Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide against different types of chemical-induced liver injury models in vivo

BIOMAC-13850; No of Pages 10 International Journal of Biological Macromolecules xxx (xxxx) xxx

Contents lists available at ScienceDirect

International Journal of Biological Macromolecules journal homepage: http://www.elsevier.com/locate/ijbiomac

Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide against different types of chemical-induced liver injury models in vivo Hang Qu a, Xin Gao a, Zhen-Yu Wang a,⁎, Juan-Juan Yi b,⁎⁎ a b

School of Chemistry and Chemical Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001, PR China School of Life Sciences, Zhengzhou University, Zhengzhou, Henan 450001, PR China

a r t i c l e

i n f o

Article history: Received 11 October 2019 Received in revised form 28 October 2019 Accepted 7 November 2019 Available online xxxx Keywords: Pine nut polysaccharide Liver injury model Hepatoprotection Antioxidant Anti-inflammation

a b s t r a c t A novel polysaccharide (PNP80b-2) was obtained from Pinus koraiensis pine nut, which has been proved to possess good hepatoprotective effects in vitro. This study comprehensively investigated its hepatoprotective activities against different types of chemical-induced liver injury in vivo. Carbon tetrachloride, alcohol and acetaminophen were used as hepatic toxicants to establish chemical pollutant-induced liver injury (CILI) model, alcohol induced-liver injury (AILI) model and drug-induced liver injury (DILI) model, respectively. The results showed that PNP80b-2 prevented elevation of biomarkers for liver injury in each model, including alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and total bilirubin (TBIL). The expression of cytochrome P450 in damaged hepatocytes was also downregulated. Additionally, PNP80b-2 enhanced hepatic antioxidant capacity through upregulating the expression of NRF2 and HO-1, thereby increasing superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and catalase (CAT) activities and decreasing malondialdehyde (MDA) levels. The uncontrolled production of inflammatory factors including tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6) and cyclooxygenase-2 (COX-2) in CILI, AILI and DILI models was also suppressed by PNP80b-2. By contrast, PNP80b-2 exerted the strongest hepatoprotection against AILI model, through improving hepatic antioxidant capacity via NRF2/ARE pathway and regulating inflammation response. Thus, PNP80b-2 is a promising functional food to prevent AILI. © 2019 Elsevier B.V. All rights reserved.

1. Introduction Liver is an important organ responsible for metabolism in human body. It can decompose or discharge many endogenous and exogenous non-nutritive substances to maintain homeostasis, which is called

Abbreviations: PNP, pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide; CCl4, carbon tetrachloride; CILI, CCl4-induced liver injury; AILI, alcohol-induced liver injury; DILI, drug-induced liver injury; APAP, acetaminophen; BW, body weight; GSH, glutathione; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline phosphatase; TBIL, total bilirubin; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde; COX-2, cyclooxygenase-2; CAT, catalase; TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; CYP2E1, cytochromeP450; NRF2, nuclear factor erythroid-2-related factor 2; HO-1, heme oxygenase 1. ⁎ Correspondence to: Z.-Y. Wang, School of Chemistry and Chemical Engineering, Harbin Institute of Technology, NO. 92 Xidazhi Street, Nangang District, Harbin, Heilongjiang 150001, PR China. ⁎⁎ Correspondence to: J.-J. Yi, School of Life Sciences, Zhengzhou University, NO. 100 Science Avenue, National High-Tech Industrial Development Zone, Zhengzhou, Henan 450001, PR China. E-mail addresses: [email protected] (Z.-Y. Wang), [email protected] (J.-J. Yi).

“detoxification function” [1]. However, current data indicate that liver diseases are prevalent and global, whether acute or chronic. Approximately two million people worldwide die of liver diseases every year, and this burden is increasing [2,3]. So it is imperative to protect liver and prevent liver injury which may influence liver microenvironment and further drive severe liver diseases [4]. Chemical-induced liver injury is a common type of liver injury, which is associated with hepatic toxicants including chemical pollutants, alcohol and drugs [5]. Carbon tetrachloride (CCl4) is a well known chemical agent causing liver damage and is widely used to establish models for liver injury research [6]. Numerous studies have revealed that CCl4-induced liver injury (CILI) is mainly attributed to the products (CCl3· and CCl3OO·) of CCl4 metabolized by cytochrome P450. The accumulated free radicals can lead to oxidative damage and activate liver macrophages to secret inflammatory cytokines, thereby causing liver injury [7–9]. Alcohol is a major cause of liver diseases, because liver is the major place for alcohol metabolism. According to the data published by World Health Organization (WHO), there are approximately two billion people consuming alcohol worldwide and up to 75 million suffer from alcohol abuse, implying the increasing risk of liver injury [10]. It has

https://doi.org/10.1016/j.ijbiomac.2019.11.069 0141-8130/© 2019 Elsevier B.V. All rights reserved.

