- Email: [email protected]
Comparative molecular characterization of ADSS1 and ADSS2 genes in pig (Sus scrofa)
Comparative Biochemistry and Physiology, Part B 147 (2007) 271 – 277 www.elsevier.com/locate/cbpb
Comparative molecular characterization of ADSS1 and ADSS2 genes in pig (Sus scrofa) Xinyun Li a,b , Zhengmao Zhu a , Delin Mo a,b , Heng Wang a,b , Shulin Yang a , Shuhong Zhao b , Kui Li a,⁎ a
Department of Gene and Cell Engineering, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100094, PR China The Key Laboratory of Animal Genetics, Breeding and Reproduction of Ministry of Education of China, Huazhong Agricultural University, Wuhan 430070, PR China
b
Received 11 September 2006; received in revised form 17 January 2007; accepted 19 January 2007 Available online 1 February 2007
Abstract Adenylosuccinate synthetase (ADSS) catalyzes the key step of AMP synthesis. Vertebrates have two isozymes of ADSS, which are named ADSS1 and ADSS2, respectively. In this study, we cloned porcine ADSS1 and ADSS2 genes and comparatively analyzed their sequence, chromosome mapping, mRNA distribution and subcellular localization. According to our results, the ADSS1 gene was predominantly expressed in the striated muscle tissues, while ADSS2 gene distributed widely in all the tissues detected. Additionally, ADSS1 gene was up-regulated significantly along with porcine muscle growth, and ADSS2 gene expression was more constant during the muscle development. Porcine ADSS1 gene was assigned to SSC7q and the linked marker was SSC12B09, ADSS2 gene was mapped on SSC10p and the linked marker was SW497, and porcine ADSS2 protein was subcellular localized in mitochondria. Moreover, we found that one single nucleotide polymorphism (SNP, T/C70) in the ninth intron of ADSS2 gene was significantly associated with average daily gain trait (ADG, P < 0.05) and loin muscle area trait (P < 0.05). © 2007 Elsevier Inc. All rights reserved. Keywords: Adenylosuccinate synthetase; ADSS1; ADSS2; Pig; SNP; Sus scrofa
1. Introduction Adenylosuccinate synthetase (ADSS) catalyzes the key step of AMP synthesis (Lowenstein, 1972). The reaction is as follows: IMP + L-Asp + GTP ↔ adenylosuccinate + GDP + phosphate. Prokaryotes only have one form of ADSS which participates in the de novo synthesis of AMP. While vertebrates have two different ADSS isozymes, one is the basic form (ADSS1) and the other is the acidic form (ADSS2) (Guicherit et al., 1991, 1994). ADSS1 participates in the important process of purine nucleotide cycle (PNC) whereas ADSS2 catalyzes the de novo synthesis of AMP (Stayton et al., 1983; Honzatko et al., 1999).
⁎ Corresponding author. Tel./fax: +86 10 62813822. E-mail addresses: [email protected], [email protected] (K. Li). 1096-4959/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2007.01.013
PNC plays an important role in energy metabolism in striated muscle tissues. During brief periods of intense muscle contraction, a large portion of the ATP is hydrolyzed and converted to AMP, which is then converted to IMP and ammonia to meet the immediate energy requirement (Tullson and Terjung, 1991a,b; Lewis et al., 1996). The concentration of IMP is increased by several folds during intense muscle contraction (Westra et al., 1986). Many myopathies such as fatigue and cramps could be associated with PNC disorder (Operti et al., 1998). AMP activates AMPK (AMP-activated protein kinase) by binding its gamma subunit (Cheung et al., 2000; Frederich and Balschi, 2002; Adams et al., 2004; Scott et al., 2004). AMPK is an important enzyme related to energy metabolism. It participates in the regulation of glucose transport, glycolysis, fatty acid oxidation, and the expression of genes associated with lipid and carbohydrate metabolisms (Hardie and Hawley, 2001; Ferre et al., 2003; Kemp et al., 2003; Leff, 2003). Therefore, study on the ADSS genes could contribute us to better understanding energy metabolism.
272
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Previous studies indicated that the genes involved in the energy metabolism were closely related to growth and carcass traits of pig. For example, the porcine melanocortin 4 receptor gene (MCR4) was associated with the ADG trait and fatness (Bruun et al., 2006). The porcine corticotropin-releasing hormone (CHR) gene was a candidate gene for the traits of loin muscle area, ADG and thickness of backfat (Murani et al., 2006). Porcine succinate dehydrogenase complex subunit D (SDHD) was associated with the loin muscle area trait (Zhu et al., 2005). The serum concentration of leptin was positively associated with the growth rate and negatively associated with the thickness of backfat trait (Berg et al., 2003), etc. We focus on ADSS genes' studies, which could be candidate genes of porcine growth and carcass traits. In this study, we cloned and mapped porcine ADSS1 and ADSS2 genes, and analyzed their expression pattern. We found one SNP (T/C70) in the ninth intron (GenBank accession no. EF204918) of porcine ADSS2 gene was significantly associated with ADG and loin muscle area traits (P < 0.05). 2. Materials and methods 2.1. Tissues used for expression pattern analysis The Longissimus dorsi muscle samples of Chinese indigenous Tongcheng pig embryos [33, 65, and 90 days postconception (dpc)] and postnatal periods (2, 28-day, and adult) were harvested, mixed, frozen in liquid nitrogen, and then stored at − 80 °C. Fifteen tissues samples were collected from Wuzhishan pigs' stomach, large intestine, kidney, lymph, small intestine, liver, heart, latissimus dorsi muscle, lung, gastrocnemius, biceps femoris muscle, brain, fat, semitendinosus and spleen. The Wuzhishan pig is one of the famous Chinese indigenous minipigs. Total RNA was extracted and treated with RNase-free DNase I (MBI Fermentas, St. Leon-Rot, Germany). Pig kidney epithelial cells (PK15 cells) were used for determining the subcellular localization of the porcine ADSS2 protein.
2.2. Molecular cloning and chromosome mapping of porcine ADSS genes According to the pig's ESTs (GenBank accession nos. CK458327, CK456903, DY432710, DY430646, DN128497 and AW315962) information, primers were designed for porcine ADSS1 gene isolation (Table 1). The full length cDNA sequence of porcine ADSS1 gene was isolated using rapid amplification of cDNA ends (RACE) method. The porcine ADSS2 gene full-length coding region sequence was presumed by directly assembling the pig ESTs (GenBank accession nos. CF789186, AJ657109, AJ660215, CF788513, CJ026527, BW976503, BP436983, BF713469 and BQ602346). The identity of the porcine ADSS2 gene was confirmed by reverse transcriptase polymerase chain reaction (RT-PCR) method. The PCR profile was 3 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at annealing temperature (Table 1), 50 s at 72 °C and a final extension of 5 min at 72 °C. All the PCR fragments were sequenced and assembled using software DNAstar (DNAstar Inc., Madison, WI, USA). The proteins coded by ADSS1 and ADSS2 were deduced by the Editseq program of DNAstar, and their isoelectric point (pI) was predicted by the tool available on http://us.expasy.org/tools/ pi_tool.html. The deduced amino acid sequences of porcine ADSS1 gene and ADSS2 gene were compared with the corresponding protein of other creatures, i.e. Human Homo sapiens (GenBank accession nos. ADSS1, NP_689541 and ADSS2, NP_001117), Mouse Mus musculus (GenBank accession nos. ADSS1, NP_031447 and ADSS2, NP_031448), African clawed frog Xenopus laevis (GenBank accession nos. highly similar to ADSS1, AAH93568 and ADSS2, AAH43896), Zebrafish Danio rerio (GenBank accession nos. highly similar to ADSS1, NP_999985 and ADSS2, NP_775344), Rat Rattus norvegicus (similar to ADSS1, XP_001072867 and similar to ADSS2 XP_222946), Dog Canis familiaris (similar to ADSS2, XP_537220), Cattle Bos taurus (similar to ADSS2 XP_869889). Consequently, phylogenetic tree was constructed
Table 1 Primers used for gene isolation, mapping, mRNA distribution and subcellular localization analysis Gene
Primer name
Primer and probe sequence (5′-3′)
PCR Tm (°C)
Size (bp)
ADSS1 cloning
ADSS1 mapping ADSS2 mapping ADSS1 expression
5′Race Nest 3′Race Nest P1L P1R P1′L P1′R P2L P2R P2′L P2′R P3L P4R Probe
Touchdown PCR a 60 62 68 62 60
1384 635 1679 892 234 356 174
ADSS2 expression
P3′L P3′R Probe
β-actin expression
P4L P4R Probe
ADSS2 Subcellular localization ADSS2 SNP detection
P5L P5R
CGAGGAGGGAACACGATTGTGGCTG CCAACCCATTTCACTGCCACT CCTTCCCCACCGAGCAGATCAACGA CCTTGACGAAGCTGGACATCCT CGGCAGAGCAGTTCAGTTCG GCACCATGAGCAGCAGGAG GGTGTGGGTAAATCCAGAGAGTC CATGTTGCCAGGCACAGTGTTG CAGCCACAATCGTGTTCCCTC CAGCTCCAACTGGACAGACAAC CCAGAGTTGGTATTGGTGCCTT CAACCTTGGCTCCTAATCTGCTC GCGTCTCGTACAAGCTGAGC CCACGAACCGGATGTAGCTC TTCCCAGCCAACCAGGAGATTCTGC GGCTGGACCTTGTTTTGCTC GTGTTCCATCCTGGGAGAGTC TGGATTTACCGCGTTGGCACTTACC GGATGCAGAAGGAGATCACG CTCGTCGTACTCCTGCTTGC ATCAAGATCATCGCGCCTCCAGAGC TCCTCGAGTCTCTGGAGCCATG GGATCCTGAAAGAGCTGAATCATAGACTCTCTGG
P6L P6R
CCAGAGTTGGTATTGGTGCCTT CAACCTTGGCTCCTAATCTGCTC
ADSS2 Cloning
a
The touchdown PCR program according to the SMART RACE Kit (Invitrogen, Carlsbad, CA, USA.
