Comparative proteomic analysis of the breast muscle response to chronic corticosterone administration in broiler chickens showing long or short tonic immobility

Comparative proteomic analysis of the breast muscle response to chronic corticosterone administration in broiler chickens showing long or short tonic immobility Wenyan Fu,* Yujing Duan,* Song Wang,* Yingdong Ni,*1 R. Grossmann,† and Ruqian Zhao* *Key Laboratory of Animal Physiology and Biochemistry, Ministry of Agriculture, Nanjing Agricultural University, Nanjing 210095, China; and †Department of Functional Genomics and Bioregulation, Institute of Animal Genetics, FLI, Mariensee, 31535 Neustadt, Germany

Key words: broiler, corticosterone, proteomics, skeletal muscle, tonic immobility 2014 Poultry Science 93:784–793 http://dx.doi.org/10.3382/ps.2013-03456 coping capability and well-being in response to stressors (Leonard, 2006). Corticosterone (CORT), a terminal hypothalamus-pituitary-adrenal gland axis hormone, has been used to mimic the response to stressors (Malheiros et al., 2003). Oral administration of CORT through drinking water for 2 wk has been used to establish an experimental model of chronic stress in broiler chickens (Post et al., 2003; Shini et al., 2009). It is generally accepted that long TI duration (LTI) and chronic stress negatively affect growth in vertebrates. The BW of LTI line birds is lower than that of short TI duration (STI) birds (Minvielle et al., 2002). Chronically elevated CORT levels retard the growth of young animals (Morici et al., 1997; Glennemeier and Denver, 2002; Hayward and Wingfield, 2004). Lin et al. (2004a,b, 2006) showed that both short- and long-term CORT administration severely retards skeletal muscle growth in birds in a dose- and age-dependent manner through suppression of protein synthesis and augmen-

INTRODUCTION Tonic immobility (TI) is a valuable biological parameter for investigating whether emotional reactivity modulates chronic stress-related behavioral and physiological dysfunction in animals (Campo and Redondo, 1996; Campo et al., 2000; Calandreau et al., 2011). The duration of the TI reaction is a reliable indicator of fearfulness (Jones et al., 1991). Due to its strong and clearly distinguishable reaction, poultry is the most commonly used animal model for studying TI induction (Gallup et al., 1977). Alteration of the stress axis (hypothalamus-pituitary-adrenal gland) is thought to be the most common means of controlling an animal’s ©2014 Poultry Science Association Inc. Received July 1, 2013. Accepted December 16, 2013. 1 Corresponding author: [email protected]

784

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

muscle damage. Real-time PCR results indicated that expression of these proteins is transcriptionally and posttranscriptionally regulated. Protein synthesis capacity, estimated by the RNA-to-protein ratio, was significantly lower in the breast muscle of CORT-treated broilers than in untreated control broilers. The level of Leu, Gly, and Ser in serum was significantly higher in CORT-treated broilers than in the control birds. Therefore, we conclude that CORT treatment retards the growth of skeletal muscle by suppressing protein synthesis and augmenting protein catabolism, paralleling the response to severe stress and muscle damage, and the negative effect of LTI on muscle growth is likely mediated through glucose metabolism. No interaction was observed between CORT and tonic immobility affecting growth performance or any parameter examined in the current study.

ABSTRACT Broilers of the same genetic origin were classified as short or long tonic immobility duration (STI and LTI, respectively) phenotypes and treated chronically with vehicle (control) or corticosterone (CORT) dissolved in drinking water between 27 and 42 d of age. Differential expression of proteins and mRNA was examined using 2-dimensional gel electrophoresis and real-time PCR to elucidate the mechanism behind the severe retardation of broiler breast muscle growth caused by LTI and CORT. The majority of the 13 proteins found to be differentially expressed in breast muscle of STI and LTI broilers are involved in either glycolysis (5 proteins) or myofilament formation (5 proteins). Of the 16 proteins differentially expressed in breast muscle following CORT treatment, 6 are structural proteins, 5 are categorized as cellular defense and stress proteins, and 3 (pyruvate kinase, l-lactate dehydrogenase, and creatine kinase) are involved in responses to stress and

COMPARATIVE PROTEOMICS IN BROILERS

MATERIALS AND METHODS The experiment was conducted following the guidelines of the Animal Ethics Committee at Nanjing Agricultural University. The study was approved by Animal Ethics of Nanjing Agricultural University. The sampling procedures complied with the Guidelines on Ethical Treatment of Experimental Animals (2006) no. 398 set by the Ministry of Science and Technology, China, and the Regulations regarding the Management and Treatment of Experimental Animals (2008) no. 45 set by the Jiangsu Provincial People’s Government.

Birds and Management Tonic immobility test is commonly used to assess the fear, and a long duration of TI is an indication for high levels of fearfulness. A TI phenotype may serve as a selection target for a low-stress response broiler line. In the current study, broiler breeder chickens (Ross 308) were tested for TI to establish 2 segregated groups of

STI and LTI phenotypes (Wang et al., 2013). Chickens demonstrating 2 extremes (shortest and longest TI duration) were registered. Eighty chickens showing the shortest TI duration (29.6 ± 2.3 s) and 80 scoring the longest duration (246.2 ± 26.8 s) were classified into STI and LTI groups, respectively. Chicken of the STI and LTI groups were allocated into control (CON) and CORT-treated subgroups to four 2 × 2.7 m2 pens (10 birds in each pen). From 27 d to 42 d, chickens in the CORT groups of both STI and LTI phenotypes (40 per phenotype) were supplied water supplemented with 5 mg/L of corticosterone (C2505, Sigma, St. Louis, MO), whereas those in CON groups (40 from LTI and 40 from STI) were supplied water supplemented with an equivalent volume of the solvent (absolute ethanol). Each broiler chicken consumed approximately 0.2 to 0.3 L of water per day on average during the experimental period (d 27–41). Therefore, the daily intake of corticosterone and ethanol was about 1.0 to 1.5 mg and 0.2 to 0.3 mL, respectively. On d 42, all birds were fasted overnight and weighed before slaughter. The blood was collected from the jugular vein and serum samples were stored at −20°C until analyzed. The breast muscles was removed from the body, quickly put into liquid nitrogen, and stored at −80°C for further analysis.

