Comparative pharmacology of the human NMDA-receptor subtypes R1-2A, R1-2B, R1-2C and R1-2D using an inducible expression system

European Journal of Pharmacology 637 (2010) 46–54

Contents lists available at ScienceDirect

European Journal of Pharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / e j p h a r

Molecular and Cellular Pharmacology

Comparative pharmacology of the human NMDA-receptor subtypes R1-2A, R1-2B, R1-2C and R1-2D using an inducible expression system Dominik Feuerbach a,⁎, Erika Loetscher b, Stephanie Neurdin a, Manuel Koller c a b c

Neuroscience Research, Novartis Institutes for BioMedical Research, CH 4002 Basel, Switzerland Autoimmune and Transplantation Research, Novartis Institutes for BioMedical Research, CH 4002 Basel, Switzerland Global Discovery Chemistry, Novartis Institutes for BioMedical Research, CH 4002 Basel, Switzerland

a r t i c l e

i n f o

Article history: Received 4 December 2009 Received in revised form 9 March 2010 Accepted 1 April 2010 Available online 13 April 2010 Keywords: NMDA receptor Calcium influx Stable expression Fluorimetric imaging plate reader Intracellular calcium measurement Real Time PCR

a b s t r a c t Pharmacological characterization of N-methyl-D-aspartate (NMDA) receptors has been hampered by the difficulty to outwit cytotoxicity after functional expression in recombinant systems. In this study a muristerone-inducible expression system for the NNMDA-R1 subunit was used. This was combined with constitutive expression of NMDA-R2A, 2B, 2C and 2D in different cell clones. After establishment of the cell lines, quantitative RT-PCR demonstrated the inducibility of the NNMDA-R1 subunit, and verified the expression of the NMDA-R2 subunits in the different cell clones. Functional responses were characterized using calcium influx through the ion channel as a robust assay system. Stimulation of the NMDA-receptor subtypes in the different cell lines led to calcium transients which were rising gradually, peaked after 30– 160 s and declined thereafter very slowly. The expression of the four different NMDA-receptor subtypes in the same cellular background allowed a direct pharmacological comparison of the different receptors. Glutamate showed the highest potency at the NMDA-R1-2D. NMDA displayed at all subtypes a lower potency compared to glutamate and was a partial agonist except at the NMDA-R1-2D. 20 antagonists were tested in this study and the pharmacological characterization of the inhibition of glutamate-evoked elevation of intracellular free Ca2+ revealed a distinct rank order of antagonist potency for each receptor subtype. These data illustrate that assessment of calcium transients upon receptor stimulation in the same cellular background is a powerful tool to compare the functional effects of compounds acting at the different NMDAR2 receptors. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Glutamatergic synapses mediate most of the excitatory neurotransmission in mammalian brains. Glutamate released from presynaptic terminals activates several types of ligand gated ion channels, including N-methyl-D-aspartate (NMDA) receptors. To date seven genes have been identified that encode NMDA-receptor subunits, namely one NMDA-R1 subunit, four NMDA-R2 subunits (2A-D), and two NR3 subunits (NR3A and B) (Dingledine et al., 1999). Eight splice variants exist for the NMDA-R1 subunit (Waxman and Lynch, 2005), that differentially influence NMDA-receptor mediated gene expression (Bradley et al., 2006). NMDA-receptor subunits have specific regional and temporal expression patterns. Adult rodent cortex expresses mainly NMDA-R1, NMDA-R2A, and NMDA-R2B subunits. NMDA-R2C expression is restricted to the granule cell layer I in the cerebellum, hippocampal interneurons, glial cells in cortex, the corpus callosum and the pineal gland (Monyer et al., 1994). NMDA-R2D ⁎ Corresponding author. Neuroscience Research, NIBR, WSJ386.725, 4002 Basel, Switzerland. Tel.: + 41 61 324 8543; fax: + 41 61 324 4866. E-mail address: [email protected] (D. Feuerbach). 0014-2999/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2010.04.002

expression is even more restricted to midline thalamic nuclei, hypothalamus, superior colliculus and the substantia nigra. Functional NMDA receptors form hetero-tetrameric complexes of two NR1 subunits and two NMDA-R2 subunits (Bigge, 1999). The NMDA-NR1 subunit binds glycine and the NMDA-R2 subunits harbor a glutamate binding site. The glycine site must be occupied before the glutamate site, however it seems that the glycine site is occupied most of the time (Johnson and Ascher, 1987). In addition, magnesium acts as a voltage-dependent antagonist at resting membrane potential while membrane depolarization relieves the block. This magnesium block is much weaker for the NMDA-R1-2C and NMDA-R1-2D receptors (Ishii et al., 1993) and the conductances are smaller compared to the other NMDA-receptor subunits (Farrant et al., 1994). Activation of NMDA-receptor requires binding of both glutamate and glycine, as well as a simultaneous depolarization of the plasma membrane. Signaling by NMDA receptors involves the influx of extracellular calcium and is crucial for inducing synaptic plasticity processes like LTD or LTP. NMDA receptors activate intracellular signaling pathways like MAPK and the transcription factor Cyclic-AMP Response Element Binding protein (CREB) (Papadia et al., 2005; Ivanov et al., 2006). NMDA receptors are involved in the

