Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages

BB

...... ' t ; I ELSEVIER

Biochimica et Biophysica Acta 1260 (1995) 191-199

etBiochi~ic~a BiophysicaA~ta

Comparative studies on the minus origin mutants of Escherichia coli spherical single-stranded DNA phages Ken-Ichi Kodaira

a,* Nigel G. Godson b, Akira Taketo c

a Molecular Biology Group, Chemical and Biochemical Engineering, Faculty of Engineering, Toyama Uniuersity, 3190, Gofuku, Toyama, Toyama 930, Japan b Department of Biochemistry, NYU Medical Center, 550 First Auenue, New York, NY 10016, USA c Department of Biochemistry, Fukui Medical School, Matsuoka, Fukui, Fukui 910-11, Japan Received 22 June 1994; accepted 15 September 1994

Abstract

The minus origins for complementary strand DNA synthesis ( - o r i ) of Escherichia coli spherical single-stranded DNA (microvirid) phages G4, ~bK, a3, and St-1 closely resemble each other in DNA structure, and contain two potential secondary hairpin loops (I and I1) that have been implicated as direct recognition sites for host E. coli dnaG protein (primase). We introduced mutations (deletion or insertion) within the - o r i regions of ~bK and G4 by the nuclease digestion method. Mutants thus constructed produced minute plaques, showed thermosensitivity, and they remarkably reduced the phage yield and rate of viral DNA synthesis. Deletions in the ~bK mutants (dTa) were ranging from 1 nucleotide (nt) to 102 nt centered at the hairpin II; a dTa8 mutant was entirely lacking in the two hairpins besides the starting point for primer RNA synthesis. On the other hand, the G4 mutants (dSa) had deletions centered at hairpin I; two mutants dSa35 and dXN completely lost the hairpin I and the primer RNA starting point. In addition, progeny phage populations of several ~bK and G4 mutants contained revertant-like phages. DNA sequencing analysis revealed that these secondary phages had been generated by spontaneous DNA rearrangement with additional insertion or deletion near the parental mutation sites, via an unknown recA-independent pathway. Keywords: Single-stranded DNA phage; Origin mutant; Deletion/insertion; Complementary strand; DNA sequence

I. Introduction

In order to elucidate the fundamental molecular process of initiation of DNA replication, G4 type phages G4, a 3, St-1 have been extensively used as the most simple system (see for a review [1]). Upon infection of Escherichia coli, the viral SS DNA is first converted into double-stranded parental replicative form DNA (RF). For this SS ~ RF conversion, only host DNA replicative proteins are essential. The G4-ot3 groups require host dnaG protein (primase) but not cellular dnaB and dnaC(D) proteins for complementary strand synthesis [2], whereas the related phage ~bX174 is dependent on d n a B / C besides dnaG function [3]. In the G4-type system, E. coli DNA primase directly recognizes only one specific region of the single-stranded DNA, referred to as - o r i , in the presence of single-

* Corresponding author. Fax: + 81 764 418432. 0167-4781/95/$09.50 © 1995 Elsevier Science B.V. All rights reserved SSDI 0 1 6 7 - 4 7 8 1 ( 9 4 ) 0 0 2 0 0 - 2

stranded binding protein, and synthesizes the primer RNA for the complementary strand [1]. The G4 - o r i has been located within the 136 nt region between genes F and G [4], whereas the - o r i of a 3 as well as ~bK and St-1 has been positioned within the 135 nt region between genes G and H [5-7]. The origins of four phages have DNA sequences highly conserved in general [4-6] (see Fig. 3). The - o r i domain has two potential secondary structure hairpin loops, I and II (see Fig. 1): loop I is the 'primer hairpin' located just downstream of starting signal (5'CTG-3') for primer RNA [8], and loop II is the 'large downstream hairpin' positioned downstream of loop I. In the ~bK - o r i , in vitro protection experiments against cleavage by various nucleases have demonstrated that one molecule of primase protects three well-separated groups of nucleotides within the intergenic region located in the stem and the base of hairpin I and in the regions flanking hairpin II [9]. For G4, the function of the - ori region cloned into the origin-defective M13- filamentous phage vector has been