60
211
60
160
64
1395
62
356
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
273
by using the neighbor-joining's method (MEGA 3.1) with 1000 bootstrap replicates. The INRA-University of Minnesota's 7000 rads radiation hybrid panel (IMpRH) was employed for chromosome mapping of porcine ADSS1 and ADSS2 genes. The PCR for RH mapping was performed in a 10 μL mixture containing 1 × buffer (TaKaRa, Dalian, P. R. C.), 25 ng panel DNA, 0.3 μM each primer (Table 1), 75 μM each dNTP, 1.5 mM MgCl2, and 1.0 U Taq DNA polymerase (TaKaRa, Dalian, P. R. C.). The PCR profile consisted of 3 min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at annealing temperature (Table 1), 40 s at 72 °C, and a final 5 min extension at 72 °C. The data was analyzed with the IMpRH mapping tool (http://www.toulouse.inra.fr/lgc/pig/RH/ IMpRH.htm) (Milan et al., 2000).
Twenty-four hours after transfection, the cells were incubated at 37 °C for 30 min in the growth medium containing 200 nM MitoTracker Red CM-H2Xros (Molecular Probes, Eugene, Oregon, USA) for mitochondrial labeling, and then fixed at 37 °C for 15 min with 3.7% formaldehyde. The fixed cells were washed three times with PBS, and then incubated with 10 μg/mL Hoechst33342 for 10 min at room temperature. Finally, the slides were mounted, sealed and analyzed by confocal microscopy (FV-1000). Olympus confocal software (FV1000 Viewer) was used to generate the individual fluorescent pictures as well as the overlay pictures demonstrating the relative distribution of the fusion protein.
2.3. TaqMan real-time PCR analysis of gene expression patterns
PCR reactions were performed using the P6L, P6R (Table 1) and genomic DNA from the Landrace and Wuzhishan minipigs. PCR products were cloned into the T-easy vector and sequenced. Polymorphism sites were analyzed by sequence comparisons using DNAstar software (DNAstar Inc., Madison, WI, USA). Allele frequencies were further calculated in four unrelated pig breeds including Laiwu (28), Tongcheng (43), Landrace (14) and Largewhite (19). The animals used in the association analysis included 158 pigs: Tongcheng (43), Denmark Landrace (14), Large White (19), and cross breeds of Large White × (Landrace × Tongcheng) (38), Landrace × (Large White × Tongcheng) (44). Thirteen traits were measured which including average daily gain, live weight at slaughter, dressing percent, loin muscle area, average back fat, belly fat percentage, meat color, marbling, drip loss, carcass length, 0 h loin muscle PH, shear force and intramuscular fat percentage. The association between genotypes and the traits was analyzed using the general linear model (GLM) procedure (SPSS 14). According to the following model:
2 μg total RNA of each sample was reverse-transcribed into cDNA using M-MLV reverse transcriptase (Promega Corp., Madison, WI, USA) followed by PCR using gene-specific primers and TaqMan probes (Table 1). The real-time PCR was performed in a 20 μL mixture containing 1 × PCR buffer (TaKaRa, Dalian, P. R. C.), 3.0 mM MgCl2, 100 μM each dNTP, 0.3 μM each primer (Table 1), 0.1 μM probe, 2 U Taq DNA polymerase (TaKaRa, Dalian, P. R. C.) and 2 μL template cDNA. The cycling conditions consisted of an initial 5 min at 95 °C followed by 35 cycles of two-temperature cycling, 15 s at 95 °C (for denaturation) and 1 min at 60 °C (for annealing and polymerization). A housekeeping gene β-actin was used as a control for the relative quantity. The PCR was performed in triplicate, and the gene expression levels were quantified relative to the expression of β-actin using the Gene Expression Macro software (Bio-Rad, Richmond, CA, USA) and an optimized comparative Ct (ΔΔCt) value method. The expression was considered undetectable when the Ct value of the targeted gene exceeded 35. 2.4. Subcellular localization of porcine ADSS2 protein in PK15 cells In human, ADSSL1 (ADSS1) protein has been localized in cytoplasm by Sun (Sun et al., 2005). In order to get the knowledge of the subcellular localization of ADSS2 protein, the open reading frame (ORF) of porcine ADSS2 gene was cloned into the xhoI–BamHI site of the pEGFP-C1 vector (BD Biosciences Clontech, CA, USA) to yield a mammalian expression plasmid pADSS2-GFP. The accuracy of the constructed vector was confirmed by sequencing. PK15 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) fetal bovine serum, 2 mM glutamine, 100 U/mL penicillin, and 0.1 mg/mL streptomycin under a humidified atmosphere containing 5% CO2 at 37 °C and seeded onto cover slips in 6-well plates. Transient transfection of pADSS2-GFP and pEGFP-C1 (control) were performed with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions.
2.5. SNP identification and association analysis
Yijk ¼ l þ Pi þ Gj þ Sk þ ðPGÞij þ ðGSÞjk þ ðPSÞik þ eijk ; where Yijk = trait measured on ijkth animal; μ = mean; Pi = fixed effect of the population (i = 1, 2, 3, 4, 5); Gj = fixed effect of genotype (j = 1, 2, 3); Sk = fixed effect of sex (k = 1, 2); (PG)ij = effect of interaction ith population × jth genotype; (GS)jk = effect of interaction jth genotype × kth sex; (PS)ik = effect of interaction ith population × kth sex; eijk = error term. 3. Results 3.1. Molecular cloning and sequence analysis of porcine ADSS1 and ADSS2 genes The analyses of the cDNA sequences of the porcine ADSS genes revealed the following: (1) The full-length cDNA of ADSS1 gene consisted of 1763 nucleotides (nt) containing an ORF of 1374 nt, encoding a protein of 457 residues with an isoelectric point (pI) of 8.72. It contained a 5′-untranslated region (5′-UTR) of 50 nt and a 3′-untranslated region (3′-UTR) of 339 nt with a consensus AATAAA polyadenylation signal 18 nt upstream of the poly (A) stretch. (2) The porcine ADSS2
274
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Fig. 1. Phylogenetic tree of the ADSS isozymes in different species. The bootstrap confidence values shown at the nodes of the tree are based on 1000 bootstrap replicates. The horizontal branch lengths are proportional to the estimated divergence of the sequence from the branch point.