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

2

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

been reported that AILI is related to multi-factors such as excessive oxidative stress, abnormal lipid metabolism and durative inflammation [11–13]. DILI is increasing all over the world, especially in China [14]. The mechanisms of DILI depend on the physicochemical properties of different drugs. Acetaminophen (APAP) used to be a common drug for treatment of fever and pain, but overdose can cause severe liver injury and even acute liver failure [15]. The pathogenesis of APAP-induced liver injury is correlated with the oxidized product of APAP metabolized by cytochrome P450, N-acetyl-p-benzoquinone imine (NAPQI), which is a toxic intermediate and can bind to glutathione (GSH). Once APAP is overdose, the accumulated NAPQI will lead to the depletion of GSH, triggering oxidative stress and ultimately inducing cell apoptosis and liver injury [16,17]. ALT and AST activities are important and direct indicators for evaluating liver injury. Elevated serum ALT and AST levels usually mean enhanced membrane permeability and impaired hepatocyte [18]. Once liver injury occurs, normal metabolism is dysregulated, causing accumulation of ALP and TBIL. Thus, serum ALP and TBIL levels are often used as indirect indicators for assessing the severity of liver damage [19]. In recent years, many plant-derived polysaccharides have been reported to exhibit hepatoprotective effects against CILI, AILI and DILI [13,19,20]. Pine nut (Pinus koraiensis Sieb. et Zucc.), a popular food rich in nutrients, is also traditional Chinese medicine for alleviating hyperlipemia and hypertension [21]. However, there are few reports about the hepatoprotection of pine nut polysaccharide (PNP) until now. A novel pine nut polysaccharide PNP80b-2 with in vitro hepatoprotective activity was obtained previously. In this work, the in vivo hepatoprotective activities of PNP80b-2 were comprehensively evaluated by comparing its effects against CILI, AILI and DILI in mice models. 2. Materials and methods 2.1. Materials and reagents Pine nuts (Pinus koraiensis Sieb. et Zucc.) were provided by Heilongjiang Laohongqi Forest Farm (Hailin, China). CCl4 was obtained from Aladdin Biochemical Technology Co. (Shanghai, China). Edible alcohol (56%, v/v) was purchased from Beijing Red Star Erguotou Co. (Beijing, China). APAP tablets (0.5 g/tablet) were obtained from SK&F (Tianjin, China). Test kits for total protein, ALT, AST, ALP, TBIL, SOD, GSH-Px, MDA and CAT were all purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Elisa kits for TNF-α, IL-1β, IL-6 and COX-2 were provided by Kenuodi Biotech Co. (Quanzhou, China). The kits for total RNA extraction and reverse transcription were obtained from TAKARA Biochemical Technology Co. (Dalian, China), and the universal SYBR Green Supermix Kit for quantitative real-time PCR was purchased from Bio-Rad (Hercules, California, USA). 2.2. Preparation of PNP80b-2 PNP80b-2 was prepared according to the previous study. Briefly, pine nut powder was extracted with hot distilled water (95 °C) and precipitated with ethanol at a final concentration of 80% after removing grease by petroleum ether. The precipitates were dissolved and deproteinized with trichloroacetic acid to produce the crude pine nut polysaccharide extract PNP80. PNP80 was purified by DEAE-cellulose52 column and Sephacryl S400 HR gel chromatography column sequentially. As a result, the purified component, PNP80b-2 was obtained, with a molecular weight of 2.30 × 104 Da, which was consisted of 85.21 ± 2.62% of carbohydrate, 6.33 ± 0.75% of protein and 3.13 ± 0.64% of uronic acid. Monosaccharide composition analysis showed that galactose, glucose, rhamnose, xylose and arabinose are the main monosaccharides in PNP80b-2, with molar ratio of 16.75:11.02:4.25:1.20:0.98.

According to the structural characterization, PNP80b-2 was mainly composed of 1,2-linked Galp, 1,2-linked Rhap, 1,4-linked Xylp, 1,6linked Glcp, 1,4-linked GlcpA, 1,2,6-linked Galp, 1,4,6-linked Glcp, 1,2,3,4-linked Arap, 1-linked Galp and Leu- and Ile-linked Oglycopeptide bonds.

2.3. Animals Male specific pathogen free (SPF)-grade Kunming mice (20–22 g) were provided by Experimental Animal Center of the 2nd Affiliated Hospital of Harbin Medical University. All mice were grown in a specialized animal lab with no pathogens and allowed to feed and drink freely. The room temperature was maintained at 22 ± 2 °C and the dark/light cycle was 12 h. All the experiments were strictly conducted based on the guidelines of the Experimental Animal Welfare and Ethics Committee of Harbin Institute of Technology.

2.4. Experimental protocol After 7 days acclimatization, all mice were weighed and randomly divided into 13 groups (6 mice for each group) as shown in Fig. 1: (A) Control group: mice were treated with saline intragastrically for 3 weeks. (B) CCl4 groups B1 (CCl4 groups-Model): mice were treated with saline intragastrically for 3 weeks and injected with 0.5% CCl4/olive oil mixture (0.1 mL/10 g body weight, BW) 6 h after the last administration [7]. B2 (CCl4 groups-PNP80b-2-L): mice were treated with 200 mg/kg BW of PNP80b-2 intragastrically for 3 weeks and injected with CCl4 mixture as B1. B3 (CCl4 groups-PNP80b-2-H): mice were treated with 400 mg/kg BW of PNP80b-2 intragastrically for 3 weeks and injected with CCl4 mixture as B1. B4 (CCl4 groups-Positive): mice were treated with 25 mg/kg BW of bifendate intragastrically for 3 weeks and injected with CCl4 mixture as B1 [19]. (C) Alcohol groups C1 (Alcohol groups-Model): mice were treated with saline for 3 weeks and 12 mL/kg BW alcohol solution (56%, v/v) intragastrically 6 h after the last administration [22]. C2 (Alcohol groups-PNP80b-2-L): mice were treated with 200 mg/kg BW of PNP80b-2 for 3 weeks and alcohol solution intragastrically as C1. C3 (Alcohol groups-PNP80b-2-H): mice were treated with 400 mg/kg BW of PNP80b-2 for 3 weeks and alcohol solution intragastrically as C1. C4 (Alcohol groups-Positive): mice were treated with 150 mg/kg BW of bifendate for 3 weeks and alcohol solution intragastrically as C1 [23]. (D) APAP groups D1 (APAP groups-Model): mice were treated with saline for 3 weeks and 400 mg/kg BW APAP saline solution orally 6 h after the last administration [24]. D2 (APAP groups-PNP80b-2-L): mice were treated with 200 mg/kg BW of PNP80b-2 for 3 weeks and APAP solution orally as D1. D3 (APAP groups-PNP80b-2-H): mice were treated with 400 mg/kg BW of PNP80b-2 for 3 weeks and APAP solution orally as D1. D4 (APAP groups-Positive): mice were treated with 100 mg/kg BW of bifendate for 3 weeks and APAP solution orally as D1. The concentrations of PNP80b-2 were selected based on the preexperiment results (data not shown). All the mice were fasted, but allowed to drink after the last administration of PNP80b-2. And 12 h after the injury treatments, blood samples were collected from orbit and mice were sacrificed by cervical dislocation. The serum was harvested by centrifugation at 3000g for 10 min at 4 °C and stored at −80 °C for future assay. Similarly, the excised liver samples were immediately immersed into liquid nitrogen and then stored at −80 °C [25].

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

3

Fig. 1. Experimental protocol.

2.5. Organ index determination

2.9. Inflammatory cytokines determination

Each mouse BW was recorded every three days during the experiment period. The weights of mice organs including liver, spleen and thymus were determined immediately after sacrifice. Organ index was expressed as a percentage of body weight.

The levels of TNF-α, IL-1β, IL-6 and COX-2 in mice livers were determined using corresponding Elisa kits following the manufacturer's instructions to reflect the inflammation responses influenced by hepatotoxins.

2.6. Histopathology analysis

2.10. mRNA assay of CYP2E1, NRF2, HO-1, TNF-α, IL-1β and IL-6

Liver samples were sequentially fixed in 4% paraformaldehyde, embedded in paraffin and cut into 4 μm-thick slices. Then, the slices were stained with Hematoxylin and Eosin (H&E) and observed under a light microscope (magnification ×400) to evaluate the histopathological changes in mice livers.