K.-I. Kodaira et al. /Biochimica et Biophysica Acta 1260 (1995) 191-199

192

studied in vivo. Thus, Lambert et al. [10] have reported that point mutations in stem of hairpin I render viral replication thermosensitive, whereas Sakai et al. [11,12] have shown that insertional mutations in the 3' end of hairpin III (equivalent to the hairpin II represented in Fig. 1) cause a reduction in synthesis of the parental RF DNA and physical separation of hairpins I and II does not significantly affect - o r i activity. In ot 3, instead of cloning the - ori into a vector phage, we have directly introduced point, deletion or insertion mutations within the - o r i [13,14]. The resultant mutants formed smaller plaques than did the wild type and showed

markedly altered growth properties: a longer latent period, a reduction in phage yield, temperature sensitivity, and host factor dependency on dnaB/C as well as dnaA. These results imply that the - o r i region containing two hairpins is indispensable for the phage replication. In addition, we recently isolated a novel a 3 mutant in which the - o r i region is entirely deleted [15]. In order to obtain further insight into the viral initiation mechanism, we introduced deletion or insertion mutations into the - o r i regions of thK and G4 phages. The present report describes the properties of these - o r i mutants. In addition, several strains out of these mutants produced

./I T (A) <-" G G (G)4-- T T ""~(C) A C T T T G G:C G:C (C)4-- 'r c C A C:G T T C:G A:T C A G G C:G C:G

lad

o1' g e n e

G:C ( T ) 4 ' - C:G -"~(A) C:G G A s88

i A T T

G C G:C C:G G:C G:C A:T &:T

•1

0: C

G:C

5 ' -TTAJULTAAAAG: C~GCC/~CGG&GAT&CCCGATAAACTAGG&&CGTG:

Start

of gene H

tfet

CCTC.~r..QCTAAGCC~

CTT&CJUi,TAT G- 3 '

(c)

(;4

X.r T A

A

G

C C T

&

C T G G:C G:C T C C A ,6,

A

T C:G T T C:G C:G

i

T

e:G G:C C:G C:G Jnd of tene G

A

A

A

G

A

C

G:C C:G G:C G:C C:G A:T G:C

÷1

St~Lrt o f gene H

ss., G: C . Her 5 ' - T A A C G C J ~ C ~ k A G : C G T G C C / T & C G G A G A T A C T C G & G T C T C C / G & T & C E ] r G : CCT&CTGCAJULGC C~kAAS~QACTJULCATAT G - 3 ' Jr. B .

Fig. 1. The - o r i structures of ~bKhT and G4. ~bKhT sequence is from Kodalra et al. (unpublished results) and possible secondary structure is from Sims et al. [5]. Nu¢leotides with bold letters in thKhT are putative bases essential for direct recognition by E. coli p d m a s e [9]. Nucleotides in parentheses are residues of or3 differing from those of ~bKhT. G4 sequence is from Godson ct al. [4]. Slashes in G4 represent gaps inserted to align nucleotides for m a x i m a l homology. + 1, starting point of in vitro primer RNA; * * *, termination codon; R.B., ribosomal binding site.

K. -I. Kodaira et al. / Biochimica et Biophysica A cta 1260 (1995) 191-199

revertant-like phages. Sequencing analysis revealed that these secondary phages had been generated by spontaneous D N A rearrangement in - o r i domain.

2. Materials and methods 2.1. Phages and bacteria

Bacteriophages ~bK, G4, and their host E. coli K12 W3110 dna + and C dna + were from our laboratory stock, thKhT is a host range mutant of ~bK (see below) and can grow on E. coli C (Kodaira et al., unpublished data). The - o r i mutants of thKhT and G4 constructed in this study (see below) are listed in Table 1, together with the related a 3 mutants isolated previously [13,14].

193

Buffers for the enzymes were as recommended by the manufacturer. The oligodeoxynucleotides for polymerase chain reaction (PCR) and sequencing were chemically synthesized using a Beckman system 1 Plus D N A synthesizer: 5 ' - T T C T G C T C G C G A T I ' G C G T r A C T G T - 3 ' (positioned in ~bK gene G), 5 ' - G A A C A T r A C A A C C C T G A A T A G C A G Y (in ~bK gene H), 5 ' - A T G G A T I ' C C C G T I ' C TACTCTGCTC-Y (in G4 gene F), 5'-GGCTGTGGTI'GTT G C A T I ' G A T r A G - 3 ' (in G4 gene G), and 5'-TAAGCTCC T I T I ' T G G G C - 3 ' (sequencing primer for ~bK), S'C A G C A A G C T G A G T A G A G - 3 ' (sequencing primer for G4), S ' - G G C A C A G A T A A A A C A G G - 3 ' (sequencing primer for G4). [o~-35S]dCTP was from NEN. All other materials were prepared as described previously [7,13,14]. 2.3. Construction o f mutant