Serum Free Amino Acids Analysis The serum concentration of free amino acids was determined according to Sunde et al. (2003). In brief, the serum supernatant was deproteinized with a Millipore Ultrafree-MC 10,000 NMWL filter unit (Millipore, Bedford, MA) at 5,000 × g and 4°C for 30 min. The filtrate of the plasma supernatant was derivatized with Waters ACCQ·Taq reagent, and analyzed with a buffer gradient system using the Alliance HPLC system. Separation of the free amino acids was performed with a Waters Nova-Pak C18 column (60 Å, 4 μm, 3.9 × 300 mm, Waters, Milford, MA).

Protein Analysis Protein Extraction. A 0.1-g muscle sample was placed in liquid nitrogen and ground thoroughly to a very fine powder with a mortar and pestle. The powder (about 100 mg) was transferred to sterile tubes containing a 1-mL sample preparation buffer [7 M urea, 2 M thiourea, 4% (wt/vol) 3-[(3-cholamidopropyl)imethylammonio]-1-propanesulfonate, 1% (vol/vol) dithiothreitol, 0.5% (vol/vol) immobilized pH gradient buffer pH 4–7, protease inhibitor cocktail purchased from Roche, Mannheim, Germany]. The mixture was then incubated for 60 min at room temperature with occasional vortexing, and centrifuged at 12,000 × g for 60 min at 4°C. The supernatants were collected and stored at −80°C until analysis. The protein concentra-

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

tation of protein catabolism. However, the mechanism underlying the negative effect of LTI on growth remains unclear. It is unclear how nonphysical entities, such as the duration of TI and level of CORT, could engage in crosstalk. Feeding CORT to laying hens has been shown to induce stress behavior, as indicated by a longer TI reaction and reduction in BW gain (El-Lethey et al., 2003). Embryonic exposure to CORT leads to behavioral and growth deficits in chicken, and posthatch handling increases the duration of TI in CORT-treated birds (Janczak et al., 2007). Long tonic immobility broilers reportedly show a greater CORT response to crating and heat challenge than STI birds (Zulkifli et al., 2009). A consistent trend toward greater adrenocortical activation was observed in high-fear compared with lowfear hens (Beuving et al., 1989). In contrast, Hazard et al. (2005, 2008) reported that Japanese quail with the LTI phenotype demonstrate lower CORT responses under restraint stress. Nevertheless, these results are suggestive of cross-talk between the TI response and endogenous CORT level. Our previous results (Wang et al., 2013) showed that the growth performance and basal protein synthesis of broiler chickens with inborn long or short TI duration differ, but that chronic CORT administration neither highlights nor masks such innate differences. Studies on the mechanism underlying the growth suppression of LTI and chronic stress will benefit welfare and health of chickens as well as production efficiency. The current study is the first report demonstrating differences in the protein synthesis capacity and protein expression profile in breast muscle that suggest the negative effects of LTI and chronic stress on muscle development in birds are mediated by different mechanisms.

785

786

FU ET AL.

Validation of Protein and Gene Expression Western Blot Analysis. Western blotting was used to validate the main differentially expressed proteins and carried out using a tank system (Bio-Rad). The protein concentration was determined with Pierce BCA Protein Assay Kit (catalog no. 23225, Thermo Scientific, Hudson, NH). Western blot analysis for heat shock cognate 70 (HSC70; catalog no. ab19136, Abcam, Cambridge, UK; diluted 1:10,000), desmin (catalog no. ab8976, Abcam; diluted 1:1,000), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; catalog no. AP0066, Bioworlde, St. Louis, MO; diluted 1:500) was conducted according to the recommended protocols provided by the manufacturers.

RNA Isolation, cDNA Synthesis, and Real-Time PCR. Total RNA was isolated from muscle tissues using Trizol Reagent (catalog no. 15596–026, Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. Concentration and quality of the extracted RNA were measured using a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific). Prime-Script 1st Strand cDNA Synthesis Kit (catalog no. D6110A, Takara, Dalian, China) was used to synthesize cDNA from 2 μg of total RNA from each sample according to the manufacturer’s instructions. Two microliters of diluted cDNA (1:20, vol/vol) was used in each real-time PCR. Primer sequences are shown in Table 1. Realtime PCR was performed with Mx3000P (Stratagene, La Jolla, CA). Expression of the housekeeping gene β-actin mRNA in breast muscle was not changed by the TI or CORT treatment. Thus, β-actin gene expression was used as the reference gene in relative real-time PCR. The specificity of amplification was determined by melting curve analysis and agarose gel electrophoresis. The PCR products were sequenced to validate the identity of the amplicons.

Statistical Analyses All data are presented as means ± SEM and were analyzed using 2-way ANOVA with SPSS 18.0 software (StatSoft Inc., Tulsa, OK). We evaluated the effects of CORT and TI, as well as their interactions. Differences were considered significant when P < 0.05. The method of 2−ΔΔCt was used to analyze the real-time PCR data (Livak and Schmittgen, 2001). The mRNA expression was expressed as the fold change relative to that of STI group.