Mice liver samples were collected for total RNA extraction according to the instruction of MiniBEST Universal RNA Extraction Kit. The obtained RNA was reversely transcribed into cDNA using the PrimeScript RT reagent Kit with gDNA Eraser. PCR was conducted using a CFX96TM real-time PCR system (Bio-Rad, California, USA). The primers were synthesized by The Beijing Genomics Institute and the sequences were listed in Table 1.

2.7. Serum biomarkers determination The activities of ALT, AST and ALP, and the content of TBIL in serum were determined using the corresponding commercial kits according to the instructions strictly.

2.8. Antioxidant capacity assay

2.11. Statistical analysis All the data in this study were expressed in the means and standard deviations. Statistical analysis was evaluated using one-way analysis of variance (ANOVA) by Duncan's test with SPSS. P b 0.05 and P b 0.01 were considered statistically significant.

Fresh liver samples were homogenized (1:9, w/v) in 0.9% saline in an ice-water bath, and then centrifuged at 2500g for 10 min at 4 °C to obtain liver homogenate for detecting liver protein content and hepatic SOD, GSH-Px, MDA and CAT levels. t1:1 t1:2

Table 1 Primer sequences for RT-PCR.

t1:3

Genes

Primer sequences (5′-3′)

t1:4 t1:5 t1:6 t1:7 t1:8 t1:9

CYP2E1 NRF2 HO-1 TNF-α IL-1β IL-6

FORWARD FORWARD FORWARD FORWARD FORWARD FORWARD

TCACCGTTGCCTTGCTTGTCTG AGCCAGCTGACCTCCTTAGA TGACACCTGAGGTCAAGCAC ATGGCCTCCCTCTCATCAGT AACCTTTGACCTGGGCTGTC CAGTACAGCCGGGAAGACAA

REVERSE REVERSE REVERSE REVERSE REVERSE REVERSE

CAGCCTTGTAGCCATGCAGGAC AGTGACTGACTGATGGCAGC ATCTTGCACCAGGCTAGCAG ATAGCAAATCGGCTGACGGT AAGGTCCACGGGAAAGACAC AGGCTTGGCAACCCAAGTAA

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

4 t2:1 t2:2

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

Table 2 Effects of PNP80b-2 on body weight and organ index.

t2:3

Groups

Initial BW (g)

Final BW (g)

Weight gain (g)

Liver index (%)

Spleen index (%)

Thymus index (%)

t2:4 t2:5 t2:6 t2:7 t2:8 t2:9 t2:10 t2:11 t2:12 t2:13 t2:14 t2:15 t2:16

A (Control group) B (CILI) B1 B2 B3 B4 C (AILI) C1 C2 C3 C4 D (DILI) D1 D2 D3 D4

25.77 ± 0.54 26.85 ± 0.63 27.65 ± 0.41 27.68 ± 0.49 26.56 ± 0.69 26.01 ± 0.32 27.57 ± 0.57 27.61 ± 0.67 26.78 ± 0.22 25.90 ± 0.38 27.50 ± 0.29 27.54 ± 0.50 26.45 ± 0.27

36.51 ± 1.49 33.19 ± 3.36 37.01 ± 3.98 37.30 ± 2.19 36.09 ± 2.88 35.59 ± 3.27 37.66 ± 3.66 37.63 ± 1.97 36.04 ± 1.54 34.18 ± 1.29 35.54 ± 2.09 36.00 ± 2.86 36.06 ± 3.74

9.77 ± 3.34 7.91 ± 3.11 8.72 ± 3.84 9.06 ± 2.55 9.08 ± 2.81 8.82 ± 3.59 9.38 ± 3.76 9.45 ± 2.54 8.82 ± 1.86 8.15 ± 1.17 8.04 ± 1.72 8.51 ± 2.38 9.65 ± 3.06

4.21 ± 0.14 4.72 ± 0.44 4.63 ± 0.29 4.55 ± 0.18 4.89 ± 0.25 5.36 ± 0.05⁎ 4.94 ± 0.38 4.51 ± 0.22 4.82 ± 0.10 4.49 ± 0.08 4.44 ± 0.16 4.40 ± 0.24 4.60 ± 0.38

0.34 ± 0.02 0.39 ± 0.01 0.37 ± 0.02 0.34 ± 0.03 0.37 ± 0.01 0.37 ± 0.02 0.35 ± 0.01 0.35 ± 0.02 0.39 ± 0.03 0.40 ± 0.02⁎ 0.31 ± 0.03 0.33 ± 0.04 0.34 ± 0.03

0.43 ± 0.01 0.26 ± 0.02⁎⁎ 0.29 ± 0.01⁎⁎ 0.34 ± 0.03⁎⁎ 0.31 ± 0.02⁎⁎ 0.26 ± 0.01⁎⁎ 0.31 ± 0.02⁎⁎ 0.35 ± 0.01⁎⁎ 0.30 ± 0.04⁎⁎ 0.29 ± 0.03⁎⁎ 0.30 ± 0.02⁎⁎ 0.34 ± 0.01⁎⁎ 0.29 ± 0.01⁎⁎

t2:17

*P b 0.05 and **P b 0.01 compared with control group A.

reduced significantly (P b 0.01), which suggested that liver injury caused by different stimuli changed the immune system of mice.

3. Results 3.1. Effects of PNP80b-2 on body weight and organ indexes

3.2. Effects of PNP80b-2 on liver histopathology During the 3-week experiment, all mice BWs increased and no adverse effects were observed, indicating that PNP80b-2 was nontoxic for mice. As shown in Table 2, there was no significant difference in initial BWs and final BWs among all the groups. However, the organ indexes of mice changed differently after liver injury treatments. The mice liver index can effectively reflect the nutritional status and pathological changes of the liver, thereby presenting the severity of liver injury [7]. It was clear that the liver index in the alcohol-model group (C1) was increased markedly (P b 0.05). Although the liver indexes in CCl4-model group (B1) and APAP-model group (D1) showed no statistical difference, they were apparently elevated compared to the control group (A) (Table 2). By contrast, the liver indexes of mice treated with PNP80b-2 were decreased and not significantly different from the normal level in each model (P N 0.05), suggesting its potential hepatoprotective effects. In addition, the spleen and thymus indexes were also measured to help evaluate the alteration of mice immunity in liver injury [26]. Obviously, the spleen indexes of all the mice were not greatly changed except that in APAP-model group (D1). However, compared to the control group, the mice thymus indexes in each model were

Liver histopathological changes of mice in each group were shown in Fig. 2. The normal hepatocyte had clear nucleus and distinct cell boundaries, and the hepatic cords were arranged in order (Fig. 2A). However, CCl4, alcohol and APAP treatments caused pathological changes. The liver tissues exhibited extensive vacuolated cytoplasm, inflammatory infiltration and necrosis (Fig. 2B1, C1 and D1), suggesting that the three in vivo liver injury models were well-established. Compared with the model groups, low and high doses of PNP80b-2 administration effectively reduced inflammatory cells and prevented livers from severe histopathological changes, with hepatocyte basically arranged regularly (Fig. 2). These results showed that PNP80b-2 had potential to alleviate CILI, AILI and DILI. 3.3. Effects of PNP80b-2 on serum biomarkers To evaluate and compare the effects of PNP80b-2 on different types of liver injury, serum ALT, AST, ALP and TBIL levels were determined [27]. As shown in Fig. 3A, CCl4, alcohol and APAP administration significantly elevated serum ALT levels, which were increased up to 434.23%,

Fig. 2. H&E staining of histological changes in mice livers. (Magnification ×400).