mRNA consisted of 2294 nt containing an ORF of 1371 nt flanked a 73 nt 5′-UTR and an 850 nt 3′-UTR. The porcine ADSS2 gene coded a protein of 456 residues with a pI of 6.31. Both ADSS1 and ADSS2 genes contained a functional domain of Adenylsucc_synt and the typical motifs of G-protein: GXXXXGK and (N/T/Q) KXD (Kjeldgaard et al., 1996). The
sequences of porcine ADSS1 gene and ADSS2 gene were deposited in GenBank (GenBank accession nos. DQ462751 and DQ463129). The phylogenetic relationship among the characterized members of the ADSS isozymes was illustrated according to the phylogenetic distance calculated by MEGA 3.1 software (Fig. 1). The results revealed that ADSS1 and ADSS2
Fig. 2. The tissue and temporal expression patterns of the porcine ADSS1 gene (A, C) and ADSS2 gene (B, D) assessed by real-time PCR. The error bars represent the SD (n = 3). The relative mRNA expression levels of ADSS genes to β-actin were normalized by endogenous β-actin expression. Lu: lung, Bf: biceps femoris muscle, Sp: spleen, Ht: heart, Sm: stomach, Li: large intestine, Ly: lymph, Si: small intestine, Lv: liver, Br: brain, Ld: latissimus dorsi muscle, Kd: kidney, Fa: fat, Gn: gastrocnemius, St: semitendinosus. E33: embryonic day 33, E65: embryonic day 65, E90: embryonic day 90, N2: 2-day neonate, N28: 28-day neonate, Adult: adult pig. The value of Br (A), Sp (B), E33 (C) and E65 (D) was arbitrarily set to 1.
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
275
Fig. 3. The subcellular localization of porcine ADSS2 protein in PK15 cells. The recombinant plasmid pADSS2-GFP and pEGFP-C1 were transiently transfected into PK15 cells using the Lipofectamine 2000 reagent. Green fluorescence of GFP (A), red fluorescence of mitochondria stained with the Mito-Tracker Red (B) and blue fluorescence of nuclei stained with Hoechst33342 (C) were analyzed by confocal microscopy. The overlay images were produced by merging all three signals together (D). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
formed two separate clusters. Moreover, ADSS2 appeared to be more conserved than ADSS1 among different species. Porcine ADSS1 gene was assigned to SSC7q and the linked marker was SSC12B09 (distance = 86 cR, LOD = 3.85), ADSS2 gene was mapped on SSC10p and the linked marker was SW497 (distance = 30 cR, LOD = 12.53). The corresponding conserved regions in human were HSC14q and HSC1q, where the human ADSS1 and ADSS2 genes were located, respectively. 3.2. Temporal and spatial expression patterns The TaqMan real-time PCR analyses revealed that porcine ADSS1 mRNA was expressed at high level in skeletal muscle tissue and heart, at low level in brain and was undetectable in lung, liver, spleen, stomach, fat, lymph, kidney and intestine (Fig. 2A). The porcine ADSS2 mRNA was distributed in all tissues detected; moreover, the expression level of ADSS2 mRNA was higher in stomach, small intestine, large intestine,
kidney, lymph and liver, but relatively weaker in the skeletal muscle tissue and heart (Fig. 2B). The expression of ADSS1 gene was up-regulated along with the porcine muscular development and growth (Fig. 2C). However, the expression of ADSS2 gene was relatively constant in the prenatal period, and remains constant at a relatively higher expression level in postnatal period (Fig. 2D). 3.3. Subcellular location of porcine ADSS2 protein in PK15 cells The subcellular location of the porcine ADSS2 protein was studied by fluorescence and confocal analyses of PK15 cells transiently transfected with pADSS2-GFP. Green fluorescence was detected throughout the control cells transiently transfected with the pEGFP-C1 vector. It was shown that porcine ADSS2 protein was localized in mitochondria (Fig. 3). 3.4. Polymorphism detection and association analysis The SNP (T/C70) of porcine ADSS2 gene locus (GenBank accession no. EF204918) was detectable by digestion with restriction enzyme BSPT104 I, resulting in one fragment (356 bp) produced by allele T and two fragments (69 bp and 287 bp) produced by allele C (Fig. 4). Genetic variation analysis Table 2 Genotypes and allele frequencies for the SNP (T/C70) (BSPT104 I) of ADSS2 gene in different pig breeds Breeds
Fig. 4. RFLP analysis of porcine ADSS2 gene polymorphism. A 356 bp ADSS2 fragment containing the T/C70 polymorphism recognized by the BSPT104 I enzyme (TT 356 bp, CC 278/69 bp, TC 356/378/69 bp). M, DNA ladder.
Laiwu Tongcheng Large white Landrace
N
28 43 19 14
Genotypes
Allele frequencies
TT
TC
CC
T
C
11 15 1 0
12 17 4 8
5 11 14 6
0.61 0.55 0.16 0.29
0.39 0.45 0.84 0.71
276
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Table 3 Analysis association of porcine ADSS2 SNP (A/T70) (BSPT104 I) with the ADG trait and the loin muscle area trait Genotypes
N
ADG (g)
Loin muscle area (cm2)
TT TC CC P-value⁎
27 59 72
644.27 ± 35.00a 689.67 ± 28.11ab 724.29 ± 25.63b 0.046
25.83 ± 1.57a 28.62 ± 1.27ab 30.39 ± 1.16b 0.034
Note: a, bmeans the significant difference between different genotypes (P < 0.05). ⁎ means the probability of F-test for the genotype effect.
results revealed that the frequency of allele C in Chinese indigenous breeds is lower than that of foreign breeds (Table 2). According to our association results, there is a significantly association between this polymorphism and two economic traits, the ADG trait (P = 0.046) and loin muscle area trait (P = 0.034). The ADG of pigs with CC genotype was significantly larger than that of TT genotype (P = 0.042), and the loin muscle area of pigs with CC was significantly larger than that of TT genotype (P = 0.011) (Table 3). 4. Discussions The ADSS catalyzes the key step in the synthesis of AMP, which could influence the energy metabolism through the PNC and the AMPK pathway. In this study, we cloned and characterized porcine ADSS genes, and we comparatively analyzed their chromosome assignment, mRNA distribution and subcellular localization. Moreover, we found one SNP in porcine ADSS2 gene locus was significantly associated with the ADG trait and the loin muscle area trait. The phylogenetic tree showed that ADSS1 and ADSS2 formed two separate clusters. And ADSS2 appeared to be more conserved than ADSS1 among different species. It is generally accepted that two ADSS isozymes participated differently bioprocess, that is, ADSS2 catalyzes the de novo synthesis of AMP whereas ADSS1 participates in the PNC (Stayton et al., 1983; Honzatko et al., 1999). Human ADSS1 protein had been located in the cytoplasm by Sun (Sun et al., 2005). While our data showed that the subcellular localization of porcine ADSS2 was in mitochondria. The mitochondria organelles play an important role in the process of energy metabolism. The difference of the ADSS isozymes' subcellular localization may be associated with the different bio-process of these two genes. Previous studies confirmed that PNC functions mainly in the muscle tissues and the brain (Lowenstein and Hollander, 1973). Disorder of PNC was associated with muscular inactivity such as fatigue and cramps (Operti et al., 1998). In our study, the porcine ADSS1 mRNA was detected only in the muscle tissues and the brain. Thus, the mRNA distribution result of porcine ADSS1 gene was accordant with previous studies. The porcine ADSS2 mRNA was distributed in all tissues detected; moreover, the expression level of ADSS2 mRNA was higher in gastrointestinal tract. The ADSS2 protein participated in de novo AMP synthesis. It had been confirmed that intracellular [AMP]/[ATP] ratio was an important candidate signal of energy metabolism, and the
elevation of the ratio was associated with increased energy metabolism (Wilson et al., 1996; Xu et al., 2004). Thus, the variation of [AMP]/[ATP] ratio caused by the change of the de novo AMP synthesis process might result in the different phenotype of economic traits. In this study, we found one SNP in porcine ADSS2 gene locus and traits association results revealed that the ADG trait and loin muscle area trait of individuals with CC genotype were significantly larger than that of individuals with TT genotype (P < 0.05). RH mapping data showed that porcine ADSS2 gene was closely linked with marker SW497. And two important QTLs of pig, Average Daily Gain and Loin and Neck Meat Weight, were closely linked with this marker in the previous studies (http://www.animalgenome. org/cgi-bin/QTLdb/browse) (Kim et al., 2006, Wendrich et al., 2003). Therefore, porcine ADSS2 gene may be an important candidate gene of growth and carcass traits and the SNP may be an useful genetic marker for pig breeding. However, our results still need to be confirmed in larger populations. Whether this polymorphism locus of ADSS2 gene has really infected the muscle development or it is just closely linked to other major genes or other SNP locus needs further study. In summary, we had cloned energy metabolism related genes ADSS1 and ADSS2 of pig, and we comparatively analyzed their molecular characters. One SNP of ADSS2 gene was identified which may be a genetic marker for pig breeding. Our study provided important basis for future studies on the energy metabolism of animals. Acknowledgements We are grateful to Dr. Martine Yerle for providing the RH panel. This research was supported by the National Natural Science Foundation of China (30400311), China Postdoctoral Science Foundation (2005037086), the National 10th Five Year Scientific Project of China for Tackling the Key Problems (2004BA717B), Key Project of National Natural Science Foundation of China (30330440), Key Project of Scientific Research Foundation of Ministry of Human Resources of China for Returned Chinese Scholars, the State Platform of Technology Infrastructure (2005DKA21101), National 973 (2006CB102105) and 863 (2006011021039) programs of China. References Adams, J., Chen, Z.P., Van Denderen, B.J., Morton, C.J., Parker, M.W., Witters, L.A., Stapleton, D., Kemp, B.E., 2004. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site. Protein Sci. 13 (1), 155–165. Berg, E.P., McFadin, E.L., Maddock, R.R., Goodwin, N., Baas, T.J., Keisler, D.H., 2003. Serum concentrations of leptin in six genetic lines of swine and relationship with growth and carcass characteristics. J. Anim. Sci. 81 (1), 167–171. Bruun, C.S., Jorgensen, C.B., Nielsen, V.H., Andersson, L., Fredholm, M., 2006. Evaluation of the porcine melanocortin 4 receptor (MC4R) gene as a positional candidate for a fatness QTL in a cross between Landrace and Hampshire. Anim. Genet. 37 (4), 359–362. Cheung, P.C., Salt, I.P., Davies, S.P., Hardie, D.G., Carling, D., 2000. Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. Biochem. J. 346 (Pt 3), 659–669.