RESULTS Protein Synthesis Capacity and Levels of Serum Amino Acids Protein content in breast muscle was not affected by the TI phenotype or CORT administration. However, RNA content in breast muscle was significantly reduced by CORT (P < 0.001) but not TI. The reduction in RNA content in turn resulted in a significant suppression (P < 0.05) of the apparent capacity for protein synthesis in CORT-treated broilers as estimated by the RNA-to-protein ratio (Table 2). As shown in Table 3, of the 8 essential amino acids, only the concentration of Leu was significantly elevated (P < 0.05) in serum following CORT administration. In addition, CORT administration resulted in a significant decrease of nonessential amino acid Gly (P < 0.05) and a significant increase of Ser (P < 0.05) in serum. Of the 18 amino acids detected in serum, only Cys content differed significantly between the TI phenotypes, and was significantly higher in LTI broilers (P < 0.01). Amino acid levels in serum were not affected by any interactions between TI and CORT (P > 0.05).

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

tion was measured by the Bradford assay using BSA (A7030, Sigma) as the standard. Two-Dimensional Gel Electrophoresis. For isoelectric focusing, a sample volume equivalent to 300 μg of protein extract was added to rehydration buffer (BioRad, Hercules, CA). The samples were loaded onto 17-cm, pH 4 to 7 IPG strips (BioRad) and each protein sample was conducted in triplicate. The IPG strips were passively rehydrated for 13 h and isoelectric focusing was performed at 250 V for 1 h, 500 V for 1 h, 1,000 V for 5 h, followed by linearly ramping to 10,000 V over 3 h and then holding at 10,000 V until 60,000 V-h had been accumulated. Prior to the second dimension, the strips were equilibrated for 15 min in 6 M urea, 30% glycerol, 2% SDS, 50 mM Tris pH 8.8, 1% (vol/vol) DTT, and then for an additional 15 min in the same buffer except that DTT was replaced by 4% iodoacetamide. After equilibration, the second dimension was run on a 12% polyacrylamide SDS gel using the Ettan DALTSix (GE Healthcare, Pittsburgh, PA). The analytical gels were stained with colloidal Coomassie Blue G-250. Image and Protein Identification. Stained gels were scanned and analyzed using PD Quest v710 software (BioRad). After alignment, spots between gels were first automatically matched. The matched spots were then reexamined manually to ensure accuracy. Generally, only those spots with expression differences >2, were chosen for further analysis (Doherty et al., 2004). Protein identification was analyzed using a fuzzy logic feedback control system (Ultraflex II MALDI TOF/ TOF system Bruker, Bremen, Germany). Mass spectrophotometry fingerprinting data searches were performed by search engines of MS-fit1 against the NCBInr database (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in the taxa of Gallus gallus with the parameter sets of trypsin digestion, 2 missed cleavages, complete modification of iodoacetamide, partial modification of Met oxidation, protein mass (±20% of the observed protein mass), and a mass tolerance for mono-isotopic data of 100 ppm. Protein identification was assigned when there were at least 4 matching peptides and >20% sequence coverage.

787

COMPARATIVE PROTEOMICS IN BROILERS Table 1. Primer sequences for the PCR amplification of specific genes GenBank accession no.

Myosin light chain 1f

NM_001044632.1

Actin, α 1, skeletal muscle

NM_204127.1

Pyruvate kinase muscle isozyme

NM_205469.1

l-Lactate dehydrogenase A chain

X53828.1

Creatine kinase M-type

NM_205507.1

Heat shock protein 70

GU980869.1

Desmin

AB011672.1

Apolipoprotein A-I precursor

M25559.1

Serum albumin precursor

NM_205261.1

Fatty acid-binding protein, heart

NM_001030889.1

α-Actin

NM_205323.1

Actinin α 2

NM_001031229.1

Glucose-6-phosphate isomerase

NM_001006128.1

Glyceraldehyde-3-phosphate dehydrogenase

NM_204305.1

6-Phosphofructokinase

AB061205.1

Calsequestrin

M58048.1

Pyruvate kinase muscle isozyme

NM_205469.1

1F

PCR product (bp)

Primer sequence1 (5c–3c) F: TGACAGGACTGGTGATGCC R: GGGTTGCCCAGGATCTTGT F: ACTTTGCCAGATGCCGACA R: TGGGGTGATTGTAGTGTAAGGG F: CGACTCCGAGCCAACCATT R: TGATACTCGTGGGTGCCGT F: GGGTGGATTGTTGGAGAGCA R: CCACCACCTGCTTGTGAACCT F: CACCGACCTCAACCACG R: GGCTGTTCAGGGCTTCC F: TAACACCACCATTCCCACCA R: GCCCTCTCACCTTCATACACCT F: CCGCTTCGCCAACTACATT R: GCAGGTCATCTAGCAGGTTGTC F: TGGACCGCATTCGGGATA R: CAGCGTGTCCAGGTTGTCA F: GTGATGTCGGTGCTTGCCT R: CAGCGTGTCCAGGTTGTCA F: ATGGTGGAAGCGTTCGTGG R: TGGTGGTGGGTTTGGTCAG F: AGAGAGGGAAAGGAGGAT R: GATGGGTTGAAGATAGCAG F: AGCAGTTTTCCCTTCCAT R: TTCAGTGGTGCTTCAGTCA F: AATGCTGATTGAACTGGC R: TGGGGTATTGGAACGATT F: AAGGCGAGATGGTGAAAG R: CGCTCCTGGAAGATAGTGAT F: CGATACCCCTGCCTGTGT R: GCCAATGTGTGACCGCTCT F: TGATGGGAAAGACCGAGTG R: TCCGTCATCTGGAACTGC F: CGACTCCGAGCCAACCATT R: TGATACTCGTGGGTGCCGT

108 123 147 148 173 96 212 137 173 124 138 249 133 241 222 138 147

= forward primer; R = reverse primer.