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

261.34% and 203.39% of control group, respectively (P b 0.01). In each model, PNP80b-2 treatment reduced the sharply increased ALT levels in dose-dependent manner. High-dose PNP80b-2 markedly decrease ALT activities from 101.51 ± 6.04 to 72.52 ± 3.17 U/L in CILI model (P b 0.01), from 61.09 ± 6.04 to 29.22 ± 2.50 U/L in AILI model (P b 0.01) and from 47.55 ± 4.48 to 32.88 ± 3.08 U/L in DILI model (P b 0.01). Fig. 3B demonstrated the effects of PNP80b-2 on serum AST levels and the results were similar to ALT. According to the results of ALT and AST activities, it could be easily found that PNP80b-2 exhibited stronger hepatoprotective effects against AILI than CILI and DILI. In general, mice serum ALP mostly derives from the liver and bone, maintaining at a stable level. Once liver injury occurs, accumulated liver ALP will be released to blood, resulting in a sharply increased level of serum ALP [28]. According to Fig. 3C, PNP80b-2 evidently suppressed the elevated serum ALP activities induced by CCl4, alcohol and APAP. In CILI model, high-dose PNP80b-2 reduced the ALP level from 248.65 ± 22.07 to 172.24 ± 11.52 U/L (P b 0.01). In AILI model, the ALP level dropped from 196.77 ± 9.29 to 124.73 ± 10.61 U/L by PNP80b-2 (P b 0.01) and in DILI model, the ALP level of mice pretreated with PNP80b-2 were markedly declined from 154.97 ± 15.24 to 117.02 ± 10.86 U/L (P b 0.01). Similarly, liver injury also blocked the normal metabolism of bilirubin, causing accumulation of TBIL [29]. The effects of PNP80b-2 on TBIL levels were demonstrated in Fig. 3D. Obviously, PNP80b-2 reduced TBIL contents in CILI and AILI models more effectively than in APAP model. In CILI model, the level of TBIL was decreased from 53.02 ± 5.60 to 31.05 ± 4.11 μmol/L (P b 0.01) and in AILI model, the content dropped from 33.02 ± 4.68 to 21.37 ± 3.62 μmol/L in mice subjected to high-dose PNP80b-2 (P b 0.01), with the TBIL inhibitory rates were 41.44% and 35.28%, respectively. However, the inhibitory rate in DILI model was only 9.40%, which implied that PNP80b-2 probably failed to effectively protect mice from APAP-induced TBIL accumulation.

5

However, pretreatment with high-dose PNP80b-2 evidently reduced the TNF-α level from 233.13 ± 12.98 to 162.03 ± 14.52 pg/mL (P b 0.01) in CILI model, from 339.60 ± 15.22 to 172.32 ± 11.46 pg/mL (P b 0.01) in AILI model and from 302.96 ± 10.86 to 203.59 ± 9.88 pg/mL (P b 0.01) in DILI model. More TNF-α production will stimulate the secretions of IL-1β and IL6, intensifying the tissue damage [33]. Based on Fig. 5(D–F) and Fig. 5 (G–I), the production of IL-1β (and IL-6) were significantly boosted by

3.4. Effects of PNP80b-2 on hepatic antioxidant capacity It is well known that oxidative stress is the main response of most chemical-induced liver injury. Excessive free radicals can impair the antioxidant capacity of liver cells and thus exacerbate liver damage [12,30]. In order to reveal the effects of PNP80b-2 on liver antioxidant capacity, the hepatic SOD, GSH-Px and CAT activities were determined. As shown in Fig. 4, in each model group, the activities of SOD, GSH-Px and CAT were all decreased markedly (P b 0.05), which indicated that CCl4, alcohol or APAP administration seriously reduced liver antioxidant capacity which was considered to be the first line to defense against oxidative stress. Nevertheless, PNP80b-2 increased the levels of liver antioxidant enzymes in a dose-dependent manner. In addition, the contents of MDA, the lipid peroxidation marker, were also determined. Based on Fig. 4(J–L), PNP80b-2 effectively protected mice from CCl4- and alcoholinduced MDA increase (P b 0.01), but not APAP-induced (P N 0.05). This finding was consistent with the results of serum biomarkers and antioxidant enzymes. Based on these results, PNP80b-2 exhibited significantly hepatoprotective activities against CILI and AILI partly through enhancing hepatic antioxidant capacity. 3.5. Effects of PNP80b-2 on inflammatory cytokines Inflammation is considered as common response to infection or injury [31], which could be indirectly certified by the alterations of spleen and thymus indexes mentioned above. Uncontrolled release of inflammatory factors will deteriorate liver injury [32]. To investigate the effects of PNP80b-2 on inflammation response in liver injury, we tested the levels of serum cytokines including TNF-α, IL-1β, IL-6 and liver COX-2. As shown in Fig. 5(A–C), the levels of TNF-α were drastically increased in each model group (P b 0.01). The accumulated TNF-α could promote neutrophil migration, produce excessive proteolytic enzymes and ROS production, thereby causing or aggravating liver damage [7].

Fig. 3. Effects of PNP80b-2 on serum biomarkers of mice: (A) Serum ALT levels; (B) Serum AST levels; (C) Serum ALP levels; (D) Serum TBIL levels. Data were presented as mean ± standard deviation (n = 6). ⁎P b 0.05 and ⁎⁎P b 0.01 compared with control group A. #P b 0.05 and ##P b 0.01 compared with control CCl4-model group B1. &P b 0.05 and &&P b 0.01 compared with control ethanol-model group C1. $P b 0.05 and $$P b 0.01 compared with control APAP-model group D1.

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

6

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

Fig. 4. Effects of PNP80b-2 on antioxidant capacity: (A, B and C) Hepatic SOD levels; (D, E and F) Hepatic GSH-Px levels; (G, H and I) Hepatic CAT levels; (J, K and L) Hepatic MDA levels. Data were presented as mean ± standard deviation (n = 6). ⁎P b 0.05 and ⁎⁎P b 0.01 compared with control group A. #P b 0.05 and ##P b 0.01 compared with control CCl4-model group B1. &P b 0.05 and &&P b 0.01 compared with control ethanol-model group C1. $P b 0.05 and $$P b 0.01 compared with control APAP-model group D1.

