- Email: [email protected]
Comparative Transcriptome Analysis of Actinidia arguta Fruits Reveals the Involvement of Various Transcription Factors in Ripening
ARTICLE IN PRESS
JID: HPJ
[mNS;February 28, 2018;21:25]
January 2018. Horticultural Plant Journal, 4 (xx): 36–44.
Horticultural Plant Journal Available online at www.sciencedirect.com The journal’s homepage: http://www.journals.elsevier.com/horticultural-plant-journal
Comparative Transcriptome Analysis of Actinidia arguta Fruits Reveals the Involvement of Various Transcription Factors in Ripening HUANG Guohui a,1, QU Yi b,1, LI Tong b, YUAN Hui b, WANG Aide b, and TAN Dongmei b,∗ a Department b College
of Horticulture, Eastern Liaoning University, Dandong, Liaoning 118003, China of Horticulture, Shenyang Agricultural University, Shenyang, Liaoning 110866, China
Received 7 May 2017; Received in revised form 29 August 2017; Accepted 25 December 2017 Available online xxx
A B S T R A C T The fruit of Actinidia arguta is typically climacteric. During ripening, the fruits produce a large amount of ethylene. Although the molecular basis of climacteric fruit ripening has been extensively studied, some aspects such as its transcriptional regulation remain unclear. Here, we compared the transcriptomes of A. arguta fruits collected at commercial harvest (sample d0) and at 6 days after harvest (sample d6) using RNA-seq. A total of 3 659 differentially expressed genes (DEGs) between samples d0 and d6 were detected, of which 2 983 and 1 104 could be functionally annotated with Gene Ontology (GO) and Clusters of Orthologous Groups (COG) pathways. DEGs involved in ethylene biosynthesis and signal transduction were identified, including ACO (c79627), ERF061 (c105131), and ERF6 (c99193). Transcription factors such as ERF, bHLH, NAC, MADS, and MYB were also differentially expressed between samples d0 and d6. Selected DEGs were subjected to further analysis using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), and the results coincided with those of RNA-seq. Our data revealed additional transcription factors that are involved in the regulation of fruit ripening. These results provide useful information for future research on the transcriptional regulation of fruit ripening. Keywords: Actinidia arguta; transcriptome; ripening; ethylene signaling; transcription factor
1. Introduction Actinidia arguta (hardy kiwifruit) is a perennial vine that originally grew in Japan, Korea, Northern China, and Russia (Lai et al., 2015). It produces small fruits that are similar to kiwifruit in taste and appearance, but with smooth green or purple skin. The plants of A. arguta exhibit strong cold hardiness and disease tolerance (Lai et al., 2015). Its fruit can be consumed in its entirety, including the skin. The fruits of A. arguta are typical climacteric fruits that undergo climacteric respiration during ripening, which involves bursts of ethylene without the need for stimulation by an external influence (Osorio et al., 2013) as ethylene itself acts as the
main regulator of ripening (Lelièvre et al., 1997; Giovannoni, 2004; Srivastava and Handa, 2005; Kevany et al., 2007; Osorio et al., 2013; Seymour et al., 2013; Ampa et al., 2017). Ethylene biosynthesis has been well documented; the most important enzymes involved in this process include 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and ACC oxidase (ACO) (Yang and Hoffman, 1984; Yang et al., 2016). The ethylene signal transduction pathway is a linear cascade that includes ethylene receptors, constitutive triple response 1 (CTR1), ethylene insensitive 2 and 3 (EIN2, EIN3), EIN3-like (EIL), and ethylene response factor (ERF) proteins, and ethyleneresponsive genes. The complexity of this particular pathway has
∗
Corresponding author. Tel.: +86 24 88487143 E-mail address: [email protected] 1 These authors contributed equally to this work. Peer review under responsibility of Chinese Society for Horticultural Science (CSHS) and Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS) https://doi.org/10.1016/j.hpj.2018.01.002 2468-0141/© 2018 Chinese Society for Horticultural Science (CSHS) and Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS). This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
37
Comparative transcriptome analysis of Actinidia arguta fruits... been extensively studied, and there is growing evidence suggesting the involvement of transcription regulation and other hormones (Adams-Phillips et al., 2004; Srivastava and Handa, 2005). Primarily, various transcription factors are reportedly involved in fruit ripening (Osorio et al., 2013). The transcriptional regulation of fruit ripening was elucidated by findings that a MADSbox transcription factor gene RIN (ripening inhibitor) controls the ripening of the tomato mutant rin (Vrebalov et al., 2002). The ethylene biosynthesis genes ACS and ACO are regulated by RIN (Martel et al., 2011). In apples, MdMADS9 is a transcriptional activator of MdACS1 during fruit ripening (Ireland et al., 2013). In tomatoes, SlAP2a acts as a negative regulator of fruit ripening (Chung et al., 2010). Another transcription factor widely reported to be involved in fruit ripening is ERF (Wang et al., 2007; Xiao et al., 2013; Li et al., 2015). The involvement of the NAC gene in fruit ripening has also been reported, where SlNAC4 acts as a positive regulator by affecting ethylene biosynthesis (Zhu et al., 2014). In addition, SlNAC1 overexpression in tomato results in early fruit softening (Ma et al., 2014). These results suggest that transcription factors play essential roles in regulating fruit ripening. However, the possible involvement of other transcription factors remains unclear. Although considerable knowledge has been gained from various genetic and epigenetic studies, the process of ripening of A. arguta fruits has not been investigated. In the present study, we compared the transcriptomes of A. arguta fruits before and after ripening and identified other transcription factors that are possibly involved in fruit ripening. The expression profiles of selected differentially expressed genes were confirmed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR).