Proteomic Analysis Complete separation of protein spots was apparent in the two-dimensional gel electrophoresis (2-DE) analyses of the breast muscle of STI and LTI broiler chickens (Figure 1), as well as control and CORT chickens (Figure 2). Coomassie blue staining of the gels revealed about 400 spots, with the molecular weight of most proteins falling between 14.4 and 200 kDa. A total of 15 protein spots exhibiting differential abundance in the breast muscle of LTI and STI broilers were subjected to subsequent matrix-assisted laser desorption ionization-time of flight mass spectrometry analysis, resulting in the identification of 13 proteins

(Table 4). The differentially expressed proteins were grouped into 4 categories: (1) myofilament (5 proteins), (2) metabolism (5 proteins), (3) transport (1 protein), and (4) miscellaneous (2 proteins). Of the 20 protein spots analyzed from the gels of CON and CORT-treated broilers, 16 proteins were identified by matching the matrix-assisted laser desorption ionization–time of flight mass spectrometry peptide data to chicken protein sequences in the NCBInr database (Table 5). The differentially expressed proteins were grouped into 5 categories: (1) myofilament (4 proteins), (2) cytoskeleton (1 protein), (3) cellular defense and stress response (5 proteins), (4) metabolism (3 proteins), and (5) transport (3 proteins).

Table 2. Effect of tonic immobility (TI) and corticosterone (CORT) on RNA, protein contents, and the capacity of protein synthesis in muscle1 Control2 Item RNA (mg/g) Protein content (100 mg/g) CS3 (mg of RNA/g of protein)

CORT

P-value

STI

LTI

STI

LTI

TI

CORT

TI × CORT

0.67 ± 0.02 1.18 ± 0.19 6.10 ± 1.07

0.70 ± 0.04 0.89 ± 0.08 7.65 ± 0.49

0.45 ± 0.07 0.92 ± 0.11 5.21 ± 1.02

0.30 ± 0.07 0.95 ± 0.14 3.40 ± 0.92

0.298 0.367 0.886

0.000 0.469 0.012

0.149 0.262 0.079

1Data are expressed as means ± SEM and were analyzed using the general linear model (univariate) to evaluate the effects of CORT and TI, as well as their interactions. Differences were considered significant when P < 0.05, n = 6/group. 2STI = short TI; LTI = long TI. 3CS = capacity of protein synthesis.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Target gene

788

FU ET AL.

Table 3. Effect of tonic immobility (TI) and corticosterone (CORT) on the level of amino acids in serum (arbitrary units) Control1 Item

STI

1STI

LTI

STI

P-value LTI

TI

CORT

TI × CORT

1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

± ± ± ± ± ± ± ±

0.14 0.05 0.03 0.07 0.07 0.12 0.10 0.12

0.59 1.00 1.04 0.85 1.03 0.95 1.07 1.19

± ± ± ± ± ± ± ±

0.19 0.08 0.04 0.03 0.07 0.07 0.09 0.15

0.77 1.11 1.14 0.83 0.98 1.27 1.34 1.48

± ± ± ± ± ± ± ±

0.12 0.09 0.08 0.06 0.09 0.13 0.08 0.10

0.58 0.96 1.10 0.84 1.08 1.01 1.20 1.18

± ± ± ± ± ± ± ±

0.13 0.11 0.05 0.03 0.15 0.05 0.05 0.10

0.067 0.370 0.979 0.220 0.506 0.165 0.891 0.673

0.447 0.684 0.081 0.136 0.875 0.139 0.011 0.063

0.497 0.368 0.493 0.173 0.716 0.323 0.367 0.056

1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

± ± ± ± ± ± ± ± ± ±

0.11 0.04 0.09 0.09 0.13 0.74 0.11 0.12 0.03 0.16

0.90 1.02 1.11 1.03 0.72 3.43 0.87 1.18 1.00 0.83

± ± ± ± ± ± ± ± ± ±

0.06 0.09 0.13 0.11 0.08 0.78 0.09 0.06 0.03 0.08

1.38 0.80 1.19 1.16 0.59 0.34 1.17 1.11 1.04 1.03

± ± ± ± ± ± ± ± ± ±

0.26 0.04 0.07 0.11 0.06 0.05 0.08 0.07 0.01 0.16

0.99 0.88 1.36 1.14 0.92 2.42 1.06 1.15 0.99 0.91

± ± ± ± ± ± ± ± ± ±

0.20 0.06 0.06 0.10 0.14 1.11 0.17 0.05 0.02 0.18

0.178 0.409 0.152 0.943 0.607 0.008 0.313 0.205 0.360 0.340

0.198 0.012 0.034 0.215 0.105 0.272 0.132 0.636 0.496 0.723

0.408 0.647 0.715 0.837 0.054 0.812 0.917 0.445 0.345 0.862

= short TI; LTI = long TI.

Quantitative Reverse-Transcription PCR Analysis The abundance of the mRNA transcripts encoding the 16 differentially expressed proteins identified in the breast muscle of CORT-treated and TI broilers was determined using quantitative reverse-transcription PCR (Table 6). Expression of the mRNA encoding α-actin and actin-α 2 was significantly lower (P < 0.05) in LTI broilers than STI broilers, which was in agreement with the level of α-actin and actin-α 2 protein expression in the breast muscle, indicating that transcriptional regu-

lation had occurred. Actin (α 1) mRNA expression was markedly increased by CORT administration, which was consistent with the change in protein expression in breast muscle. In LTI broilers, expression of mRNA encoding actin (α 1) was significantly upregulated. Expression of mRNA encoding 6-phosphofructokinase was downregulated by CORT administration (P < 0.05).