Fig. 5. Effects of PNP80b-2 on inflammatory cytokines: (A, B and C) Serum TNF-α levels; (D, E and F) Serum IL-1β levels; (G, H and I) Serum IL-6 levels; (J, K and L) Hepatic COX-2 levels. Data were presented as mean ± standard deviation (n = 6). ⁎P b 0.05 and ⁎⁎P b 0.01 compared with control group A. #P b 0.05 and ##P b 0.01 compared with control CCl4-model group B1. & P b 0.05 and &&P b 0.01 compared with control ethanol-model group C1. $P b 0.05 and $$P b 0.01 compared with control APAP-model group D1.

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

7

8

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

CCl4, alcohol or APAP treatment (P b 0.01), which were as high as 5.44 (and 5.50), 6.25 (and 4.04) and 4.76 (and 3.38) folds of the control, respectively. However, PNP80b-2 suppressed the secretions of IL-1β and IL-6 in dose-dependent manner (P b 0.01) in all the three models. In addition, COX, as a rate-limiting enzyme, plays an important part in regulating physiological responses and inflammation [34]. COX-2 has been reported to be associated with chemical induced liver injury [35]. According to Fig. 5(J–L), CCl4, alcohol or APAP treatment significantly promoted the production of COX-2 (P b 0.01), and PNP80b-2 effectively reversed the trend, with the inhibitory rates of 25.07% in CILI (P b 0.01), 33.94% in AILI (P b 0.01) and 20.95% in DILI (P b 0.01). Considering all the results, the hepatoprotective effect of PNP80b-2 is likely to be closely related to the regulation of inflammatory cytokines.

3.6. Effects of PNP80b-2 on mRNA expression of CYP2E1, NRF2, HO-1, TNFα, IL-1and IL-6 To further evaluate the hepatoprotective effects of PNP80b-2 against CILI, AILI and DILI, the mRNA expression of CYP2E1, NRF2, HO-1, TNF-α, IL-1β and IL-6 in each model was investigated and the results were shown in Fig. 6. As presented in Fig. 6A, CCl4 markedly upregulated the expression of CYP2E1 to 4.35 ± 0.30 fold of control (P b 0.01), suggesting the severe damage in liver tissues. Compared to the CCl4-model group, low- and high-dose PNP80b-2 suppressed CYP2E1 expression by 22.99% and 36.09% (P b 0.01), respectively, which were still statistically different from the normal level. The expression of genes NRF2 and HO-1 related to oxidative stress was also studied. Obviously, both doses of PNP80b2 promoted the downregulated expression of NRF2 and HO-1 to normal level, indicating that PNP80b-2 protected mice from CILI mainly through improving the hepatic antioxidant capacity. Additionally, the mRNA expression of TNF-α, IL-1β and IL-6 was basically consistent with the trend of previous Elisa results. PNP80b-2 effectively suppressed the mRNA expression of pro-inflammatory cytokines (P b 0.01), but still significantly different from the control group at the genetic level. Fig. 6B showed the effects of PNP80b-2 on mRNA expression of related molecules in AILI. Similarly, alcohol caused an increase in CYP2E1, TNF-α, IL-1β and IL-6 expression (P b 0.01) and a decrease in NRF2 and HO-1 expression (P b 0.01). In AILI model, high-dose PNP80b-2 suppressed the expression of CYP2E1 by 41.25% (P b 0.01) and evidently downregulated the expression of TNF-α, IL-1β and IL-6 genes related to the inflammation by 49.33%, 53.70% and 45.00%, respectively (P b 0.01). It is worth noting that the expression of IL-1β in the high-dose PNP80b-2 group was close to that in control group (P N 0.05). Moreover, the expression of NRF2 and HO-1 in PNP80b-2treated groups were not significantly different from the normal level (P N 0.05). These results indicated that PNP80b-2 exhibited good hepatoprotective activity against AILI with increasing antioxidant capacity and suppressing inflammation. However, the effects of PNP80b-2 on DILI model were not so positive according to Fig. 6C. Low and high doses of PNP80b-2 suppressed the expression of CYP2E1 by only 14.44% and 22.22%, respectively, which were lower than those in CILI and AILI models. The expression of NRF2 and HO-1 was not markedly upregulated by PNP80b-2 (P N 0.05). Although the inflammation related genes expression showed downregulated trend by PNP80b-2 treatment, but still significantly higher than the normal level.

4. Discussion Liver disease is prevalent worldwide and the global burdens of both acute and chronic liver disorder are increasing [2]. Thus, in order to reduce the incidence of liver diseases, liver injury prevention is one of the effective measures. Recently, many plant-derived polysaccharides have been reported to exert protective effects against liver injury induced by CCl4 [36], alcohol [22], drug [20] and other hepatic toxicants [27,37]. We obtained a polysaccharide PNP80b-2 from pine nuts and found its hepatoprotective activity in vitro. In this work, the effects of PNP80b-2 on three classical types of liver injury, including CILI, AILI and DILI, were studied to comprehensively evaluate its hepatoprotection and reveal which type it works best. Based on this, an in-depth study will be conducted on the mechanism underpinning the hepatoprotection of PNP80b-2 against the optimal liver injury model in future. Numerous studies have confirmed that most liver injury is closely related to oxidative stress. Under normal circumstance, the level of oxidative stress is controlled, maintaining a balance between oxidant and antioxidant. Once the chemical is metabolized in liver, excessive free radicals, such as CCl3·, CCl3OO· and ·OH, are produced in the mitochondria and in the endoplasmic reticulum of hepatocytes via the cytochrome P450 enzymes, which can cause structural and functional abnormalities in liver [38]. SOD, GSH-Px and CAT, as classical antioxidant enzymes, are mainly regulated by NRF2/ARE pathway. As a cellular redox status sensor, NRF2 mostly is bound to Kelch-like ECH-associated protein1 (KEAP1) in the hepatic cytoplasm under normal conditions. Increased free radicals can cause NRF2 to release from KEAP1 and transfer to nucleus. The free NRF2 will promote the transcription of cytoprotective genes by activating the antioxidant response element (ARE) as a protective mechanism [39]. Based on this, regulating oxidative stress and enhancing antioxidant capacity of hepatocytes provide the potential to prevent or alleviate liver damage. Furthermore, systemic inflammatory response syndrome (SIRS) has an important relationship with the pathogenesis and progression of different types of liver injury. Exogenous hepatic toxicant intake can activate inflammatory response, thereby releasing inflammatory cytokines such as TNF-α, IL-1β and IL-6 and leading to inflammatory cascade [31,40]. Undoubtedly, the excessive production of proinflammatory cytokines will aggravate the damage of liver tissues. TNF-α can increase vascular endothelial cell permeability by activating lymphocytes and neureophils, and promote the secretion of proinflammatory factors IL-1β and IL-6, which can deteriorate the severity of liver injury [41]. Therefore, suppression of inflammatory response and regulation of cytokines can also be considered as a feasible way to protect mice from severe chemical-induced liver injury. In CILI model, the sharp increases of serum ALT, AST, ALP and TBIL are valid evidences of liver injury, which is also verified by the tissue HE staining results. Apparently, CILI was more serious than AILI and DILI, with the most leakage of ALT and AST, but PNP80b-2 significantly reduced the activities of ALT, AST, ALP and the content of TBIL in mice serum, manifesting its hepatoprotective effects against CCl4-induced liver injury. Reduced antioxidant enzymes activities and downregulated NRF2 and HO-1 expression were also markedly reversed by PNP80b-2. The enhanced antioxidant capacity of hepatocytes helped defense the attack of excessive free radicals. Furthermore, PNP80b-2 effectively suppressed the sharp increases in TNF-α, IL-1β and IL-6 both in protein and genetic level, suggesting that PNP80b-2 regulated the inflammation response in CILI model. These results were similar to what Wang et al [7], Meng et al [9] and Cao et al [42] reported. Therefore, PNP80b-2 exhibited hepatoprotective effects against CCl4-induced liver injury probably through enhancing antioxidant capacity via NRF2/ARE pathway and inhibiting the uncontrolled inflammation response.