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277 Ferre, P., Azzout-Marniche, D., Foufelle, F., 2003. AMP-activated protein kinase and hepatic genes involved in glucose metabolism. Biochem. Soc. Trans. 31 (Pt 1), 220–223. Frederich, M., Balschi, J.A., 2002. The relationship between AMP-activated protein kinase activity and AMP concentration in the isolated perfused rat heart. J. Biol. Chem. 277 (3), 1928–1932. Guicherit, O.M., Rudolph, F.B., Kellems, R.E., Cooper, B.F., 1991. Molecular cloning and expression of a mouse muscle cDNA encoding adenylosuccinate synthetase. J. Biol. Chem. 266 (33), 22582–22587. Guicherit, O.M., Cooper, B.F., Rudolph, F.B., Kellems, R.E., 1994. Amplification of an adenylosuccinate synthetase gene in alanosine-resistant murine Tlymphoma cells. Molecular cloning of a cDNA encoding the “non-muscle” isozyme. J. Biol. Chem. 269 (6), 4488–4496. Hardie, D.G., Hawley, S.A., 2001. AMP-activated protein kinase the energy charge hypothesis revisited. Bioessays 23 (12), 1112–1119. Honzatko, R.B., Stayton, M.M., Fromm, H.J., 1999. Adenylosuccinate synthetase: recent developments. Adv. Enzymol. Relat. Areas Mol. Biol. 73, 57–102. Kemp, B.E., Stapleton, D., Campbell, D.J., Chen, Z.P., Murthy, S., Walter, M., Gupta, A., Adams, J.J., Katsis, F., vanDenderen, B., Jennings, I.G., Iseli, T., Michell, B.J., Witters, L.A., 2003. AMP-activated protein kinase, super metabolic regulator. Biochem. Soc. Trans. 31 (Pt 1), 162. Kim, C.W., Hong, Y.H., Yun, S., Lee, S.R., Kim, Y.H., Kim, M.S., Chung, K.H., Jung, W.Y., Kw, E.J., 2006. Use of microsatellite markers to detect quantitative trait loci in Yorkshire pigs. J. Reprod. Dev. 52 (2), 229–237. Kjeldgaard, M., Nyborg, J., Clark, B.F., 1996. The GTP binding motif: variations on a theme. Faseb. J. 10 (12), 1347–1368. Leff, T., 2003. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem. Soc. Trans. 31 (Pt 1), 224–227. Lewis, A.L., Guicherit, O.M., Datta, S.K., Hanten, G.R., Kellems, R.E., 1996. Structure and expression of the murine muscle adenylosuccinate synthetase gene. J. Biol. Chem. 271 (37), 22647–22656. Lowenstein, J.M., 1972. Ammonia production in muscle and other tissues: The purine nucleotide cycle. Physiol. Rev. 52 (2), 382–414. Lowenstein, J.M., Hollander, V., 1973. The purine nucleotide cycle. The production of ammonia from aspartate by brain and muscle. Vopr. Biokhim. Mozga. 8, 49–62. Milan, D., Hawken, R., Cabau, C., Leroux, S., Genet, C., Lahbib, Y., Tosser, G., Robic, A., Hatey, F., Alexander, L., Beattie, C., Schook, L., Yerle, M., Gellin, J., 2000. IMpRH server: an RH mapping server available on the Web. Bioinformatics 16 (6), 558–559.
277
Murani, E., Muraniova, M., Ponsuksili, S., Schellander, K., Wimmers, K., 2006. Molecular characterization and evidencing of the porcine CRH gene as a functional–positional candidate for growth and body composition. Biochem. Biophys. Res. Commun. 342 (2), 394–405. Operti, M.G., Vincent, M.F., Brucher, J.M., van den Berghe, G., 1998. Enzymes of the purine nucleotide cycle in muscle of patients with exercise intolerance. Muscle Nerve 21 (3), 401–403. Scott, J.W., Hawley, S.A., Green, K.A., Anis, M., Stewart, G., Scullion, G.A., Norman, D.G., Hardie, D.G., 2004. CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J. Clin. Invest. 113 (2), 274–284. Stayton, M.M., Rudolph, F.B., Fromm, H.J., 1983. Regulation, genetics, and properties of adenylosuccinate synthetase: a review. Curr. Top. Cell. Regul. 22, 103–141. Sun, H., Li, N., Wang, X., Chen, T., Shi, L., Zhang, L., Wang, J., Wan, T., Cao, X., 2005. Molecular cloning and characterization of a novel muscle adenylosuccinate synthetase, AdSSL1, from human bone marrow stromal cells. Mol. Cell. Biochem. 269 (1–2), 85–94. Tullson, P.C., Terjung, R.L., 1991a. Adenine nucleotide metabolism in contracting skeletal muscle. Exerc. Sport Sci. Rev. 19, 507–537. Tullson, P.C., Terjung, R.L., 1991b. Adenine nucleotide synthesis in exercising and endurance-trained skeletal muscle. Am. J. Physiol. 261 (2 Pt 1), C342–C347. Wendrich, M.D., Moser, G., Bartenschlager, H., Reiner, G., Geldermann, H., 2003. Linkage and QTL mapping for Sus scrofa chromosome 10. J. Anim. Breed. Genet. 120 (Suppl. 1), 82–88. Westra, H.G., De Haan, A., van Doorn, J.E., de Haan, E.J., 1986. IMP production and energy metabolism during exercise in rats in relation to age. Biochem. J. 239 (3), 751–755. Wilson, W.A., Hawley, S.A., Hardie, D.G., 1996. Glucose repression/ derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr. Biol. 6 (11), 1426–1434. Xu, Z., Yaguchi, S., Tsurugi, K., 2004. Gts1p stabilizes oscillations in energy metabolism by activating the transcription of TPS1 encoding trehalose-6phosphate synthase 1 in the yeast Saccharomyces cerevisiae. Biochem. J. 383 (Pt 1), 171–178. Zhu, Z.M., Zhang, J.B., Li, K., Zhao, S.H., 2005. Cloning, mapping and association study with carcass traits of the porcine SDHD gene. Anim. Genet. 36, 191–195.
