II contains a larger α domain with five to six α-helices. There are two ligand-binding sites per subunit: a specific GSH-binding site (G-site) and the hydrophobic substrate binding site (H-site) (Frova, 2006; Sun et al., 1998). Cytosolic GSTs from human, rat, and mouse have been well studied and are assigned to one of seven classes [alpha (α), mu (μ), pi (π), theta (τ), sigma (σ), zeta (ζ), omega (ο)] based on amino acid similarities (Frova, 2006; Hayes et al., 2005). Human GSTs are diverse and most abundantly expressed in the liver. Members of each class tend to have high sequence identity (N60%)(Board, 1998) and individual genes for each human GST class are clustered together on the same chromosome (Board and Webb, 1987). Human α-class GSTs (hGSTA) are well documented with five functional genes (hGSTA1hGSTA5) and seven pseudogenes on chromosome 6p12.1-6p12.2 (Coles and Kadlubar, 2005; Morel et al., 2002). Avian GSTs comprise a complex isoenzyme system that has received much less attention (Yeung and Gidari, 1980). According to electrophoretic mobility on SDS/PAGE, five groups of GST subunits (designated CL1–CL5) have been identified in the cytosolic fraction of Leghorn chick livers (Chang et al., 1990). Searches of Expressed Sequence Tag (EST) databases have isolated α (Chang et al., 1990; Chang et al., 1992; Liu et al., 1993), μ (Liu and Tam, 1991; Sun et al.,
46
J.E. Kim et al. / Gene 452 (2010) 45–53
1998), τ (Hsiao et al., 1995) and σ (Thomson et al., 1998) classes from cDNA sequences of the domestic chicken. Full-length cDNA of α-class GSTs was isolated and heterologously expressed in baculovirus and Escherichia coli system using GST-specific substrates (Liu et al., 1997; Liu et al., 1993). Nine class-alpha isozymes with distinctive molecular masses were affinity purified from chicken livers and partially cloned and characterized (Hsieh et al., 1999); clustering of chicken ESTs accessioned in Genbank suggests expression of six separate α-class transcripts. The nomenclature of chicken α-class GSTs was recently re-named (GenBank accession nos.) as cGSTA1 (NM_001001777), cGSTA2 (NM_001001776), cGSTA3 (NM_204818), and cGSTA-CL3 (M38219) based on subunit nomenclature proposed by (Mannervik et al., 1992). In nearly all animals studied, GSTs are the principal detoxification enzymes for aflatoxin B1 (AFB1), a ubiquitous food and feed-borne mycotoxin that is a potent animal and human hepatotoxin and carcinogen (Coulombe, 1993; Newberne and Butler, 1969). To exert its toxic and carcinogenic effects, AFB1 requires metabolic activation to the highly reactive electrophilic and carcinogenic intermediate, the exo-AFB1-8,9-epoxide (AFBO), catalyzed by hepatic cytochromes P450 (CYPs) (Hayes et al., 1991b; Swenson et al., 1975). When functional, GSTs catalyze the conjugation of GSH to AFBO, thereby rendering it non-toxic and easily excretable. We recently amplified and cloned from turkey CYP1A5 and CYP3A37, high-affinity enzymes mostly responsible for AFB1 bioactivation in turkey liver (Rawal et al., 2009; Yip and Coulombe, 2006). In rodents, α-class GSTs are the most efficient isozymes in detoxifying the AFBO (Hayes et al., 1991a; Hayes et al., 1991b). Mouse liver cytosol almost exclusively conjugates the exo-AFBO through the activity of its α-class GST (Raney et al., 1992), designated Gsta3, which has a high affinity toward AFBO, has been shown to be critical in the relative resistance of mice toward AFB1 (Ramsdell and Eaton, 1990). Rat constitutively express only small amount of α-class GST with high AFBO activity (rGSTA5-5) and thus are sensitive to AFB1-induced hepatocarcinogenesis (Hayes and Pulford, 1995; Wang et al., 2002). In contrast to rodents, constitutively expressed human hepatic α-class GSTs has little or no AFBO detoxifying activity(Raney et al., 1992; Slone et al., 1995). Turkeys are one of the most susceptible animals known to AFB1 (Giambrone et al., 1985; Hamilton et al., 1972). Even small amounts in the diet cause severe hepatotoxicosis and reduction in growth rate, feed efficiency and hatchability, acute hepatic necrosis, and increased susceptibility to bacterial and viral diseases(Kubena et al., 1995; Pier et al., 1980). There is currently little information available on the nature of GSTs in turkeys. Using prototype substrates we have demonstrated that turkey liver possesses active GST activity, but none with measurable GST-mediated detoxification of AFB1 (Klein et al., 2000; Klein et al., 2002, 2003). The purpose of this study was to fully characterize the αclass GSTs of the turkey. We amplified six α-class GSTs (tGSTs) from turkey liver mRNA by RACE and genetically mapped them to turkey chromosome MGA2. The CHORI-260 turkey BAC library was screened to identify clones containing the α-class gene cluster and one clone was fully sequenced and assembled. The six α-class GST genes were annotated according to gene structure, sequence similarity and synteny with chicken and human α-class GSTs. This study provides the complete sequence of the α-class genes and genetic markers that will be important in future studies of AFB1 susceptibility and resistance in turkeys. 2. Materials and methods 2.1. RNA extraction and Rapid Amplification of cDNA Ends (RACE) Male day-old turkey poults (Nicholas commercial strain) were obtained from Moroni Feed Co. (Moroni, UT). Freshly isolated turkey
livers were stored in RNAlater (Ambion). Samples were homogenized using a Polytron (Brinkman) and mRNA was extracted using Oligotex Direct mRNA kit (Qiagen). The first strand cDNA was synthesized using MMLV reverse transcriptase (Clontech) and each 5′-CDS primer and 3′-CDS primer provided in SMART™ RACE cDNA Amplification Kit (Clontech), respectively, to carry out RACE. Gene-specific primers (Table 1) were designed based on sequences of chicken GST α-class transcripts, cGSTA1, cGSTA2, cGSTA3 and cGSTA-CL3 to perform 5′and 3′-RACE. Fragments were amplified in PCR reactions with both universal primer mix (UPM, long primer: 5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′, and short primer: 5′CTAATACGACTCACTATAGGGC-3′) and nested universal primers (NUP, 5′-AAGCAGTGGTATCAACGCAGAGT-3′) provided in SMART™ RACE cDNA Amplification kit (Clontech). The following PCR profile was performed with Advantage 2 PCR kit (Clontech): 2 min at 94 °C, 30 s at 94 °C, 30 s at optimal annealing temperature 58–68 °C (34 cycles for first reaction and 25 cycles for nested PCR), and 45 s–90 s at 72 °C, followed by a final extension at 72 °C for 8 min. PCR products were subcloned in TA cloning vector pDrive (Qiagen) and transformed into chemically competent E. coli, DH5a (Invitrogen). Presence of RACE fragments within the clones was confirmed by colony PCR and sequence analysis. For confirmation of GST gene coding regions, PCR was performed using the proofreading enzyme pfuUltra high-fidelity DNA polymerase (Stratagene) with genespecific primers (Table 2) and cloning with Zero Blunt PCRII vector (Invitrogen). The PCR profile for this reaction was 2 min at 94 °C, 30 s at 94 °C, 30 s at optimal annealing temperature, 56–60 °C (25 cycles), and 1 min and 30 s at 72 °C, followed by a final extension at 72 °C for 8 min. Clones were confirmed by colony PCR and sequence analysis. All alignments of genes were analyzed with ClustalW (http://www. ebi.ac.uk/Tools/clustalw/index.html#). 2.2. BAC library screening and sequencing Sequences of turkey GST genes were used to design probes to screen the CHORI-260 BAC library array by overgo hybridization (Ross et al., 1999). Overgo sequences were as follows: GSTA2 O2CAGAGTAGAATTACATTACGTTGCTG; and GSTA2 O1-CTGTATTACTGTTCTGCAGTTACCCA; GSTA3 O1-CAGGCAGATGTAAGAGGAGCACTTC; and GSTA3 O2-TTAGAAGACTTCATTGCGTGGAAGT. Positive BAC clones were identified and grown overnight in LB media containing 25 μg/mL chloramphenicol. BAC DNA was prepared using QIAprep columns (Qiagen) and presence of GSTs was confirmed by PCR (Table 3A). Two GST-positive clones were identified (37H15 and 08C04) and end sequenced with vector-specific primers (Genbank accession nos. FI907948, FI907949, FI907950, FI907951). Based on position in the chicken genome of end sequences, 37H15 was chosen for full sequencing. BAC DNA was prepared using a large construct kit (Qiagen) and submitted to the Advanced Genetic Analysis Center, University of Minnesota for sublibrary construction and sequencing with Roche 454 GS FLX technology. 2.3. BAC contig assembly Approximately 16,000 454 sequence reads (∼12X coverage) were generated. Sequences were initially assembled with GS Assembler (Roche) and Sequencher software (Gene Codes, Corp) with the tGST cDNAs used to aid alignments. Assembled contigs were confirmed by overlapping gene-specific PCR and resequencing using primers anchored within exons (Table 3B). PCR reactions were performed with BAC DNA as template using Hotstar Taq polymerase (Qiagen). Amplifications were performed for 35 cycles with 58 °C annealing temperature and 1 min/kb extension times. PCR products were purified with PCR cleanup columns (Qiagen) and directly sequenced. Due to the duplicated nature of the three A1 genes, additional large-insert clones were constructed to aid in assembly of the
J.E. Kim et al. / Gene 452 (2010) 45–53
47
Table 1 Summary of primers used to amplify GSTA fragments from turkey cDNA using 5′ and 3′ Rapid Amplification cDNA Ends (RACE). Gene
5′-RACE
Gene specific primers
3′-RACE
Gene specific primers
GenBank accession
tGSTA1a
A1_UPM A1_NUP A2_UPM A2_NUP A3_UPM A3_NUP A4_UPM A4_NUP
5′-GCACTGCACCAACTTCATCCCATCGATC-3′ 5′-CAGCAGGGATCCATCTTGGCATAACTTC-3′ 5′-CACATCGGCTGCTTGAAAAGGGAGAG-3′ 5′-GTTCCCTCCACATACATATCAATC-3′ 5′-GCTACATAATTTTCATCTGGTGGGGGTTTTC-3′ 5′-TGCCCAGCTGAATCGGTTTCCCACAA-3′ 5′-GCCAACAAGAAAGTCCTGGCCATGGTC-3′ 5′-CATGTCAATCAGGGCTCTCTCCTTCAGGTC-3′
A1_UPM A1_NUP A2_UPM A2_NUP A3_UPM A3_NUP A4_UPM A4_NUP
5′-GATGAACGTCGTCCAACCAGCAGATA-3′ 5′-TTTAGCGGTGGAAGAGTCGAAGCCTGAT-3′ 5′-CTCTCCCTTTTCAAGCAGCCGATGTG-3′ 5′-CCATGGTCAGGATTATCTTGTTGGCA-3′ 5′-GCCACAATTGCAGAGAAGGCAACAGAG-3′ 5′-AGCAGTGGAGGAGAAAGTGCCTTCTGTG-3′ 5′-CCCGTTCTTATCAGCTGAGGATAAGGTG-3′ 5′-AAGGCTACAAGCAGGTACTTCCCAG-3′
NM_001001777b
tGSTA2 tGSTA3 tGSTA4
NM_001001776b NM_204818c M38219d
UPM: Universal Primer Mix (Clontech), NUP: Nested Universal Primer (Clontech). a tGSTA1.1, tGSTA1.2, tGSTA1.3. b Liu et al., 1993. c Hsieh et al., 1999. d Chang et al., 1992.