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

pathophysiology of a range of diseases like brain injury, epilepsy, Alzheimer's disease and schizophrenia. The recombinant expression of NMDA receptor in a defined cellular background allows the efficient characterization of the subtype selectivity and activity of agonists, antagonists or allosteric modulators. Several groups have reported on the characterization of human, mouse and rat NMDA receptors in recombinant systems (Priestley et al., 1995; Grimwood et al., 1996; Varney et al., 1996; Uchino et al., 2001; Steinmetz et al., 2002; Nagy et al., 2003; Kurko et al., 2005; Hansen et al., 2008). However, none of these studies has compared more than two NMDA-receptor ligands at all 4 NMDA-R2 receptor subtypes. In this report an inducible expression system is used for the NR1 subunit, in combination with stable expression of either the NMDA-R2A, 2B, 2C or the 2D subunit. Using influx of extracellular Ca2+ as read-out, the pharmacological characteristics of the distinct NMDA-receptor subtypes in a single cellular background were established with the aid of pharmacological tool compounds. 2. Materials and methods 2.1. DNA constructs The NMDA-receptor expressing cell lines were designed such that the NR1 subunit is inducible upon muristerone induction, whereas the different NR2 subunits are expressed constitutively. hNMDA-R1 cDNA was cloned into the NheI/NotI site of the pIND/Hygro vector (Invitrogen, Groningen, The Netherlands). The hNMDA-R2A cDNA was inserted into the EcoRI/NotI site and the hNMDA-R2D cDNA into the EcoRV/EcoRI site of the pCDNA3.1neo(−) vector (Invitrogen, Groningen, The Netherlands). The hNMDA-R2C cDNA was cloned into the BamHI/EcoRI site of the pCDNA3.1neo(+) vector (Invitrogen, Groningen, The Netherlands), whereas the hNMDA-R2B cDNA was cloned into the EcoRI/EcoRV site of the pCMV-T7 vector (Invitrogen, Groningen, The Netherlands). 2.2. Cell culturing and generation of stable cell lines 293EcR cells (Invitrogen, Groningen, The Netherlands) were cultured in a 1:1 mixture of Dulbecco's Modified Eagle Medium (DMEM, Seromed, Biochrom, Berlin, Germany; 3.7 g/l NaHCO3; 1.0 g/l sucrose; with stable glutamine) and Ham's F-12 Nutrient Mixture (Seromed; 1.176 g/l NaHCO3; with stable glutamine) supplemented with 10% (v/v) dialyzed fetal bovine serum (FBS; Gibco BRL) and 0.2 mg/ml zeocine at 37 °C, 5% CO2 and 95% relative humidity. For passaging, the cells were detached from the cell culture flask by washing with phosphatebuffered saline (PBS) and brief incubation with trypsine (0.5 mg/ml)/ EDTA (0.2 mg/ml) (Gibco BRL). The cells were passaged every 3 days. 293EcR cells were transfected using the SuperFect kit (Quiagen, Hilden, Germany) according to the manufacturer's instruction with both the hNMDA-R1 and the hNMDA-R2 cDNA's simultaneously. For each combination a separate transfection was carried out. In case of the hNMDA-R2B receptor the plasmid was transfected together with 1/10 of the pCDNA3.1 vector since the hNMDA-R2B was cloned in a plasmid which did not contain a neomycin resistance gene. Neomycin and hygromycin B selection was initiated 48 h after transfection with 0.2 mg/ml neomycin and 0.2 mg/ml hygromycin B. After individual colonies were visible about 200 cell clones were picked using cloning cylinders and expanded for further analysis. 2.3. Measurement of intracellular Ca2+ 1.5 × 104 cells per well were seeded 48 h prior to the experiment on black poly-L-lysine coated 96-well plates (Costar, New York, USA) in normal growth medium and incubated at 37 °C in a humidified atmosphere (5% CO2/95% air). 16 h before the experiment medium was changed to 1% BSA in HEPES-buffered salt solution (HBSS, in mM:

47

NaCl 130, KCl 5.4, MgSO4 4, NaH2PO4 0.9, glucose 25, CaCl2 1.8 mM, ketamine 0.1, muristerone 0.001, Hepes 20, pH 7.4). On the day of the experiment medium was replaced with 100 µl HBSS/1%BSA containing 2 µM Fluo-4, (Molecular Probes) in the presence of 0.1 mM probenecid (Sigma). The cells were incubated at 37 °C in a humidified atmosphere (5% CO2/95% air) for 30 min. Plates were flicked to remove excess of Fluo-4, washed twice with HBSS/1%BSA and refilled with 100 µl of Mgfree HBSS containing 25 µM glycine, 100 µM probenecid, 5 mM CaCl2, 20 mM HEPES and antagonists when appropriate. The incubation in the presence of the antagonist lasted 5 min. Plates were then placed in the cell plate stage of the FLIPR (Molecular Devices, Sunnyvale, CA, USA). A baseline consisting in 5 measurements of 0.4 s each (laser: excitation 488 nm at 1 W, CCD camera opening of 0.4 s) was recorded. Agonists (50 µl) were added to the cells using the FLIPR 96-tip pipettor simultaneously to fluorescence recordings for 3 min. To assess the activity of antagonists 10 µM glutamate was used for NMDA-R1-2A and -2B, 30 µM glutamate for the NMDA-R1-2C and 3 µM for the NMDA-R12D. Calcium kinetic data were normalized to the maximal fitted response induced by glutamate which was included in each experiment. Four parameter Hill equations were fitted to the concentration– response data (GraphPad Prism 3.0). Values of Emax (maximal effect), EC50 (concentration producing half the maximal effect) and IC50 were derived from this fit. Each graph is a representative plot from at least three determinations. All measurements were performed in triplicates and error bars in the graphs are standard deviation (S.D.). 2.4. Relative quantification of NMDA-receptor transcripts Total RNA was isolated from cell lines using the S.N.A.P.™ Total RNA Isolation Kit (Invitrogen) according to the manufacturer's instructions, except that the DNAse I treatment was done twice to remove all traces of genomic DNA. The amount of total RNA was determined by staining the RNA with RiboGreen (Molecular Probes). The concentration of the RNA stained with RiboGreen was determined using a fluorescence microplate reader (Fluorskan II; BioConcept). For the reverse transcription, 2 µg of total RNA was transcribed into cDNA in 20 µl of buffer containing 1.5 µg random hexamer primers, 10 mM DTT, 0.4 mM dNTPs, 50 mM Tris–HCl (pH 8.3), 75 mM KCl and 3 mM MgCl2. The reaction mix without the reverse transcriptase was incubated at 95° C for 10 min, followed by 70° C for 10 min and then at 37° C for 5 min. 200 U of M-MLV reverse transcriptase (GIBCO/BRL) were added and the reaction was incubated at 37° C for 60 min. The reaction was stopped by heating up to 95° C for 10 min. After completion of the reaction, the cDNA was diluted with H2O to a final concentration of 10 ng/µl. For the TaqMan assays the following thermal cycling profile was used: 50° C/2 min, 95° C/10 min followed by 40 cycles of 95°C/15 s and 60° C/1 min. The forward and reverse primers and the TaqMan probe were designed by using the Primer Express software Version 1.0 (PE Applied Biosystems). Specificity of the primer and probes was checked by running BLAST searches against the GeneBank/EMBL databases. The forward and reverse primers as well as the TaqMan probe were synthesized by Microsynth AG (Balgach, Switzerland). The probes were labelled at the 5′ end with FAM and at the 3′ end with TAMRA (see Table 1). For the TaqMan “Real Time PCR” approach, the TaqMan Universal PCR master mix (Perkin-Elmer) was used. The mix is supplied as a 2× concentrated solution containing AmpliTaq Gold DNA polymerase, AmpErase UNG, dNTPs with dUTP, ROX and the buffer components. For all TaqMan assays, the primers and the probe were used at concentrations of 300 nM and 175 nM, respectively. The expression levels of the NMDA-receptor subunits were analyzed by determining the CT (threshold cycle; cycle at which a statistically significant increase in fluorescence is first detected) values. 2.5. Compounds The substances were obtained from Tocris (Anawa Trading SA, Wangen, Switzerland) or were synthesized at Novartis Pharma AG,

48

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

Table 1 Summary of the oligotriplets of human NMDA-receptor subunits and control genes used for Real Time PCR (TaqMan Approach). The GenBank accession number and the sequences of the oligotriplets are presented. Gene

GenBank Oligonucleotide Sequence number name

huNR1

L05666

huNR1-1 huNR1-2 huNR1-3

huNR2A

U09002

huNR2A-1 huNR2A-2 huNR2A-3

huNR2B

U90278

huNR2B-1 huNR2B-2 huNR2B-3

huNR2C

U77782

huNR2C-1 huNR2C-2 huNR2C-3

huNR2D

U77783

huNR2D-1 huNR2D-2 huNR2D-3

hu actin

M10277

huActin-1 huActin-2 huActin-3

Cyclophilin Y00052

huCyclo-1 huCyclo-2 huCyclo-3

5′ GATGATGGGCGAGCTGCT 3′ 5′ TGTTTATGGTTAGCGGCGC 3′ 5′ FAMAGCGGGCAGGCAGACATGATCGTTAMRA 3′ 5′ TGTGACCCTGCCCGAGA 3′ 5′ GCGGAAGTTTTCACTGGGATC 3′ 5′ FAM-CGTGGACTTCCCGGACCCCTACCTAMRA 3′ 5′ TCCCCGCCAGAGTGAGAG3′ 5′ TGTGCTCAGACAGCATGTCAGA 3′ 5′ FAMTGGAATTGCCATAATCACCACTGCTGCTAMRA 3′ 5′ GCCACTGTCAGGGTTAAGCG 3′ 5′ ATGGCCAGGATTTCATGGTAGA 3′ 5′ FAMCAGGCAGGATTGGGCTTTTCTGGCTAMRA 3′ 5′ CCCTGCTGCGTGATTATG 3′ 5′ GGTTCTGGGCGCGACAG 3′ 5′ FAM-TTCCTTCCTGAGCTCGGCCACCTAMRA 3′ 5′ TCACCCACACTGTGCCCATCTACGA 3′ 5′ CAGCGGAACCGCTCATTGCCAATGG 3′ 5′ FAM-ATGCCC-X(TAMRA)CCCCCATGCCATCCTGCGT 3′ 5′ GCGCTTTGGGTCCAGGA 3′ 5′ TCGAGTTGTCCACAGTCAGCA 3′ 5′ FAMTGGCAAGACCAGCAAGAAGATCACCATAMRA 3′

Basel, Switzerland. A list with the structure, generic name and IUPAC name is given in Table 2. The substances were prepared at 10 or 30 mM, either in distilled water or in DMSO and further diluted in HBSS. 3. Results 3.1. Generation of cell lines stably expressing the NMDA-receptor subtypes To avoid cytotoxicity caused by continuous stimulation of constitutively expressed NMDA receptors, a muristerone-inducible expression system was chosen (see Materials and methods section). After transfection the colonies which were resistant to the selection-marker were analyzed for expression of the different NMDA-receptor subunits. The NR1 subunit was induced with muristerone, cells were stimulated with glutamate and intracellular calcium increases recorded using the FLIPR. From each NMDA-receptor subtype 150–200 clones were tested. For further analysis clones were selected on the following criteria: first, whether the glutamate-evoked response was maintained over several passages and secondly, whether basal fluorescence remained unaffected by administration of a NMDA-receptor antagonist (a reduction would indicate activation of the receptor under basal conditions). Cell clones were used for up to 30 passages. At higher passages the signal deteriorated or the basal activation increased, particularly for the NMDA-R1-2C and NMDA-R1-2D clones. 3.2. Quantification of the mRNA levels of the NMDA-receptor subunits in the different cell lines The expression of NMDA-receptor subunits in the different clones was verified at the mRNA level by quantitative RT-PCR. Untransfected 293EcR cells do not express NMDA-receptor subunits (CT values N35,