Comparative molecular characterization of ADSS1 and ADSS2 genes in pig (Sus scrofa) Xinyun Li a,b , Zhengmao Zhu a , Delin Mo a,b , Heng Wang a,b , Shulin Yang a , Shuhong Zhao b , Kui Li a,⁎ a
Department of Gene and Cell Engineering, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100094, PR China The Key Laboratory of Animal Genetics, Breeding and Reproduction of Ministry of Education of China, Huazhong Agricultural University, Wuhan 430070, PR China
b
Received 11 September 2006; received in revised form 17 January 2007; accepted 19 January 2007 Available online 1 February 2007
Abstract Adenylosuccinate synthetase (ADSS) catalyzes the key step of AMP synthesis. Vertebrates have two isozymes of ADSS, which are named ADSS1 and ADSS2, respectively. In this study, we cloned porcine ADSS1 and ADSS2 genes and comparatively analyzed their sequence, chromosome mapping, mRNA distribution and subcellular localization. According to our results, the ADSS1 gene was predominantly expressed in the striated muscle tissues, while ADSS2 gene distributed widely in all the tissues detected. Additionally, ADSS1 gene was up-regulated significantly along with porcine muscle growth, and ADSS2 gene expression was more constant during the muscle development. Porcine ADSS1 gene was assigned to SSC7q and the linked marker was SSC12B09, ADSS2 gene was mapped on SSC10p and the linked marker was SW497, and porcine ADSS2 protein was subcellular localized in mitochondria. Moreover, we found that one single nucleotide polymorphism (SNP, T/C70) in the ninth intron of ADSS2 gene was significantly associated with average daily gain trait (ADG, P < 0.05) and loin muscle area trait (P < 0.05). © 2007 Elsevier Inc. All rights reserved. Keywords: Adenylosuccinate synthetase; ADSS1; ADSS2; Pig; SNP; Sus scrofa
1. Introduction Adenylosuccinate synthetase (ADSS) catalyzes the key step of AMP synthesis (Lowenstein, 1972). The reaction is as follows: IMP + L-Asp + GTP ↔ adenylosuccinate + GDP + phosphate. Prokaryotes only have one form of ADSS which participates in the de novo synthesis of AMP. While vertebrates have two different ADSS isozymes, one is the basic form (ADSS1) and the other is the acidic form (ADSS2) (Guicherit et al., 1991, 1994). ADSS1 participates in the important process of purine nucleotide cycle (PNC) whereas ADSS2 catalyzes the de novo synthesis of AMP (Stayton et al., 1983; Honzatko et al., 1999).
⁎ Corresponding author. Tel./fax: +86 10 62813822. E-mail addresses: [email protected], [email protected] (K. Li). 1096-4959/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpb.2007.01.013
PNC plays an important role in energy metabolism in striated muscle tissues. During brief periods of intense muscle contraction, a large portion of the ATP is hydrolyzed and converted to AMP, which is then converted to IMP and ammonia to meet the immediate energy requirement (Tullson and Terjung, 1991a,b; Lewis et al., 1996). The concentration of IMP is increased by several folds during intense muscle contraction (Westra et al., 1986). Many myopathies such as fatigue and cramps could be associated with PNC disorder (Operti et al., 1998). AMP activates AMPK (AMP-activated protein kinase) by binding its gamma subunit (Cheung et al., 2000; Frederich and Balschi, 2002; Adams et al., 2004; Scott et al., 2004). AMPK is an important enzyme related to energy metabolism. It participates in the regulation of glucose transport, glycolysis, fatty acid oxidation, and the expression of genes associated with lipid and carbohydrate metabolisms (Hardie and Hawley, 2001; Ferre et al., 2003; Kemp et al., 2003; Leff, 2003). Therefore, study on the ADSS genes could contribute us to better understanding energy metabolism.
272
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Previous studies indicated that the genes involved in the energy metabolism were closely related to growth and carcass traits of pig. For example, the porcine melanocortin 4 receptor gene (MCR4) was associated with the ADG trait and fatness (Bruun et al., 2006). The porcine corticotropin-releasing hormone (CHR) gene was a candidate gene for the traits of loin muscle area, ADG and thickness of backfat (Murani et al., 2006). Porcine succinate dehydrogenase complex subunit D (SDHD) was associated with the loin muscle area trait (Zhu et al., 2005). The serum concentration of leptin was positively associated with the growth rate and negatively associated with the thickness of backfat trait (Berg et al., 2003), etc. We focus on ADSS genes' studies, which could be candidate genes of porcine growth and carcass traits. In this study, we cloned and mapped porcine ADSS1 and ADSS2 genes, and analyzed their expression pattern. We found one SNP (T/C70) in the ninth intron (GenBank accession no. EF204918) of porcine ADSS2 gene was significantly associated with ADG and loin muscle area traits (P < 0.05). 2. Materials and methods 2.1. Tissues used for expression pattern analysis The Longissimus dorsi muscle samples of Chinese indigenous Tongcheng pig embryos [33, 65, and 90 days postconception (dpc)] and postnatal periods (2, 28-day, and adult) were harvested, mixed, frozen in liquid nitrogen, and then stored at − 80 °C. Fifteen tissues samples were collected from Wuzhishan pigs' stomach, large intestine, kidney, lymph, small intestine, liver, heart, latissimus dorsi muscle, lung, gastrocnemius, biceps femoris muscle, brain, fat, semitendinosus and spleen. The Wuzhishan pig is one of the famous Chinese indigenous minipigs. Total RNA was extracted and treated with RNase-free DNase I (MBI Fermentas, St. Leon-Rot, Germany). Pig kidney epithelial cells (PK15 cells) were used for determining the subcellular localization of the porcine ADSS2 protein.
2.2. Molecular cloning and chromosome mapping of porcine ADSS genes According to the pig's ESTs (GenBank accession nos. CK458327, CK456903, DY432710, DY430646, DN128497 and AW315962) information, primers were designed for porcine ADSS1 gene isolation (Table 1). The full length cDNA sequence of porcine ADSS1 gene was isolated using rapid amplification of cDNA ends (RACE) method. The porcine ADSS2 gene full-length coding region sequence was presumed by directly assembling the pig ESTs (GenBank accession nos. CF789186, AJ657109, AJ660215, CF788513, CJ026527, BW976503, BP436983, BF713469 and BQ602346). The identity of the porcine ADSS2 gene was confirmed by reverse transcriptase polymerase chain reaction (RT-PCR) method. The PCR profile was 3 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at annealing temperature (Table 1), 50 s at 72 °C and a final extension of 5 min at 72 °C. All the PCR fragments were sequenced and assembled using software DNAstar (DNAstar Inc., Madison, WI, USA). The proteins coded by ADSS1 and ADSS2 were deduced by the Editseq program of DNAstar, and their isoelectric point (pI) was predicted by the tool available on http://us.expasy.org/tools/ pi_tool.html. The deduced amino acid sequences of porcine ADSS1 gene and ADSS2 gene were compared with the corresponding protein of other creatures, i.e. Human Homo sapiens (GenBank accession nos. ADSS1, NP_689541 and ADSS2, NP_001117), Mouse Mus musculus (GenBank accession nos. ADSS1, NP_031447 and ADSS2, NP_031448), African clawed frog Xenopus laevis (GenBank accession nos. highly similar to ADSS1, AAH93568 and ADSS2, AAH43896), Zebrafish Danio rerio (GenBank accession nos. highly similar to ADSS1, NP_999985 and ADSS2, NP_775344), Rat Rattus norvegicus (similar to ADSS1, XP_001072867 and similar to ADSS2 XP_222946), Dog Canis familiaris (similar to ADSS2, XP_537220), Cattle Bos taurus (similar to ADSS2 XP_869889). Consequently, phylogenetic tree was constructed
Table 1 Primers used for gene isolation, mapping, mRNA distribution and subcellular localization analysis Gene
Primer name
Primer and probe sequence (5′-3′)
PCR Tm (°C)
Size (bp)
ADSS1 cloning
ADSS1 mapping ADSS2 mapping ADSS1 expression
5′Race Nest 3′Race Nest P1L P1R P1′L P1′R P2L P2R P2′L P2′R P3L P4R Probe
Touchdown PCR a 60 62 68 62 60
1384 635 1679 892 234 356 174
ADSS2 expression
P3′L P3′R Probe
β-actin expression
P4L P4R Probe
ADSS2 Subcellular localization ADSS2 SNP detection
P5L P5R
CGAGGAGGGAACACGATTGTGGCTG CCAACCCATTTCACTGCCACT CCTTCCCCACCGAGCAGATCAACGA CCTTGACGAAGCTGGACATCCT CGGCAGAGCAGTTCAGTTCG GCACCATGAGCAGCAGGAG GGTGTGGGTAAATCCAGAGAGTC CATGTTGCCAGGCACAGTGTTG CAGCCACAATCGTGTTCCCTC CAGCTCCAACTGGACAGACAAC CCAGAGTTGGTATTGGTGCCTT CAACCTTGGCTCCTAATCTGCTC GCGTCTCGTACAAGCTGAGC CCACGAACCGGATGTAGCTC TTCCCAGCCAACCAGGAGATTCTGC GGCTGGACCTTGTTTTGCTC GTGTTCCATCCTGGGAGAGTC TGGATTTACCGCGTTGGCACTTACC GGATGCAGAAGGAGATCACG CTCGTCGTACTCCTGCTTGC ATCAAGATCATCGCGCCTCCAGAGC TCCTCGAGTCTCTGGAGCCATG GGATCCTGAAAGAGCTGAATCATAGACTCTCTGG
P6L P6R
CCAGAGTTGGTATTGGTGCCTT CAACCTTGGCTCCTAATCTGCTC
ADSS2 Cloning
a
The touchdown PCR program according to the SMART RACE Kit (Invitrogen, Carlsbad, CA, USA.