intergenic regions. Gene-specific primers anchored in exons 7 and 2 of adjacent genes were designed to bridge the sequences between the three A1 genes and the A3/A1 and A1/A2 spacers. PCR reactions were performed with BAC DNA as template using Long Range Taq Mastermix (Qiagen). Amplifications were performed for 35 cycles with 62 °C annealing temperature and 1 min/kb extension times. PCR products were either TA cloned using the pDrive vector (Qiagen) or digested with restriction endonucleases, ligated into a compatibly prepared vector (pBluescript KS+, Stratagene), and transformed into chemically competent DH5α cells (Invitrogen). Plasmids were purified with Qiagen plasmid minipreps and sequenced using vector-specific and internal primers. 2.4. Gene identification and annotation The assembled sequence was analyzed with Softberry FGENESH (http://linux1.softberry.com/all.htm) and the basic local alignment search tool (BLAST) to identify putative transcripts and homologies to known genes. Comparisons between predicted gene sequences, available ESTs, and the published chicken whole genome sequence were performed using Sequencher software (Gene Codes, Corp). Repetitive elements were identified using REPEATMASKER and Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.basic.submit. html). GC content analysis was performed with 100 bp windows using Isochore (http://www.ebi.ac.uk/Tools/emboss/cpgplot/index.html). CpG islands were identified with the Softberry CpGfinder using default settings (http://linux1.softberry.com/all.htm). 2.5. Genetic mapping of α-class GST gene cluster In order to confirm position of the turkey α-class GST gene cluster on chromosome MGA2 as predicted by comparative sequence alignments, primers were designed to amplify GST introns to identify segregating polymorphisms in the UMN/NTBF mapping population (Reed et al., 2003). Targeted regions included intron 2 of tGSTA4,
intron 4 of tGSTA1 (A1.1), and introns 2 and 4 of tGSTA2. In chicken and quail, intron 2 of GSTA4 contains a microsatellite repeat (quail locus GUJ0099). Sequencing of the F1 individuals from the UMN/NTBF mapping population found a polymorphic tetranucleotide repeat (TATC)N also occurs within this intron in the turkey. Primers were designed for PCR amplification (Forward 5′-TTTTAAGTTTCCCCAGGCAG-3′ and Reverse 5′-CACACACTGTATCATACTGGAATTTAC-3′) and the locus was genotyped as described in Knutson et al. (2004). SNPs were identified in intron 4 of tGSTA1.1 (C/T) and in intron 4 of tGSTA2 (C/T) by resequencing. The SNP markers were genotyped (PCR/RFLP) across the UMN/NTBF mapping families by digestion of the PCR amplicons directly with restriction endonucleases (Dde I for GSTA1.1 and Bsp HI for GSTA2) followed by electrophoresis in 1% agarose and manual scoring of alleles. Two-point linkage analysis was performed in combination with previously genotyped markers using Locusmap software (Garbe & Da, 2003). 3. Results and discussion 3.1. Amplification of turkey α-class GST genes The full-length cDNAs of six α-class GST genes were isolated and amplified from turkey liver using 5′- and 3′-RACE. Availability of the extensive chicken EST database which is genetically close to turkey (http://www.ncbi.nlm.nih.gov/genome/guide/chicken/ enabled the design of gene-specific primers to amplify turkey α-class GST genes (Tables 1 and 2). Primers for cGSTA1 amplified the three related A1 genes, tGSTA1.1, tGSTA1.2 and tGSTA1.3. Predicted open reading frames (tGSTA1.1, 743 bp with ORF 663 bp; tGSTA1.2, 724 bp with ORF 666 bp; tGSTA1.3, 666 bp with ORF 666 bp; tGSTA2, 840 bp with ORF 669 bp; tGSTA3, 851 bp with ORF 672 bp; and tGSTA4, 845 bp with ORF 690 bp), were confirmed by PCR amplification with proofreading enzyme followed by DNA sequencing (Table 1). The resulting cDNA sequences are accessioned in GenBank (accession nos. GQ228399, GQ228400, GQ228401, GQ228402, GQ228403 and
Table 2 Summary of primers used to amplify the open reading frame of α-class GST fragments from turkey cDNA. Gene
Gene size (bp)
Name
Gene specific primers
GenBank accession
tGSTA1.1
663 666
tGSTA1.3
666
tGSTA2
669
tGSTA3
672
tGSTA4
690
5′-ATGTCTGGGAAGCCAGTTCTG-3′ 5′-TCA ATGGAAAATTGCCATCA-3′ 5′-ATGTCTGGGAAGCCAGTTCTG-3′ 5′-TCAGTGGAAAATTGCTATCACACT-3′ 5′-ATGTCTGGGAAGCCAGTTCT-3′ 5′-TCAACTGAAAATTGCCAGCAG-3′ 5′-ATGGCGGAGAAACCTAAGCTTCACTATACCA-3′ 5′-TAATGTGAGGAAAATATTCAGTTTCTAAGGCCGC-3′ 5′-ATGTCGGAGAAGCCCAGGCTCACCTA-3′ 5′-TCAGTCTAGCTTAAAAATTTTCATCACAGTTGC-3′ 5′-ATGGCTGCAAAACCTGTACTCTACTAC-3′ 5′-CTAATTTGGTTTTACATCATAATACATCCGG-3′
GQ228399
tGSTA1.2
A1.1_F A1.1_R A1.2_F A1.2_R A1.3_F A1.3_R A2_F A2_R A3_F A3_R A4_F A4_R
GQ228400 GQ228401 GQ228402 GQ228403 GQ228404
48
J.E. Kim et al. / Gene 452 (2010) 45–53
Table 3 PCR primers used to verify presence of GST genes within BAC clones prior to sequencing (A) and for amplification of A1 gene regions in BAC assembly (B). (A) GSTA1_prof GSTA1_pro GSTA1 2-3f GSTA1 2-3r GSTA1 3-4r GSTA1 3-4f GSTA2_int2f GSTA2_int2r GSTA3_prof GSTA3_pror
5′-TTAATTAATAATCAGCTGCTTTGC-3′ 5′-GCTAGCAGCCAGCGTACTG-3′ 5′-ATGGATCCCTGCTGTTCCAG-3′ 5′-CAAAGACTGGGAAATATCTGTTTG-3′ 5′-GCATCAGGCTTCGACTCTTC-3′ 5′-GACATGTATGTGGAAGGACTGG-3′ 5′-CTTCAGCTGCCAGGTTTG-3′ 5′-AACCCCAGCTGCTGCTAAC-3′ 5′-GCGTTATGCAAAGCAGAGC-3′ 5′-AGCGGATCGACTCCATTTTG-3′
(B) A1.1_2f A1.2_2f A1.3_2f A1.1_2r A1.2_2r A1.3_2r A1.1_3r A1.2_3r A1.3_3r A1_univ_4r A1_univ_5f A1.1_6f A1.2_6f A1.3_6f A1.1_7f A1.2_7f A1.3_7f A1.1_7r A1.2_7r A1.3_7r
5′-CTGCACTATCCCAACTCACG-3′ 5′-CTGCACTATGCTAATATACG-3′ 5′-CTGCACTATGTCAGTGTACG-3′ 5′-ATTCGGCCTCGTGAGTTGGG-3′ 5′-GGTTCCATTCGGCCTCGTATATTAGC-3′ 5′-ATTCGGCCGCGTACACTGAC-3′ 5′-TGTAACTTTTGGAGATCTTCCTTTTT-3′ 5′-TTTGGAGATCATCCTTAGTTTTCAG-3′ 5′-TGGAGATCTTCTTTTGTTTCCAG-3′ 5′-GGTTGTATTTCCCTGCGATG-3′ 5′-GTATGTGGAAGGAWTGGCAG-3′ 5′-CCATTTTAGTGGTGGAAGAGC-3′ 5′-TTTTGGGGTTGGAAGAGTTG-3′ 5′-TTTAATGGTGGAAGAGTTCAAGC-3′ 5′-GCCAGAGGAAACCACCTTTAC-3′ 5′-GCGCAAAGAAACCACTGATTC-3′ 5′-GCCCAAGGAAACCACCTCTAC-3′ 5′-GGAAAATTGCCATCAGACTTG-3′ 5′-GGAAAATTGCTATCACACTTG-3′ 5′-TGAAAATTGCCAGCAGGTTTG-3′
GQ228404, Fig. 1 and Table 2). The open reading frame of tGSTA1.1 (663 bp) lacks three nucleic acids compared to tGSTA1.2 (666 bp), tGSTA1.3 (666 bp) and chicken GSTA1 (666 bp). Significance of the missing three nucleic acids (single codon) is not yet known. A functional characterization of the E. coli-expressed proteins from these genes is currently underway in our laboratory. The GSTA gene cluster was physically mapped within a single BAC clone (Fig. 2). Since only a few ESTs corresponding to the α-class tGSTs are accessioned in Genbank databases, there is little information regarding the relative expression patterns of the individual genes in turkeys. However, examination of chicken ESTs shows differential presence of individual transcripts suggestive of expression differences. Although only a single GSTA1 sequence has been described in the chicken, EST evidence indicates presence of three A1-like transcripts as seen in the turkey. 3.2. BAC contig assembly Because of the low quality assembly and annotation of the α-class GST cluster in the chicken genome (Build 2), the turkey GST genes could not be correctly aligned, necessitating identification and sequencing of a turkey GST BAC clone. Approximately 16,000 454 sequence reads were generated from the CHORI-260 BAC clone 37H15. Removal of pTARBAC2.1 vector sequence left a 222,565 bp insert of approximately 12X coverage (Fig. 2A). The BAC insert ended in the terminal exon of the gamma-glutamylcysteine synthetase gene (GCLC) and the fourth exon of transmembrane protein 14A (TMEM14A). Several repetitive DNA types were identified in the GST BAC (Fig. 2B) comprising almost 24 kb of the 222.5 kb sequence. These included numerous CR1/LTR and simple sequence repeats. Two large complex repeats were identified including an approximately 450 bp GGAAA/GGCAA pentameric repeat located at 9.6 kb and a second repeat (CATTTTTTCTTTTTTTTTT) of approximately 650 bp located at 135.9 kb. The turkey GST BAC had an overall GC content of 42.4%.
Notable spikes occurred at 31.5 and 122 kb where GC content exceeded 80% (Fig. 2C). Additional GC spikes are associated with the α-class GSTs. These regions of high GC content correspond to eight CpG islands detected with CpGfinder. A single non-coding 7SK snRNA sequence was found at 145.2 kb. This ncRNA appears to be widely conserved in vertebrates being present in the human genome as well as the chicken. The final assembly was annotated and submitted to Genbank (accession no. GQ254850). 3.3. Gene identification and annotation Based on BLAST homologies, FGENESH, and EST analysis, the 222.5 kb region contained 15 predicted genes (Fig. 2A). These include the six α-class GSTs (tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3, and tGSTA4) identified by RACE, the ELOVL5 (Elongation of very long chain fatty acids) homolog, GCM (glial cells missing homolog 1), FBX09 (F-box protein 9), ICK (intestinal cell (MAK-like) kinase), a sequence similar to transcribed locus BI335628, and two predicted genes not supported by EST data. Partial coding sequences are also included for GCLC and THEM14A as previously discussed. Single amino acid differences were observed between the tGSTA2, tGSTA3, and tGSA4 ORFs in the BAC clone versus those amplified by RACE. These differences can be attributed to the different DNA sources used for RACE amplification (Nicholas commercial strain) and the BAC clone (Chaves et al., 2009). 3.4. Genetic mapping of GST α-class To verify position of the α-class GST in the turkey genome, a polymorphic tetranucleotide repeat (tGUJ099) within intron 2 of tGSTA4 (cGSTCL3) and SNPs within tGSTA1.1 and tGSTA2 were genotyped across the UMN/NTBF mapping families. The number of informative meioses was 171 for tGUJ099, 168 for the tGSTA1.1 SNP, and 124 for tGSTA2 SNP. Significant genetic linkage (LOD N 3.0) was observed between tGUJ099 and 10 previously linked loci on MGA2 (Table 4). As expected, this microsatellite was also linked to both GST SNPs and the SNPs were linked to each other (θ = 0.085, LOD = 19.53) and to a subset of the loci found linked to tGUJ099. These results place the turkey GST genes on the distal q arm of chromosome 2 (MGA2) which is homologous to chicken chromosome 3 (GGA3; Reed et al., 2007). 3.5. GST nomenclature Nomenclature for turkey cytosolic GSTs should reflect primary structural similarities, the division of GSTs into classes of more closely related sequences (Mannervik et al., 1992; Mannervik et al., 2005), and the position of the α-class GST genes within the sequence cluster as aligned with the human genome sequence (conserved synteny, Fig. 2D). Amino acid similarities among the tGSTs ranged from 62% to 86% with an average of 70%. This is similar to that observed in chicken where similarities range from 64% to 71% (average 68%, Table 5) and comparable values are seen among human GSTAs (Table 6). Turkey and chicken GSTs are on average 95% similar in amino acid sequence (Table 5) indicating these represent orthologues (only a single GSTA1 gene has been formally described in the chicken although three genes were identified in accessioned ESTs). Given the observed synteny between the human and turkey αclass gene cluster and flanking genes, we have designated three of the turkey α-class genes as follows: tGSTA4 ( = hGSTA4 and cGST-CL3), tGSTA3 ( = hGSTA3 and cGSTA3) and tGSTA2 ( = hGSTA2 and cGSTA2). Nomenclature of the remaining “tGSTA1-like” genes is problematic given their close DNA sequence and amino acid similarities. We have provisionally designated the three tGSTA1-like genes as tGSTA1.1, tGSTA1.2 and tGSTA1.3 pending future functional assays. Highest amino acid similarity is seen among the three tGSTA1 genes (average
J.E. Kim et al. / Gene 452 (2010) 45–53
49
Fig. 1. Alignment of nucleotide sequences corresponding to the coding regions of six α-class GST genes amplified from turkey liver. tGSTA1.1 (Gene Bank accession no. GQ228399), tGSTA1.2 (GQ228400), tGSTA1.3 (GQ228401), tGSTA2 (GQ228402), tGSTA3 (GQ228403) and tGSTA4 (GQ228404). Periods denote identical bases and dashes denote gaps inserted for alignment.