Western Blot Analysis Western blot analysis showed a significant increase of HSC70 (P < 0.05) and with a tendency for an in-

Figure 1. Differentially expressed muscle proteins in breast muscle of the short tonic immobility (STI) and long tonic immobility (LTI) groups by two-dimensional gel electrophoresis analysis. The differentially expressed proteins between STI and LTI chickens were spotted and numbered. Neither the STI nor the LTI group was exposed to corticosterone. pI, isoelectric point; Mr, molecular mass.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Essential amino acid Lys Trp Phe Met Thr Ile Leu Val Nonessential amino acid Pro Gly Ser His Ala Cys Orn Glu Tyr Asp

CORT

789

COMPARATIVE PROTEOMICS IN BROILERS

Table 4. Differentially expressed muscle proteins of the short and long tonic immobility groups identified by two-dimensional gel electrophoresis analysis and MALDI-TOF-MS1,2 Spot number

Accession number

Moleculur weight (KDa)

pI

Protein expression

α-Actin α-Actinin-2 Myosin heavy chain Myosin regulatory light chain 2 Myosin L2

gi|178027 gi|46048687 gi|238274 gi|311314962 gi|223047

42.28 104.78 223.8 18.92 18.74

5.23 5.26 5.61 4.77 4.77

p p p n p

Glucose-6-phosphate isomerase 6-Phosphofructokinase Glyceraldehyde-3-phosphate dehydrogenase Phosphoglycerate mutase 1 Pyruvate kinase muscle isozyme

gi|57524920 gi|16610202 gi|46048961 gi|71895985 gi|45382651

62.41 84.78 35.91 29.05 58.43

7.4 8.35 8.71 7.03 7.29

p p p p n

Apolipoprotein A-I precursor

gi|211146

30.67

5.97

n

Calsequestrin Skeletal muscle C-protein

gi|211497 gi|212659

45.09 112.18

4 6.05

p n

1MALDI-TOF-MS 2Protein

= matrix-assisted laser desorption ionization-time of flight mass spectrometry. pI, isoelectric point; gi, GenInfo Identifier. name and accession numbers were derived from NCBI database.

crease for desmin (0.05 < P < 0.1) protein in the breast muscle of CORT-treated chickens compared with control, which was consistent with the results in 2-DE proteomic analyses. However, Western blot analysis did not detect a significant change of GAPDH protein in breast muscle of LTI and STI chickens as observed in 2-DE proteomic analyses (Figure 3).

DISCUSSION It is generally accepted that LTI and chronic stress negatively affect growth and development. Severe suppression of BW gain in broilers and quail associated

with CORT administration has been well documented (Malheiros et al., 2003; Dong et al., 2007). Dong et al. (2007) reported that chronic CORT exposure significantly decreases the capacity of protein synthesis in the pectoralis major muscle of broilers as estimated by the RNA-to-protein ratio. In our study, the capacity of protein synthesis as estimated by RNA-to-protein ratio was consistently and significantly suppressed by CORT administration, but not LTI. Our results also showed that the levels of amino acids in serum generally increased in CORT-treated chickens, and that the serum concentrations of Ser and Leu in particular increased significantly. The increase in amino acid concentrations

Figure 2. Differentially expressed muscle proteins of control (CON) and corticosterone (CORT) group in breast muscle by two-dimensional gel electrophoresis analysis. The differentially expressed proteins between control and CORT-treated chickens were spotted and numbered. pI, isoelectric point; Mr, molecular mass.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Myofilament 2 6 7 8 9 Metabolism 3 5 1 12 13 Transport 10 Miscellaneous 4 11

Protein name

790

FU ET AL.

Table 5. Differentially expressed muscle proteins of the control and corticosterone groups identified by two-dimensional gel electrophoresis analysis and MALDI-TOF-MS1,2 Spot number

Accession number

Molecular weight (KDa)

pI

Protein expression

Actin, α skeletal muscle Myosin L2 Myosin light chain 1f Actin, α 1, skeletal muscle

gi|27819614 gi|223047 gi|212330 gi|55741890

42.45 18.74 20.96 42.37

5.31 4.77 4.79 5.23

p p n n

Desmin

gi|2959450

51.69

5.30

n

gi|161408079 gi|30962014 gi|45384222 gi|326931250 gi|45384370

71.03 70.10 21.72 21.89 71.07

5.37 5.66 5.77 6.23 5.47

n n n n n

Pyruvate kinase muscle isozyme l-Lactate dehydrogenase A chain Creatine kinase M-type

gi|45382651 gi|45384208 gi|45382875

58.43 36.78 43.53

7.29 7.75 6.5

n p p

Apolipoprotein A-I precursor Serum albumin precursor Fatty acid-binding protein, heart

gi|211146 gi|45383974 gi|71894843

30.67 71.87 14.81

5.97 5.51 5.92

n n n

Heat Heat Heat Heat Heat

shock shock shock shock shock

protein 70B protein 70 protein β-1 protein β-1-like cognate 71 kDa protein

1Corticosterone (C 2505, Sigma, St. Louis, MO); MALDI-TOF-MS = matrix-assisted laser desorption ionization-time of flight mass spectrometry. pI, isoelectric point; gi, GenInfo Identifier. 2Protein name and accession numbers were derived from NCBI database.

in the blood is indicative of augmented protein catabolism and protein breakdown in the skeletal muscle following CORT treatment, consistent with previous reports (Hayashi et al., 1994; Dong et al., 2007). Increases in the concentrations of circulating amino acids might act as signals regulating biological processes and organ development. Leucine has been shown to suppress myofibrillar proteolysis in chick skeletal mus-

cle (Nakashima et al., 2005) and to play a role in regulation of the mechanistic target of rapamycin signaling pathway (Lynch, 2001). However, of the 18 amino acids we detected, only Cys content in serum differed significantly between the TI phenotypes, as the Cys level was significantly higher in LTI broilers. The discrepancies between LTI and CORT broilers, with respect to the protein synthesis capacity and serum amino acid profile