2. Materials and methods
2.2. RNA extraction and deep sequencing Total RNA extraction was performed as described by Li et al. (2014). mRNA isolation and first- and second-strand cDNA synthesis were performed according to Huang et al. (2014). The purified cDNAs were subjected to end reparation and polyadenylation and then mixed with Solexa adapters. Suitable fragments were recovered from an agarose gel, PCR amplified, and then sequenced using an Illumina HiSeqTM 2500 system.
2.3. Bioinformatics analysis Sequence reads with adapters or low-quality bases were removed from the raw data to generate clean reads. The clean sequence reads were then used in de novo transcriptome assembly using Trinity software (Grabherr et al., 2011). Trinity combined reads with overlaps to form contigs, which were then clustered to generate unigenes. For gene annotation, the assembled unigenes were aligned to public protein databases using BLASTx (E value < 10−7 ), including the non-redundant (NR), Swiss-Prot, Gene Ontology (GO), and Clusters of Orthologous Groups (COG) databases. Differentially expressed genes (DEGs) were analyzed using Bowtie (Langmead et al., 2009). Expression levels were calculated according to the RSEM method (Li and Dewey, 2011). The fragments per kilobase of transcript per million mapped reads (FPKM) method was used to calculate the rate of DEGs (Trapnell et al., 2010), and the false discovery rate (FDR) was used to correct the P-value thresholds via multiple testing (Benjamini and Yekutieli, 2001), with a P value ≤ 0.05 and a foldchange (log2 FC) ≥ 2. The heat map for the DEGs involved in ethylene biosynthesis and the signaling pathway were constructed using Cluster 3.0 software. The raw data were deposited into NCBI Sequence Read Archive (SRA) as accession number SRP073020.
2.1. Plant materials Fruits of A. arguta were harvested from the experimental farm of Eastern Liaoning University (Dandong, Liaoning, China) when the total soluble solids (TSS) reached 6% on September 8, 2014. The fruits were stored at room temperature (24 °C) for 9 days and sampled every 3 days. Trees of A. arguta were 4 years. A total of 120 fruits were collected. At each sampling point, 10 fruits were collected for measurements. For measurement of ethylene production, 30 fruits were divided into 3 groups (10 fruits for each group), and each group of fruits was kept tightly in a gas-tight container (0.8 L) at 24 °C for 1 h, then ethylene was collected using 1 mL-syringe and was measured according to the method described by Li et al. (2014). Each group of fruits was used as one biological replicate, and three biological replicates were performed at each sampling point. Total soluble solids were measured from the fruit juice of each sample using a Brix tester (PAL-1, ATAGO, Tokyo, Japan). The flesh of 10 fruits was sliced, pooled, frozen in liquid N2 , and stored at −80 °C until RNA extraction. Fruits of A. arguta collected on the commercial harvest day (sample d0) and 6 days after storage at room temperature (sample d6) were used for RNA-seq. At each sampling time, two groups of fruit were collected as two biological replicates (d0-1 and d0-2 were the replicates for sample d0, and d6-1 and d6-2 were the replicates for sample d6) for RNA-seq. A total of four samples were sequenced.
2.4. qRT-PCR The total RNA (500 ng) extracted from A. arguta fruits was used in cDNA synthesis with an M-MLV RTase cDNA synthesis Kit (Cat# D6130, TaKaRa). The resulting cDNAs were then used as templates for qRT-PCR, which was conducted as described by Tan et al. (2013). Specific primers for each gene were designed using Primer3 (http://frodo.wi.mit.edu/) (Table 1). The actin gene (Yin et al., 2010) of kiwifruit (Actinidia deliciosa), which was constitutively expressed in this study, was used as internal reference. Three biological replicates were performed for each gene, calculating the mean and standard error (SE) for subsequent analyses.
3. Results 3.1. Total soluble solids and ethylene production of A. arguta fruits Total soluble solids and ethylene production of the A. arguta fruits were first measured during normal ripening. Total soluble solids continuously increased during the storage period (Fig. 1). Ethylene production increased after harvest and peaked at day 6 (Fig. 1). Therefore, we used fruit samples from the time of commercial harvest (sample d0) and after storage at room temperature for 6 days (sample d6) for RNA-seq analysis.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
ARTICLE IN PRESS
JID: HPJ
[mNS;February 28, 2018;21:25]
38
HUANG Guohui et al. Table 1 Primers used in this study
Gene name (ID)
Forward primer (5 –3 )
Reverse primer (5 –3 )
ACO (c79627) PG (c99110) ERF061 (c105131) ERF6 (c99193) bHLH91 (c104633) MYC (c98728) NAC72 (c105965) NAC29 (c80243) SOC1 (c88292) MYB-like (c97736) Actin
CAACTCGAGGTAATCACAAATGGA GACACAAGTTGCGGTTAAATTCAA CAGAGGTACGCAATGGAAGC GTCGACTCAGTTCGCTTATTACC CCACTGAGAGGCAAAGGAGA CCATGAAATCTACAACTATGGCGA ATCCTTTTGTTTTCGCGCCT GTAGTGCCATGATGACGCTG GCGAGGAGAGAAGACGATGA TGCTCCTCCAATCCCCTTTT TGCATGAGCGATCAAGTTTCAAG
TTTGCTCTTCTTTCTCTACCAGTG AACTTGAGGGCTTAACTAAACCAG GGTATCGGTGGTTCCTAGGG ACACTAAACGTCAACAGGAAATGA CCTTGAGCTCATCCACCGTT ACACCTTCTCTAACAGCAATCAAG CAGAGTGGAATCAGAGCCCA CAATGACCTCACAGCTGCTC ATTTGTGCCTCCTCTCCCAA TCATCATCGTCGAGCAAGGA TGTCCCATGTCTGGTTGATGACT