83%) with GSTA1.2 and GSTA1.3 being the most similar (86%, Table 5). When compared to the human GST sequences the tGSTA1 genes are slightly more similar to hGSTA1 (average 63.6% similarity) than to other human α-class GST genes: hGSTA2 (62.6%), hGSTA3 (62.6%), hGSTA4 (59%) and hGSTA5 (61.3%) (Table 6). The degree of shared synteny between turkey and human GST orthologues is interesting given the estimated divergence of the avian lineage from mammals 300–350 million years ago (Mya) (Kumar and Hedges, 1998). Presence of orthologous genes on homologous
chromosome segments (conserved synteny) reflects both common phylogenetic origin and ancestral genomic organization (Andersson et al., 1996; O'Brien et al., 1993). Examples of this are seen on human chromosome 9 (HSA9) where homologs for 11 of 18 genes found on the chicken Z chromosome are located (Nanda et al., 1999; Nanda et al., 2000), and the GST locus where α-class GSTs and flanking genes are shared between human (HSA6) and turkey (MGA2). While conservation of gene order indicates ancestral genomic organization, conservation of gene clusters is indicative of local gene
50 J.E. Kim et al. / Gene 452 (2010) 45–53 Fig. 2. Sequence features of the turkey a-class GST cluster. (A) Genes and orientation as predicted within the turkey GST BAC. GST genes are indicated in black and other genes with supporting EST data are in gray. Genes predicted in silico are white. (B) Position and type of repetitive elements identified within clone 37H15. (C) GC content calculated by continuous 100 bp windows. Arrowheads denote position of CpG islands. (D) Homologous human sequence (∼0.8 Mb) from 6p12.1-12.2 showing position of predicted genes. Genes are coded as in A.
J.E. Kim et al. / Gene 452 (2010) 45–53 Table 4 Pairwise linkage analysis of GST markers in the UMN/NTBF mapping population. GST locus
Linked loci
Theta
LOD
tGUJ099
GSTA1.1SNP GSTA2SNP MNT045 MNT070 MNT080 MNT155 MNT217 MNT329 MNT379 MNT382 MNT415 RHT259 GSTA2SNP MNT045 MNT080 MNT155 MNT217 MNT329 MNT382 MNT415 RHT259 MNT080 MNT217 MNT329 MNT382 MNT415 RHT259
0.025 0.097 0.349 0.388 0.238 0.159 0.022 0.284 0.378 0.023 0.064 0.185 0.085 0.362 0.238 0.105 0.043 0.266 0.047 0.093 0.195 0.311 0.135 0.314 0.088 0.156 0.234
37.66 18.23 4.76 3.01 10.3 4.87 11.75 10.3 3.00 10.88 15.83 19.68 19.53 4.17 10.59 5.88 10.27 12.62 9.43 13.11 18.26 4.01 4.77 5.09 5.83 6.37 10.00
GSTA1.1SNP
GSTA2SNP
51
Table 6 Amino acid sequence similarities among turkey and human α-class GSTs.
tGSTA1.1 tGSTA1.2 tGSTA1.3 tGSTA2 tGSTA3 tGSTA4 hGSTA1 hGSTA2 hGSTA3 hGSTA4
hGSTA1
hGSTA2
hGSTA3
hGSTA4
hGSTA5
65 62 64 69 64 62
63 62 63 69 64 62 95
64 61 63 68 63 62 90 88
61 58 58 59 61 61 53 54 53
63 60 61 69 62 62 90 88 85 53
proteins are divided into four motifs with conserved residues: (1) 15– 29 aa (xMExxxWLLAAAGVE), (2) 82–98 aa (YGKDxKERAxIDMYVxG), (3) 134–148 aa (PVxEKVLKxHGxxxL) and (4) 191–208 aa (PxIKKFLxPGSxxKPxxx). Interestingly, tGSTA1.1 contains only three motifs (1, 2 and 4) (Fig. 3) due to lack of one amino acid (position 142) within the signature motif. This gene (220aa) has 91% sequence similarity with the single described cGSTA1 (221aa) (Table 5). Since a single point mutation in the hydrophobic substrate-binding site region is enough to shift substrate specificity from class π to α (Dirr et al., 1994; Nuccetelli et al., 1998), it is possible that these differences may explain substrate specificities of the turkey forms of GSTA. Turkey liver cytosolic GSTs are active toward prototypical substrates, such as chlorodinitrobenezene (CDNB) and dichlornitrobenzene (DCNB), but not toward AFBO, a condition posited to be a critical determinant for the extreme sensitivity of turkeys toward AFB1 (Klein et al., 2000; Klein et al., 2002, 2003). The functional characteristics and substrate specificities of each of these genes, and the possible effects of specific sequences and domains therein, will be confirmed in experiments using E. coli-expressed proteins, which is currently underway in our laboratory.
duplications that occurred early in vertebrate evolution. One example is the melanocortin receptors (MC2R, MC5R, and MC4R) in chicken (GGA2), humans (HSA18), and other mammals where gene clusters appear to reflect ancient local gene duplication (Schioth et al., 2003). The turkey α-class GST cluster appears to contain both genes of ancient local duplication (GSTA2-4) and others of more recent events (GSTA1.1, A1.2 and A1.3).
4. Conclusions 3.6. Turkey α-class GST domains The extreme sensitivity of turkeys is strongly associated with unresponsiveness of hepatic GSTs toward AFBO. We have shown that while turkey livers contain catalytically-active GSTs, none of which possess affinity toward AFBO (Klein et al., 2000; Klein et al., 2002, 2003), a situation similar in humans where constitutively expressed hepatic α-class GSTs have little or no AFBO detoxifying activity (Raney et al., 1992; Slone et al., 1995). Despite the large impact of this mycotoxin to the poultry industry, there is little information about the functional characteristics of avian GSTs, especially in the context of AFB1 detoxification. To our knowledge, this is the first study to fully amplify, identify, sequence and map turkey α-class GSTs. Comparative genomic approaches were used to genetically map the α-class GSTcluster to turkey chromosome MGA2 and the observed synteny between turkey and human α-class GSTs are reflected in
The alignment of six a-class GST proteins demonstrated that all six genes encode α-class tGST proteins based on two conserved domains and four signature motifs (Fig. 3). PROSITE (http://www.expasy.org/ prosite/) and BLOCKS (http://www.blocks.fhcrc.org/) queries for conserved domains of α-class of tGSTs revealed the presence of an Nterminal thioredoxin conserved domain (3–83 amino acids) and a Cterminal conserved α-helical domain (tGSTA1.1, tGSTA1.2 and tGSTA4: 85–207 aa: tGSTA1.3 and tGSTA2: 85–208 aa; tGSTA3: 85–209 aa). PANTHER (http://www.pantherdb.org/) and BLOCK searches revealed four putative motifs predicting high catalytic activity toward cumene hydroperoxide and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole (NBD), amongst other substrates. In addition, α-class tGSTs exhibit a number of differences from the characteristic GST structure (Dirr et al., 1994). The signature motifs and conserved residues of α-class tGST Table 5 Amino acid sequence similarities among turkey and chicken α-class GSTs. tGSTA1.1 tGSTA1.1 tGSTA1.2 tGSTA1.3 tGSTA2 tGSTA3 tGSTA4 cGSTA1 cGSTA2 cGSTA3 cGSTA-CL3
tGSTA1.2
tGSTA1.3
tGSTA2
tGSTA3
tGSTA4
cGSTA1
cGSTA2
cGSTA3
cGSTA-CL3
80
83 86
70 69 71
65 65 66 68
62 63 64 70 68
91 81 82 71 66 63
70 69 71 99 68 70 71
66 63 67 68 94 67 66 68
63 63 65 71 69 97 64 70 69
52
J.E. Kim et al. / Gene 452 (2010) 45–53
Fig. 3. Alignment of predicted amino acid sequence of tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3 and tGSTA4. Amino acid alignment of six GSTs from turkey liver. The conserved N-terminal thioredoxin domain (3–83 amino acids) is outlined in dotted line box; the conserved C-terminal α-helical domain (85–207 amino acids) is outlined in solid line box. Signature motifs and specific conserved residues of α-class tGSTs (shaded boxes) are indicated in (1) 15–29 aa (xMExxxWLLAAAGVE), (2) 82–98 aa (YGKDxKERAxIDMYVxG ), (3) 134–148 aa (PVxEKVLKxHGxxxL) and (4) 191–208 aa (PxIKKFLxPGSxxKPxxx). A single amino acid (142 aa) is missing in tGSTA1.1 (2).
annotation of turkey GSTAs. Comparative gene mapping is an effective tool for the study of genome evolution in phylogenetically distant species (turkey, chicken and human) that represent key stages in vertebrate evolution (O'Brien et al., 1993). The GST cluster provides insight into the origin and evolution of duplicated gene families. Identifying the complete sequence of the turkey α-class GSTs is the first and necessary step in discovering SNPs and other markers associated with AFB1 susceptibility and resistance in turkeys. All six GSTAs contained two conserved GST domains: the GSHbinding site (G subsite) and the hydrophobic substrate-binding site (H subsite) which is subject to variation across the classes (Allardyce et al., 1999). The presence of four signature motifs in turkey GSTs (with the exception of tGSTA1.1 which lacked one motif) suggests the presence of intact GSTAs in turkey livers. While some GSTs share substrate specificities, there are distinct differences in substrate preference between subfamilies. Sequence similarity between classes is rather low, ranging between 20% and 30% (Nuccetelli et al., 1998). Heterologously-expressed proteins from each GSTA are currently being functionally characterized to determine substrate specificities, as well as the possible effect of the absence of motifs. Certain detoxification enzymes such as GSTs are reported to be transcriptionally regulated through antioxidant response elements (AREs). Expression of the ABO metabolizing Gsta3 regulated by the Nrf2 transcription factor through an antioxidant response element was reported in mice (Hayes et al., 2000; Jowsey et al., 2003). Based on our complete sequences of tGSTA (Genbank accession no. GQ254850), we have identified several putative transcription factors in the 5′-regulatory elements of these GSTs (data not shown), and their significance in GST regulation to AFB1 is the subject of future studies. Our genomic approach provides the framework necessary to identifying genetic markers related to AFB1 susceptibility and
resistance in turkeys with the ultimate goal of re-introducing AFB1protective alleles into commercial populations. Acknowledgements The authors thank L.D. Chaves for assistance in BAC screening and sequence annotation. We also thank Dr. Lynn Bagley of the Moroni Feed Cooperative for generously providing turkeys and feed for this study. This research was supported in part by NRI competitive grant 2004-35205-14217 from the USDA-CSREES, by competitive grant 2007-35205-17880 from the USDA CSREES, Animal Genome program, and support from the Minnesota, and Utah and Agricultural Experiment Stations, where this is published as paper 8122. References Allardyce, C.S., McDonagh, P.D., Lian, L.Y., Wolf, C.R., Roberts, G.C., 1999. The role of tyrosine-9 and the C-terminal helix in the catalytic mechanism of Alpha-class glutathione S-transferases. Biochem. J. 343 (Pt 3), 525–531. Andersson, L., Archibald, A., Ashburner, M., Audun, S., Barendse, W., Bitgood, J., Bottema, C., Broad, T., Brown, S., Burt, D., Charlier, C., Copeland, N., Davis, S., Davisson, M., Edwards, J., Eggen, A., Elgar, G., Eppig, J.T., Franklin, I., Grewe, P., Gill 3rd, T., Graves, J.A., Hawken, R., Hetzel, J., Womack, J., et al., 1996. Comparative genome organization of vertebrates. The First International Workshop on Comparative Genome Organization. Mamm. Genome 7, 717–734. Board, P.G., 1998. Identification of cDNAs encoding two human alpha class glutathione transferases (GSTA3 and GSTA4) and the heterologous expression of GSTA4-4. Biochem. J. 330 (Pt 2), 827–831. Board, P.G., Webb, G.C., 1987. Isolation of a cDNA clone and localization of human glutathione S-transferase 2 genes to chromosome band 6p12. Proc. Natl. Acad. Sci. U. S. A. 84, 2377–2381. Chang, L.H., Chuang, L.F., Tsai, C.P., Tu, C.P., Tam, M.F., 1990. Characterization of glutathione S-transferases from day-old chick livers. Biochem. 29, 744–750. Chang, L.H., Fan, J.Y., Liu, L.F., Tsai, S.P., Tam, M.F., 1992. Cloning and expression of a chick liver glutathione S-transferase CL 3 subunit with the use of a baculovirus expression system. Biochem. J. 281 (Pt 2), 545–551.