Table 1 ori mutants of G4 type phages ~bK, G4, and a3 Phage Properties Source/Reference

Double-stranded RF D N A of thKhT (or G4) was linearized with restriction endonuclease RsrII ( X h o I ) and subsequently digested by Bal31 nuclease for various time periods (from 0 to 10 min). The D N A was then filled in using D N A polymerase I (Klenow fragment). After joining the treated D N A with T4 ligase, mutant phages were obtained by Ca2÷-dependent transfection of E. coli C. The resulting mutants which formed smaller plaques than those of the parental strain were isolated and checked for mutations by analyses using restriction enzyme and PCR.

thK thKhT

2.4. Single-step growth

2.2. Enzymes and biochemicals

Restriction enzymes, phage T4 D N A ligase, E. coli D N A polymerase I (Klenow fragment) and reagents used for dideoxy sequencing were purchased from CalBiochem (USA), Takara Shuzo (Kyoto) and Nippon Gene (Toyama).

-

dTal dTal8 dTal3 dTal4 dTal5 dTa8 dTal9 dTa3 dTaLl dTaL19 dTaL3

G4 dSa8 dSal6 dSa35 dXN dSaL8 cz3 oriAA oriGA delo2006 deloLl05 delo5014 delo5001 delo2018 delo2017 delo4010 delo2016 delB inoK5

wild-type host range mutant of 4~K del mutant of tbKhT (1) del mutant of ~bKhT(7) del mutant of ~bKhT(10) del mutant of ~bKhT(18) del mutant of ~bKhT(45) del mutant of thKhT (102) ins mutant of 4,KhT (2) ins mutant of thKhT (3) spontaneousderivative of dTal spontaneousderivative of dTal9 spontaneousderivative of dTa3 wild-type del mutant of G4 (23) del mutant of G4 (27) del mutant of G4 (56) del mutant of G4 (60) spontaneousderivative of dSa8 wild-type point mutant of or3 spontaneousderivative of oriAA del/ins mutant of a3 (0) del mutant of or3 (4) del mutant of or3 (8) del mutant of a3 (20) del mutant of a3 (20) del mutant of c~3 (19) del mutant of a3 (26) del mutant of a3 (38) del mutant of a3 (121) ins mutant of a3 (4)

laboratory stock laboratory stock this work this work this work this work this work this work this work this work this work this work this work laboratory stock this work this work this work this work this work [2] [13] [13] [14] [14] [14] [14] [14] [14] [14] [14] [15] [14]

Nucleotide numbers of deletion or insertion are presented in parentheses. Deletion and insertion are indicated as del and ins, respectively.

E. coli C cells were grown at 27 ° or 30°C (for details, see below) with shaking in nutrient broth or LB medium [16,17]. When the A660 of the culture had reached 0.25, 1 / 1 0 vol. phage (input multiplicity, 0.1) was added with 1 / 4 0 vol. 0.2 M CaC12. After 10 mih adsorption, the infected culture was diluted 104-fold into medium prewarmed at 27 ° or 37°C. At intervals, aliquots were removed, treated with chloroform and then free phage was titrated. 2.5. DNA sequencing

The - o r i regions were prepared from viral RF a n d / o r PCR-amplified DNA, and the RsaI and AluI fragments that contain ~ K h T and G4 - o r i , respectively, were then cloned into sequencing vector plasmid (pUC118 or M13mp18). Viral D N A as a direct template was extracted from phage particles purified by CsC1 centrifugation [14]. The nucleotide sequence of the - o r i region was determined by the chain termination method [18] using synthetic oligodeoxynucleotides (see above) a n d / o r universal vector primers. 2.6. Analysis o f viral DNA replication E. coli C cells were grown at 37°C with shaking in LB medium [17]. When the A660 of the culture had reached

194

K. 4. Kodaira et al. / Biochimica et Biophysica Acta 1260 (1995) 191-199

0.5, 1 / 5 0 vol. chloramphenicol (1.5 mg/ml), 1/100 vol. phage (input multiplicity, 10) and 1/200 vol. 1 M CaCI 2 were added. At intervals, the infected culture was poured into ice-cold 75% ethanol in 0.05 M Tris-HC1, 0.02 M EDTA (pH 8.0). The phage DNA was extracted as described previously [19] and analyzed with 1% agarose gel electrophoresis.