60
211
60
160
64
1395
62
356
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
273
by using the neighbor-joining's method (MEGA 3.1) with 1000 bootstrap replicates. The INRA-University of Minnesota's 7000 rads radiation hybrid panel (IMpRH) was employed for chromosome mapping of porcine ADSS1 and ADSS2 genes. The PCR for RH mapping was performed in a 10 μL mixture containing 1 × buffer (TaKaRa, Dalian, P. R. C.), 25 ng panel DNA, 0.3 μM each primer (Table 1), 75 μM each dNTP, 1.5 mM MgCl2, and 1.0 U Taq DNA polymerase (TaKaRa, Dalian, P. R. C.). The PCR profile consisted of 3 min at 94 °C, 35 cycles of 30 s at 94 °C, 30 s at annealing temperature (Table 1), 40 s at 72 °C, and a final 5 min extension at 72 °C. The data was analyzed with the IMpRH mapping tool (http://www.toulouse.inra.fr/lgc/pig/RH/ IMpRH.htm) (Milan et al., 2000).
Twenty-four hours after transfection, the cells were incubated at 37 °C for 30 min in the growth medium containing 200 nM MitoTracker Red CM-H2Xros (Molecular Probes, Eugene, Oregon, USA) for mitochondrial labeling, and then fixed at 37 °C for 15 min with 3.7% formaldehyde. The fixed cells were washed three times with PBS, and then incubated with 10 μg/mL Hoechst33342 for 10 min at room temperature. Finally, the slides were mounted, sealed and analyzed by confocal microscopy (FV-1000). Olympus confocal software (FV1000 Viewer) was used to generate the individual fluorescent pictures as well as the overlay pictures demonstrating the relative distribution of the fusion protein.
2.3. TaqMan real-time PCR analysis of gene expression patterns
PCR reactions were performed using the P6L, P6R (Table 1) and genomic DNA from the Landrace and Wuzhishan minipigs. PCR products were cloned into the T-easy vector and sequenced. Polymorphism sites were analyzed by sequence comparisons using DNAstar software (DNAstar Inc., Madison, WI, USA). Allele frequencies were further calculated in four unrelated pig breeds including Laiwu (28), Tongcheng (43), Landrace (14) and Largewhite (19). The animals used in the association analysis included 158 pigs: Tongcheng (43), Denmark Landrace (14), Large White (19), and cross breeds of Large White × (Landrace × Tongcheng) (38), Landrace × (Large White × Tongcheng) (44). Thirteen traits were measured which including average daily gain, live weight at slaughter, dressing percent, loin muscle area, average back fat, belly fat percentage, meat color, marbling, drip loss, carcass length, 0 h loin muscle PH, shear force and intramuscular fat percentage. The association between genotypes and the traits was analyzed using the general linear model (GLM) procedure (SPSS 14). According to the following model:
2 μg total RNA of each sample was reverse-transcribed into cDNA using M-MLV reverse transcriptase (Promega Corp., Madison, WI, USA) followed by PCR using gene-specific primers and TaqMan probes (Table 1). The real-time PCR was performed in a 20 μL mixture containing 1 × PCR buffer (TaKaRa, Dalian, P. R. C.), 3.0 mM MgCl2, 100 μM each dNTP, 0.3 μM each primer (Table 1), 0.1 μM probe, 2 U Taq DNA polymerase (TaKaRa, Dalian, P. R. C.) and 2 μL template cDNA. The cycling conditions consisted of an initial 5 min at 95 °C followed by 35 cycles of two-temperature cycling, 15 s at 95 °C (for denaturation) and 1 min at 60 °C (for annealing and polymerization). A housekeeping gene β-actin was used as a control for the relative quantity. The PCR was performed in triplicate, and the gene expression levels were quantified relative to the expression of β-actin using the Gene Expression Macro software (Bio-Rad, Richmond, CA, USA) and an optimized comparative Ct (ΔΔCt) value method. The expression was considered undetectable when the Ct value of the targeted gene exceeded 35. 2.4. Subcellular localization of porcine ADSS2 protein in PK15 cells In human, ADSSL1 (ADSS1) protein has been localized in cytoplasm by Sun (Sun et al., 2005). In order to get the knowledge of the subcellular localization of ADSS2 protein, the open reading frame (ORF) of porcine ADSS2 gene was cloned into the xhoI–BamHI site of the pEGFP-C1 vector (BD Biosciences Clontech, CA, USA) to yield a mammalian expression plasmid pADSS2-GFP. The accuracy of the constructed vector was confirmed by sequencing. PK15 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) fetal bovine serum, 2 mM glutamine, 100 U/mL penicillin, and 0.1 mg/mL streptomycin under a humidified atmosphere containing 5% CO2 at 37 °C and seeded onto cover slips in 6-well plates. Transient transfection of pADSS2-GFP and pEGFP-C1 (control) were performed with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer's instructions.
2.5. SNP identification and association analysis
Yijk ¼ l þ Pi þ Gj þ Sk þ ðPGÞij þ ðGSÞjk þ ðPSÞik þ eijk ; where Yijk = trait measured on ijkth animal; μ = mean; Pi = fixed effect of the population (i = 1, 2, 3, 4, 5); Gj = fixed effect of genotype (j = 1, 2, 3); Sk = fixed effect of sex (k = 1, 2); (PG)ij = effect of interaction ith population × jth genotype; (GS)jk = effect of interaction jth genotype × kth sex; (PS)ik = effect of interaction ith population × kth sex; eijk = error term. 3. Results 3.1. Molecular cloning and sequence analysis of porcine ADSS1 and ADSS2 genes The analyses of the cDNA sequences of the porcine ADSS genes revealed the following: (1) The full-length cDNA of ADSS1 gene consisted of 1763 nucleotides (nt) containing an ORF of 1374 nt, encoding a protein of 457 residues with an isoelectric point (pI) of 8.72. It contained a 5′-untranslated region (5′-UTR) of 50 nt and a 3′-untranslated region (3′-UTR) of 339 nt with a consensus AATAAA polyadenylation signal 18 nt upstream of the poly (A) stretch. (2) The porcine ADSS2
274
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Fig. 1. Phylogenetic tree of the ADSS isozymes in different species. The bootstrap confidence values shown at the nodes of the tree are based on 1000 bootstrap replicates. The horizontal branch lengths are proportional to the estimated divergence of the sequence from the branch point.
mRNA consisted of 2294 nt containing an ORF of 1371 nt flanked a 73 nt 5′-UTR and an 850 nt 3′-UTR. The porcine ADSS2 gene coded a protein of 456 residues with a pI of 6.31. Both ADSS1 and ADSS2 genes contained a functional domain of Adenylsucc_synt and the typical motifs of G-protein: GXXXXGK and (N/T/Q) KXD (Kjeldgaard et al., 1996). The
sequences of porcine ADSS1 gene and ADSS2 gene were deposited in GenBank (GenBank accession nos. DQ462751 and DQ463129). The phylogenetic relationship among the characterized members of the ADSS isozymes was illustrated according to the phylogenetic distance calculated by MEGA 3.1 software (Fig. 1). The results revealed that ADSS1 and ADSS2
Fig. 2. The tissue and temporal expression patterns of the porcine ADSS1 gene (A, C) and ADSS2 gene (B, D) assessed by real-time PCR. The error bars represent the SD (n = 3). The relative mRNA expression levels of ADSS genes to β-actin were normalized by endogenous β-actin expression. Lu: lung, Bf: biceps femoris muscle, Sp: spleen, Ht: heart, Sm: stomach, Li: large intestine, Ly: lymph, Si: small intestine, Lv: liver, Br: brain, Ld: latissimus dorsi muscle, Kd: kidney, Fa: fat, Gn: gastrocnemius, St: semitendinosus. E33: embryonic day 33, E65: embryonic day 65, E90: embryonic day 90, N2: 2-day neonate, N28: 28-day neonate, Adult: adult pig. The value of Br (A), Sp (B), E33 (C) and E65 (D) was arbitrarily set to 1.