J.E. Kim et al. / Gene 452 (2010) 45–53 Chaves, L.D., Harry, D.E., Reed, K.M., 2009. Genome-wide genetic diversity of ‘Nici’, the DNA source for the CHORI-260 turkey BAC library and candidate for whole genome sequencing. Anim. Genet. 40, 348–352. Coles, B.F., Kadlubar, F.F., 2005. Human alpha class glutathione S-transferases: genetic polymorphism, expression, and susceptibility to disease. Methods Enzymol. 401, 9–42. Coulombe Jr, R.A., 1993. Biological action of mycotoxins. J. Dairy Sci. 76, 880–891. Dirr, H., Reinemer, P., Huber, R., 1994. X-ray crystal structures of cytosolic glutathione Stransferases. Implications for protein architecture, substrate recognition and catalytic function. Eur. J. Biochem. 220, 645–661. Eaton, D.L., Bammler, T.K., 1999. Concise review of the glutathione S-transferases and their significance to toxicology. Toxicol. Sci. 49, 156–164. Frova, C., 2006. Glutathione transferases in the genomics era: new insights and perspectives. Biomol. Eng. 23, 149–169. Garbe, J., Da, Y., 2003. Locusmap user manual Version 1.1. Department of Animal Science, University of Minnesota, St. Paul. Giambrone, J.J., Diener, U.L., Davis, N.D., Panangala, V.S., Hoerr, F.J., 1985. Effects of aflatoxin on young turkeys and broiler chickens. Poult. Sci. 64, 1678–1684. Hamilton, P.B., Tung, H.T., Harris, J.R., Gainer, J.H., Donaldson, W.E., 1972. The effect of dietary fat on aflatoxicosis in turkeys. Poult. Sci. 51, 165–170. Hayes, J.D., Chanas, S.A., Henderson, C.J., McMahon, M., Sun, C., Moffat, G.J., Wolf, C.R., Yamamoto, M., 2000. The Nrf2 transcription factor contributes both to the basal expression of glutathione S-transferases in mouse liver and to their induction by the chemopreventive synthetic antioxidants, butylated hydroxyanisole and ethoxyquin. Biochem. Soc. Trans. 28, 33–41. Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2005. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 45, 51–88. Hayes, J.D., Judah, D.J., McLellan, L.I., Kerr, L.A., Peacock, S.D., Neal, G.E., 1991a. Ethoxyquininduced resistance to aflatoxin b1 in the rat is associated with the expression of a novel alpha-class glutathione S-transferase subunit, Yc2, which possesses high catalytic activity for aflatoxin B1-8,9-epoxide. Biochem. J. 279, 385–398. Hayes, J.D., Judah, D.J., McLellan, L.I., Neal, G.E., 1991b. Contribution of the glutathione stransferases to the mechanisms of resistance to aflatoxin B1. Pharmac. Ther. 50, 443–472. Hayes, J.D., Pulford, D.J., 1995. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol. 30, 445–600. Hsiao, C.D., Martsen, E.O., Lee, J.Y., Tsai, S.P., Tam, M.F., 1995. Amino acid sequencing, molecular cloning and modelling of the chick liver class-theta glutathione Stransferase CL1. Biochem. J. 312 (Pt 1), 91–98. Hsieh, C.H., Liu, L.F., Tsai, S.P., Tam, M.F., 1999. Characterization and cloning of avianhepatic glutathione S-transferases. Biochem. J. 343 (Pt 1), 87–93. Jowsey, I.R., Jiang, Q., Itoh, K., Yamamoto, M., Hayes, J.D., 2003. Expression of the aflatoxin B1-8,9-epoxide-metabolizing murine glutathione S-transferase A3 subunit is regulated by the Nrf2 transcription factor through an antioxidant response element. Mol. Pharmacol. 64, 1018–1028. Kelner, M.J., Stokely, M.N., Stovall, N.E., Montoya, M.A., 1996. Structural organization of the human microsomal glutathione S-transferase gene (GST12). Genomics 36, 100–103. Klein, P.J., Buckner, R., Kelly, J., Coulombe Jr, R.A., 2000. Biochemical basis for the extreme sensitivity of turkeys to aflatoxin B(1). Toxicol. Appl. Pharmacol. 165, 45–52. Klein, P.J., Van Vleet, T.R., Hall, J.O., Coulombe Jr, R.A., 2002. Biochemical factors underlying the age-related sensitivity of turkeys to aflatoxin B(1). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 132, 193–201. Klein, P.J., Van Vleet, T.R., Hall, J.O., Coulombe Jr, R.A., 2003. Effects of dietary butylated hydroxytoluene on aflatoxin B1-relevant metabolic enzymes in turkeys. Food Chem. Toxicol. 41, 671–678. Knutson, T.P., Chaves, L.D., Hall, M.K., Reed, K.M., 2004. One hundred fifty-four genetic markers for the turkey (Meleagris gallopavo). Genome 47, 1015–1028. Konishi, T., Kato, K., Araki, T., Shiraki, K., Takagi, M., Tamaru, Y., 2005. Molecular cloning and characterization of alpha-class glutathione S-transferase genes from the hepatopancreas of red sea bream, Pagrus major. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140, 309–320. Kubena, L.F., Edrington, T.S., Kamps-Holtzapple, C., Harvey, R.B., Elissalde, M.H., Rottinghaus, G.E., 1995. Effects of feeding fumonisin B1 present in Fusarium moniliforme culture material and aflatoxin singly and in combination to turkey poults. Poult. Sci. 74, 1295–1303. Kumar, S., Hedges, S.B., 1998. A molecular timescale for vertebrate evolution. Nature 392, 917–920. Liu, L.F., Liaw, Y.C., Tam, M.F., 1997. Characterization of chicken-liver glutathione Stransferase (GST) A1-1 and A2-2 isoenzymes and their site-directed mutants heterologously expressed in Escherichia coli: identification of Lys-15 and Ser-208 on cGSTA1-1 as residues interacting with ethacrynic acid. Biochem. J. 327 (Pt 2), 593–600. Liu, L.F., Tam, M.F., 1991. Nucleotide sequence of a class mu glutathione S-transferase from chicken liver. Biochim. Biophys. Acta 1090, 343–344.
53
Liu, L.F., Wu, S.H., Tam, M.F., 1993. Nucleotide sequence of class-alpha glutathione Stransferases from chicken liver. Biochim. Biophys. Acta 1216, 332–334. Mannervik, B., Awasthi, Y.C., Board, P.G., Hayes, J.D., Di Ilio, C., Ketterer, B., Listowsky, I., Morgenstern, R., Muramatsu, M., Pearsons, W.R., Pickett, C.B., Sato, K., Widersten, M., Wolf, C.R., 1992. Nomenclature for human glutathione transferase. Biochem. J. Lett. 282, 305–308. Mannervik, B., Board, P.G., Hayes, J.D., Listowsky, I., Pearson, W.R., 2005. Nomenclature for mammalian soluble glutathione transferases. Methods Enzymol. 401, 1–8. Mannervik, B., Danielson, U.H., 1988. Glutathione transferases–structure and catalytic activity. CRC Crit. Rev. Biochem. 23, 283–337. Morel, F., Rauch, C., Coles, B., Le Ferrec, E., Guillouzo, A., 2002. The human glutathione transferase alpha locus: genomic organization of the gene cluster and functional characterization of the genetic polymorphism in the hGSTA1 promoter. Pharmacogenet. Genom. 12, 277–286. Nanda, I., Shan, Z., Schartl, M., Burt, D.W., Koehler, M., Nothwang, H., Grutzner, F., Paton, I.R., Windsor, D., Dunn, I., Engel, W., Staeheli, P., Mizuno, S., Haaf, T., Schmid, M., 1999. 300 million years of conserved synteny between chicken Z and human chromosome 9. Nat. Genet. 21, 258–259. Nanda, I., Zend-Ajusch, E., Shan, Z., Grutzner, F., Schartl, M., Burt, D.W., Koehler, M., Fowler, V.M., Goodwin, G., Schneider, W.J., Mizuno, S., Dechant, G., Haaf, T., Schmid, M., 2000. Conserved synteny between the chicken Z sex chromosome and human chromosome 9 includes the male regulatory gene DMRT1: a comparative (re)view on avian sex determination. Cytogenet. Cell Genet. 89, 67–78. Newberne, P.M., Butler, W.H., 1969. Acute and chronic effects of aflatoxin on the liver of domestic and laboratory animals: a review. Cancer Res. 29, 236–250. Nuccetelli, M., Mazzetti, A.P., Rossjohn, J., Parker, M.W., Board, P., Caccuri, A.M., Federici, G., Ricci, G., Lo Bello, M., 1998. Shifting substrate specificity of human glutathione transferase (from class Pi to class alpha) by a single point mutation. Biochem. Biophys. Res. Commun. 252, 184–189. O'Brien, S.J., Womack, J.E., Lyons, L.A., Moore, K.J., Jenkins, N.A., Copeland, N.G., 1993. Anchored reference loci for comparative genome mapping in mammals. Nat. Genet. 3, 103–112. Pier, A.C., Richard, J.L., Cysewski, S.J., 1980. Implications of mycotoxins in animal disease. J. Am. Vet. Med. Assoc. 176, 719–724. Ramsdell, H.S., Eaton, D.L., 1990. Mouse liver glutathione S-transferase isoenzyme activity toward aflatoxin B1-8,9-epoxide and Benzo(a)pyrene-7,8-dihydrodiol9,10-epoxide. Toxicol. Appl. Pharm. 105, 216–225. Raney, K.D., Meyer, D.J., Ketterer, B., Harris, T.M., Guengerich, F.P., 1992. Glutathione conjugation of aflatoxin B1 exo- and endo-epoxides by rat and human glutathione S-transferases. Chem. Res. Toxicol. 5, 470–478. Rawal, S., R.K., Mendoza, K.M., Reed, K.M., Coulombe, R.A., 2009. Structure, genetic mapping, and function of the cytochrome P450 3A37 gene in the turkey (Meleagris gallopavo). Cytogenet. Genome Res. 125, 67–73. Reed, K.M., Chaves, L.D., Garbe, J.R., Da, Y., Harry, D.E., 2003. Allelic variation and genetic linkage of avian microsatellites in a new turkey population for genetic mapping. Cytogenet. Genome Res. 102, 331–339. Reed, K.M., Chaves, L.D., Mendoza, K.M., 2007. An integrated and comparative genetic map of the turkey genome. Cytogenet. Genome Res. 119, 113–126. Ross, M.T., LaBrie, S., McPherson, J.D., Stanton, V.P., 1999. Screening large-insert libraries by hybridization. In: Dracopoli, N.C., et al. (Ed.), Current protocols in human genetics. Wiley, New York, pp. 5.6.1–5.6.5. Salinas, A.E., Wong, M.G., 1999. Glutathione S-transferases—a review. Curr. Med. Chem. 6, 279–309. Schioth, H.B., Raudsepp, T., Ringholm, A., Fredriksson, R., Takeuchi, S., Larhammar, D., Chowdhary, B.P., 2003. Remarkable synteny conservation of melanocortin receptors in chicken, human, and other vertebrates. Genomics 81, 504–509. Slone, D.H., Gallagher, E.P., Ramsdell, H.S., Rettie, A.E., Stapleton, P.L., Berlad, L.G., Eaton, D.L., 1995. Human variability in hepatic glutathione S-transferase-mediated conjugation of aflatoxin B1-epoxide and other substrates. Pharmacogenet. Genom. 5, 224–233. Sun, Y.J., Kuan, I.C., Tam, M.F., Hsiao, C.D., 1998. The three-dimensional structure of an avian class-mu glutathione S-transferase, cGSTM1-1 at 1.94 A resolution. J. Mol. Biol. 278, 239–252. Swenson, D.H., Miller, J.A., Miller, E.C., 1975. The reactivity and carcinogenicity of aflatoxin B1-2,3-dichloride, a model for the putative 2,3-oxide metabolite of aflatoxin B1. Cancer Res. 35, 3811–3823. Thomson, A.M., Meyer, D.J., Hayes, J.D., 1998. Sequence, catalytic properties and expression of chicken glutathione-dependent prostaglandin D2 synthase, a novel class Sigma glutathione S-transferase. Biochem. J. 333 (Pt 2), 317–325. Wang, C., Bammler, T.K., Eaton, D.L., 2002. Complementary DNA cloning, protein expression, and characterization of alpha-class GSTs from Macaca fascicularis liver. Toxicol. Sci. 70, 20–26. Yeung, T.C., Gidari, A.S., 1980. Purification and properties of a chicken liver glutathione S-transferase. Arch. Biochem. Biophys. 205, 404–411. Yip, S.S., Coulombe Jr., R.A., 2006. Molecular cloning and expression of a novel cytochrome p450 from turkey liver with aflatoxin B1 oxidizing activity. Chem. Res. Toxicol. 19, 30–37.