data not shown). Addition of 0.3 to 10 µM muristerone induced dose dependently the NMDA-R1 mRNA in all cell lines, except in the NMDA-R2A cell. The inducibility of the NR1 subunit was about 7 fold for the NMDA-R1-2D, 9 fold for the NMDA-R1-2C and 30 fold for the NMDA-R1-2B cell line (see Fig. 1). In the NMDA-R1-2A cell line a strong basal expression was observed that was not further increased upon muristerone treatment (data not shown). In all further experiments cells were pretreated with 1 µM muristerone for 16 h. The expression level of the NMDA-R2A, NMDA-R2B, NMDA-R2C and NMDA-R2D in the different cell lines was comparable (CT values of about 22, data not shown). 3.3. Characterization of the intracellular calcium increase after agonist stimulation Typical calcium kinetics after stimulation of the different NMDAreceptor subunits in their respective cell line are shown in Fig. 2. After stimulation of the receptor an initial drop in the fluorescence change was seen. This might be due to the dilution of dye which diffused out of the cells after washing when the agonist is added or due to the release of dye from cells where the membrane is disintegrated. Then a slow rise in fluorescence change was detected which peaked after 30 to 60 min for NMDA-R1-2A and NMDA-R1-2B and after 100–140 s for NMDA-R1-2C and NMDAR-R1-2D and declined thereafter very slowly. The graph also demonstrates that the increase in fluorescence is quantitatively related to the extent to which the receptor is stimulated by an agonist. The rapid change in fluorescence after agonist stimulation is caused by an increase in intracellular calcium. Omission of calcium from the extracellular buffer abrogated the signal caused by agonist stimulation (Fig. 3A, data for 293EcR-hNMDA-R1-2B cells shown only). Next it was investigated whether calcium induced calcium release (CICR) contributed to the intracellular calcium increase. Preincubating the cells with dantrolene, a cell-permeable blocker of intracellular calcium release from the endoplasmatic reticulum, did not affect the rise in intracellular calcium after agonist stimulation (Fig. 3A). Further, pre-treatment of the cells with xestospongine, a cell-permeable blocker of IP3-mediated calcium release, did not change the glutamate-evoked increases in intracellular calcium. To explore the possibility of calcium entry via voltage-gated calcium channels, the cells were depolarized with potassium or treated with (−)bayK8644, an L-type calcium channel activator. None of these treatments led to an increase in intracellular calcium (Fig. 3B). The maximal intracellular calcium signal caused by agonist stimulation might be limited by the availability of the fluorescent dye which would lead to a distorted estimation of the Emax responses. This possibility can be ruled out, since the stimulation of the 293EcRNMDA-R1-2B cells with ionomycin, an agent which inserts holes into the plasma membrane and thus allows unspecific influx of ions, led to a significantly higher fluorescence change compared to glutamate. For comparison the absolute fluorescence changes are given in Fig. 3B. Similar results as shown in Fig. 3 for the NMDA-R1-2B subunit were obtained for the other NMDA subunits. Taken together, these experiments suggest that the calcium responses recorded, are the direct result of calcium influx after NMDA-receptor activation and not caused by secondary activation of voltage-gated calcium channels or release of calcium from intracellular stores. Furthermore the fluorescent dye is not saturated by the calcium increase caused by the NMDA-receptor activation since much stronger calcium signals—like elicited via treatment of the cells with ionomycin—can be recorded. 3.4. Effect of muristerone treatment on calcium transient after agonist stimulation Muristerone treatment prior to the calcium influx measurements is critical, because in the absence of muristerone, glutamate was not

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

49

Table 2 Structure, generic name and IUPAC name of compounds used in the study. Structure

Generic name

IUPAC name (AutoNom)

PCP (phencyclidine)

1-(1-Phenyl-cyclohexyl)-piperidine

Ro 25-6981

4-[(1R,2S)-3-(4-Benzyl-piperidin-1-yl)-1-hydroxy-2-methylpropyl]-phenol

46b

5-[3-(4-Benzyl-piperidin-1-yl)-prop-1-ynyl]-1,3-dihydrobenzoimidazol-2-one

PEAQX

[(R)-[(S)-1-(4-Bromo-phenyl)-ethylamino]-(2,3-dioxo-1,2,3,4tetrahydro-quinoxalin-5-yl)-methyl]-phosphonic acid

AP-5

2-Amino-5-phosphono-pentanoic acid

AP-7

2-Amino-7-phosphono-heptanoic acid

D-CPP-ene

(R)-4-((E)-3-Phosphono-allyl)-piperazine-2-carboxylic acid

(±)-CPP

4-(3-Phosphono-propyl)-piperazine-2-carboxylic acid

Selfotel (CGS 19755)

(2R,4S)-4-Phosphonomethyl-piperidine-2-carboxylic acid

(continued on next page)

50

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

Table 2 (continued) Structure

Na2NH4[Fe(CN)5(NH3)] Na2[Fe(CN)5(NH3)]

Generic name

IUPAC name (AutoNom)