3. Results 3.1. Construction o f minus origin mutants

As shown in Fig. 1, the thK - o r i (135 nt) between genes G and H has two putative secondary structure hairpin loops, I and II, and a possible primer RNA starting signal 5'-CTG-3' just upstream of the hairpin I (the complete sequence of ~bK DNA will be published separately by Kodaira et al.). At the base of the hairpin II (on the 3' stem), tkK has a single unique site for restriction enzyme R s r l I that is methylated in host E. coli strain K12 (data not shown). Therefore, we have isolated a host range mutant, referred to as thKhT, that can grow on E. coli strain C (modification deficient); thKhT has identical - o r i to that of thK (see below). In this study, we used thKhT R s r l I site to introduce mutations within the - o r i domain as described in Materials and methods. In G4, the 136 nt - o r i between genes F and G is very similar in DNA structure to that of thKhT (see above and Fig. 1). G4 has two X h o I restriction sites: one is located in the middle region between two hairpins I and II, and the other is in gene C [4]. We obtained linear RF DNA cut at the X h o I site in the - o r i by partial digestion, and then introduced mutations by the same strategy as employed in ~bKhT (see above). For a deletion between X h o I and N d e I the linearized RF was cut out by NdeI, and then filled in using DNA polymerase I (Klenow fragment). Mutants thus constructed, referred to as dTa (from ~bKhT) and dSa (from G4), and their spontaneous pseudorevertants (see below) were listed in Table 1 together with a 3 - o r i mutants isolated previously [13-15]. The dTa members formed nearly homologous plaques, which were smaller than those of 4~KhT and slightly larger than those of M13 (see Fig. 2). Most of the dTa mutants remained stable over a long time, but three strains dTal, dTal9, and dTa3 produced revertant-like phages (referred to as dTaL19, and dTaL3, respectively) on E. coli C rec + or r e c A strain at frequencies lower than 10 -6. In Fig. 2, plaques of the dTaL1 mutant are compared with those of the parental strain dTal. On the other hand, G4 mutants were mutually different plaque size (dSa8 > dSal6 > dSa35 = dXN). dSa8 formed formed significantly smaller plaques (about one fifth) than those of the wild-type, whereas dXN (deleted from X h o I to NdeI) showed pinhole-like plaques. The dSa members, except dSa8 have been stable for a long time. Similar to

Fig. 2. Plaques of dTaL1 mutant. The dTaL1 phages were plated on Escherichia coli C at 37°C together with the original mutant dTal. A typical dTaL1 plaque is arrowed.

the dTaL groups (see above), dSa8 produced revertant-like phages (referred to as dSaL8) whose plaques were smaller than those of the wild type, but significantly larger than those of the parental strain dSa8 (data not shown). 3.2. Sequence analysis o f - o r i mutant

Analyses by PCR and restriction endonuclease mapping have indicated that each of the ~bKhT and G4 mutants has an expected mutation only within the - o r i (data not shown). To determine the mutation sites precisely, the dTa G / H and dSa F / G intergenic regions were sequenced by the chain termination methods [18] as described in Materials and methods. In the dTaL and dSaL groups, - o r i regions were amplified by PCR using synthetic oligodeoxynucleotides (Materials and methods), and were sequenced as well to confirm the mutations. The results of sequencing are summarized in Fig. 3. Each mutant had one mutation within the - o r i domain centered at the restriction site. Deletions of the dTa members were extending from 1 nt to 102 nt: (1) dTal lost 1 nt (G) within the R s r l I recognition site (5'-CGGACCG-3'), (2) deletions of three mutants d T a l 8 (7 nt), dTal3 (10 nt), and dTal4 (18 nt) were located within the 3' stem of hairpin II, (3) dTal5 (45 nt) was entirely lacking in the hairpin II and acquired a new stop codon 5'-TAG-3' for gene G instead of original 5'-TAA-3', and (4) dTa-8 missed the largest 102 nt containing the 3' stem of hairpin II, the space between the two hairpins I and II ('loop-space'), the hairpin I, and the primer RNA starting signal 5'-CTG-3', all of which are considered to be the most important parts of the - o r i function. On the other hand, dTal9 and dTa3 had 2 nt (5'-GA-3') and 3 nt (5'-GAC-3') insertions, respectively, at the R s r l I site. As shown in Fig. 3, two G4 mutants dSa35 (56 nt) and dXN (60 nt) were lacking in the 3' region of loop space, the hairpin I, and the primer RNA starting signal besides the ribosomal binding site for gene G. A 5'-GGAG-3' sequence located 2 nt upstream of the X h o I site probably