Contents lists available at ScienceDirect
Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e
Comparative genomics identifies new alpha class genes within the avian glutathione S-transferase gene cluster Ji Eun Kim a, Miranda M. Bauer b, Kristelle M. Mendoza b, Kent M. Reed b, Roger A. Coulombe Jr. a,⁎ a b
Department of Veterinary Sciences and Graduate Toxicology Program, Utah State University, Logan, UT 84322, USA Department of Veterinary and Biomedical Sciences, University of Minnesota, St. Paul, MN 55108, USA
a r t i c l e
i n f o
Article history: Received 15 September 2009 Received in revised form 2 November 2009 Accepted 3 November 2009 Available online 10 November 2009 Received by L. Marino-Ramirez Key words: Aflatoxin B1 Glutathione S-transferases Detoxification BAC Mapping SNP
a b s t r a c t Glutathione S-transferases (GSTs: EC2.5.1.18) are a superfamily of multifunctional dimeric enzymes that catalyze the conjugation of glutathione (GSH) to electrophilic chemicals. In most animals and in humans, GSTs are the principal enzymes responsible for detoxifying the mycotoxin aflatoxin B1 (AFB1) and GST dysfunction is a known risk factor for susceptibility towards AFB1. Turkeys are one of the most susceptible animals known to AFB1, which is a common contaminant of poultry feeds. The extreme susceptibility of turkeys is associated with hepatic GSTs unable to detoxify the highly reactive and electrophilic metabolite exo-AFB1-8,9-epoxide (AFBO). In this study, comparative genomic approaches were used to amplify and identify the α-class tGST genes (tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3 and tGSTA4) from turkey liver. The conserved GST domains and four α-class signature motifs in turkey GSTs (with the exception of tGSTA1.1 which lacked one motif) confirm the presence of hepatic α-class GSTs in the turkey. Four signature motifs and conserved residues found in α-class tGSTs are (1) xMExxxWLLAAAGVE, (2) YGKDxKERAxIDMYVxG, (3) PVxEKVLKxHGxxxL and (4) PxIKKFLXPGSxxKPxxx. A BAC clone containing the α-class GST gene cluster was isolated and sequenced. The turkey α-class GTS genes genetically map to chromosome MGA2 with synteny between turkey and human α-class GSTs and flanking genes. This study identifies the α-class tGST gene cluster and genetic markers (SNPs, single nucleotide polymorphisms) that can be used to further examine AFB1 susceptibility and resistance in turkeys. Functional characterization of heterologously expressed proteins from these genes is currently underway. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Glutathione S-transferases (GSTs; E.C.2.5.1.18), a superfamily of multifunctional dimeric proteins, are important phase II biotransformation enzymes involved in cellular detoxification and excretion of a variety of xenobiotic substances (Eaton and Bammler, 1999; Frova, 2006). Carcinogens, environmental toxins and products of oxidative stress are detoxified by GSTs which principally catalyze the conjugation of reactive, electrophilic atoms with reduced glutathione (GSH) (Konishi et al., 2005; Salinas and Wong, 1999). Because of their importance in disease resistance, cancer susceptibility, and responsiveness to drug therapy, mammalian GSTs have been intensively studied. GSTs are primarily cytosolic enzymes, but microsomal forms also exist (Kelner et al., 1996). Cytosolic GSTs exist as dimeric subunits of 23–30 k Da with an average length of 199–244 amino acids (Hayes and Pulford, 1995; Mannervik and Danielson, 1988). Each subunit is composed of two spatially distinct domains. The N-terminal domain I
Abbreviations: GST, glutathione S-transferase; AFB1, Aflatoxin B1; AFBO, exo-AFB18,9-epoxide; tGST, turkey glutathione S-transferase. ⁎ Corresponding author. Department of Veterinary Sciences, Utah State University, Logan, UT 84322, USA. Tel.: +1 435 7971598; Fax: +1 435 797 1601. E-mail address: [email protected] (R.A. Coulombe). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.11.001
has an α/β structure consisting of four β-strands and three α-helices. Domain II contains a larger α domain with five to six α-helices. There are two ligand-binding sites per subunit: a specific GSH-binding site (G-site) and the hydrophobic substrate binding site (H-site) (Frova, 2006; Sun et al., 1998). Cytosolic GSTs from human, rat, and mouse have been well studied and are assigned to one of seven classes [alpha (α), mu (μ), pi (π), theta (τ), sigma (σ), zeta (ζ), omega (ο)] based on amino acid similarities (Frova, 2006; Hayes et al., 2005). Human GSTs are diverse and most abundantly expressed in the liver. Members of each class tend to have high sequence identity (N60%)(Board, 1998) and individual genes for each human GST class are clustered together on the same chromosome (Board and Webb, 1987). Human α-class GSTs (hGSTA) are well documented with five functional genes (hGSTA1hGSTA5) and seven pseudogenes on chromosome 6p12.1-6p12.2 (Coles and Kadlubar, 2005; Morel et al., 2002). Avian GSTs comprise a complex isoenzyme system that has received much less attention (Yeung and Gidari, 1980). According to electrophoretic mobility on SDS/PAGE, five groups of GST subunits (designated CL1–CL5) have been identified in the cytosolic fraction of Leghorn chick livers (Chang et al., 1990). Searches of Expressed Sequence Tag (EST) databases have isolated α (Chang et al., 1990; Chang et al., 1992; Liu et al., 1993), μ (Liu and Tam, 1991; Sun et al.,
46
J.E. Kim et al. / Gene 452 (2010) 45–53
1998), τ (Hsiao et al., 1995) and σ (Thomson et al., 1998) classes from cDNA sequences of the domestic chicken. Full-length cDNA of α-class GSTs was isolated and heterologously expressed in baculovirus and Escherichia coli system using GST-specific substrates (Liu et al., 1997; Liu et al., 1993). Nine class-alpha isozymes with distinctive molecular masses were affinity purified from chicken livers and partially cloned and characterized (Hsieh et al., 1999); clustering of chicken ESTs accessioned in Genbank suggests expression of six separate α-class transcripts. The nomenclature of chicken α-class GSTs was recently re-named (GenBank accession nos.) as cGSTA1 (NM_001001777), cGSTA2 (NM_001001776), cGSTA3 (NM_204818), and cGSTA-CL3 (M38219) based on subunit nomenclature proposed by (Mannervik et al., 1992). In nearly all animals studied, GSTs are the principal detoxification enzymes for aflatoxin B1 (AFB1), a ubiquitous food and feed-borne mycotoxin that is a potent animal and human hepatotoxin and carcinogen (Coulombe, 1993; Newberne and Butler, 1969). To exert its toxic and carcinogenic effects, AFB1 requires metabolic activation to the highly reactive electrophilic and carcinogenic intermediate, the exo-AFB1-8,9-epoxide (AFBO), catalyzed by hepatic cytochromes P450 (CYPs) (Hayes et al., 1991b; Swenson et al., 1975). When functional, GSTs catalyze the conjugation of GSH to AFBO, thereby rendering it non-toxic and easily excretable. We recently amplified and cloned from turkey CYP1A5 and CYP3A37, high-affinity enzymes mostly responsible for AFB1 bioactivation in turkey liver (Rawal et al., 2009; Yip and Coulombe, 2006). In rodents, α-class GSTs are the most efficient isozymes in detoxifying the AFBO (Hayes et al., 1991a; Hayes et al., 1991b). Mouse liver cytosol almost exclusively conjugates the exo-AFBO through the activity of its α-class GST (Raney et al., 1992), designated Gsta3, which has a high affinity toward AFBO, has been shown to be critical in the relative resistance of mice toward AFB1 (Ramsdell and Eaton, 1990). Rat constitutively express only small amount of α-class GST with high AFBO activity (rGSTA5-5) and thus are sensitive to AFB1-induced hepatocarcinogenesis (Hayes and Pulford, 1995; Wang et al., 2002). In contrast to rodents, constitutively expressed human hepatic α-class GSTs has little or no AFBO detoxifying activity(Raney et al., 1992; Slone et al., 1995). Turkeys are one of the most susceptible animals known to AFB1 (Giambrone et al., 1985; Hamilton et al., 1972). Even small amounts in the diet cause severe hepatotoxicosis and reduction in growth rate, feed efficiency and hatchability, acute hepatic necrosis, and increased susceptibility to bacterial and viral diseases(Kubena et al., 1995; Pier et al., 1980). There is currently little information available on the nature of GSTs in turkeys. Using prototype substrates we have demonstrated that turkey liver possesses active GST activity, but none with measurable GST-mediated detoxification of AFB1 (Klein et al., 2000; Klein et al., 2002, 2003). The purpose of this study was to fully characterize the αclass GSTs of the turkey. We amplified six α-class GSTs (tGSTs) from turkey liver mRNA by RACE and genetically mapped them to turkey chromosome MGA2. The CHORI-260 turkey BAC library was screened to identify clones containing the α-class gene cluster and one clone was fully sequenced and assembled. The six α-class GST genes were annotated according to gene structure, sequence similarity and synteny with chicken and human α-class GSTs. This study provides the complete sequence of the α-class genes and genetic markers that will be important in future studies of AFB1 susceptibility and resistance in turkeys. 2. Materials and methods 2.1. RNA extraction and Rapid Amplification of cDNA Ends (RACE) Male day-old turkey poults (Nicholas commercial strain) were obtained from Moroni Feed Co. (Moroni, UT). Freshly isolated turkey
livers were stored in RNAlater (Ambion). Samples were homogenized using a Polytron (Brinkman) and mRNA was extracted using Oligotex Direct mRNA kit (Qiagen). The first strand cDNA was synthesized using MMLV reverse transcriptase (Clontech) and each 5′-CDS primer and 3′-CDS primer provided in SMART™ RACE cDNA Amplification Kit (Clontech), respectively, to carry out RACE. Gene-specific primers (Table 1) were designed based on sequences of chicken GST α-class transcripts, cGSTA1, cGSTA2, cGSTA3 and cGSTA-CL3 to perform 5′and 3′-RACE. Fragments were amplified in PCR reactions with both universal primer mix (UPM, long primer: 5′-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3′, and short primer: 5′CTAATACGACTCACTATAGGGC-3′) and nested universal primers (NUP, 5′-AAGCAGTGGTATCAACGCAGAGT-3′) provided in SMART™ RACE cDNA Amplification kit (Clontech). The following PCR profile was performed with Advantage 2 PCR kit (Clontech): 2 min at 94 °C, 30 s at 94 °C, 30 s at optimal annealing temperature 58–68 °C (34 cycles for first reaction and 25 cycles for nested PCR), and 45 s–90 s at 72 °C, followed by a final extension at 72 °C for 8 min. PCR products were subcloned in TA cloning vector pDrive (Qiagen) and transformed into chemically competent E. coli, DH5a (Invitrogen). Presence of RACE fragments within the clones was confirmed by colony PCR and sequence analysis. For confirmation of GST gene coding regions, PCR was performed using the proofreading enzyme pfuUltra high-fidelity DNA polymerase (Stratagene) with genespecific primers (Table 2) and cloning with Zero Blunt PCRII vector (Invitrogen). The PCR profile for this reaction was 2 min at 94 °C, 30 s at 94 °C, 30 s at optimal annealing temperature, 56–60 °C (25 cycles), and 1 min and 30 s at 72 °C, followed by a final extension at 72 °C for 8 min. Clones were confirmed by colony PCR and sequence analysis. All alignments of genes were analyzed with ClustalW (http://www. ebi.ac.uk/Tools/clustalw/index.html#). 2.2. BAC library screening and sequencing Sequences of turkey GST genes were used to design probes to screen the CHORI-260 BAC library array by overgo hybridization (Ross et al., 1999). Overgo sequences were as follows: GSTA2 O2CAGAGTAGAATTACATTACGTTGCTG; and GSTA2 O1-CTGTATTACTGTTCTGCAGTTACCCA; GSTA3 O1-CAGGCAGATGTAAGAGGAGCACTTC; and GSTA3 O2-TTAGAAGACTTCATTGCGTGGAAGT. Positive BAC clones were identified and grown overnight in LB media containing 25 μg/mL chloramphenicol. BAC DNA was prepared using QIAprep columns (Qiagen) and presence of GSTs was confirmed by PCR (Table 3A). Two GST-positive clones were identified (37H15 and 08C04) and end sequenced with vector-specific primers (Genbank accession nos. FI907948, FI907949, FI907950, FI907951). Based on position in the chicken genome of end sequences, 37H15 was chosen for full sequencing. BAC DNA was prepared using a large construct kit (Qiagen) and submitted to the Advanced Genetic Analysis Center, University of Minnesota for sublibrary construction and sequencing with Roche 454 GS FLX technology. 2.3. BAC contig assembly Approximately 16,000 454 sequence reads (∼12X coverage) were generated. Sequences were initially assembled with GS Assembler (Roche) and Sequencher software (Gene Codes, Corp) with the tGST cDNAs used to aid alignments. Assembled contigs were confirmed by overlapping gene-specific PCR and resequencing using primers anchored within exons (Table 3B). PCR reactions were performed with BAC DNA as template using Hotstar Taq polymerase (Qiagen). Amplifications were performed for 35 cycles with 58 °C annealing temperature and 1 min/kb extension times. PCR products were purified with PCR cleanup columns (Qiagen) and directly sequenced. Due to the duplicated nature of the three A1 genes, additional large-insert clones were constructed to aid in assembly of the
J.E. Kim et al. / Gene 452 (2010) 45–53
47
Table 1 Summary of primers used to amplify GSTA fragments from turkey cDNA using 5′ and 3′ Rapid Amplification cDNA Ends (RACE). Gene
5′-RACE
Gene specific primers
3′-RACE
Gene specific primers
GenBank accession
tGSTA1a
A1_UPM A1_NUP A2_UPM A2_NUP A3_UPM A3_NUP A4_UPM A4_NUP
5′-GCACTGCACCAACTTCATCCCATCGATC-3′ 5′-CAGCAGGGATCCATCTTGGCATAACTTC-3′ 5′-CACATCGGCTGCTTGAAAAGGGAGAG-3′ 5′-GTTCCCTCCACATACATATCAATC-3′ 5′-GCTACATAATTTTCATCTGGTGGGGGTTTTC-3′ 5′-TGCCCAGCTGAATCGGTTTCCCACAA-3′ 5′-GCCAACAAGAAAGTCCTGGCCATGGTC-3′ 5′-CATGTCAATCAGGGCTCTCTCCTTCAGGTC-3′
A1_UPM A1_NUP A2_UPM A2_NUP A3_UPM A3_NUP A4_UPM A4_NUP
5′-GATGAACGTCGTCCAACCAGCAGATA-3′ 5′-TTTAGCGGTGGAAGAGTCGAAGCCTGAT-3′ 5′-CTCTCCCTTTTCAAGCAGCCGATGTG-3′ 5′-CCATGGTCAGGATTATCTTGTTGGCA-3′ 5′-GCCACAATTGCAGAGAAGGCAACAGAG-3′ 5′-AGCAGTGGAGGAGAAAGTGCCTTCTGTG-3′ 5′-CCCGTTCTTATCAGCTGAGGATAAGGTG-3′ 5′-AAGGCTACAAGCAGGTACTTCCCAG-3′
NM_001001777b
tGSTA2 tGSTA3 tGSTA4
NM_001001776b NM_204818c M38219d
UPM: Universal Primer Mix (Clontech), NUP: Nested Universal Primer (Clontech). a tGSTA1.1, tGSTA1.2, tGSTA1.3. b Liu et al., 1993. c Hsieh et al., 1999. d Chang et al., 1992.