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
275
Fig. 3. The subcellular localization of porcine ADSS2 protein in PK15 cells. The recombinant plasmid pADSS2-GFP and pEGFP-C1 were transiently transfected into PK15 cells using the Lipofectamine 2000 reagent. Green fluorescence of GFP (A), red fluorescence of mitochondria stained with the Mito-Tracker Red (B) and blue fluorescence of nuclei stained with Hoechst33342 (C) were analyzed by confocal microscopy. The overlay images were produced by merging all three signals together (D). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
formed two separate clusters. Moreover, ADSS2 appeared to be more conserved than ADSS1 among different species. Porcine ADSS1 gene was assigned to SSC7q and the linked marker was SSC12B09 (distance = 86 cR, LOD = 3.85), ADSS2 gene was mapped on SSC10p and the linked marker was SW497 (distance = 30 cR, LOD = 12.53). The corresponding conserved regions in human were HSC14q and HSC1q, where the human ADSS1 and ADSS2 genes were located, respectively. 3.2. Temporal and spatial expression patterns The TaqMan real-time PCR analyses revealed that porcine ADSS1 mRNA was expressed at high level in skeletal muscle tissue and heart, at low level in brain and was undetectable in lung, liver, spleen, stomach, fat, lymph, kidney and intestine (Fig. 2A). The porcine ADSS2 mRNA was distributed in all tissues detected; moreover, the expression level of ADSS2 mRNA was higher in stomach, small intestine, large intestine,
kidney, lymph and liver, but relatively weaker in the skeletal muscle tissue and heart (Fig. 2B). The expression of ADSS1 gene was up-regulated along with the porcine muscular development and growth (Fig. 2C). However, the expression of ADSS2 gene was relatively constant in the prenatal period, and remains constant at a relatively higher expression level in postnatal period (Fig. 2D). 3.3. Subcellular location of porcine ADSS2 protein in PK15 cells The subcellular location of the porcine ADSS2 protein was studied by fluorescence and confocal analyses of PK15 cells transiently transfected with pADSS2-GFP. Green fluorescence was detected throughout the control cells transiently transfected with the pEGFP-C1 vector. It was shown that porcine ADSS2 protein was localized in mitochondria (Fig. 3). 3.4. Polymorphism detection and association analysis The SNP (T/C70) of porcine ADSS2 gene locus (GenBank accession no. EF204918) was detectable by digestion with restriction enzyme BSPT104 I, resulting in one fragment (356 bp) produced by allele T and two fragments (69 bp and 287 bp) produced by allele C (Fig. 4). Genetic variation analysis Table 2 Genotypes and allele frequencies for the SNP (T/C70) (BSPT104 I) of ADSS2 gene in different pig breeds Breeds
Fig. 4. RFLP analysis of porcine ADSS2 gene polymorphism. A 356 bp ADSS2 fragment containing the T/C70 polymorphism recognized by the BSPT104 I enzyme (TT 356 bp, CC 278/69 bp, TC 356/378/69 bp). M, DNA ladder.
Laiwu Tongcheng Large white Landrace
N
28 43 19 14
Genotypes
Allele frequencies
TT
TC
CC
T
C
11 15 1 0
12 17 4 8
5 11 14 6
0.61 0.55 0.16 0.29
0.39 0.45 0.84 0.71
276
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277
Table 3 Analysis association of porcine ADSS2 SNP (A/T70) (BSPT104 I) with the ADG trait and the loin muscle area trait Genotypes
N
ADG (g)
Loin muscle area (cm2)
TT TC CC P-value⁎
27 59 72
644.27 ± 35.00a 689.67 ± 28.11ab 724.29 ± 25.63b 0.046
25.83 ± 1.57a 28.62 ± 1.27ab 30.39 ± 1.16b 0.034
Note: a, bmeans the significant difference between different genotypes (P < 0.05). ⁎ means the probability of F-test for the genotype effect.
results revealed that the frequency of allele C in Chinese indigenous breeds is lower than that of foreign breeds (Table 2). According to our association results, there is a significantly association between this polymorphism and two economic traits, the ADG trait (P = 0.046) and loin muscle area trait (P = 0.034). The ADG of pigs with CC genotype was significantly larger than that of TT genotype (P = 0.042), and the loin muscle area of pigs with CC was significantly larger than that of TT genotype (P = 0.011) (Table 3). 4. Discussions The ADSS catalyzes the key step in the synthesis of AMP, which could influence the energy metabolism through the PNC and the AMPK pathway. In this study, we cloned and characterized porcine ADSS genes, and we comparatively analyzed their chromosome assignment, mRNA distribution and subcellular localization. Moreover, we found one SNP in porcine ADSS2 gene locus was significantly associated with the ADG trait and the loin muscle area trait. The phylogenetic tree showed that ADSS1 and ADSS2 formed two separate clusters. And ADSS2 appeared to be more conserved than ADSS1 among different species. It is generally accepted that two ADSS isozymes participated differently bioprocess, that is, ADSS2 catalyzes the de novo synthesis of AMP whereas ADSS1 participates in the PNC (Stayton et al., 1983; Honzatko et al., 1999). Human ADSS1 protein had been located in the cytoplasm by Sun (Sun et al., 2005). While our data showed that the subcellular localization of porcine ADSS2 was in mitochondria. The mitochondria organelles play an important role in the process of energy metabolism. The difference of the ADSS isozymes' subcellular localization may be associated with the different bio-process of these two genes. Previous studies confirmed that PNC functions mainly in the muscle tissues and the brain (Lowenstein and Hollander, 1973). Disorder of PNC was associated with muscular inactivity such as fatigue and cramps (Operti et al., 1998). In our study, the porcine ADSS1 mRNA was detected only in the muscle tissues and the brain. Thus, the mRNA distribution result of porcine ADSS1 gene was accordant with previous studies. The porcine ADSS2 mRNA was distributed in all tissues detected; moreover, the expression level of ADSS2 mRNA was higher in gastrointestinal tract. The ADSS2 protein participated in de novo AMP synthesis. It had been confirmed that intracellular [AMP]/[ATP] ratio was an important candidate signal of energy metabolism, and the
elevation of the ratio was associated with increased energy metabolism (Wilson et al., 1996; Xu et al., 2004). Thus, the variation of [AMP]/[ATP] ratio caused by the change of the de novo AMP synthesis process might result in the different phenotype of economic traits. In this study, we found one SNP in porcine ADSS2 gene locus and traits association results revealed that the ADG trait and loin muscle area trait of individuals with CC genotype were significantly larger than that of individuals with TT genotype (P < 0.05). RH mapping data showed that porcine ADSS2 gene was closely linked with marker SW497. And two important QTLs of pig, Average Daily Gain and Loin and Neck Meat Weight, were closely linked with this marker in the previous studies (http://www.animalgenome. org/cgi-bin/QTLdb/browse) (Kim et al., 2006, Wendrich et al., 2003). Therefore, porcine ADSS2 gene may be an important candidate gene of growth and carcass traits and the SNP may be an useful genetic marker for pig breeding. However, our results still need to be confirmed in larger populations. Whether this polymorphism locus of ADSS2 gene has really infected the muscle development or it is just closely linked to other major genes or other SNP locus needs further study. In summary, we had cloned energy metabolism related genes ADSS1 and ADSS2 of pig, and we comparatively analyzed their molecular characters. One SNP of ADSS2 gene was identified which may be a genetic marker for pig breeding. Our study provided important basis for future studies on the energy metabolism of animals. Acknowledgements We are grateful to Dr. Martine Yerle for providing the RH panel. This research was supported by the National Natural Science Foundation of China (30400311), China Postdoctoral Science Foundation (2005037086), the National 10th Five Year Scientific Project of China for Tackling the Key Problems (2004BA717B), Key Project of National Natural Science Foundation of China (30330440), Key Project of Scientific Research Foundation of Ministry of Human Resources of China for Returned Chinese Scholars, the State Platform of Technology Infrastructure (2005DKA21101), National 973 (2006CB102105) and 863 (2006011021039) programs of China. References Adams, J., Chen, Z.P., Van Denderen, B.J., Morton, C.J., Parker, M.W., Witters, L.A., Stapleton, D., Kemp, B.E., 2004. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site. Protein Sci. 13 (1), 155–165. Berg, E.P., McFadin, E.L., Maddock, R.R., Goodwin, N., Baas, T.J., Keisler, D.H., 2003. Serum concentrations of leptin in six genetic lines of swine and relationship with growth and carcass characteristics. J. Anim. Sci. 81 (1), 167–171. Bruun, C.S., Jorgensen, C.B., Nielsen, V.H., Andersson, L., Fredholm, M., 2006. Evaluation of the porcine melanocortin 4 receptor (MC4R) gene as a positional candidate for a fatness QTL in a cross between Landrace and Hampshire. Anim. Genet. 37 (4), 359–362. Cheung, P.C., Salt, I.P., Davies, S.P., Hardie, D.G., Carling, D., 2000. Characterization of AMP-activated protein kinase gamma-subunit isoforms and their role in AMP binding. Biochem. J. 346 (Pt 3), 659–669.