K.-I. Kodaira et aL / Biochimica et Biophysica A cta 1260 (1995) 1 9 1 - 1 9 9

~00~0

k

U O 0 ~ O ~ O 0 0 0 0 0 ~

i

U

195

U

k

))

~UU UUUUIbU

U~,,I

11)

e

"I "~

~-~ - I.* [.~ I~ I..* I~ l~

U

U

)))

0

0

~-~

U

UUU~UU

U

~u g

U

U

U

u

U

U U i

n ¢ ~ -

U

~ i ~ ~o

!

)°,°i) I

~,~

U

L,11U "-

~o . t -

U u

U U

u <

~u

~I~~

k U U

~ I, i~,. ~I

.~ii °°

uo U~ u

~

v~,

U

U

U

u

~,I~ ~! ,

r~N

u U u

• ¢~ .m

u U~

u

U u u

).

il{iiiiiiiii

!iiii

ii°ii ~ O m ~ N N

~

',~?~*,

0

,~

0 !

*

I 0 ! ! U m

~ o

196

K.-I. Kodaira et al. / B i o c h i m i c a et Biophysica A c t a 1260 (1995) 1 9 1 - 1 9 9

functions as a new ribosomal binding site for the gene G. dSa8 lost 23 nt extending from the 3' region of loop space to the 5' stem of hairpin I. On the contrary, dSal6 missed 27 nt centered at the hairpin II from the 3' stem of hairpin II to the 5' region of loop space. It is interesting that dTaL1 was spontaneously derived from dTal (see above) and had a secondary 3 nt (5'-ACG3') insertion at the original deletion site, consequently bearing a 2 nt (5'-AC-3') addition as compared with the qbKhT - o r i (Fig. 4). On the contrary, dTaL19 and dTaL3 lost the 2 nt and 3 nt insertions, respectively, and regained the sequence identical to that of (hKhT. In G4, dSaL8 had a spontaneous 7 nt (5'-AGATACT-3') addition at 3 nt upstream of the dSa8 deletion site (Fig. 4).

3.3. Growth properties of

ori mutants

-

In order to determine the effect of - o r i mutations on replication, we investigated growth properties of the mutants. Table 2 shows plating efficiencies of the ~bKhT and G4 mutants at different temperatures from 27 ° to 42°C. The dTa and dSa strains grew well at 27°-37°C, but not at 42°C, whereas dTaL1 had no thermosensitivity at 42°C. Experiments of single-step growth in E. coli C at 27°-37°C revealed that the dTa and dSa members had a latent period approx. 20 min longer than the wild type and gave a significantly lower phage yield. For example, the mean burst size of dSa8, dSal6, and dSa35 were 20 versus 100 of the wild type, at 27°C in nutrient broth (Fig. 5A).

~k~ ~,e~rlI 8mSWmtg

4-- H a l r p l n

CKhr

If

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

Htirpln

I

TGT~T~T~CCC>~T&~GGCGG&CCr~G~C&T&CGG&GAT&CC~TA~&~CT&GG~ACGTG~AAGGCGTT~CCGCCTTCCCT

dral

- 1

TGTGTCTGCCC•GTGTAGGG•G••CCGAGCCATACG•AGATACCCGATAAACT&GGAACGTGGAAGGCGTT&GCCGCCTTCCCT

dFaLl

*2

TGT~TCT~CCC&~TGT~GGGCG~CCGAGC~ATACGGAGATACCCG~TAAACT~GGAACGTGGAAGG~GTTAGCCGCCTTCCCT acg

dTa3

÷3

TGTGTCTGCCCAGTGTAGGGC ,~ACCGAGCCATACGG&GATACCCGATAAACTAGGAACGTGGAAGGCGTTAGCCGC CTTCCCT g~'c

dra£3

0

(vt)

TCTGTCTGCCCAGTGTAGGGCGGACCGAGCC&TACGGAG&TACCCGATA.4ACTkGGAACGTGGAAGGCGTTAGCC GCCTTCCCT

G_& ~--

G4wt

llairp2n

If

XhoI ..........