intergenic regions. Gene-specific primers anchored in exons 7 and 2 of adjacent genes were designed to bridge the sequences between the three A1 genes and the A3/A1 and A1/A2 spacers. PCR reactions were performed with BAC DNA as template using Long Range Taq Mastermix (Qiagen). Amplifications were performed for 35 cycles with 62 °C annealing temperature and 1 min/kb extension times. PCR products were either TA cloned using the pDrive vector (Qiagen) or digested with restriction endonucleases, ligated into a compatibly prepared vector (pBluescript KS+, Stratagene), and transformed into chemically competent DH5α cells (Invitrogen). Plasmids were purified with Qiagen plasmid minipreps and sequenced using vector-specific and internal primers. 2.4. Gene identification and annotation The assembled sequence was analyzed with Softberry FGENESH (http://linux1.softberry.com/all.htm) and the basic local alignment search tool (BLAST) to identify putative transcripts and homologies to known genes. Comparisons between predicted gene sequences, available ESTs, and the published chicken whole genome sequence were performed using Sequencher software (Gene Codes, Corp). Repetitive elements were identified using REPEATMASKER and Tandem Repeats Finder (http://tandem.bu.edu/trf/trf.basic.submit. html). GC content analysis was performed with 100 bp windows using Isochore (http://www.ebi.ac.uk/Tools/emboss/cpgplot/index.html). CpG islands were identified with the Softberry CpGfinder using default settings (http://linux1.softberry.com/all.htm). 2.5. Genetic mapping of α-class GST gene cluster In order to confirm position of the turkey α-class GST gene cluster on chromosome MGA2 as predicted by comparative sequence alignments, primers were designed to amplify GST introns to identify segregating polymorphisms in the UMN/NTBF mapping population (Reed et al., 2003). Targeted regions included intron 2 of tGSTA4,
intron 4 of tGSTA1 (A1.1), and introns 2 and 4 of tGSTA2. In chicken and quail, intron 2 of GSTA4 contains a microsatellite repeat (quail locus GUJ0099). Sequencing of the F1 individuals from the UMN/NTBF mapping population found a polymorphic tetranucleotide repeat (TATC)N also occurs within this intron in the turkey. Primers were designed for PCR amplification (Forward 5′-TTTTAAGTTTCCCCAGGCAG-3′ and Reverse 5′-CACACACTGTATCATACTGGAATTTAC-3′) and the locus was genotyped as described in Knutson et al. (2004). SNPs were identified in intron 4 of tGSTA1.1 (C/T) and in intron 4 of tGSTA2 (C/T) by resequencing. The SNP markers were genotyped (PCR/RFLP) across the UMN/NTBF mapping families by digestion of the PCR amplicons directly with restriction endonucleases (Dde I for GSTA1.1 and Bsp HI for GSTA2) followed by electrophoresis in 1% agarose and manual scoring of alleles. Two-point linkage analysis was performed in combination with previously genotyped markers using Locusmap software (Garbe & Da, 2003). 3. Results and discussion 3.1. Amplification of turkey α-class GST genes The full-length cDNAs of six α-class GST genes were isolated and amplified from turkey liver using 5′- and 3′-RACE. Availability of the extensive chicken EST database which is genetically close to turkey (http://www.ncbi.nlm.nih.gov/genome/guide/chicken/ enabled the design of gene-specific primers to amplify turkey α-class GST genes (Tables 1 and 2). Primers for cGSTA1 amplified the three related A1 genes, tGSTA1.1, tGSTA1.2 and tGSTA1.3. Predicted open reading frames (tGSTA1.1, 743 bp with ORF 663 bp; tGSTA1.2, 724 bp with ORF 666 bp; tGSTA1.3, 666 bp with ORF 666 bp; tGSTA2, 840 bp with ORF 669 bp; tGSTA3, 851 bp with ORF 672 bp; and tGSTA4, 845 bp with ORF 690 bp), were confirmed by PCR amplification with proofreading enzyme followed by DNA sequencing (Table 1). The resulting cDNA sequences are accessioned in GenBank (accession nos. GQ228399, GQ228400, GQ228401, GQ228402, GQ228403 and
Table 2 Summary of primers used to amplify the open reading frame of α-class GST fragments from turkey cDNA. Gene
Gene size (bp)
Name
Gene specific primers
GenBank accession
tGSTA1.1
663 666
tGSTA1.3
666
tGSTA2
669
tGSTA3
672
tGSTA4
690
5′-ATGTCTGGGAAGCCAGTTCTG-3′ 5′-TCA ATGGAAAATTGCCATCA-3′ 5′-ATGTCTGGGAAGCCAGTTCTG-3′ 5′-TCAGTGGAAAATTGCTATCACACT-3′ 5′-ATGTCTGGGAAGCCAGTTCT-3′ 5′-TCAACTGAAAATTGCCAGCAG-3′ 5′-ATGGCGGAGAAACCTAAGCTTCACTATACCA-3′ 5′-TAATGTGAGGAAAATATTCAGTTTCTAAGGCCGC-3′ 5′-ATGTCGGAGAAGCCCAGGCTCACCTA-3′ 5′-TCAGTCTAGCTTAAAAATTTTCATCACAGTTGC-3′ 5′-ATGGCTGCAAAACCTGTACTCTACTAC-3′ 5′-CTAATTTGGTTTTACATCATAATACATCCGG-3′
GQ228399
tGSTA1.2
A1.1_F A1.1_R A1.2_F A1.2_R A1.3_F A1.3_R A2_F A2_R A3_F A3_R A4_F A4_R
GQ228400 GQ228401 GQ228402 GQ228403 GQ228404
48
J.E. Kim et al. / Gene 452 (2010) 45–53
Table 3 PCR primers used to verify presence of GST genes within BAC clones prior to sequencing (A) and for amplification of A1 gene regions in BAC assembly (B). (A) GSTA1_prof GSTA1_pro GSTA1 2-3f GSTA1 2-3r GSTA1 3-4r GSTA1 3-4f GSTA2_int2f GSTA2_int2r GSTA3_prof GSTA3_pror
5′-TTAATTAATAATCAGCTGCTTTGC-3′ 5′-GCTAGCAGCCAGCGTACTG-3′ 5′-ATGGATCCCTGCTGTTCCAG-3′ 5′-CAAAGACTGGGAAATATCTGTTTG-3′ 5′-GCATCAGGCTTCGACTCTTC-3′ 5′-GACATGTATGTGGAAGGACTGG-3′ 5′-CTTCAGCTGCCAGGTTTG-3′ 5′-AACCCCAGCTGCTGCTAAC-3′ 5′-GCGTTATGCAAAGCAGAGC-3′ 5′-AGCGGATCGACTCCATTTTG-3′
(B) A1.1_2f A1.2_2f A1.3_2f A1.1_2r A1.2_2r A1.3_2r A1.1_3r A1.2_3r A1.3_3r A1_univ_4r A1_univ_5f A1.1_6f A1.2_6f A1.3_6f A1.1_7f A1.2_7f A1.3_7f A1.1_7r A1.2_7r A1.3_7r
5′-CTGCACTATCCCAACTCACG-3′ 5′-CTGCACTATGCTAATATACG-3′ 5′-CTGCACTATGTCAGTGTACG-3′ 5′-ATTCGGCCTCGTGAGTTGGG-3′ 5′-GGTTCCATTCGGCCTCGTATATTAGC-3′ 5′-ATTCGGCCGCGTACACTGAC-3′ 5′-TGTAACTTTTGGAGATCTTCCTTTTT-3′ 5′-TTTGGAGATCATCCTTAGTTTTCAG-3′ 5′-TGGAGATCTTCTTTTGTTTCCAG-3′ 5′-GGTTGTATTTCCCTGCGATG-3′ 5′-GTATGTGGAAGGAWTGGCAG-3′ 5′-CCATTTTAGTGGTGGAAGAGC-3′ 5′-TTTTGGGGTTGGAAGAGTTG-3′ 5′-TTTAATGGTGGAAGAGTTCAAGC-3′ 5′-GCCAGAGGAAACCACCTTTAC-3′ 5′-GCGCAAAGAAACCACTGATTC-3′ 5′-GCCCAAGGAAACCACCTCTAC-3′ 5′-GGAAAATTGCCATCAGACTTG-3′ 5′-GGAAAATTGCTATCACACTTG-3′ 5′-TGAAAATTGCCAGCAGGTTTG-3′
GQ228404, Fig. 1 and Table 2). The open reading frame of tGSTA1.1 (663 bp) lacks three nucleic acids compared to tGSTA1.2 (666 bp), tGSTA1.3 (666 bp) and chicken GSTA1 (666 bp). Significance of the missing three nucleic acids (single codon) is not yet known. A functional characterization of the E. coli-expressed proteins from these genes is currently underway in our laboratory. The GSTA gene cluster was physically mapped within a single BAC clone (Fig. 2). Since only a few ESTs corresponding to the α-class tGSTs are accessioned in Genbank databases, there is little information regarding the relative expression patterns of the individual genes in turkeys. However, examination of chicken ESTs shows differential presence of individual transcripts suggestive of expression differences. Although only a single GSTA1 sequence has been described in the chicken, EST evidence indicates presence of three A1-like transcripts as seen in the turkey. 3.2. BAC contig assembly Because of the low quality assembly and annotation of the α-class GST cluster in the chicken genome (Build 2), the turkey GST genes could not be correctly aligned, necessitating identification and sequencing of a turkey GST BAC clone. Approximately 16,000 454 sequence reads were generated from the CHORI-260 BAC clone 37H15. Removal of pTARBAC2.1 vector sequence left a 222,565 bp insert of approximately 12X coverage (Fig. 2A). The BAC insert ended in the terminal exon of the gamma-glutamylcysteine synthetase gene (GCLC) and the fourth exon of transmembrane protein 14A (TMEM14A). Several repetitive DNA types were identified in the GST BAC (Fig. 2B) comprising almost 24 kb of the 222.5 kb sequence. These included numerous CR1/LTR and simple sequence repeats. Two large complex repeats were identified including an approximately 450 bp GGAAA/GGCAA pentameric repeat located at 9.6 kb and a second repeat (CATTTTTTCTTTTTTTTTT) of approximately 650 bp located at 135.9 kb. The turkey GST BAC had an overall GC content of 42.4%.
Notable spikes occurred at 31.5 and 122 kb where GC content exceeded 80% (Fig. 2C). Additional GC spikes are associated with the α-class GSTs. These regions of high GC content correspond to eight CpG islands detected with CpGfinder. A single non-coding 7SK snRNA sequence was found at 145.2 kb. This ncRNA appears to be widely conserved in vertebrates being present in the human genome as well as the chicken. The final assembly was annotated and submitted to Genbank (accession no. GQ254850). 3.3. Gene identification and annotation Based on BLAST homologies, FGENESH, and EST analysis, the 222.5 kb region contained 15 predicted genes (Fig. 2A). These include the six α-class GSTs (tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3, and tGSTA4) identified by RACE, the ELOVL5 (Elongation of very long chain fatty acids) homolog, GCM (glial cells missing homolog 1), FBX09 (F-box protein 9), ICK (intestinal cell (MAK-like) kinase), a sequence similar to transcribed locus BI335628, and two predicted genes not supported by EST data. Partial coding sequences are also included for GCLC and THEM14A as previously discussed. Single amino acid differences were observed between the tGSTA2, tGSTA3, and tGSA4 ORFs in the BAC clone versus those amplified by RACE. These differences can be attributed to the different DNA sources used for RACE amplification (Nicholas commercial strain) and the BAC clone (Chaves et al., 2009). 3.4. Genetic mapping of GST α-class To verify position of the α-class GST in the turkey genome, a polymorphic tetranucleotide repeat (tGUJ099) within intron 2 of tGSTA4 (cGSTCL3) and SNPs within tGSTA1.1 and tGSTA2 were genotyped across the UMN/NTBF mapping families. The number of informative meioses was 171 for tGUJ099, 168 for the tGSTA1.1 SNP, and 124 for tGSTA2 SNP. Significant genetic linkage (LOD N 3.0) was observed between tGUJ099 and 10 previously linked loci on MGA2 (Table 4). As expected, this microsatellite was also linked to both GST SNPs and the SNPs were linked to each other (θ = 0.085, LOD = 19.53) and to a subset of the loci found linked to tGUJ099. These results place the turkey GST genes on the distal q arm of chromosome 2 (MGA2) which is homologous to chicken chromosome 3 (GGA3; Reed et al., 2007). 3.5. GST nomenclature Nomenclature for turkey cytosolic GSTs should reflect primary structural similarities, the division of GSTs into classes of more closely related sequences (Mannervik et al., 1992; Mannervik et al., 2005), and the position of the α-class GST genes within the sequence cluster as aligned with the human genome sequence (conserved synteny, Fig. 2D). Amino acid similarities among the tGSTs ranged from 62% to 86% with an average of 70%. This is similar to that observed in chicken where similarities range from 64% to 71% (average 68%, Table 5) and comparable values are seen among human GSTAs (Table 6). Turkey and chicken GSTs are on average 95% similar in amino acid sequence (Table 5) indicating these represent orthologues (only a single GSTA1 gene has been formally described in the chicken although three genes were identified in accessioned ESTs). Given the observed synteny between the human and turkey αclass gene cluster and flanking genes, we have designated three of the turkey α-class genes as follows: tGSTA4 ( = hGSTA4 and cGST-CL3), tGSTA3 ( = hGSTA3 and cGSTA3) and tGSTA2 ( = hGSTA2 and cGSTA2). Nomenclature of the remaining “tGSTA1-like” genes is problematic given their close DNA sequence and amino acid similarities. We have provisionally designated the three tGSTA1-like genes as tGSTA1.1, tGSTA1.2 and tGSTA1.3 pending future functional assays. Highest amino acid similarity is seen among the three tGSTA1 genes (average
J.E. Kim et al. / Gene 452 (2010) 45–53
49
Fig. 1. Alignment of nucleotide sequences corresponding to the coding regions of six α-class GST genes amplified from turkey liver. tGSTA1.1 (Gene Bank accession no. GQ228399), tGSTA1.2 (GQ228400), tGSTA1.3 (GQ228401), tGSTA2 (GQ228402), tGSTA3 (GQ228403) and tGSTA4 (GQ228404). Periods denote identical bases and dashes denote gaps inserted for alignment.