Table 6. Differentially expressed at the mRNA level1 Control2 Item Myofilament Myosin light chain 1f Actin, α 1, skeletal muscle α-Actin Actin α 2 Metabolism Pyruvate kinase muscle isozyme Creatine kinase M-type Glucose-6-phosphate isomerase Glyceraldehyde-3-phosphate dehydrogenase 6-Phosphofructokinase l-Lactate dehydrogenase A chain Pyruvate kinase muscle isozyme Transport Apolipoprotein A-I precursor Fatty acid-binding protein, heart Cytoskeleton Desmin Cellular defense and stress Heat shock protein 70 Miscellaneous Calsequestrin 1Values

STI

CORT2 LTI

STI

P-value2 LTI

TI

CORT

TI × CORT

1.00 1.00 1.00 1.00

± ± ± ±

0.08 0.53 0.22 0.11

0.86 2.84 0.63 0.81

± ± ± ±

0.07 1.06 0.09 0.14

0.78 3.93 0.85 0.83

± ± ± ±

0.11 0.91 0.13 0.10

0.92 6.47 0.58 0.56

± ± ± ±

0.10 0.99 0.11 0.05

0.993 0.024 0.041 0.041

0.409 0.002 0.496 0.496

0.140 0.702 0.732 0.732

1.00 1.00 1.00 1.00

± ± ± ±

0.06 0.06 0.06 0.05

0.99 0.84 0.82 1.07

± ± ± ±

0.24 0.06 0.12 0.06

0.89 0.93 0.98 0.97

± ± ± ±

0.21 0.20 0.16 0.12

0.87 0.63 0.87 0.66

± ± ± ±

0.06 0.10 0.04 0.17

0.903 0.067 0.155 0.399

0.373 0.243 0.894 0.138

0.986 0.565 0.713 0.205

1.00 ± 0.08 1.00 ± 0.12 1.00 ± 0.06

1.00 ± 0.14 1.21 ± 0.16 0.99 ± 0.24

0.87 ± 0.17 0.91 ± 0.18 0.89 ± 0.21

0.89 ± 0.09 0.96 ± 0.04 0.87 ± 0.06

0.291 0.817 0.903

0.043 0.065 0.373

0.284 0.199 0.986

1.00 ± 0.14 1.00 ± 0.10

0.80 ± 0.12 0.96 ± 0.11

0.77 ± 0.06 0.95 ± 0.14

0.75 ± 0.13 0.77 ± 0.09

0.336 0.310

0.246 0.290

0.448 0.536

1.00 ± 0.53

2.49 ± 1.07

2.83 ± 0.60

2.58 ± 0.36

0.351

0.159

0.198

1.00 ± 0.17

0.83 ± 0.07

0.68 ± 0.08

0.77 ± 0.14

0.735

0.133

0.311

1.00 ± 0.21

0.85 ± 0.10

0.89 ± 0.12

0.91 ± 0.07

0.353

0.649

0.275

are means ± SEM, n = 6/group. = corticosterone (C 2505, Sigma, St. Louis, MO); STI = short tonic immobility duration; LTI = long tonic immobility duration; TI = tonic immobility. 2CORT

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Myofilament 2 3 4 13 Cytoskeleton 6 Cellular defense and stress 7 9 11 14 15 Metabolism 1 12 16 Transport 5 8 10

Protein name

COMPARATIVE PROTEOMICS IN BROILERS

791

data, indicate that different mechanisms are responsible for the negative effects on muscle development associated with these variables. The potential effect of significantly higher concentrations of Cys in the blood of LTI broilers remains unknown. Myofibrillar filaments are responsible for generating the physical movement of skeletal muscles. Myosin heavy chain and myosin L2 were more abundant in STI than LTI chickens, whereas myosin regulatory light chain 2 was more abundant in LTI chickens. Compared with control chickens, the abundance of myosin L2 was higher, but that of myosin light chain 1f was lower after CORT administration. The significant down- or upregulation of these myosin light chain proteins is the primary determinant of force and velocity in muscle fibers, which is coincident with the change in skeletal muscle fiber types during skeletal muscle development

(Ohlendieck, 2010). Actin is a major component of the contractile apparatus of vertebrate skeletal, cardiac, and smooth muscle (Kabsch and Vandekerckhove, 1992). In our study, 2-DE indicated that desmin was highly expressed in breast muscle after CORT administration, and this result was confirmed by Western blot analysis with an antibody specific for desmin. The modifications that we observed in regulatory proteins were likely related to the characteristic disorganization of myofibers that occurs in response to fear and chronic stress mimicked by chronic CORT administration. Skeletal muscle tissue is unique in its ability to handle very rapid and coordinated changes in energy supply and oxygen flux during contraction (Ge et al., 2004). Metabolic proteins are heavily involved in the processes that occur in skeletal muscle during myogenesis and development. In the pectoralis muscle, glycolysis is one

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Figure 3. Western blot analysis of differentially expressed protein in two-dimensional gel electrophoresis (2-DE) gels. (A) Western blot analysis of desmin, heat shock cognate 70 (HSC70), and glyceraldehyde 3-phosphate dehydrogenase (GADPH) in total protein extracts from skeletal muscle. (B) The proteins from representative 2-DE gels are displayed. CON = control group; CORT = corticosterone-treated group; STI = short tonic immobility group not exposed to CORT; LTI = long tonic immobility group not exposed to CORT. Means with asterisks (*) are significantly different from those of the corresponding controls (P < 0.05).