........

8888s8

llmirptn

I

GATACCTGCCCAATGTGGGGCGG&CCGTGCC/T&CGGAG£TACTCG>CTCC/ G & T A C & T ~ C ~ G C C G C C G T C ~ T

4, dSa8

-23

GAT&CCTGCCCA&TGTGGGGCGGACCGTGCC / TACGG&GATACTCGA. . . . . .

/ .................

AGCCGCCGTtCCT

dSa.f.8

-16

GAT&CCTGCCCAATGTGGGGCGGACCGTGCC/TACGGAG&TACTag, a t a c t C G&. . . . . . . . . . . . . . . . .

AGCCGCCGTCCCT

$pli ,e-. B R t r p t n

(~rt

II

..........

8=a88=

........

B~irp2n

I

"-~

GATGCCTG•CC•GTGTAGGGCAG•CC•A•CCGT•CGG•G•T&CCCG•TA•£CT•GGAACGTGG•A•GCGTT&GCCGCCTT•CCT

( -9

de12006

0

GATCCCTGCCCAGTGTAGGGCAGACCGAGCCG. . . . . . . . .

&CCC~GGAACGTGG£AGGCGTT&GCCGCCTTCCCT )

GATGCCTGCCCAGTGT&GGGCAGACCGAGCCGACCC~tmmct a ~ G ~ C G T G G A A G G C G T T A G C C G C C T T C C C T

Fig. 4. Secondary mutants occurred spontaneously from - ori mutants. Sequences of the - ori are shown from the 3' region of hairpin II to the 5' region of hairpin I. Symbols are the same as in Fig. 3. Inserted nucleotides are represented with small letters. Closed triangles indicate insertion sites. Duplicated nucleotides are underlined. Putative a 3 mutant missing 9 nucleotides is shown in parenthesis.

197

K.-I. K o d a i r a et al. / B i o c h i m i c a et B i o p h y s i c a A c t a 1 2 6 0 (1995) 1 9 1 - 1 9 9

Table 2 Plating efficiency of - o r i mutant Strain

Relative number of plaques Temperature:

thKwt ~bKhT d T a 3 ( + 3) d T a l ( - 1) d T a l 8 ( - 7) d T a l 3 ( - 10) d T a l 4 ( - 18) d T a l 5 ( - 45) d T a 8 ( - 102) dTaL1 ( + 2 )

G4 wt dSa8 ( - 23) dSal6 ( - 27) dSa35 ( - 5 6 ) dXN ( - 60)

27°C

30°C

370C

42oc a

< 1.0" 10 -8 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. 1.0 1.0 1.0 1.0 1.0

< 1.0" 10 -8 0.7 0.6 0.6 0.4 0.4 0.8 1.0 0.8 0.6 n.d. n.d. n.d. n.d. n.d.

< 1.0" 10 -8 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.3 0.2 0.2 0.2

< 1.0.10-8 0.7 7.7 10 -3 2.0 10 -3 7.6 10 -4 2.0 10 -4 9.3 10 -4 1.5 10 -4 1.2 10 -4 0.6 1.4 " 10 -2 1.0" 10 -7 1.0 " 10- 7 1.0" 10 -7 1.0- 10 -7

Phages were plated on E s c h e r i c h i a coli C. Nucleotide numbers of deletion or insertion are presented in parentheses. In most strains of the - ori mutants, plaques at 42°C are small and turbid.

The dXN mutant also showed low phage yield at 30°C in LB medium, but its latent period was nearly identical to that of the wild type (Fig. 5B).

In (hKhT series, the dTa strains (except dTa3) had almost the same growth profiles as those of the dSa mutants (data not shown). The 3 nt insertion in the dTa3

10 (A) I / x / x

-

x

-

x - - x - - x

(B)

--x

~x i'

al

/° J

o

o

0

<~

0

o

8

0

ij

•

ii'i/

..,.J

7,

6

7

/ 40

j

8

0

6~ 0

o

, , ~"

o

/

io . . . .