CGP 40116

(E)-(R)-2-Amino-4-methyl-5-phosphono-pent-3-enoic acid

SDZ 220-581

(S)-2-Amino-3-(2′-chloro-5-phosphonomethyl-biphenyl3-yl)-propionic acid

SDZ 220-004

(S)-2-Amino-3-(2′-chloro-4-hydroxy-5-phosphonomethylbiphenyl-3-yl)-propionic acid

Aminopentacyanoferrate(II) Aminopentacyanoferrate(III)

Ammonium disodium aminopentacyano-ferrate(II) Disodium aminopentacyanoferrate(III)

(R)-HA-966

(R)-3-Amino-1-hydroxy-pyrrolidin-2-one

AMP397

{[(7-Nitro-2,3-dioxo-1,2,3,4-tetrahydro-quinoxalin-5ylmethyl)-amino]-methyl}-phosphonic acid

able to induce calcium influx. Without induction, no glutamate induced calcium influx was observed (data not shown). An exception was the NMDA-R1-2A cell line and the NMDA-R1-2D cell line, in which receptor stimulation evoked a weak response (approximately 10% of the response seen in the muristerone-treated condition).

3.5. Effect of NMDA-receptor agonists and antagonists on the intracellular calcium release in the different cell lines Concentration–response curves for the prototypic agonists, glutamate and NMDA in the four different cell lines are shown in Fig. 4. Except at the NMDA-R1-2D receptor, NMDA behaved as a partial agonist. Glutamate displayed the highest potency at the NMDA-R12D. A summary of the agonist responses by glutamate and NMDA in the four cell lines is given in Table 3. The glutamate-elicited calcium influx in the different cell lines is blocked by known NMDA antagonists, demonstrating that the calcium transients are caused by the activation of NMDA receptors and not by any unspecific interaction or other endogenously expressed receptors. A selected range of antagonists binding at different sites to the NMDA receptor was tested for their inhibitory activity in the four

NMDA-receptor expressing cell lines and a summary of the results is given in Table 4.

4. Discussion These studies report the establishment of four stable, inducible cell lines expressing recombinant the NMDA-receptor subtypes NR1NR2A to D and describe their pharmacological characterization. Over prolonged passages (20–30) the signal deteriorated. The reason might be that the muristerone driven expression system is not completely shut off in the absence of muristerone. The resulting basal transcription of the NR1 subunit which leads to functional NMDA receptors might reduce the growth of the NMDA-R1 containing cells in favor of cells that have lost the receptor. This effect was most pronounced for the NMDA-R1-2C and NMDA-R1-2D expressing cell lines. The increase in [Ca2+]i which is transient in nature might be explained by a slow desensitization of the receptor and by mechanisms that sequester cytoplasmic Ca2+. Based on experiments reported here the agonist-induced increases in intracellular calcium are mainly, if not exclusively due to calcium influx through the NMDA channel.

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

51

Fig. 1. Relative mRNA expression level of NMDA-R1 subunit after muristerone treatment in the different cell lines. Error bars are S.D. Expression levels were normalized to 18S RNA levels and repeated twice with similar results.

Thus, omission of calcium from the extracellular buffer solution obliterated the signal. Second, activation of voltage-gated ion channels seems not to be involved in the transient cytoplasmic calcium increase in HEK293 cells, because depolarization of the cells with potassium, which would activate expressed voltage-gated calcium channels, did not lead to an intracellular calcium increase. In addition, stimulation of the cells with the L-type calcium channel activator (−)BayK8644 did not rise intracellular calcium levels. Whereas the absence of voltage-gated calcium channels was not surprising in a non-excitable cell, we investigated further mechanisms that might enhance the increase of intracellular calcium. It is unlikely that calcium released from intracellular stores contributed to the cytoplasmic calcium elevation, since neither dantrolene, nor xestospongine influenced calcium transients. Ionomycin also induced calcium transients, however the response to this agent elicited a much higher fluorescence than glutamate or NMDA. The result of this experiment shows that the calcium transients are not limited by saturation of the dye. The calcium transients obtained with the human NMDA-receptor subunits are very similar to those found with rat NMDA receptors in HEK cells (Kurko et al., 2005) or CHO cells (Hansen et al., 2008). The slow decline of the calcium traces reflects well the slow desensitization of NMDA-R which contrasts calcium traces of fast desensitizing channels like the muscle nAChR (Michelmore et al., 2002) or voltage-gated calcium channels (Feuerbach et al., 2005). Two agonists, glutamate and NMDA were characterized for their potency and efficacy. Glutamate displayed the following rank order of potency at the different NMDA receptors: NMDA-R1-R2D N NMDA-R1R2B = NMDA-R1-R2C N NMDA-R1-R2A. The rank order of potency for NMDA was NMDA-R1-R2D = NMDA-R1-R2B NNMDA-R1R2A N NMDA-R1-R2C. Using calcium imaging in a recombinant

Fig. 2. Calcium kinetics as displayed by the FLIPR. Glutamate was added at a time point 20 s. Solid line: 100 µM glutamate, dashed line: 10 µM glutamate for A, B and C and 3 µM for D, dotted line: buffer. A: 293EcR-hNMDA-R1-2A cells, B: 293EcR-hNMDA-R1-2B cells, C: 293EcR-hNMDA-R1-2C cells, D: 293EcR-hNMDA-R1-2D cells. Error bars represent S.D. of 3–6 wells.