Fig. 1 Total soluble solids and ethylene production in A. arguta fruits during ripening Table 2 Statistics of the sequencing and assembly of A. arguta Sample
Number of clean reads
Number of bases
GC content/%
Number of mapped reads
Mapped ratio/%
d0-1 d0-2 d6-1 d6-2
25 401 263 26 492 353 20 505 140 19 773 439
5 130 569 049 5 298 029 498 4 141 631 631 4 176 733 872
48.01 48.28 47.58 47.52
20 285 635 21 391 656 16 387 596 15 731 295
79.86 80.75 79.92 79.56
Table 3 Statistics of the sequence assembly Length range/nt
Number of contigs (Percentage)
Number of transcripts (Percentage)
Number of unigenes (Percentage)
200–300 300–500 500–1 000 1 000–2 000 ≥2 000 Total number Total length/nt N50 length/nt Mean length/nt
7 477 848 (99.25%) 26 119 (0.35%) 15 785 (0.21%) 9 531 (0.13%) 4 770 (0.06%) 7 534 053 358 375 359 48 47.57
40 570 (23.97%) 31 410 (18.56%) 34 062 (20.13%) 38 711 (22.88%) 24 467 (14.46%) 169 220 174 248 502 1 715 1 029.72
32 035 (40.86%) 19 785 (25.23%) 12 536 (15.99%) 8 986 (11.46%) 5 066 (6.46%) 78 408 51 894 929 1 147 661.86
Note: N50 indicates that 50% of reads are longer than this value.
3.2. RNA-seq, de novo assembly, and annotation RNA-seq generated more than 92 million clean reads, each 100 nucleotides long (paired-end), for a total of 18.75 Gb of clean data. In each sample, the GC content was more than 47.52% (Table 2). The Trinity program was used to assemble the clean reads de novo. All of the high-quality clean reads were assembled into 78 408 unigenes for all samples, and at least 79.56% of the reads in each sample were mapped to the unigenes. The mean length of the assembled unigenes was 661.86 bp (Table 3, Fig. 2). To annotate the assembled unigenes, sequence similarity searches (E-value < 10−7 ) were performed against public databases, including NCBI NR, Swiss-Prot, GO, and COG. A total of 30 656 unigenes were successfully annotated in at least one database (Table 4).
Table 4 Number of unigenes functionally annotated in various public databases Database
Unigene
≥300 nt
≥1 000 nt
NR Swiss-Prot GO COG All
30 114 20 070 22 711 9 151 30 656
23 841 16 294 18 351 7 869 24 061
12 304 8 990 10 108 5 197 12 325
3.3. Identification of DEGs To identify genes involved in fruit ripening, we compared the transcripts in samples d0 and d6 using the DEseq program (Anders and Huber, 2010). The transcription level of each gene was estimated using the FPKM method. A total of 3 659 uni-
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
39
Comparative transcriptome analysis of Actinidia arguta fruits...
Fig. 2 Length distribution of unigenes
were mapped to the “binding” and “catalytic activity” groups. In the biological process category, the largest groups were “cellular processes” and “metabolic processes”. Of the 3 659 DEGs, 1 104 were annotated in the COG database. Most of the DEGs (27.3%) were included in the COG category “signal transduction mechanisms”, “transcription” and “replication, recombination and repair” (Fig. 5).
3.4. Identification of DEGs related to ethylene signaling The role of ethylene in fruit ripening has been well reported in other studies, and some genes involved in the ethylene signaling pathway were identified as DEGs between sample d0 and d6. Here, we used these genes as markers to confirm the accuracy of our RNA-seq data (Table 5). Most of the genes, including ACO, ERF, PG and Expansin, showed higher expression in sample d6. We investigated the expression levels of ACO (c79627) and PG (c99110) by qRT-PCR and found that both genes were upregulated during fruit ripening (Fig. 6), which were in agreement with the results of previous reports on pear and peach (Huang et al., 2014; Sanhueza et al., 2015).
Fig. 3 DEGs identified between d0 and d6 samples of A. arguta fruits
genes were differentially expressed between samples d0 and d6 (log2 ratio ≥ 2, FDR ≤ 0.01). In sample d6, the transcripts of 1 763 unigenes were downregulated, and 1 896 unigenes were upregulated (Fig. 3). GO analysis was employed to analyze the DEGs. Of the 2 983 DEGs, 2 379 were successfully annotated and categorized into GO groups (Fig. 4). The unigenes were mapped to three main categories: cellular component, molecular function, and biological process. In the cellular component category, the greatest number of genes was observed for the terms “cell part” and “cell”. In the molecular function category, most of the DEGs
3.5. Identification of differentially expressed transcription factors involved in fruit ripening In addition to the ERF transcription factor family, we identified several other transcription factor families that were upor downregulated in sample d6, including bHLH, NAC, MADS, and MYB (Table 6). In the present study, a MADS-box gene, SOC1 (c88292), was much lower in expression in sample d6 than in sample d0, and its change in transcription levels might have contributed to the ripening of A. arguta fruits (Table 6). Eight ERFs and five NACs were also identified as DEGs (Table 6). However, other transcription factors that showed differential expression profiles in our study such as bHLH and MYB have not been reported to participate in fruit ripening, but their differential expression in our samples suggests their involvement in
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
40
[mNS;February 28, 2018;21:25]
HUANG Guohui et al.