83%) with GSTA1.2 and GSTA1.3 being the most similar (86%, Table 5). When compared to the human GST sequences the tGSTA1 genes are slightly more similar to hGSTA1 (average 63.6% similarity) than to other human α-class GST genes: hGSTA2 (62.6%), hGSTA3 (62.6%), hGSTA4 (59%) and hGSTA5 (61.3%) (Table 6). The degree of shared synteny between turkey and human GST orthologues is interesting given the estimated divergence of the avian lineage from mammals 300–350 million years ago (Mya) (Kumar and Hedges, 1998). Presence of orthologous genes on homologous
chromosome segments (conserved synteny) reflects both common phylogenetic origin and ancestral genomic organization (Andersson et al., 1996; O'Brien et al., 1993). Examples of this are seen on human chromosome 9 (HSA9) where homologs for 11 of 18 genes found on the chicken Z chromosome are located (Nanda et al., 1999; Nanda et al., 2000), and the GST locus where α-class GSTs and flanking genes are shared between human (HSA6) and turkey (MGA2). While conservation of gene order indicates ancestral genomic organization, conservation of gene clusters is indicative of local gene
50 J.E. Kim et al. / Gene 452 (2010) 45–53 Fig. 2. Sequence features of the turkey a-class GST cluster. (A) Genes and orientation as predicted within the turkey GST BAC. GST genes are indicated in black and other genes with supporting EST data are in gray. Genes predicted in silico are white. (B) Position and type of repetitive elements identified within clone 37H15. (C) GC content calculated by continuous 100 bp windows. Arrowheads denote position of CpG islands. (D) Homologous human sequence (∼0.8 Mb) from 6p12.1-12.2 showing position of predicted genes. Genes are coded as in A.
J.E. Kim et al. / Gene 452 (2010) 45–53 Table 4 Pairwise linkage analysis of GST markers in the UMN/NTBF mapping population. GST locus
Linked loci
Theta
LOD
tGUJ099
GSTA1.1SNP GSTA2SNP MNT045 MNT070 MNT080 MNT155 MNT217 MNT329 MNT379 MNT382 MNT415 RHT259 GSTA2SNP MNT045 MNT080 MNT155 MNT217 MNT329 MNT382 MNT415 RHT259 MNT080 MNT217 MNT329 MNT382 MNT415 RHT259
0.025 0.097 0.349 0.388 0.238 0.159 0.022 0.284 0.378 0.023 0.064 0.185 0.085 0.362 0.238 0.105 0.043 0.266 0.047 0.093 0.195 0.311 0.135 0.314 0.088 0.156 0.234
37.66 18.23 4.76 3.01 10.3 4.87 11.75 10.3 3.00 10.88 15.83 19.68 19.53 4.17 10.59 5.88 10.27 12.62 9.43 13.11 18.26 4.01 4.77 5.09 5.83 6.37 10.00
GSTA1.1SNP
GSTA2SNP
51
Table 6 Amino acid sequence similarities among turkey and human α-class GSTs.
tGSTA1.1 tGSTA1.2 tGSTA1.3 tGSTA2 tGSTA3 tGSTA4 hGSTA1 hGSTA2 hGSTA3 hGSTA4
hGSTA1
hGSTA2
hGSTA3
hGSTA4
hGSTA5
65 62 64 69 64 62
63 62 63 69 64 62 95
64 61 63 68 63 62 90 88
61 58 58 59 61 61 53 54 53
63 60 61 69 62 62 90 88 85 53
proteins are divided into four motifs with conserved residues: (1) 15– 29 aa (xMExxxWLLAAAGVE), (2) 82–98 aa (YGKDxKERAxIDMYVxG), (3) 134–148 aa (PVxEKVLKxHGxxxL) and (4) 191–208 aa (PxIKKFLxPGSxxKPxxx). Interestingly, tGSTA1.1 contains only three motifs (1, 2 and 4) (Fig. 3) due to lack of one amino acid (position 142) within the signature motif. This gene (220aa) has 91% sequence similarity with the single described cGSTA1 (221aa) (Table 5). Since a single point mutation in the hydrophobic substrate-binding site region is enough to shift substrate specificity from class π to α (Dirr et al., 1994; Nuccetelli et al., 1998), it is possible that these differences may explain substrate specificities of the turkey forms of GSTA. Turkey liver cytosolic GSTs are active toward prototypical substrates, such as chlorodinitrobenezene (CDNB) and dichlornitrobenzene (DCNB), but not toward AFBO, a condition posited to be a critical determinant for the extreme sensitivity of turkeys toward AFB1 (Klein et al., 2000; Klein et al., 2002, 2003). The functional characteristics and substrate specificities of each of these genes, and the possible effects of specific sequences and domains therein, will be confirmed in experiments using E. coli-expressed proteins, which is currently underway in our laboratory.
duplications that occurred early in vertebrate evolution. One example is the melanocortin receptors (MC2R, MC5R, and MC4R) in chicken (GGA2), humans (HSA18), and other mammals where gene clusters appear to reflect ancient local gene duplication (Schioth et al., 2003). The turkey α-class GST cluster appears to contain both genes of ancient local duplication (GSTA2-4) and others of more recent events (GSTA1.1, A1.2 and A1.3).
4. Conclusions 3.6. Turkey α-class GST domains The extreme sensitivity of turkeys is strongly associated with unresponsiveness of hepatic GSTs toward AFBO. We have shown that while turkey livers contain catalytically-active GSTs, none of which possess affinity toward AFBO (Klein et al., 2000; Klein et al., 2002, 2003), a situation similar in humans where constitutively expressed hepatic α-class GSTs have little or no AFBO detoxifying activity (Raney et al., 1992; Slone et al., 1995). Despite the large impact of this mycotoxin to the poultry industry, there is little information about the functional characteristics of avian GSTs, especially in the context of AFB1 detoxification. To our knowledge, this is the first study to fully amplify, identify, sequence and map turkey α-class GSTs. Comparative genomic approaches were used to genetically map the α-class GSTcluster to turkey chromosome MGA2 and the observed synteny between turkey and human α-class GSTs are reflected in
The alignment of six a-class GST proteins demonstrated that all six genes encode α-class tGST proteins based on two conserved domains and four signature motifs (Fig. 3). PROSITE (http://www.expasy.org/ prosite/) and BLOCKS (http://www.blocks.fhcrc.org/) queries for conserved domains of α-class of tGSTs revealed the presence of an Nterminal thioredoxin conserved domain (3–83 amino acids) and a Cterminal conserved α-helical domain (tGSTA1.1, tGSTA1.2 and tGSTA4: 85–207 aa: tGSTA1.3 and tGSTA2: 85–208 aa; tGSTA3: 85–209 aa). PANTHER (http://www.pantherdb.org/) and BLOCK searches revealed four putative motifs predicting high catalytic activity toward cumene hydroperoxide and 7-chloro-4-nitrobenz-2-oxa-1,3-diazole (NBD), amongst other substrates. In addition, α-class tGSTs exhibit a number of differences from the characteristic GST structure (Dirr et al., 1994). The signature motifs and conserved residues of α-class tGST Table 5 Amino acid sequence similarities among turkey and chicken α-class GSTs. tGSTA1.1 tGSTA1.1 tGSTA1.2 tGSTA1.3 tGSTA2 tGSTA3 tGSTA4 cGSTA1 cGSTA2 cGSTA3 cGSTA-CL3
tGSTA1.2
tGSTA1.3
tGSTA2
tGSTA3
tGSTA4
cGSTA1
cGSTA2
cGSTA3
cGSTA-CL3
80
83 86
70 69 71
65 65 66 68
62 63 64 70 68
91 81 82 71 66 63
70 69 71 99 68 70 71
66 63 67 68 94 67 66 68
63 63 65 71 69 97 64 70 69
52
J.E. Kim et al. / Gene 452 (2010) 45–53
Fig. 3. Alignment of predicted amino acid sequence of tGSTA1.1, tGSTA1.2, tGSTA1.3, tGSTA2, tGSTA3 and tGSTA4. Amino acid alignment of six GSTs from turkey liver. The conserved N-terminal thioredoxin domain (3–83 amino acids) is outlined in dotted line box; the conserved C-terminal α-helical domain (85–207 amino acids) is outlined in solid line box. Signature motifs and specific conserved residues of α-class tGSTs (shaded boxes) are indicated in (1) 15–29 aa (xMExxxWLLAAAGVE), (2) 82–98 aa (YGKDxKERAxIDMYVxG ), (3) 134–148 aa (PVxEKVLKxHGxxxL) and (4) 191–208 aa (PxIKKFLxPGSxxKPxxx). A single amino acid (142 aa) is missing in tGSTA1.1 (2).
annotation of turkey GSTAs. Comparative gene mapping is an effective tool for the study of genome evolution in phylogenetically distant species (turkey, chicken and human) that represent key stages in vertebrate evolution (O'Brien et al., 1993). The GST cluster provides insight into the origin and evolution of duplicated gene families. Identifying the complete sequence of the turkey α-class GSTs is the first and necessary step in discovering SNPs and other markers associated with AFB1 susceptibility and resistance in turkeys. All six GSTAs contained two conserved GST domains: the GSHbinding site (G subsite) and the hydrophobic substrate-binding site (H subsite) which is subject to variation across the classes (Allardyce et al., 1999). The presence of four signature motifs in turkey GSTs (with the exception of tGSTA1.1 which lacked one motif) suggests the presence of intact GSTAs in turkey livers. While some GSTs share substrate specificities, there are distinct differences in substrate preference between subfamilies. Sequence similarity between classes is rather low, ranging between 20% and 30% (Nuccetelli et al., 1998). Heterologously-expressed proteins from each GSTA are currently being functionally characterized to determine substrate specificities, as well as the possible effect of the absence of motifs. Certain detoxification enzymes such as GSTs are reported to be transcriptionally regulated through antioxidant response elements (AREs). Expression of the ABO metabolizing Gsta3 regulated by the Nrf2 transcription factor through an antioxidant response element was reported in mice (Hayes et al., 2000; Jowsey et al., 2003). Based on our complete sequences of tGSTA (Genbank accession no. GQ254850), we have identified several putative transcription factors in the 5′-regulatory elements of these GSTs (data not shown), and their significance in GST regulation to AFB1 is the subject of future studies. Our genomic approach provides the framework necessary to identifying genetic markers related to AFB1 susceptibility and
resistance in turkeys with the ultimate goal of re-introducing AFB1protective alleles into commercial populations. Acknowledgements The authors thank L.D. Chaves for assistance in BAC screening and sequence annotation. We also thank Dr. Lynn Bagley of the Moroni Feed Cooperative for generously providing turkeys and feed for this study. This research was supported in part by NRI competitive grant 2004-35205-14217 from the USDA-CSREES, by competitive grant 2007-35205-17880 from the USDA CSREES, Animal Genome program, and support from the Minnesota, and Utah and Agricultural Experiment Stations, where this is published as paper 8122. References Allardyce, C.S., McDonagh, P.D., Lian, L.Y., Wolf, C.R., Roberts, G.C., 1999. The role of tyrosine-9 and the C-terminal helix in the catalytic mechanism of Alpha-class glutathione S-transferases. Biochem. J. 343 (Pt 3), 525–531. Andersson, L., Archibald, A., Ashburner, M., Audun, S., Barendse, W., Bitgood, J., Bottema, C., Broad, T., Brown, S., Burt, D., Charlier, C., Copeland, N., Davis, S., Davisson, M., Edwards, J., Eggen, A., Elgar, G., Eppig, J.T., Franklin, I., Grewe, P., Gill 3rd, T., Graves, J.A., Hawken, R., Hetzel, J., Womack, J., et al., 1996. Comparative genome organization of vertebrates. The First International Workshop on Comparative Genome Organization. Mamm. Genome 7, 717–734. Board, P.G., 1998. Identification of cDNAs encoding two human alpha class glutathione transferases (GSTA3 and GSTA4) and the heterologous expression of GSTA4-4. Biochem. J. 330 (Pt 2), 827–831. Board, P.G., Webb, G.C., 1987. Isolation of a cDNA clone and localization of human glutathione S-transferase 2 genes to chromosome band 6p12. Proc. Natl. Acad. Sci. U. S. A. 84, 2377–2381. Chang, L.H., Chuang, L.F., Tsai, C.P., Tu, C.P., Tam, M.F., 1990. Characterization of glutathione S-transferases from day-old chick livers. Biochem. 29, 744–750. Chang, L.H., Fan, J.Y., Liu, L.F., Tsai, S.P., Tam, M.F., 1992. Cloning and expression of a chick liver glutathione S-transferase CL 3 subunit with the use of a baculovirus expression system. Biochem. J. 281 (Pt 2), 545–551.