NMDA-receptor expression system without induction the same rank order of potency was described for glutamate (Hansen et al., 2008). In further experiments these authors determined the potencies for glutamate using two-electrode voltage clamp electrophysiology (TEVC) at rat NMDA receptors expressed in oocytes and showed the same rank order. For NMDA we showed a slightly different rank order of potency compared to glutamate at the four NMDA-receptor subtypes, whereas in the study of Hansen et al. (2008) NMDA displayed the same rank order of potency as glutamate in TEVC and in the calcium influx experiments (NMDA-R1-2D was assessed in TEVC only). Further, NMDA was a full agonist at NMDA-R1-2D in our study and a partial agonist with about 60% efficacy of glutamate at the other NMDA-receptor subtypes. In the study by Hansen et al. (2008) NMDA was a partial agonist at all NMDA-receptor subtypes including

52

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

Fig. 3. Effect of different compounds on the increase of intracellular calcium in 293EcRhNMDA-R1-2B cells. Error bars are S.D.

the NMDA-R1-2D using TEVC. These discrepancies might be attributed to the different species (rat vs. human) or methodology (calcium influx vs. TEVC). In the next set of experiments a selected range of antagonists was assessed for their activity at the different NMDA-receptor subtypes. The “classical” antagonists like AP-5, AP-7, D-CPPene, CPP, CGP40116 and selfotel were tested and displayed a general inhibition of most subtypes (recently reviewed in Paoletti and Neyton, 2007). Further it was confirmed that D-CPPene shows a lower IC50 in the functional test employed here (5.68 at NMDA-R1-R2A) compared to binding at rat neocortex (pKi 7.5, Lowe et al., 1994). Ifenprodil and Ro25-6981 (Fischer et al., 1997) showed high selectivity to the NMDA-R1-2B subunit which is well in agreement with published data, although ifenprodil also blocks NMDA-R1-2D at higher concentrations. The typical antipsychotic compound haloperidol and the atypical clozapine showed inhibition in the high micromolar range. Using twoelectrode voltage clamp electrophysiology and rat NMDA receptors, haloperidol has been shown to inhibit selectively the NMDA-R1-2B (Ilyin et al., 1996). In the current study haloperidol shows the highest potency also at the NMDA-R1-R2B but the NMDA-R2C and NMDA-R12D are inhibited at 5 fold higher concentrations. PEAQX (Auberson et al., 2002), formerly described as a NMDA-R1-2A preferring antagonist at rat NMDA receptor also blocks NMDAR-R1-2C and 2D with similar potency as NMDA-R1-R2A. AMP397 (Suter et al., 2002) which has been shown to be a selective AMPA-R antagonist displays only weak activity at the NMDA-R1-2A with no effect at the other subunits. The most potent antagonists at all NMDA-receptor subtypes are the biphenyl analogues of AP-7, PKF220-581 and PKF220-004 (Urwyler et al., 1996). The aminopentacyanoferrate(III) and (II) which were described as competitive and selective NMDA-receptor antagonists (Neijt et al., 2001) inhibited all four NMDA-receptor subtypes with highest activity at the NMDA-2C. In the literature, a variety of strategies has been employed to generate cell lines recombinantly expressing NMDA receptors and to overcome cytotoxicity owing to chronic activation of the NMDA receptor by ambient glutamate and glycine. Several reports describe cellular systems in which NMDA-receptor expression is induced by heat (Uchino et al., 2001, mouse NMDA receptor), dexamethasone

Fig. 4. Effect of glutamate (squares) and NMDA (triangles) on the calcium influx in A: 293EcR-hNMDA-R1-2A cells, B: 293EcR-hNMDA-R1-2B cells, C: 293EcR-hNMDA-R12C cells, D: 293EcR-hNMDA-R1-2D cells. Each graph is a representative plot from at least 5 different determinations. Error bars are S.D.

(Priestley et al., 1995, human NMDA receptor; Varney et al., 1996, human NMDA receptor; Steinmetz et al., 2002, human NMDA receptor; Grimwood et al., 1996, human NMDA receptor) or muristerone (Nagy et al., 2003, rat NMDA receptor; Kurko et al., 2005, rat NMDA receptor). In many studies a NMDA-receptor antagonist has been added during cell culture to further reduce activation of the receptor (e.g. ketamine by Priestley et al., 1995 or AP5 and DCKA by Hansen et al., 2008). Some of these studies have developed functional assays using intracellular calcium assessments (Varney et al., 1996; Uchino et al., 2001; Nagy et al., 2003; Kurko et al., 2005). Using a muristerone-inducible cellular system we have now established a functional assay for the four human NMDA-R1-R2 receptors which allows to compare activity of compounds in the same cellular background. The system might be limited by the fact that only early passages of the cell lines can be used, by autofluorescence of compounds, or by agents that change the ion-selectivity of the

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

53

Table 3 Agonist parameters in the different NMDA-receptor expressing cell lines. Relative efficacy values are Emax values expressed as percentage of Emax of glutamate. Cells

Glutamate NMDA

NMDA-R1-2A

NMDA-R1-2B

NMDA-R1-2C

NMDA-R1-2D

pEC50 ± S.E.M.

Efficacy ± S.E.M.

n

pEC50 ± S.E.M.

Efficacy ± S.E.M.

n

pEC50 ± S.E.M.

Efficacy ± S.E.M.

n

pEC50 ± S.E.M.