Fig. 4 Functional annotation of DEGs to GO categories Significantly up- or downregulated genes are marked in blue, and genes that did not show significant differential expression are indicated in red.
Fig. 5 Functional annotation of DEGs to COG categories
fruit ripening. These genes might participate in ethylene regulation by transcriptionally modulating ethylene biosynthesisrelated genes. Therefore, functional analysis of these transcription factors, particularly the transcriptional regulation of ethylene biosynthesis genes, is thus essential to the elucidation of their regulatory roles in the ripening of climacteric fruits.
We used qRT-PCR to investigate the expression profiles of ERF, NAC, MYC and MADS-box transcription factors during A. arguta fruit ripening. The expression of the ERF061 gene (c105131) increased at the beginning of fruit ripening and then decreased, whereas the ERF6 gene (c99193) was downregulated during fruit ripening. bHLH91 (c104633) expression was very low at day 0 and day 3, and peaked at day 6; another bHLH gene MYC (c98728) showed the highest expression at day 3 and
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
ARTICLE IN PRESS
JID: HPJ
[mNS;February 28, 2018;21:25]
41
Comparative transcriptome analysis of Actinidia arguta fruits... Table 5 DEGs related to ethylene biosynthesis and signal transduction pathway Gene ID c79627 c100439 c102197 c103091 c106294 c95357 c99110 c102430 c99110
Annotation ACO Expansin-A1 Expansin-A4 Expansin-A6 Expansin-A8 Expansin-B16 Polygalacturonase (PG) Polygalacturonase (PG) Polygalacturonase (PG)
Expression level d0-1 d0-2 20.55 26.05 4.02 4.90 7.80 10.40 38.69 45.74 39.78 62.78 0.42 0.17 43.24 35.30 40.08 40.44 48.42 42.03
d6-1 583.26 29.79 62.41 967.75 462.73 9.32 640.70 2 350.32 760.03
d6-2 491.37 40.80 68.26 1 232.00 551.02 17.18 434.31 1 943.51 532.36
FDR
log2 FC
Regulation
5.46E−47 4.61E−10 1.22E−13 2.39E−34 6.16E−37 2.61E−06 9.62E−09 3.28E−55 2.10E−10
4.45 2.91 2.77 4.63 3.22 5.45 3.72 5.67 3.78
Up Up Up Up Up Up Up Up Up
Note: FDR, false discovery rate; FC, fold change.
Fig. 6 qRT-PCR analysis of ethylene signal transduction genes during A. arguta fruit ripening
Table 6 DEGs related to transcription factors Gene ID MADS c88292 ERF c105131 c99193 c90424 c76172 c90613 c80164 c98282 c101022 NAC c105965 c80243 c93353 c106265 c97987 bHLH c104633 c98728 c105940 MYB c97736 c98256 c98898 c107690 c103442 Others c107076 c107797 c95723 c95152
Annotation
Expression level d0-1 d0-2
d6-1
d6-2
FDR
log2 FC
Regulation
MADS-box protein SOC1
1.65
1.51
0.58
0.23
3.09E−04
−2.02
Down
Ethylene-responsive transcription factor ERF061 Ethylene-responsive transcription factor ERF6 Ethylene-responsive transcription factor ERF2 Ethylene-responsive transcription factor ERF014 Ethylene-responsive transcription factor ERF114 Ethylene-responsive transcription factor ERF115 Ethylene-responsive transcription factor RAP2-12 Ethylene-responsive transcription factor TINY
21.52 223.39 2.46 3.40 10.35 4.76 21.38 3.86
19.68 126.21 2.48 2.96 4.85 3.07 17.66 2.96
121.34 20.33 0.13 0.17 0.14 0.00 2.56 0.77
112.63 35.39 0.61 0.88 0.29 0.00 1.60 0.54
3.42E−46 1.50E−04 4.77E−07 4.68E−06 1.74E−04 1.56E−11 2.16E−17 1.69E−05
2.44 −2.70 −2.82 −2.67 −5.17 ∞ −3.29 −2.44
Up Down Down Down Down Down Down Down
NAC domain-containing protein 72 NAC transcription factor 29 NAC domain-containing protein 18 NAC domain-containing protein 18 NAC domain-containing protein 90
58.21 2.75 7.76 118.22 0.36
42.45 4.73 8.54 118.88 0.23
242.83 0.15 33.88 710.09 2.53
187.02 0.65 49.96 743.62 1.48
2.57E−08 4.96E−03 1.07E−05 3.67E−43 2.39E−03
2.04 −3.32 2.29 2.55 2.72
Up Down Up Up Up
Transcription factor bHLH91 Transcription factor bHLH-MYC EMB1444 Transcription factor bHLH-MYC LHW
0.32 8.62 10.86
0.28 8.51 6.21
2.91 1.53 1.62
2.51 2.78 1.81
4.14E−10 5.03E−08 4.35E−04
3.11 −2.06 −2.36
Up Down Down
Transcription factor MYB-like Transcription factor MYB1R1 Putative MYB family transcription factor Transcription factor MYB-like LUX Transcription factor MYB-like TRY
2.26 3.79 3.59 32.99 14.12
2.25 3.97 4.35 25.68 12.82
0.28 0.33 0.54 3.90 3.56
0.29 0.70 0.81 5.72 3.47
2.10E−07 7.09E−07 6.07E−07 2.20E−30 1.34E−06
−3.05 −2.98 −2.62 −2.67 −2.00
Down Down Down Down Down
Heat shock factor protein HSF30 Transcription factor E2FC Transcription factor NAI1 Transcription factor UNE12
3.92 11.41 13.96 1.75
3.86 11.89 11.54 0.73
0.15 2.36 2.98 5.95
0.43 3.23 2.46 7.22
1.23E−14 4.48E−12 8.02E−07 3.83E−06
−3.82 −2.13 −2.29 2.37
Down Down Down Up
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
42
[mNS;February 28, 2018;21:25]
HUANG Guohui et al.