792

FU ET AL.

expression of glycolytic enzymes is dramatically altered in STI but not CORT-treated broilers. The observed differences in biochemical parameters, gene expression, and protein expression profiles in breast muscle imply that the stress response mechanism differs in CORTtreated and TI broilers. This is the first report demonstrating that in parallel with the absence of interaction of LTI and CORT on BW and muscle weight, TI and CORT do not interact on the protein synthesis capacity, serum amino acid levels, protein expression profile, or gene transcription in the breast muscle of broilers.

REFERENCES Awerman, J. L., and L. M. Romero. 2010. Chronic psychological stress alters body weight and blood chemistry in European starlings (Sturnus vulgaris). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 156:136–142. Beuving, G., R. B. Jones, and H. J. Blokhuis. 1989. Adrenocortical and heterophil/lymphocyte responses to challenge in hens showing short or long tonic immobility reactions. Br. Poult. Sci. 30:175–184. Calandreau, L., A. Favrea-Peigne, A. Bertin, P. Constantin, C. Arnould, A. Laurence, S. Lumineau, C. Houdelier, M. A. RichardYris, A. Boissy, and C. Leterrier. 2011. Higher inherent fearfulness potentiates the effects of chronic stress in the Japanese quail. Behav. Brain Res. 225:505–510. Campo, J. L., M. G. Gil, I. Munoz, and M. Alonso. 2000. Relationships between bilateral asymmetry and tonic immobility reaction or heterophil to lymphocyte ratio in five breeds of chickens. Poult. Sci. 79:453–459. Campo, J. L., and A. Redondo. 1996. Tonic immobility reaction and heterophil to lymphocyte ratio in hens from three Spanish breeds laying pink eggshells. Poult. Sci. 75:155–159. Doherty, M. K., L. McLean, J. R. Hayter, J. M. Pratt, D. H. Robertson, A. El-Shafei, S. J. Gaskell, and R. J. Beynon. 2004. The proteome of chicken skeletal muscle: changes in soluble protein expression during growth in a layer strain. Proteomics 4:2082– 2093. Dong, H., H. Lin, H. C. Jiao, Z. G. Song, J. P. Zhao, and K. J. Jiang. 2007. Altered development and protein metabolism in skeletal muscles of broiler chickens (Gallus gallus domesticus) by corticosterone. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 147:189–195. El-Lethey, H., B. Huber-Eicher, and T. W. Jungi. 2003. Exploration of stress-induced immunosuppression in chickens reveals both stress-resistant and stress-susceptible antigen responses. Vet. Immunol. Immunopathol. 95:91–101. Gallup, G. G., L. B. Jr. Wallnau, J. L. Boren, G. J. Gagliardi, J. D. Maser, and P. H. Edson. 1977. Tryptophan and tonic immobility in chickens: effects of dietary and systemic manipulations. J. Comp. Physiol. Psychol. 91:642–648. Ge, Y., M. P. Molloy, J. S. Chamberlain, and P. C. Andrews. 2004. Differential expression of the skeletal muscle proteome in mdx mice at different ages. Electrophoresis 25:2576–2585. Glennemeier, K. A., and R. J. Denver. 2002. Small changes in wholebody corticosterone content affect larval Rana pipiens fitness components. Gen. Comp. Endocrinol. 127:16–25. Hayashi, K., Y. Nagai, A. Ohtsuka, and Y. Tomita. 1994. Effects of dietary corticosterone and trilostane on growth and skeletal muscle protein turnover in broiler cockerels. Br. Poult. Sci. 35:789–798. Hayward, L. S., and J. C. Wingfield. 2004. Maternal corticosterone is transferred to avian yolk and may alter offspring growth and adult phenotype. Gen. Comp. Endocrinol. 135:365–371. Hazard, D., M. Couty, J. M. Faure, and D. Guémené. 2005. Relationship between hypothalamic-pituitary-adrenal axis responsiveness and age, sexual maturity status, and sex in Japanese quail selected for long or short duration of tonic immobility. Poult. Sci. 84:1913–1919.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

of the main pathways through which birds derive energy for muscle contraction and fuel energy demands for growth (Doherty et al., 2004). In the present study, the content of glycolytic enzymes in breast muscle was greatly affected by TI, as LTI broilers had lower levels of glucose-6-phosphate isomerase, 6-phosphofructokinase, GAPDH, and phosphoglycerate mutase 1 than STI broilers. Although the expression of pyruvate kinase muscle isozyme was upregulated in breast muscle of both CORT-treated and LTI broilers, no differences were observed in the expression of 4 other glycolytic enzymes in the breast muscle of control and CORTtreated broilers. Our results indicated that the differences in glucose metabolism in muscle might contribute to the divergent growth performance between STI and LTI birds. When a quantitative trait loci study was undertaken to identify genome regions involved in the response of fearfulness between LTI and STI, the key enzymes controlling glucose metabolism can be taken into consideration in birds. Moreover, the expression of both l-lactate dehydrogenase A chain (LDH) and creatine kinase M-type (CK-M) was significantly downregulated by CORT administration. The observed decreases in the expression of LDH and CK-M in breast muscle caused by CORT were consistent with the reported lower activities of LDH and CK-M in serum after CORT administration (Wang et al., 2013). In contrast to other studies demonstrating that plasma CK-M and LDH levels increase in response to stress (Awerman and Romero, 2010), we found that the decreased activity of CK-M and LDH induced by chronic CORT exposure is likely related to significant decreases in growth rate and muscle mass. Heat shock proteins (HSP) are a family of highly conserved stress proteins found in almost all cells. We found that the expression of 5 HSP increased as a result of CORT treatment. The increase in the abundance of HSC70 in breast muscle following CORT treatment was confirmed by Western blotting. Heat shock protein 70 is one of the most highly inducible stress response proteins (Welch, 1992). Heat shock protein B1 and heat shock protein B1-like, which are small HSP, are very important for proper myogenesis (Sugiyama et al., 2000; Middleton and Shelden, 2013) and are required to sustain muscle function under physiological stress. We report herein the first demonstration that chronic administration of CORT induces a substantial increase in HSP expression in breast muscle, which contributes to retarded muscle development via the stress response. However, no differential HSP expression was observed in LTI phenotype broilers, indicating that there are divergent pathways of muscle development in breast muscle. In conclusion, we found that the growth of breast muscle is severely retarded in broilers of the LTI innate phenotype and broilers subjected to chronic CORT administration. Proteomic analyses showed that HSP expression is significantly upregulated in the breast muscle of CORT-treated but not LTI broilers, whereas the