J.E. Kim et al. / Gene 452 (2010) 45–53 Chaves, L.D., Harry, D.E., Reed, K.M., 2009. Genome-wide genetic diversity of ‘Nici’, the DNA source for the CHORI-260 turkey BAC library and candidate for whole genome sequencing. Anim. Genet. 40, 348–352. Coles, B.F., Kadlubar, F.F., 2005. Human alpha class glutathione S-transferases: genetic polymorphism, expression, and susceptibility to disease. Methods Enzymol. 401, 9–42. Coulombe Jr, R.A., 1993. Biological action of mycotoxins. J. Dairy Sci. 76, 880–891. Dirr, H., Reinemer, P., Huber, R., 1994. X-ray crystal structures of cytosolic glutathione Stransferases. Implications for protein architecture, substrate recognition and catalytic function. Eur. J. Biochem. 220, 645–661. Eaton, D.L., Bammler, T.K., 1999. Concise review of the glutathione S-transferases and their significance to toxicology. Toxicol. Sci. 49, 156–164. Frova, C., 2006. Glutathione transferases in the genomics era: new insights and perspectives. Biomol. Eng. 23, 149–169. Garbe, J., Da, Y., 2003. Locusmap user manual Version 1.1. Department of Animal Science, University of Minnesota, St. Paul. Giambrone, J.J., Diener, U.L., Davis, N.D., Panangala, V.S., Hoerr, F.J., 1985. Effects of aflatoxin on young turkeys and broiler chickens. Poult. Sci. 64, 1678–1684. Hamilton, P.B., Tung, H.T., Harris, J.R., Gainer, J.H., Donaldson, W.E., 1972. The effect of dietary fat on aflatoxicosis in turkeys. Poult. Sci. 51, 165–170. Hayes, J.D., Chanas, S.A., Henderson, C.J., McMahon, M., Sun, C., Moffat, G.J., Wolf, C.R., Yamamoto, M., 2000. The Nrf2 transcription factor contributes both to the basal expression of glutathione S-transferases in mouse liver and to their induction by the chemopreventive synthetic antioxidants, butylated hydroxyanisole and ethoxyquin. Biochem. Soc. Trans. 28, 33–41. Hayes, J.D., Flanagan, J.U., Jowsey, I.R., 2005. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 45, 51–88. Hayes, J.D., Judah, D.J., McLellan, L.I., Kerr, L.A., Peacock, S.D., Neal, G.E., 1991a. Ethoxyquininduced resistance to aflatoxin b1 in the rat is associated with the expression of a novel alpha-class glutathione S-transferase subunit, Yc2, which possesses high catalytic activity for aflatoxin B1-8,9-epoxide. Biochem. J. 279, 385–398. Hayes, J.D., Judah, D.J., McLellan, L.I., Neal, G.E., 1991b. Contribution of the glutathione stransferases to the mechanisms of resistance to aflatoxin B1. Pharmac. Ther. 50, 443–472. Hayes, J.D., Pulford, D.J., 1995. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit. Rev. Biochem. Mol. Biol. 30, 445–600. Hsiao, C.D., Martsen, E.O., Lee, J.Y., Tsai, S.P., Tam, M.F., 1995. Amino acid sequencing, molecular cloning and modelling of the chick liver class-theta glutathione Stransferase CL1. Biochem. J. 312 (Pt 1), 91–98. Hsieh, C.H., Liu, L.F., Tsai, S.P., Tam, M.F., 1999. Characterization and cloning of avianhepatic glutathione S-transferases. Biochem. J. 343 (Pt 1), 87–93. Jowsey, I.R., Jiang, Q., Itoh, K., Yamamoto, M., Hayes, J.D., 2003. Expression of the aflatoxin B1-8,9-epoxide-metabolizing murine glutathione S-transferase A3 subunit is regulated by the Nrf2 transcription factor through an antioxidant response element. Mol. Pharmacol. 64, 1018–1028. Kelner, M.J., Stokely, M.N., Stovall, N.E., Montoya, M.A., 1996. Structural organization of the human microsomal glutathione S-transferase gene (GST12). Genomics 36, 100–103. Klein, P.J., Buckner, R., Kelly, J., Coulombe Jr, R.A., 2000. Biochemical basis for the extreme sensitivity of turkeys to aflatoxin B(1). Toxicol. Appl. Pharmacol. 165, 45–52. Klein, P.J., Van Vleet, T.R., Hall, J.O., Coulombe Jr, R.A., 2002. Biochemical factors underlying the age-related sensitivity of turkeys to aflatoxin B(1). Comp. Biochem. Physiol. C Toxicol. Pharmacol. 132, 193–201. Klein, P.J., Van Vleet, T.R., Hall, J.O., Coulombe Jr, R.A., 2003. Effects of dietary butylated hydroxytoluene on aflatoxin B1-relevant metabolic enzymes in turkeys. Food Chem. Toxicol. 41, 671–678. Knutson, T.P., Chaves, L.D., Hall, M.K., Reed, K.M., 2004. One hundred fifty-four genetic markers for the turkey (Meleagris gallopavo). Genome 47, 1015–1028. Konishi, T., Kato, K., Araki, T., Shiraki, K., Takagi, M., Tamaru, Y., 2005. Molecular cloning and characterization of alpha-class glutathione S-transferase genes from the hepatopancreas of red sea bream, Pagrus major. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140, 309–320. Kubena, L.F., Edrington, T.S., Kamps-Holtzapple, C., Harvey, R.B., Elissalde, M.H., Rottinghaus, G.E., 1995. Effects of feeding fumonisin B1 present in Fusarium moniliforme culture material and aflatoxin singly and in combination to turkey poults. Poult. Sci. 74, 1295–1303. Kumar, S., Hedges, S.B., 1998. A molecular timescale for vertebrate evolution. Nature 392, 917–920. Liu, L.F., Liaw, Y.C., Tam, M.F., 1997. Characterization of chicken-liver glutathione Stransferase (GST) A1-1 and A2-2 isoenzymes and their site-directed mutants heterologously expressed in Escherichia coli: identification of Lys-15 and Ser-208 on cGSTA1-1 as residues interacting with ethacrynic acid. Biochem. J. 327 (Pt 2), 593–600. Liu, L.F., Tam, M.F., 1991. Nucleotide sequence of a class mu glutathione S-transferase from chicken liver. Biochim. Biophys. Acta 1090, 343–344.
53
Liu, L.F., Wu, S.H., Tam, M.F., 1993. Nucleotide sequence of class-alpha glutathione Stransferases from chicken liver. Biochim. Biophys. Acta 1216, 332–334. Mannervik, B., Awasthi, Y.C., Board, P.G., Hayes, J.D., Di Ilio, C., Ketterer, B., Listowsky, I., Morgenstern, R., Muramatsu, M., Pearsons, W.R., Pickett, C.B., Sato, K., Widersten, M., Wolf, C.R., 1992. Nomenclature for human glutathione transferase. Biochem. J. Lett. 282, 305–308. Mannervik, B., Board, P.G., Hayes, J.D., Listowsky, I., Pearson, W.R., 2005. Nomenclature for mammalian soluble glutathione transferases. Methods Enzymol. 401, 1–8. Mannervik, B., Danielson, U.H., 1988. Glutathione transferases–structure and catalytic activity. CRC Crit. Rev. Biochem. 23, 283–337. Morel, F., Rauch, C., Coles, B., Le Ferrec, E., Guillouzo, A., 2002. The human glutathione transferase alpha locus: genomic organization of the gene cluster and functional characterization of the genetic polymorphism in the hGSTA1 promoter. Pharmacogenet. Genom. 12, 277–286. Nanda, I., Shan, Z., Schartl, M., Burt, D.W., Koehler, M., Nothwang, H., Grutzner, F., Paton, I.R., Windsor, D., Dunn, I., Engel, W., Staeheli, P., Mizuno, S., Haaf, T., Schmid, M., 1999. 300 million years of conserved synteny between chicken Z and human chromosome 9. Nat. Genet. 21, 258–259. Nanda, I., Zend-Ajusch, E., Shan, Z., Grutzner, F., Schartl, M., Burt, D.W., Koehler, M., Fowler, V.M., Goodwin, G., Schneider, W.J., Mizuno, S., Dechant, G., Haaf, T., Schmid, M., 2000. Conserved synteny between the chicken Z sex chromosome and human chromosome 9 includes the male regulatory gene DMRT1: a comparative (re)view on avian sex determination. Cytogenet. Cell Genet. 89, 67–78. Newberne, P.M., Butler, W.H., 1969. Acute and chronic effects of aflatoxin on the liver of domestic and laboratory animals: a review. Cancer Res. 29, 236–250. Nuccetelli, M., Mazzetti, A.P., Rossjohn, J., Parker, M.W., Board, P., Caccuri, A.M., Federici, G., Ricci, G., Lo Bello, M., 1998. Shifting substrate specificity of human glutathione transferase (from class Pi to class alpha) by a single point mutation. Biochem. Biophys. Res. Commun. 252, 184–189. O'Brien, S.J., Womack, J.E., Lyons, L.A., Moore, K.J., Jenkins, N.A., Copeland, N.G., 1993. Anchored reference loci for comparative genome mapping in mammals. Nat. Genet. 3, 103–112. Pier, A.C., Richard, J.L., Cysewski, S.J., 1980. Implications of mycotoxins in animal disease. J. Am. Vet. Med. Assoc. 176, 719–724. Ramsdell, H.S., Eaton, D.L., 1990. Mouse liver glutathione S-transferase isoenzyme activity toward aflatoxin B1-8,9-epoxide and Benzo(a)pyrene-7,8-dihydrodiol9,10-epoxide. Toxicol. Appl. Pharm. 105, 216–225. Raney, K.D., Meyer, D.J., Ketterer, B., Harris, T.M., Guengerich, F.P., 1992. Glutathione conjugation of aflatoxin B1 exo- and endo-epoxides by rat and human glutathione S-transferases. Chem. Res. Toxicol. 5, 470–478. Rawal, S., R.K., Mendoza, K.M., Reed, K.M., Coulombe, R.A., 2009. Structure, genetic mapping, and function of the cytochrome P450 3A37 gene in the turkey (Meleagris gallopavo). Cytogenet. Genome Res. 125, 67–73. Reed, K.M., Chaves, L.D., Garbe, J.R., Da, Y., Harry, D.E., 2003. Allelic variation and genetic linkage of avian microsatellites in a new turkey population for genetic mapping. Cytogenet. Genome Res. 102, 331–339. Reed, K.M., Chaves, L.D., Mendoza, K.M., 2007. An integrated and comparative genetic map of the turkey genome. Cytogenet. Genome Res. 119, 113–126. Ross, M.T., LaBrie, S., McPherson, J.D., Stanton, V.P., 1999. Screening large-insert libraries by hybridization. In: Dracopoli, N.C., et al. (Ed.), Current protocols in human genetics. Wiley, New York, pp. 5.6.1–5.6.5. Salinas, A.E., Wong, M.G., 1999. Glutathione S-transferases—a review. Curr. Med. Chem. 6, 279–309. Schioth, H.B., Raudsepp, T., Ringholm, A., Fredriksson, R., Takeuchi, S., Larhammar, D., Chowdhary, B.P., 2003. Remarkable synteny conservation of melanocortin receptors in chicken, human, and other vertebrates. Genomics 81, 504–509. Slone, D.H., Gallagher, E.P., Ramsdell, H.S., Rettie, A.E., Stapleton, P.L., Berlad, L.G., Eaton, D.L., 1995. Human variability in hepatic glutathione S-transferase-mediated conjugation of aflatoxin B1-epoxide and other substrates. Pharmacogenet. Genom. 5, 224–233. Sun, Y.J., Kuan, I.C., Tam, M.F., Hsiao, C.D., 1998. The three-dimensional structure of an avian class-mu glutathione S-transferase, cGSTM1-1 at 1.94 A resolution. J. Mol. Biol. 278, 239–252. Swenson, D.H., Miller, J.A., Miller, E.C., 1975. The reactivity and carcinogenicity of aflatoxin B1-2,3-dichloride, a model for the putative 2,3-oxide metabolite of aflatoxin B1. Cancer Res. 35, 3811–3823. Thomson, A.M., Meyer, D.J., Hayes, J.D., 1998. Sequence, catalytic properties and expression of chicken glutathione-dependent prostaglandin D2 synthase, a novel class Sigma glutathione S-transferase. Biochem. J. 333 (Pt 2), 317–325. Wang, C., Bammler, T.K., Eaton, D.L., 2002. Complementary DNA cloning, protein expression, and characterization of alpha-class GSTs from Macaca fascicularis liver. Toxicol. Sci. 70, 20–26. Yeung, T.C., Gidari, A.S., 1980. Purification and properties of a chicken liver glutathione S-transferase. Arch. Biochem. Biophys. 205, 404–411. Yip, S.S., Coulombe Jr., R.A., 2006. Molecular cloning and expression of a novel cytochrome p450 from turkey liver with aflatoxin B1 oxidizing activity. Chem. Res. Toxicol. 19, 30–37.