Efficacy ± S.E.M.

n

5.5 ± 0.08 4.6 ± 0.1

100 67 ± 7

14 9

5.9 ± 0.06 4.9 ± 0.12

100 66 ± 10

29 5

5.8 ± 0.07 4.4 ± 0.1

100 56 ± 8

15 8

6.4 ± 0.07 5.0 ± 0.12

100 102 ± 4

17 5

Table 4 Antagonist parameters in the different NMDA-receptor expressing cell lines ⁎ 46b in Wright et al. (2000). NMDA-R1-2A pIC50 Open channel blocker MK-801 Ketamine PCP Subunit selective blocker Ifenprodil Ro 25-6981 46b* PEAQX Competitive antagonists AP-5 AP-7 D-CPP-ene ± CPP Selfotel/CGS 19755 CGP 40116 SDZ 220-581 SDZ 220-004 Aminopentacyanoferrate(II) Aminopentacyanoferrate(III) Neuroleptica Haloperidol Clozapine AMPA-R antagonist AMP397

NMDA-R1-2B

S.E.M.

n

S.E.M.

n

0.09 0.16 0.10

11 5 4

6.23 4.36 5.07

0.09 0.08 0.11

17 7 12

6.30 5.67 6.23

b4 b4 4.20 6.36

0.07 0.09

5 4 3 13

5.65 6.53 6.49 4.57

0.09 0.11 0.10 0.42

19 16 17 4

4.80 5.61 5.68 5.56 5.23 6.20 6.95 7.25 6.85 5.69

0.46 0.42 0.07 0.13 0.09 0.06 0.09 0.16 0.04 0.09

4 4 5 11 8 9 11 5 9 7

3.86 3.72 5.30 4.80 4.94 5.08 6.72 8.01 5.80 5.49

0.13 0.12 0.12 0.11 0.13 0.08 0.11 0.09 0.16 0.18

b4 4.26

0.16

6 4

5.05 4.18

0.06 0.08

4.70

0.08

5

6.36 4.82 5.75

pIC50

NMDA-R1-2C

b4

channel. Some of the limitations could be overcome in future experiments by the use of a tight repression system for the inducible NMDA-receptor subunit and co-expression of a glutamate–aspartate transporter to limit extracellular glutamate. Acknowledgements We are grateful to Caroline Burg and Anja Weber for excellent technical assistance and to Hans Kalkman for proof reading the article. References Auberson, Y.P., Allgeier, H., Bischoff, S., Lingenhoehl, K., Moretti, R., Schmutz, M., 2002. 5-Phosphonomethylquinoxalinediones as competitive NMDA receptor antagonists with a preference for the human 1A/2A, rather than 1A/2B receptor composition. Bioorg. Med. Chem. Lett. 12, 1099–1102. Bigge, C.F., 1999. Ionotropic glutamate receptors. Curr. Opin. Chem. Biol. 3, 441–447. Bradley, J., Carter, S.R., Rao, V.R., Wang, J., Finkbeiner, S., 2006. Splice variants of the NR1 subunit differentially induce NMDA receptor-dependent gene expression. J. Neurosci. 26, 1065–1076. Dingledine, R., Borges, K., Bowie, D., Traynelis, S.F., 1999. The glutamate receptor ion channels. Pharmacol. Rev. 51, 7–61. Farrant, M., Feldmeyer, D., Takahashi, T., Cull-Candy, S.G., 1994. NMDA-receptor channel diversity in the developing cerebellum. Nature 368, 335–339. Feuerbach, D., Lingenhohl, K., Dobbins, P., Mosbacher, J., Corbett, N., Nozulak, J., Hoyer, D., 2005. Coupling of human nicotinic acetylcholine receptors alpha 7 to calcium channels in GH3 cells. Neuropharmacology 48, 215–227. Fischer, G., Mutel, V., Trube, G., Malherbe, P., Kew, J.N., Mohacsi, E., Heitz, M.P., Kemp, J.A., 1997. Ro 25-6981, a highly potent and selective blocker of N-methyl-D-aspartate

pIC50

NMDA-R1-2D

S.E.M.

n

0.12 0.09 0.13

6 10 4

5.62 4.58 5.15

0.13 0.11 0.11

5 4 4

b4 b4 4.37 6.32

4.03 b4 4.30 5.82

0.15

0.16 0.10

5 5 5 11

0.12 0.10

4 4 4 8

5 3 11 5 13 13 16 15 5 13

4.03 4.17 4.66 4.79 4.69 5.19 7.40 8.51 6.93 6.97

0.08 0.06 0.21 0.20 0.16 0.22 0.10 0.14 0.09 0.10

4 5 6 6 7 6 5 6 6 7

b4 b4 4.39 4.13 4.86 4.77 7.03 8.17 4.75 5.19

0.17 0.20 0.19 0.14 0.12 0.10 0.16 0.13

3 3 6 7 6 6 10 5 8 8

3 16

4.35 4.98

0.20 0.08

5 5

4.35 4.33

0.18 0.15

4 5

5

b4

pIC50

4

b4

S.E.M.