Fig. 7 qRT-PCR analysis of transcription factors during A. arguta fruit ripening
then decreased during the storage period. The NAC72 gene (c105965) was upregulated, whereas NAC29 (c80243) showed gradual downregulation during fruit ripening. The MADS-box gene SOC1 (c88292) exhibited progressive downregulation during the storage period. MYB-like (c97736) expression peaked at day 3 and then dramatically decreased during fruit ripening (Fig. 7).
4. Discussion The fruit of A. arguta is climacteric, and its ripening process is achieved by a burst of ethylene production. The role of ethylene
in fruit ripening involves the regulation of its biosynthesis and signal transduction (Seymour et al., 2013). Although the transcriptional regulation of fruit ripening has been reported in various studies (Chung et al., 2010; Martel et al., 2011; Ma et al., 2014), the identification of more transcription factors involved in fruit ripening remains important in expanding our knowledge of fruit ripening. In the present study, we compared the transcripts of A. arguta fruits before and after ripening and identified 3659 DEGs. The genes involved in the ethylene signaling pathway such as ACO (c79627) and PG (c99110) were identified as DEGs and their expression levels were investigated by qRT-PCR. The
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
43
Comparative transcriptome analysis of Actinidia arguta fruits... results of RNA-seq and qRT-PCR were coincided, indicating the accuracy of our RNA-seq data. More importantly, the transcription factor family bHLH, NAC, MADS, and MYB showed differential expression during fruit ripening. As one of the largest transcription factor families, MYB transcription factors are involved in cell development, cell cycling, and in responding to various hormones and environmental signals. For example, a previous study has shown that the overexpression of the MYB gene in Arabidopsis increases anthocyanin content (Takos et al., 2006). In our study, MYB-like (c97736) expression peaked at day 3 and then dramatically decreased during fruit ripening, thereby suggesting its role in fruit ripening. Because of the important roles of transcription factors in regulating fruit ripening, it would be interesting to study the transcriptional regulation of structural genes and protein interactions or that among various transcription factors. Our results provide abundant resources in this area and identified a new area for future research. In conclusion, we identified 3659 DEGs during A. arguta fruit ripening, which included several transcription factors. Functional analysis of these transcription factors may facilitate research on transcriptional regulation of fruit ripening, particularly that have not been reported to be involved in fruit ripening such as MYB and bHLH.
Acknowledgments The Innovative Program for Fruit Tree Research of Liaoning Province, China (LNGSCYTX-13/14-4) supported this study.
R E F E R E N C E S Adams-Phillips, L., Barry, C., Giovannoni, J., 2004. Signal transduction systems regulating fruit ripening. Trends Plant Sci, 9: 331–338. Ampa, K., Saito, T., Okawa, K., Ohara, H., Kondo, S., 2017. Effects of ethephon and abscisic acid application on ripening-related genes in ‘Kohi’ kiwifruit (Actinidia chinensis) on the vine. Hortic Plant J, 3: 29–33. Anders, S., Huber, W., 2010. Differential expression analysis for sequence count data. Genome Biol, 11: R106. Benjamini, Y., Yekutieli, D., 2001. The control of the false discovery rate in multiple testing under dependency. Ann Stat, 29: 1165–1188. Chung, M.Y., Vrebalov, J., Alba, R., Lee, J., McQuinn, R., Chung, J.D., Klein, P., Giovannoni, J., 2010. A tomato (Solanum lycopersicum) APETALA2/ERF gene, SlAP2a, is a negative regulator of fruit ripening. Plant J, 64: 936–947. Giovannoni, J.J., 2004. Genetic regulation of fruit development and ripening. Plant Cell, 16 (Suppl): S170–S180. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol, 29: 644–652. Huang, G., Li, T., Li, X., Tan, D., Jiang, Z., Wei, Y., Li, J., Wang, A., 2014. Comparative transcriptome analysis of climacteric fruit of Chinese pear (Pyrus ussuriensis) reveals new insights into fruit ripening. PLoS One, 9, E107562. Ireland, H.S., Yao, J.L., Tomes, S., Sutherland, P.W., Nieuwenhuizen, N., Gunaseelan, K., Winz, R.A., David, K.M., Schaffer, R.J., 2013. Apple SEPALLATA1/2-like genes control fruit flesh development and ripening. Plant J, 73: 1044–1056.