Fig. 6. Effects of PNP80b-2 on the mRNA expression of CYP2E1, NRF2, HO-1, TNF-α, IL-1and IL-6: (A) CILI; (B) AILI and (C) DILI. Data were presented as mean ± standard deviation (n = 6). ⁎P b 0.05 and ⁎⁎P b 0.01 compared with control group A. #P b 0.05 and ##P b 0.01 compared with control CCl4-model group B1. &P b 0.05 and &&P b 0.01 compared with control ethanolmodel group C1. $P b 0.05 and $$P b 0.01 compared with control APAP-model group D1.

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx

9

Fig. 7. Working model of CYP2E1-dependent oxidative stress and toxicity in alcohol-induced liver injury model [12].

Similarly, in AILI model, excessive alcohol intake induced liver injury with increasing serum ALT, AST, ALP and TBIL, and upregulated CYP2E1 expression. Liver, as the main organ for metabolism, is responsible for approximately 90% of alcohol metabolism [43]. More evidences have indicated that oxidative stress is the major cause of AILI pathogenesis. In fact, there are two main pathways involved in the metabolism of alcohol, namely alcohol dehydrogenase oxidation system (ADHOS) and microsome alcohol oxidation system (MAOS). CYP2E1 is a key component of MAOS and is also considered as a contributor to oxidative stress and liver injury induced by alcohol as shown in Fig. 7 [12,44]. The toxicity of alcohol is enhanced after induction of CYP2E1 and the poor couple with NAPDH-cytochrome P450 reeducates leads to a high NADPH oxidase activity [12]. In our work, PNP80b-2 markedly downregulated the expression of CYP2E1, upregulated NRF2 expression and elevated the hepatic antioxidant activities in alcohol-fed mice, suggesting its protective effect against AILI. Meanwhile, excessive alcohol activated inflammation responses as well, overproducing inflammatory factors TNF-α, IL-1β, IL-6 and COX-2, which would accelerate the secretions of down-stream relevant factors for contributing to the pathogenesis of liver inflammation [45]. However, PNP80b-2 treatment effectively reduced the levels of TNF-α, IL-1β, IL-6 and COX-2, which was a crucial reason for PNP80b-2 to exert hepatoprotective activity. Generally, regular dose of APAP is safe for therapy. But overdose APAP can induce hepatotoxicity, causing DILI or even liver failure. APAP is absorbed by the duodenum and then enters into liver for metabolism after oral administration. Most APAP is catalyzed by hepatic UDP-glucuronosyltranssferases and sulfotransferase at phase II, converted to non-toxic glucuronide and sulfate metabolites, which could be excreted in the urine [16]. The remaining small amount of APAP will be catalyzed by CYP2E1 to form toxic NAPQI at phase I. However, when APAP is overdose, the excessive APAP has to be catalyzed at phase I because phase II is saturated, implying that the production of NAPQI is sharply increased, depleting GSH and causing excessive ROS, finally leading to liver injury [46]. Apparently, PNP80b-2 pretreatment elevated the activities of antioxidant enzymes and the expression of NRF2, but not significantly. On the other hand, APAP-induced liver injury was also related to inflammation because the damaged or apoptotic hepatocytes can activate the secondary neutrophilic inflammatory response, which has been confirmed as a danger to further aggravate

the existing liver damage [47]. According to our research, PNP80b-2 suppressed the production of pro-inflammatory cytokines, but the levels were still significantly higher than the normal levels. Comprehensively considering all the results, PNP80b-2 showed the weakest protective effects on APAP-induced liver injury, with the lowest antioxidant capacity increase rate and cytokine inhibitory rate. The good hepatoprotective effect against CCl4- induced liver injury was mostly attributed to the improvement of liver antioxidant system. By contrast, PNP80b-2 performed the strongest hepatoprotective activity against AILI mainly through enhancing hepatic antioxidant capacity via NRF2/ARE pathway and regulating inflammation response by inhibiting the expression of pro-inflammatory cytokines. 5. Conclusion In conclusion, pine nut polysaccharide PNP80b-2 protects mice from CCl4-, alcohol- and APAP-induced liver injury. By comparison, PNP80b-2 performs the strongest hepatoprotective activity against alcoholinduced liver damage through enhancing hepatic antioxidant capacity via NRF2/ARE pathway and regulating inflammation responses. Declaration of competing interest All authors declare no conflict of interest. Acknowledgements This work is financially supported by the National Key Research and Development Program of China [Grant number 2016YFC0500305-02] and is gratefully acknowledged. References [1] B. Sun, M. Karin, NF-κB signaling, liver disease and hepatoprotective agents, Oncogene 27 (2008) 6228. [2] S.K. Asrani, H. Devarbhavi, J. Eaton, P.S. Kamath, Burden of liver diseases in the world, J. Hepatol. 70 (1) (2019) 151–171. [3] A.H. Mokdad, M.H. Forouzanfar, F. Daoud, A.A. Mokdad, C. El Bcheraoui, M. MoradiLakeh, H.H. Kyu, R.M. Barber, J. Wagner, K. Cercy, H. Kravitz, M. Coggeshall, A. Chew, K.F. O'Rourke, C. Steiner, M. Tuffaha, R. Charara, E.A. Al-Ghamdi, Y. Adi, R.A. Afifi, H. Alahmadi, F. AlBuhairan, N. Allen, M. AlMazroa, A.A. Al-Nehmi, Z. AlRayess, M. Arora,