n

4

receptors containing the NR2B subunit. Characterization in vitro. J. Pharmacol. Exp. Ther. 283, 1285–1292. Grimwood, S., Le Bourdelles, B., Atack, J.R., Barton, C., Cockett, W., Cook, S.M., Gilbert, E., Hutson, P.H., McKernan, R.M., Myers, J., Ragan, C.I., Wingrove, P.B., Whiting, P.J., 1996. Generation and characterisation of stable cell lines expressing recombinant human N-methyl-D-aspartate receptor subtypes. J. Neurochem. 66, 2239–2247. Hansen, K.B., Brauner-Osborne, H., Egebjerg, J., 2008. Pharmacological characterization of ligands at recombinant NMDA receptor subtypes by electrophysiological recordings and intracellular calcium measurements. Comb. Chem. High Throughput Screen. 11, 304–315. Ilyin, V.I., Whittemore, E.R., Guastella, J., Weber, E., Woodward, R.M., 1996. Subtypeselective inhibition of N-methyl-D-aspartate receptors by haloperidol. Mol. Pharmacol. 50, 1541–1550. Ishii, T., Moriyoshi, K., Sugihara, H., Sakurada, K., Kadotani, H., Yokoi, M., Akazawa, C., Shigemoto, R., Mizuno, N., Masu, M., 1993. Molecular characterization of the family of the N-methyl-D-aspartate receptor subunits. J. Biol. Chem. 268, 2836–2843. Ivanov, A., Pellegrino, C., Rama, S., Dumalska, I., Salyha, Y., Ben Ari, Y., Medina, I., 2006. Opposing role of synaptic and extrasynaptic NMDA receptors in regulation of the extracellular signal-regulated kinases (ERK) activity in cultured rat hippocampal neurons. J. Physiol. 572, 789–798. Johnson, J.W., Ascher, P., 1987. Glycine potentiates the NMDA response in cultured mouse brain neurons. Nature 325, 529–531. Kurko, D., Dezso, P., Boros, A., Kolok, S., Fodor, L., Nagy, J., Szombathelyi, Z., 2005. Inducible expression and pharmacological characterization of recombinant rat NR1a/NR2A NMDA receptors. Neurochem. Int. 46, 369–379. Lowe, D.A., Emre, M., Frey, P., Kelly, P.H., Malanowski, J., McAllister, K.H., Neijt, H.C., Rudeberg, C., Urwyler, S., White, T.G., 1994. The pharmacology of SDZ EAA 494, a competitive NMDA antagonist. Neurochem. Int. 25, 583–600. Michelmore, S., Croskery, K., Nozulak, J., Hoyer, D., Longato, R., Weber, A., Bouhelal, R., Feuerbach, D., 2002. Study of the calcium dynamics of the human alpha4beta2, alpha3beta4 and alpha1beta1gammadelta nicotinic acetylcholine receptors. Naunyn Schmiedebergs Arch. Pharmacol. 366, 235–245.

54

D. Feuerbach et al. / European Journal of Pharmacology 637 (2010) 46–54

Monyer, H., Burnashev, N., Laurie, D.J., Sakmann, B., Seeburg, P.H., 1994. Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron 12, 529–540. Nagy, J., Boros, A., Dezso, P., Kolok, S., Fodor, L., 2003. Inducible expression and pharmacology of recombinant NMDA receptors, composed of rat NR1a/NR2B subunits. Neurochem. Int. 43, 19–29. Neijt, H., Koller, M., Urwyler, S., 2001. Inorganic iron complexes derived from the nitric oxide donor nitroprusside: competitive N-methyl-D-aspartate receptor antagonists with nanomolar affinity. Biochem. Pharmacol. 61, 343–349. Paoletti, P., Neyton, J., 2007. NMDA receptor subunits: function and pharmacology. Curr. Opin. Pharmacol. 7, 39–47. Papadia, S., Stevenson, P., Hardingham, N.R., Bading, H., Hardingham, G.E., 2005. Nuclear Ca2+ and the cAMP response element-binding protein family mediate a late phase of activity-dependent neuroprotection. J. Neurosci. 25, 4279–4287. Priestley, T., Laughton, P., Myers, J., Le Bourdelles, B., Kerby, J., Whiting, P.J., 1995. Pharmacological properties of recombinant human N-methyl-D-aspartate receptors comprising NR1a/NR2A and NR1a/NR2B subunit assemblies expressed in permanently transfected mouse fibroblast cells. Mol. Pharmacol. 48, 841–848. Steinmetz, R.D., Fava, E., Nicotera, P., Steinhilber, D., 2002. A simple cell line based in vitro test system for N-methyl-D-aspartate (NMDA) receptor ligands. J. Neurosci. Methods 113, 99–110. Suter, W., Hartmann, A., Poetter, F., Sagelsdorff, P., Hoffmann, P., Martus, H.J., 2002. Genotoxicity assessment of the antiepileptic drug AMP397, an Ames-positive aromatic nitro compound. Mutat. Res. 518, 181–194.

Uchino, S., Watanabe, W., Nakamura, T., Shuto, S., Kazuta, Y., Matsuda, A., NakajimaIijima, S., Kudo, Y., Kohsaka, S., Mishina, M., 2001. Establishment of CHO cell lines expressing four N-methyl-D-aspartate receptor subtypes and characterization of a novel antagonist PPDC. FEBS Lett. 506, 117–122. Urwyler, S., Laurie, D., Lowe, D.A., Meier, C.L., Muller, W., 1996. Biphenyl-derivatives of 2amino-7-phosphonoheptanoic acid, a novel class of potent competitive N-methyl-Daspartate receptor antagonist—I. Pharmacological characterization in vitro. Neuropharmacology 35, 643–654. Varney, M.A., Jachec, C., Deal, C., Hess, S.D., Daggett, L.P., Skvoretz, R., Urcan, M., Morrison, J.H., Moran, T., Johnson, E.C., Velicelebi, G., 1996. Stable expression and characterization of recombinant human heteromeric N-methyl-D-aspartate receptor subtypes NMDAR1A/2A and NMDAR1A/2B in mammalian cells. J. Pharmacol. Exp. Ther. 279, 367–378. Waxman, E.A., Lynch, D.R., 2005. N-methyl-D-aspartate receptor subtypes: multiple roles in excitotoxicity and neurological disease. Neuroscientist 11, 37–49. Wright, J.L., Gregory, T.F., Kesten, S.R., Boxer, P.A., Serpa, K.A., Meltzer, L.T., Wise, L.D., Espitia, S.A., Konkoy, C.S., Whittemore, E.R., Woodward, R.M., 2000. Subtypeselective N-methyl-D-aspartate receptor antagonists: synthesis and biological evaluation of 1-(heteroarylalkynyl)-4-benzylpiperidines. J. Med. Chem. 43, 3408–3419.