Kevany, B.M., Tieman, D.M., Taylor, M.G., Cin, V.D., Klee, H.J., 2007. Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J, 51: 458–467. Lai, J.J., Li, Z.Z., Man, Y.P., Lei, R., Wang, Y.C., 2015. Genetic diversity of five wild Actinidia arguta populations native to China as revealed by SSR markers. Sci Hortic, 191: 101–107. Langmead, B., Trapnell, C., Pop, M., Salzberg, S.L., 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol, 10: R25. Lelièvre, J.M., Latchè, A., Jones, B., Bouzayen, M., Pech, J.C., 1997. Ethylene and fruit ripening. Physiol Plant, 101: 727–739. Li, B., Dewey, C.N., 2011. RSEM: accurate transcript quantification from RNA-seq data with or without a reference genome. BMC Bioinf, 12: 323. Li, T., Li, X., Tan, D., Jiang, Z., Wei, Y., Li, J., Du, G., Wang, A., 2014. Distinct expression profiles of ripening related genes in the ‘Nanguo’ pear (Pyrus ussuriensis) fruits. Sci Hortic, 171: 78–82. Li, T., Tan, D., Liu, Z., Jiang, Z., Wei, Y., Zhang, L., Li, X., Yuan, H., Wang, A., 2015. Apple MdACS6 regulates ethylene biosynthesis during fruit development involving ethylene-responsive factor. Plant Cell Physiol, 56: 1909–1917. Ma, N., Feng, H., Meng, X., Li, D., Yang, D., Wu, C., Meng, Q., 2014. Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation and softening. BMC Plant Biol, 14: 351. Martel, C., Vrebalov, J., Tafelmeyer, P., Giovannoni, J.J., 2011. The tomato MADS-box transcription factor RIPENING INHIBITOR interacts with promoters involved in numerous ripening processes in a COLORLESS NONRIPENING-dependent manner. Plant Physiol, 157: 1568–1579. Osorio, S., Scossa, F., Fernie, A.R., 2013. Molecular regulation of fruit ripening. Front Plant Sci, 4: 198. Sanhueza, D., Vizoso, P., Balic, I., Campos-Vargas, R., Meneses, C., 2015. Transcriptomic analysis of fruit stored under cold conditions using controlled atmosphere in Prunus persica cv. “Red Pearl”. Front Plant Sci, 6: 788. Seymour, G.B., Ostergaard, L., Chapman, N.H., Knapp, S., Martin, C., 2013. Fruit development and ripening. Annu Rev Plant Biol, 64: 219–241. Srivastava, A., Handa, A.K., 2005. Hormonal regulation of tomato fruit development: a molecular perspective. J Plant Growth Regul, 24: 67–82. Takos, A.M., Jaffé, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol, 142: 1216–1232. Tan, D., Li, T., Wang, A., 2013. Apple 1-aminocyclopropane-1-carboxylic acid synthase genes, MdACS1 and MdACS3a, are expressed in different systems of ethylene biosynthesis. Plant Mol Biol Rep, 31: 204–209. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., Pachter, L., 2010. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol, 28: 511–515. Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R., Schuch, W., Giovannoni, J., 2002. A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science, 296: 343–346. Wang, A., Tan, D., Takahashi, A., Li, T.Z., Harada, T., 2007. MdERFs, two ethylene-response factors involved in apple fruit ripening. J Exp Bot, 58: 3743–3748. Xiao, Y.Y., Chen, J.Y., Kuang, J.F., Shan, W., Xie, H., Jiang, Y.M., Lu, W.J., 2013. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes. J Exp Bot, 64: 2499–2510. Yang, S.F., Hoffman, N.E., 1984. Ethylene biosynthesis and its regulation in higher plants. Annu Rev Plant Physiol, 35: 155–189.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
44 Yang, Y., Ma, R.J., Zhang, B.B., Song, Z.Z., Zhang, C.H., Guo, S.L., Yu, M.L., 2016. Different expression analysis in fruit softening and ethylene biosynthetic pathways in peaches of different flesh textures. Hortic Plant J, 2: 75–81. Yin, X.R., Allan, A.C., Chen, K.S., Ferguson, I.B., 2010. Kiwifruit EIL and ERF genes involved in regulating fruit ripening. Plant Physiol, 153: 1280–1292.
[mNS;February 28, 2018;21:25]
HUANG Guohui et al. Zhu, M., Chen, G., Zhou, S., Tu, Y., Wang, Y., Dong, T., Hu, Z., 2014. A new tomato NAC (NAM/ATAF1/2/CUC2) transcription factor, SlNAC4, functions as a positive regulator of fruit ripening and carotenoid accumulation. Plant Cell Physiol, 55: 119–135.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
[mNS;February 28, 2018;21:25]
January 2018. Horticultural Plant Journal, 4 (xx): 36–44.
Horticultural Plant Journal Available online at www.sciencedirect.com The journal’s homepage: http://www.journals.elsevier.com/horticultural-plant-journal
Comparative Transcriptome Analysis of Actinidia arguta Fruits Reveals the Involvement of Various Transcription Factors in Ripening HUANG Guohui a,1, QU Yi b,1, LI Tong b, YUAN Hui b, WANG Aide b, and TAN Dongmei b,∗ a Department b College
of Horticulture, Eastern Liaoning University, Dandong, Liaoning 118003, China of Horticulture, Shenyang Agricultural University, Shenyang, Liaoning 110866, China
Received 7 May 2017; Received in revised form 29 August 2017; Accepted 25 December 2017 Available online xxx
A B S T R A C T The fruit of Actinidia arguta is typically climacteric. During ripening, the fruits produce a large amount of ethylene. Although the molecular basis of climacteric fruit ripening has been extensively studied, some aspects such as its transcriptional regulation remain unclear. Here, we compared the transcriptomes of A. arguta fruits collected at commercial harvest (sample d0) and at 6 days after harvest (sample d6) using RNA-seq. A total of 3 659 differentially expressed genes (DEGs) between samples d0 and d6 were detected, of which 2 983 and 1 104 could be functionally annotated with Gene Ontology (GO) and Clusters of Orthologous Groups (COG) pathways. DEGs involved in ethylene biosynthesis and signal transduction were identified, including ACO (c79627), ERF061 (c105131), and ERF6 (c99193). Transcription factors such as ERF, bHLH, NAC, MADS, and MYB were also differentially expressed between samples d0 and d6. Selected DEGs were subjected to further analysis using quantitative reverse transcription-polymerase chain reaction (qRT-PCR), and the results coincided with those of RNA-seq. Our data revealed additional transcription factors that are involved in the regulation of fruit ripening. These results provide useful information for future research on the transcriptional regulation of fruit ripening. Keywords: Actinidia arguta; transcriptome; ripening; ethylene signaling; transcription factor