80

120 Time (min)

160

200

5

I

I

I

40

8O

120

Time (rain)

Fig. 5. Single-step growth of - o r i mutant. (A) E. coli cells (3.0 • 108/ml) of strain C grown at 27°C were infected with phage (moi, 0.1) in nutrient broth [16] supplemented with 5 mM CaCl 2. After 10 rain adsorption, the infected culture was diluted 104-fold into prewarmed medium at 27 ° or 370C. At intervals, aliquots were removed, treated with chloroform and then free phage was titrated. × , wild type; O, dSal6; zx, dSa8; 12, dSa35. (B) Conditions were the same as in (a), except that LB medium [17] supplemented with 5 mM CaCl 2 was used. C), d.XN at 30°C; Q, dXN at 370C; r,, wild type at 30°C; A, wild type at 37°C. (C) Conditions were the same as in (a). zx, d T a 3 at 33°C; A, d T a 3 at 370C; O, ~bKhT at 33°C; O, ~bKhT at 37°C.

198

K.-L Kodaira et al. / Biochimica et Biophysica Acta 1260 (1995) 191-199 I

(C)

I

I

A~

o

E

8

l/

/

0 __1

o

/

7

/2/ 5 0

I 20

I 40

I 60

plaque size (Fig. 2), thermosensitivity (Table 2), a longer latent period (Fig. 5), reduced in phage yield (Fig. 5) and RF replication (Fig. 6). These data indicate that a tertiary structure made up by the hairpins I and II and the loopspace plays a pivotal role in direct recognition by the primase. In G4, two mutants dSa35 and dXN completely lost the hairpin I and the primer-starting signal 5'-CTG-3' (Fig. 3). Moreover, the dTa8 mutant of d~KhT was lacking in a 102 nt sequence that contains the two hairpin I and II and the primer-starting signal, and retaining only the ribosomal binding site for the gene H (Fig. 3). These extreme mutants missing the fundamental domains, that have been believed to be essential for the - o r i activity, might utilize a new replication origin(s). This possibility is further supported by the fact reported previously [15] that growth of delB, an a 3 mutant bearing a 121 nt deletion (see Fig. 3), depends on host dnaB and dnaC functions like ~bX174, in which primer is synthesized by a primosome made up of dnaB, dnaC and other replication proteins, rather than direct priming by the primase [20].

I 80

"~

Time (min)

~

Fig. 5(continued).

mutant caused longer latent period (about 20 min), but no significant decrease in the phage yield at both 33°C and 37°C (Fig. 5C). Like dTa3, inoK5, an a 3 mutant, with 4 nt insertion within the loop space (Table 1), gave higher phage yield [14]. The - o r i regions of the G4 type phages are used both for the conversion of the infecting SS DNA into the parental RF DNA and for the subsequent replication of progeny RF [11,14]. To study effects of the - o r i mutations on viral DNA replication in vivo, rate of the RF synthesis was measured in E. coli C in the presence of chloramphenicol (30/.tg/ml). The cells were infected with the mutant and the intracellular viral DNA was subjected to agarose electrophoresis analysis. Fig. 6 shows RF synthesis of the dTa3 and dXN mutants. Amount of RF DNA accumulated after infection was declined in both mutants. The degree of RF replication in other dTa and dSa mutants was clearly reduced in parallel with prolongation in latent period and/or decrease in phage yield as well (data not shown). These results indicate requirement of specific - ori structure for initiation of viral DNA replication.

4. Discussion

In - o r i mutants of ~bKhT and G4 constructed in this study, viral growth was remarkably affected: a minute

,e.

~

~

~,

~

,~ ~

o~

~

~

='~ ==

Host RFil RF I

O

Host RFU RFI

Fig. 6. Rate of RF DNA synthesis of dTa3 and dXN mutants. Cells (5.0.108/ml) of E. coli C grown at 30°C were infected with phage (moi, 10) at 37°C in LB medium [17] supplemented with 30 p,g/ml of chloramphenicol. At 20, 40, 60, 80, and 100 min postinfection, the intracellular viral DNA was extracted and subjected to 1% agarose gel electrophoresis. Control, RF DNA; Host, host DNA.