X. Li et al. / Comparative Biochemistry and Physiology, Part B 147 (2007) 271–277 Ferre, P., Azzout-Marniche, D., Foufelle, F., 2003. AMP-activated protein kinase and hepatic genes involved in glucose metabolism. Biochem. Soc. Trans. 31 (Pt 1), 220–223. Frederich, M., Balschi, J.A., 2002. The relationship between AMP-activated protein kinase activity and AMP concentration in the isolated perfused rat heart. J. Biol. Chem. 277 (3), 1928–1932. Guicherit, O.M., Rudolph, F.B., Kellems, R.E., Cooper, B.F., 1991. Molecular cloning and expression of a mouse muscle cDNA encoding adenylosuccinate synthetase. J. Biol. Chem. 266 (33), 22582–22587. Guicherit, O.M., Cooper, B.F., Rudolph, F.B., Kellems, R.E., 1994. Amplification of an adenylosuccinate synthetase gene in alanosine-resistant murine Tlymphoma cells. Molecular cloning of a cDNA encoding the “non-muscle” isozyme. J. Biol. Chem. 269 (6), 4488–4496. Hardie, D.G., Hawley, S.A., 2001. AMP-activated protein kinase the energy charge hypothesis revisited. Bioessays 23 (12), 1112–1119. Honzatko, R.B., Stayton, M.M., Fromm, H.J., 1999. Adenylosuccinate synthetase: recent developments. Adv. Enzymol. Relat. Areas Mol. Biol. 73, 57–102. Kemp, B.E., Stapleton, D., Campbell, D.J., Chen, Z.P., Murthy, S., Walter, M., Gupta, A., Adams, J.J., Katsis, F., vanDenderen, B., Jennings, I.G., Iseli, T., Michell, B.J., Witters, L.A., 2003. AMP-activated protein kinase, super metabolic regulator. Biochem. Soc. Trans. 31 (Pt 1), 162. Kim, C.W., Hong, Y.H., Yun, S., Lee, S.R., Kim, Y.H., Kim, M.S., Chung, K.H., Jung, W.Y., Kw, E.J., 2006. Use of microsatellite markers to detect quantitative trait loci in Yorkshire pigs. J. Reprod. Dev. 52 (2), 229–237. Kjeldgaard, M., Nyborg, J., Clark, B.F., 1996. The GTP binding motif: variations on a theme. Faseb. J. 10 (12), 1347–1368. Leff, T., 2003. AMP-activated protein kinase regulates gene expression by direct phosphorylation of nuclear proteins. Biochem. Soc. Trans. 31 (Pt 1), 224–227. Lewis, A.L., Guicherit, O.M., Datta, S.K., Hanten, G.R., Kellems, R.E., 1996. Structure and expression of the murine muscle adenylosuccinate synthetase gene. J. Biol. Chem. 271 (37), 22647–22656. Lowenstein, J.M., 1972. Ammonia production in muscle and other tissues: The purine nucleotide cycle. Physiol. Rev. 52 (2), 382–414. Lowenstein, J.M., Hollander, V., 1973. The purine nucleotide cycle. The production of ammonia from aspartate by brain and muscle. Vopr. Biokhim. Mozga. 8, 49–62. Milan, D., Hawken, R., Cabau, C., Leroux, S., Genet, C., Lahbib, Y., Tosser, G., Robic, A., Hatey, F., Alexander, L., Beattie, C., Schook, L., Yerle, M., Gellin, J., 2000. IMpRH server: an RH mapping server available on the Web. Bioinformatics 16 (6), 558–559.
277
Murani, E., Muraniova, M., Ponsuksili, S., Schellander, K., Wimmers, K., 2006. Molecular characterization and evidencing of the porcine CRH gene as a functional–positional candidate for growth and body composition. Biochem. Biophys. Res. Commun. 342 (2), 394–405. Operti, M.G., Vincent, M.F., Brucher, J.M., van den Berghe, G., 1998. Enzymes of the purine nucleotide cycle in muscle of patients with exercise intolerance. Muscle Nerve 21 (3), 401–403. Scott, J.W., Hawley, S.A., Green, K.A., Anis, M., Stewart, G., Scullion, G.A., Norman, D.G., Hardie, D.G., 2004. CBS domains form energy-sensing modules whose binding of adenosine ligands is disrupted by disease mutations. J. Clin. Invest. 113 (2), 274–284. Stayton, M.M., Rudolph, F.B., Fromm, H.J., 1983. Regulation, genetics, and properties of adenylosuccinate synthetase: a review. Curr. Top. Cell. Regul. 22, 103–141. Sun, H., Li, N., Wang, X., Chen, T., Shi, L., Zhang, L., Wang, J., Wan, T., Cao, X., 2005. Molecular cloning and characterization of a novel muscle adenylosuccinate synthetase, AdSSL1, from human bone marrow stromal cells. Mol. Cell. Biochem. 269 (1–2), 85–94. Tullson, P.C., Terjung, R.L., 1991a. Adenine nucleotide metabolism in contracting skeletal muscle. Exerc. Sport Sci. Rev. 19, 507–537. Tullson, P.C., Terjung, R.L., 1991b. Adenine nucleotide synthesis in exercising and endurance-trained skeletal muscle. Am. J. Physiol. 261 (2 Pt 1), C342–C347. Wendrich, M.D., Moser, G., Bartenschlager, H., Reiner, G., Geldermann, H., 2003. Linkage and QTL mapping for Sus scrofa chromosome 10. J. Anim. Breed. Genet. 120 (Suppl. 1), 82–88. Westra, H.G., De Haan, A., van Doorn, J.E., de Haan, E.J., 1986. IMP production and energy metabolism during exercise in rats in relation to age. Biochem. J. 239 (3), 751–755. Wilson, W.A., Hawley, S.A., Hardie, D.G., 1996. Glucose repression/ derepression in budding yeast: SNF1 protein kinase is activated by phosphorylation under derepressing conditions, and this correlates with a high AMP:ATP ratio. Curr. Biol. 6 (11), 1426–1434. Xu, Z., Yaguchi, S., Tsurugi, K., 2004. Gts1p stabilizes oscillations in energy metabolism by activating the transcription of TPS1 encoding trehalose-6phosphate synthase 1 in the yeast Saccharomyces cerevisiae. Biochem. J. 383 (Pt 1), 171–178. Zhu, Z.M., Zhang, J.B., Li, K., Zhao, S.H., 2005. Cloning, mapping and association study with carcass traits of the porcine SDHD gene. Anim. Genet. 36, 191–195.