1. Introduction Actinidia arguta (hardy kiwifruit) is a perennial vine that originally grew in Japan, Korea, Northern China, and Russia (Lai et al., 2015). It produces small fruits that are similar to kiwifruit in taste and appearance, but with smooth green or purple skin. The plants of A. arguta exhibit strong cold hardiness and disease tolerance (Lai et al., 2015). Its fruit can be consumed in its entirety, including the skin. The fruits of A. arguta are typical climacteric fruits that undergo climacteric respiration during ripening, which involves bursts of ethylene without the need for stimulation by an external influence (Osorio et al., 2013) as ethylene itself acts as the
main regulator of ripening (Lelièvre et al., 1997; Giovannoni, 2004; Srivastava and Handa, 2005; Kevany et al., 2007; Osorio et al., 2013; Seymour et al., 2013; Ampa et al., 2017). Ethylene biosynthesis has been well documented; the most important enzymes involved in this process include 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and ACC oxidase (ACO) (Yang and Hoffman, 1984; Yang et al., 2016). The ethylene signal transduction pathway is a linear cascade that includes ethylene receptors, constitutive triple response 1 (CTR1), ethylene insensitive 2 and 3 (EIN2, EIN3), EIN3-like (EIL), and ethylene response factor (ERF) proteins, and ethyleneresponsive genes. The complexity of this particular pathway has
∗
Corresponding author. Tel.: +86 24 88487143 E-mail address: [email protected] 1 These authors contributed equally to this work. Peer review under responsibility of Chinese Society for Horticultural Science (CSHS) and Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS) https://doi.org/10.1016/j.hpj.2018.01.002 2468-0141/© 2018 Chinese Society for Horticultural Science (CSHS) and Institute of Vegetables and Flowers (IVF), Chinese Academy of Agricultural Sciences (CAAS). This is an open access article under the CC BY-NC-ND license. (http://creativecommons.org/licenses/by-nc-nd/4.0/)
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
37
Comparative transcriptome analysis of Actinidia arguta fruits... been extensively studied, and there is growing evidence suggesting the involvement of transcription regulation and other hormones (Adams-Phillips et al., 2004; Srivastava and Handa, 2005). Primarily, various transcription factors are reportedly involved in fruit ripening (Osorio et al., 2013). The transcriptional regulation of fruit ripening was elucidated by findings that a MADSbox transcription factor gene RIN (ripening inhibitor) controls the ripening of the tomato mutant rin (Vrebalov et al., 2002). The ethylene biosynthesis genes ACS and ACO are regulated by RIN (Martel et al., 2011). In apples, MdMADS9 is a transcriptional activator of MdACS1 during fruit ripening (Ireland et al., 2013). In tomatoes, SlAP2a acts as a negative regulator of fruit ripening (Chung et al., 2010). Another transcription factor widely reported to be involved in fruit ripening is ERF (Wang et al., 2007; Xiao et al., 2013; Li et al., 2015). The involvement of the NAC gene in fruit ripening has also been reported, where SlNAC4 acts as a positive regulator by affecting ethylene biosynthesis (Zhu et al., 2014). In addition, SlNAC1 overexpression in tomato results in early fruit softening (Ma et al., 2014). These results suggest that transcription factors play essential roles in regulating fruit ripening. However, the possible involvement of other transcription factors remains unclear. Although considerable knowledge has been gained from various genetic and epigenetic studies, the process of ripening of A. arguta fruits has not been investigated. In the present study, we compared the transcriptomes of A. arguta fruits before and after ripening and identified other transcription factors that are possibly involved in fruit ripening. The expression profiles of selected differentially expressed genes were confirmed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR).
2. Materials and methods
2.2. RNA extraction and deep sequencing Total RNA extraction was performed as described by Li et al. (2014). mRNA isolation and first- and second-strand cDNA synthesis were performed according to Huang et al. (2014). The purified cDNAs were subjected to end reparation and polyadenylation and then mixed with Solexa adapters. Suitable fragments were recovered from an agarose gel, PCR amplified, and then sequenced using an Illumina HiSeqTM 2500 system.
2.3. Bioinformatics analysis Sequence reads with adapters or low-quality bases were removed from the raw data to generate clean reads. The clean sequence reads were then used in de novo transcriptome assembly using Trinity software (Grabherr et al., 2011). Trinity combined reads with overlaps to form contigs, which were then clustered to generate unigenes. For gene annotation, the assembled unigenes were aligned to public protein databases using BLASTx (E value < 10−7 ), including the non-redundant (NR), Swiss-Prot, Gene Ontology (GO), and Clusters of Orthologous Groups (COG) databases. Differentially expressed genes (DEGs) were analyzed using Bowtie (Langmead et al., 2009). Expression levels were calculated according to the RSEM method (Li and Dewey, 2011). The fragments per kilobase of transcript per million mapped reads (FPKM) method was used to calculate the rate of DEGs (Trapnell et al., 2010), and the false discovery rate (FDR) was used to correct the P-value thresholds via multiple testing (Benjamini and Yekutieli, 2001), with a P value ≤ 0.05 and a foldchange (log2 FC) ≥ 2. The heat map for the DEGs involved in ethylene biosynthesis and the signaling pathway were constructed using Cluster 3.0 software. The raw data were deposited into NCBI Sequence Read Archive (SRA) as accession number SRP073020.