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069

10

[4]

[5]

[6]

[7]

[8]

[9]

[10] [11] [12] [13]

[14] [15] [16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

H. Qu et al. / International Journal of Biological Macromolecules xxx (xxxx) xxx P. Azzopardi, C. Barroso, M. Basulaiman, Z.A. Bhutta, C. Bonell, C. Breinbauer, L. Degenhardt, D. Denno, J. Fang, A. Fatusi, A.B. Feigl, R. Kakuma, N. Karam, E. Kennedy, T.K.A.M. Khoja, F. Maalouf, C.M. Obermeyer, A. Mattoo, T. McGovern, Z.A. Memish, G.A. Mensah, V. Patel, S. Petroni, N. Reavley, D.R. Zertuche, M. Saeedi, J. Santelli, S.M. Sawyer, F. Ssewamala, K. Taiwo, M. Tantawy, R.M. Viner, J. Waldfogel, M.P. Zuniga, M. Naghavi, H. Wang, T. Vos, A.D. Lopez, A.A. Al Rabeeah, G.C. Patton, C.J.L. Murray, Global burden of diseases, injuries, and risk factors for young people's health during 1990–2013: a systematic analysis for the Global Burden of Disease Study 2013, Lancet 387 (10036) (2016) 2383–2401. J.D. Riordan, C.R. Feddersen, B.R. Tschida, P.J. Beckmann, V.W. Keng, M.A. Linden, K. Amin, C.S. Stipp, D.A. Largaespada, A.J. Dupuy, Chronic liver injury alters driver mutation profiles in hepatocellular carcinoma in mice, Hepatology 67 (3) (2018) 924–939. X. Meng, Y. Li, S. Li, R.-Y. Gan, H.-B. Li, Natural products for prevention and treatment of chemical-induced liver injuries, Compr. Rev. Food Sci. Food Saf. 17 (2) (2018) 472–495. X. Yang, S. Yang, Y. Guo, Y. Jiao, Y. Zhao, Compositional characterisation of soluble apple polysaccharides, and their antioxidant and hepatoprotective effects on acute CCl4-caused liver damage in mice, Food Chem. 138 (2–3) (2013) 1256–1264. W. Wang, L. Jiang, Y. Ren, M. Shen, J. Xie, Characterizations and hepatoprotective effect of polysaccharides from Mesona blumes against tetrachloride-induced acute liver injury in mice, Int. J. Biol. Macromol. 124 (2019) 788–795. J. Liu, Y. Fu, H. Zhang, J. Wang, J. Zhu, Y. Wang, Y. Guo, G. Wang, T. Xu, M. Chu, F. Wang, The hepatoprotective effect of the probiotic Clostridium butyricum against carbon tetrachloride-induced acute liver damage in mice, Food Funct. 8 (11) (2017) 4042–4052. X. Meng, Z. Wang, S. Liang, Z. Tang, J. Liu, Y. Xin, H. Kuang, Q. Wang, Hepatoprotective effect of a polysaccharide from Radix Cyathulae officinalis Kuan against CCl4induced acute liver injury in rat, Int. J. Biol. Macromol. 132 (2019) 1057–1067. A. George, Global status report on alcohol 2004, Canadian Journal of Public HealthRevue Canadienne De Sante Publique 97 (5) (2006) 408–+. K. Li, L. Wang, R. Zhou, H. Fan, J. Sui, Amelioration of alcohol-induced liver injury in mice by ginsenosides in ginseng wine, J. Funct. Foods 54 (2019) 281–288. A. Dey, A.I. Cederbaum, Alcohol and oxidative liver injury, Hepatology 43 (2) (2006) S63–S74. H. Zhao, H. Li, Q. Lai, Q. Yang, Y. Dong, X. Liu, W. Wang, J. Zhang, L. Jia, Antioxidant and hepatoprotective activities of modified polysaccharides from Coprinus comatus in mice with alcohol-induced liver injury, Int. J. Biol. Macromol. 127 (2019) 476–485. G.-Q. Wang, Y.-Q. Deng, F.-Q. Hou, Overview of drug-induced liver injury in China, Clinical Liver Disease 4 (1) (2014) 26–29. M.J. Hodgman, A.R. Garrard, A review of acetaminophen poisoning, Crit. Care Clin. 28 (4) (2012) 499. E. Yoon, A. Babar, M. Choudhary, M. Kutner, N. Pyrsopoulos, Acetaminopheninduced hepatotoxicity: a comprehensive update, Journal of Clinical and Translational Hepatology 4 (2) (2016) 131–142. S. Dong, J. Ji, L. Hu, H. Wang, Dihydromyricetin alleviates acetaminophen-induced liver injury via the regulation of transformation, lipid homeostasis, cell death and regeneration, Life Sci. 227 (2019) 20–29. J. Xie, W. Wang, C. Dong, L. Huang, H. Wang, C. Li, S. Nie, M. Xie, Protective effect of flavonoids from Cyclocarya paliurus leaves against carbon tetrachloride-induced acute liver injury in mice, Food Chem. Toxicol. 119 (2018) 392–399. X. Liu, H. Pang, Z. Gao, H. Zhao, J. Zhang, L. Jia, Antioxidant and hepatoprotective activities of residue polysaccharides by Check for Pleurotus citrinipileatus, Int. J. Biol. Macromol. 131 (2019) 315–322. K. Wu, J. Fan, X. Huang, X. Wu, C. Guo, Hepatoprotective effects exerted by Poria Cocos polysaccharides against acetaminophen-induced liver injury in mice, Int. J. Biol. Macromol. 114 (2018) 137–142. G. Asset, R.L. Wolff, E. Bauge, J.C. Fruchart, J. Dallongeville, 91 Δ5 olefinic acids extracted from pine tree seeds decrease serum triglyceride levels in rats, Atherosclerosis 130 (1997) S24. X. Liu, R. Hou, J. Yan, K. Xu, X. Wu, W. Lin, M. Zheng, J. Fu, Purification and characterization of Inonotus hispidus exopolysaccharide and its protective effect on acute alcoholic liver injury in mice, Int. J. Biol. Macromol. 129 (2019) 41–49. C. Wu, J. Liu, Y. Tang, Y. Li, Q. Yan, Z. Jiang, Hepatoprotective potential of partially hydrolyzed guar gum against acute alcohol-induced liver injury in vitro and vivo, Nutrients 11 (5) (2019). C. Pang, Z. Zheng, L. Shi, Y. Sheng, H. Wei, Z. Wang, L. Ji, Caffeic acid prevents acetaminophen-induced liver injury by activating the Keapl-Nrf2 antioxidative defense system, Free Radic. Biol. Med. 91 (2016) 236–246.