COMPARATIVE PROTEOMICS IN BROILERS

Minvielle, F., A. D. Mills, J. M. Faure, J. L. Monvoisin, and D. Gourichon. 2002. Fearfulness and performance related traits in selected lines of Japanese quail (Coturnix japonica). Poult. Sci. 81:321–326. Morici, L. A., R. M. Elsey, and V. A. Lance. 1997. Effects of longterm corticosterone implants on growth and immune function in juvenile alligators, Alligator mississippiensis. J. Exp. Zool. 279:156–162. Nakashima, K., A. Ishida, M. Yamazaki, and H. Abe. 2005. Leucine suppresses myofibrillar proteolysis by down-regulating ubiquitinproteasome pathway in chick skeletal muscles. Biochem. Biophys. Res. Commun. 336:660–666. Ohlendieck, K. 2010. Proteomics of skeletal muscle glycolysis. Biochim. Biophys. Acta 1804:2089–2101. Post, J., J. M. Rebel, and A. A. ter Huurne. 2003. Physiological effects of elevated plasma corticosterone concentrations in broiler chickens. An alternative means by which to assess the physiological effects of stress. Poult. Sci. 82:1313–1318. Shini, S., A. Shini, and G. R. Huff. 2009. Effects of chronic and repeated corticosterone administration in rearing chickens on physiology, the onset of lay and egg production of hens. Physiol. Behav. 98:73–77. Sugiyama, Y., A. Suzuki, M. Kishikawa, R. Akutsu, T. Hirose, M. M. Waye, S. K. Tsui, S. Yoshida, and S. Ohno. 2000. Muscle develops a specific form of small heat shock protein complex composed of MKBP/HSPB2 and HSPB3 during myogenic differentiation. J. Biol. Chem. 275:1095–1104. Sunde, J., A. Kiessling, D. Higgs, and J. Opstvedt. 2003. Evaluation of feed protein quality by measuring plasma free amino acids in Atlantic salmon (Salmo salar L.) after dorsal aorta cannulation. Aquacult. Nutr. 9:351–360. Wang, S., Y. D. Ni, F. Guo, W. Y. Fu, R. Grossmann, and R. Q. Zhao. 2013. Effect of corticosterone on growth and welfare of broiler chickens showing long or short tonic immobility. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 164:537–543. Welch, W. J. 1992. Mammalian stress response: Cell physiology, structure/function of stress proteins, and implications for medicine and disease. Physiol. Rev. 72:1063–1081. Zulkifli, I., A. Al-Aqil, A. R. Omar, A. Q. Sazili, and M. A. Rajion. 2009. Crating and heat stress influence blood parameters and heat shock protein 70 expression in broiler chickens showing short or long tonic immobility reactions. Poult. Sci. 88:471–476.

Downloaded from http://ps.oxfordjournals.org/ at National Chung Hsing University Library on April 9, 2014

Hazard, D., M. Couty, S. Richard, and D. Guémené. 2008. Intensity and duration of corticosterone response to stressful situations in Japanese quail divergently selected for tonic immobility. Gen. Comp. Endocrinol. 155:288–297. Janczak, A. M., M. Heikkilä, A. Valros, P. Torjesen, I. L. Andersen, and M. Bakken. 2007. Effects of embryonic corticosterone exposure and post-hatch handling on tonic immobility and willingness to compete in chicks. Appl. Anim. Behav. Sci. 107:275–286. Jones, R. B., A. D. Mills, and J. M. Faure. 1991. Genetic and experiential manipulation of fear-related behavior in Japanese quail chicks (Coturnix coturnix japonica). J. Comp. Psychol. 105:15– 24. Kabsch, W., and J. Vandekerckhove. 1992. Structure and function of actin. Annu. Rev. Biophys. Biomol. Struct. 21:49–76. Leonard, B. E. 2006. HPA and immune axes in stress: Involvement of the serotonergic system. Neuroimmunomodulation 13:268–276. Lin, H., E. Decuypere, and J. Buyse. 2004a. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus) 1. Chronic exposure. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139:737–744. Lin, H., E. Decuypere, and J. Buyse. 2004b. Oxidative stress induced by corticosterone administration in broiler chickens (Gallus gallus domesticus) 2. Short-term effect. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 139:745–751. Lin, H., S. J. Sui, H. C. Jiao, J. Buyse, and E. Decuypere. 2006. Impaired development of broiler chickens by stress mimicked by corticosterone exposure. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 143:400–405. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) . Methods 25:402–408. Lynch, C. J. 2001. Role of leucine in the regulation of mTOR by amino acids: Revelations from structure-activity studies. J. Nutr. 131:861S–865S. Malheiros, R. D., V. M. Moraes, A. Collin, E. Decuypere, and J. Buyse. 2003. Free diet selection by broilers as influenced by dietary macronutrient ratio and corticosterone supplementation. 1. Diet selection, organ weights, and plasma metabolites. Poult. Sci. 82:123–131. Middleton, R. C., and E. A. Shelden. 2013. Small heat shock protein HSPB1 regulates growth of embryonic zebrafish craniofacial muscles. Exp. Cell Res. 319:860–874.

793