K.-I. Kodaira et al. / Biochimica et Biophysica Acta 1260 (1995) 191-199

Alternatively, it is possible that a secondary structure which is newly generated near the site of deletion may be recognized by the primosome, or a novel mechanism might participate in priming of the - ori mutants. It was interesting that progeny phage population of dSa8 contained revertant-like phage dSaL8 (see above). The secondary mutant dSaL8 spontaneously acquired a 7 nt (5'AGATACT-3') additional sequence, that is probably generated by duplication of the identical 7 nt sequence located 3 nt upstream of the deletion site of the dSa8 strain (Fig. 4). Spontaneous occurrence of this type of secondary mutation is known in a 3 [14]; a delo2006 mutant (Table l) has a 9 nt (5'-GATAAACTA-3') duplication within the loop space (Fig. 4). Both the duplications thus occur in the loop space and contain a common sequence, 5'-GATA-3'. These results indicate that the secondary duplication detected in dSaL8 is advantageous over the shorter deletion of dSa8, for - o r i function. Nucleotide pairing located in the base of hairpin II has been considered to be important for the direct recognition by the primase (see Fig. 1). In ct3, a mutant oriAA disturbed in a G:C pairing at the base of hairpin II (from G to A) showed abnormal growth properties: a minute plaque size, a reduced phage yield, and spontaneous production of revertant-like phage oriGA in which the base nucleotide is reverted from A to G the same as in the wild type [13]. Likely, the d~KhT mutants dTal, dTal9, and dTa3 had mutations disturbing G:C pairings at the base of hairpin II (Fig. 3) and produced revertant-like phages (dTLaL1, dTaL19, and dTaL3, respectively) due to spontaneous insertion or deletion (Fig. 4). These results suggest that the base of hairpin II formed by G:C pairings is critical for - o r i activity. When the G:C pairings are disturbed, the phage might preferentially gain second mutation suitable for the primase recognition. These spontaneous mutations detected in microvirid phages (summarized in Fig. 4) seem to be generated via an unknown recA-independent pathway (see above). In rolling-circle type replication found in both gramnegative and -positive bacteria, many different systems might operate for complementary strand synthesis (Kodaira

199

et al., unpublished data). The evolutionary relationship among the systems remains to be clarified in detail. Further studies are in progress to dissect signal(s) for - o r i functions.

References [1] Baas, P.D. and Jansz, H.S. (1988) Current Topics Microbiol. Immunol. 136, 31-70. [2] Taketo, A. and Kodaira, K.-I. (1978) In the Single-Stranded DNA Phages (Denhardt, D.T., Dressier, D. and Ray, D.S., eds.), pp. 361-367, Cold Spring Harbor Laboratory, Cold Spring Harbor. [3] Kornberg, A. (1980) DNA Replication, W.H. Freeman, San Francisco. [4] Godson, G.N., Fiddes, J.C., Barrell, B.G. and Sanger, F. (1978) In the Single-Stranded DNA Phages (Denhardt, D.T., Dressier, D. and Ray, D.S., eds.), pp. 51-86, Cold Spring Harbor Laboratory, Cold Spring Harbor. [5] Sims, J., Capon, D. and Dressier, D. (1979) J. Biol. Chem. 254, 12615-12628. [6] Kodaira. K.-I., Nakano, K., Okada, S. and Taketo, A. (1992) Biochim. Biophys. Acta 1130, 277-288. [7] Kodaira. K.-I., Nakano, K. and Taketo, A. (1985) Biqchim. Biophys. Acta 825, 255-260. [8] Hiasa, H., Sakai, H., Komano, T. and Godson, G.N. (1990) Nucleic Acids Res. 18, 4825-4831. [9] Sims, J. and Benz, E.W. (1980) Proc. Natl. Acad. Sci. USA 77, 900-904. [10] Lambert, P.F., Kawashima, E. and Reznikoff, W.S. (1987) Gene 53, 257-264. [11] Sakai, H. and Godson, G.N. (1985) Biochim. Biophys. Acta 826, 30-37. [12] Sakai, H., Komano, T. and Godson, G.N. (1987) Gene 53, 265-273. [13] Kodaira, K.-I., Nakano, K. and Taketo, A. (1989) Biochim. Biophys. Acta 1007, 359-362. [14] Nakano, K., Kodaira, K.-I. and Taketo, A. (1990) Biochim. Biophys Acta 1048, 43-49. [15] Kodaira, K.-I., Nakano, K. and Taketo, A. (1990) Mol. Gen. Genet. 220, 240-244. [16] Taketo, A. and Kuno, S (1972) J. Biochem. 71, 497-505. [17] Kodaira, K.-I. and Taketo, A. (1984) Mol. Gen. Genet. 195,541-543. [18] Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. [19] Kodaira, K.-I. and Taketo, A. (1977) Biochim. Biophys. Acta 476, 149-155. [20] Arai, K.-I. and Kornberg, A (1981) Proc. Natl. Acad. Sci. USA 78, 69-73.