[25] W. Zhang, X. Zhang, K. Zou, J. Xie, S. Zhao, J. Liu, H. Liu, J. Wang, Y. Wang, Seabuckthorn Berry Polysaccharide Protects Against Carbon Tetrachloride-induced Hepatotoxicity in Mice: Via Anti-Oxidative and Anti-inflammatory Activities, 2017. [26] X. Gao, H. Qu, Z. Gao, D. Zeng, J. Wang, D. Baranenko, Y. Li, W. Lu, Protective effects of Ulva pertusa polysaccharide and polysaccharide iron (III) complex on cyclophosphamide induced immunosuppression in mice, Int. J. Biol. Macromol. 133 (2019) 911–919. [27] L. Xu, R. Sang, Y. Yu, J. Li, B. Ge, X. Zhang, The polysaccharide from Inonotus obliquus protects mice from Toxoplasma gondii-induced liver injury, Int. J. Biol. Macromol. 125 (2019) 1–8. [28] D.H. El-Kashef, A.R. El-Sheakh, Hepatoprotective effect of celecoxib against tamoxifen-induced liver injury via inhibiting ASK-1/JNK pathway in female rats, Life Sci. 231 (2019), 116573. [29] S. Shiomi, D. Habu, T. Kuroki, S. Ishida, N. Tatsumi, Clinical usefulness of conjugated bilirubin levels in patients with acute liver diseases, J. Gastroenterol. 34 (1) (1999) 88–93. [30] X. Li, L. Wang, Z. Wang, Structural characterization and antioxidant activity of polysaccharide from Hohenbuehelia serotina, Int. J. Biol. Macromol. 98 (2017) 59–66. [31] W. Zhang, X. Zhang, K. Zou, J. Xie, S. Zhao, J. Liu, H. Liu, J. Wang, Y. Wang, Seabuckthorn berry polysaccharide protects against carbon tetrachloride-induced hepatotoxicity in mice via anti-oxidative and anti-inflammatory activities, Food Funct. 8 (9) (2017) 3130–3138. [32] J.B. Hoek, J.G. Pastorino, Ethanol, oxidative stress, and cytokine-induced liver cell injury, Alcohol 27 (1) (2002) 63–68. [33] D. Porowski, A. Wirkowska, E. Hryniewiecka, J. Wyzgal, M. Pacholczyk, L. Paczek, Liver failure impairs the intrahepatic elimination of Interleukin-6, tumor necrosis factor-alpha, hepatocyte growth factor, and transforming growth factor-beta, Biomed. Res. Int. 2015 (2015) 1–7. [34] P. Martin-Sanz, M. Casado, L. Bosca, Cyclooxygenase 2 in liver dysfunction and carcinogenesis: facts and perspectives, World J. Gastroenterol. 23 (20) (2017) 3572–3580. [35] X. Liang, J. Zhang, F. Guo, L. Wei, Q. Zhou, Oxidative stress and inflammatory responses in the liver of swamp eel (Monopterus albus) exposed to carbon tetrachloride, Aquaculture 496 (2018) 232–238. [36] H. Qu, X. Gao, H.-T. Zhao, Z.-Y. Wang, J.-J. Yi, Structural characterization and in vitro hepatoprotective activity of polysaccharide from pine nut (Pinus koraiensis Sieb. et Zucc.), Carbohydr. Polym. 223 (2019), 115056. [37] G. Hou, M.M. Surhio, H. Ye, X. Gao, Z. Ye, J. Li, M. Ye, Protective effects of a Lachnum polysaccharide against liver and kidney injury induced by lead exposure in mice, Int. J. Biol. Macromol. 124 (2019) 716–723. [38] H. Cichoz-Lach, A. Michalak, Oxidative stress as a crucial factor in liver diseases, World J. Gastroenterol. 20 (25) (2014) 8082–8091. [39] L.M. Aleksunes, J.E. Manautou, Emerging role of Nrf2 in protecting against hepatic and gastrointestinal disease, Toxicol. Pathol. 35 (4) (2007) 459–473. [40] R.-B. Ding, K. Tian, L.-L. huang, C.-W. He, Y. Jiang, Y.-T. Wang, J.-B. Wan, Herbal medicines for the prevention of alcoholic liver disease: a review, J. Ethnopharmacol. 144 (3) (2012) 457–465. [41] L. Li, C. Duan, Y. Zhao, X. Zhang, H. Yin, T. Wang, C. Huang, S. Liu, S. Yang, X. Li, Preventive effects of interleukin-6 in lipopolysaccharide/d-galactosamine induced acute liver injury via regulating inflammatory response in hepatic macrophages, Int. Immunopharmacol. 51 (2017) 99–106. [42] J.-J. Cao, Q.-Q. Lv, B. Zhang, H.-Q. Chen, Structural characterization and hepatoprotective activities of polysaccharides from the leaves of Toona sinensis (A. Juss) Roem, Carbohydr. Polym. 212 (2019) 89–101. [43] P. Pronko, L. Bardina, V. Satanovskaya, A. Kuzmich, S. Zimatkin, Effect of chronic alcohol consumption on the ethanol- and acetaldehyde-metabolizing systems in the rat gastrointestinal tract, Alcohol Alcohol. 37 (3) (2002) 229–235. [44] A.I. Cederbaum, Alcohol metabolism, Clinics in Liver Disease 16 (4) (2012) 667–685. [45] S. Song, S. Li, N. Su, J. Li, F. Shi, M. Ye, Structural characterization, molecular modification and hepatoprotective effect of melanin from Lachnum YM226 on acute alcohol-induced liver injury in mice, Food Funct. 7 (8) (2016) 3617–3627. [46] C. Bunchorntavakul, K.R. Reddy, Acetaminophen-related hepatotoxicity, Clinics in Liver Disease 17 (4) (2013) 587–607. [47] C. Cover, J. Liu, A. Farhood, E. Malle, M.P. Waalkes, M.L. Bajt, H. Jaeschke, Pathophysiological role of the acute inflammatory response during acetaminophen hepatotoxicity, Toxicol. Appl. Pharmacol. 216 (1) (2006) 98–107.

Please cite this article as: H. Qu, X. Gao, Z.-Y. Wang, et al., Comparative study on hepatoprotection of pine nut (Pinus koraiensis Sieb. et Zucc.) polysaccharide ..., , https://doi.org/10.1016/j.ijbiomac.2019.11.069