2.1. Plant materials Fruits of A. arguta were harvested from the experimental farm of Eastern Liaoning University (Dandong, Liaoning, China) when the total soluble solids (TSS) reached 6% on September 8, 2014. The fruits were stored at room temperature (24 °C) for 9 days and sampled every 3 days. Trees of A. arguta were 4 years. A total of 120 fruits were collected. At each sampling point, 10 fruits were collected for measurements. For measurement of ethylene production, 30 fruits were divided into 3 groups (10 fruits for each group), and each group of fruits was kept tightly in a gas-tight container (0.8 L) at 24 °C for 1 h, then ethylene was collected using 1 mL-syringe and was measured according to the method described by Li et al. (2014). Each group of fruits was used as one biological replicate, and three biological replicates were performed at each sampling point. Total soluble solids were measured from the fruit juice of each sample using a Brix tester (PAL-1, ATAGO, Tokyo, Japan). The flesh of 10 fruits was sliced, pooled, frozen in liquid N2 , and stored at −80 °C until RNA extraction. Fruits of A. arguta collected on the commercial harvest day (sample d0) and 6 days after storage at room temperature (sample d6) were used for RNA-seq. At each sampling time, two groups of fruit were collected as two biological replicates (d0-1 and d0-2 were the replicates for sample d0, and d6-1 and d6-2 were the replicates for sample d6) for RNA-seq. A total of four samples were sequenced.
2.4. qRT-PCR The total RNA (500 ng) extracted from A. arguta fruits was used in cDNA synthesis with an M-MLV RTase cDNA synthesis Kit (Cat# D6130, TaKaRa). The resulting cDNAs were then used as templates for qRT-PCR, which was conducted as described by Tan et al. (2013). Specific primers for each gene were designed using Primer3 (http://frodo.wi.mit.edu/) (Table 1). The actin gene (Yin et al., 2010) of kiwifruit (Actinidia deliciosa), which was constitutively expressed in this study, was used as internal reference. Three biological replicates were performed for each gene, calculating the mean and standard error (SE) for subsequent analyses.
3. Results 3.1. Total soluble solids and ethylene production of A. arguta fruits Total soluble solids and ethylene production of the A. arguta fruits were first measured during normal ripening. Total soluble solids continuously increased during the storage period (Fig. 1). Ethylene production increased after harvest and peaked at day 6 (Fig. 1). Therefore, we used fruit samples from the time of commercial harvest (sample d0) and after storage at room temperature for 6 days (sample d6) for RNA-seq analysis.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
ARTICLE IN PRESS
JID: HPJ
[mNS;February 28, 2018;21:25]
38
HUANG Guohui et al. Table 1 Primers used in this study
Gene name (ID)
Forward primer (5 –3 )
Reverse primer (5 –3 )
ACO (c79627) PG (c99110) ERF061 (c105131) ERF6 (c99193) bHLH91 (c104633) MYC (c98728) NAC72 (c105965) NAC29 (c80243) SOC1 (c88292) MYB-like (c97736) Actin
CAACTCGAGGTAATCACAAATGGA GACACAAGTTGCGGTTAAATTCAA CAGAGGTACGCAATGGAAGC GTCGACTCAGTTCGCTTATTACC CCACTGAGAGGCAAAGGAGA CCATGAAATCTACAACTATGGCGA ATCCTTTTGTTTTCGCGCCT GTAGTGCCATGATGACGCTG GCGAGGAGAGAAGACGATGA TGCTCCTCCAATCCCCTTTT TGCATGAGCGATCAAGTTTCAAG
TTTGCTCTTCTTTCTCTACCAGTG AACTTGAGGGCTTAACTAAACCAG GGTATCGGTGGTTCCTAGGG ACACTAAACGTCAACAGGAAATGA CCTTGAGCTCATCCACCGTT ACACCTTCTCTAACAGCAATCAAG CAGAGTGGAATCAGAGCCCA CAATGACCTCACAGCTGCTC ATTTGTGCCTCCTCTCCCAA TCATCATCGTCGAGCAAGGA TGTCCCATGTCTGGTTGATGACT
Fig. 1 Total soluble solids and ethylene production in A. arguta fruits during ripening Table 2 Statistics of the sequencing and assembly of A. arguta Sample
Number of clean reads
Number of bases
GC content/%
Number of mapped reads
Mapped ratio/%
d0-1 d0-2 d6-1 d6-2
25 401 263 26 492 353 20 505 140 19 773 439
5 130 569 049 5 298 029 498 4 141 631 631 4 176 733 872
48.01 48.28 47.58 47.52
20 285 635 21 391 656 16 387 596 15 731 295
79.86 80.75 79.92 79.56
Table 3 Statistics of the sequence assembly Length range/nt
Number of contigs (Percentage)
Number of transcripts (Percentage)
Number of unigenes (Percentage)
200–300 300–500 500–1 000 1 000–2 000 ≥2 000 Total number Total length/nt N50 length/nt Mean length/nt
7 477 848 (99.25%) 26 119 (0.35%) 15 785 (0.21%) 9 531 (0.13%) 4 770 (0.06%) 7 534 053 358 375 359 48 47.57
40 570 (23.97%) 31 410 (18.56%) 34 062 (20.13%) 38 711 (22.88%) 24 467 (14.46%) 169 220 174 248 502 1 715 1 029.72
32 035 (40.86%) 19 785 (25.23%) 12 536 (15.99%) 8 986 (11.46%) 5 066 (6.46%) 78 408 51 894 929 1 147 661.86
Note: N50 indicates that 50% of reads are longer than this value.
3.2. RNA-seq, de novo assembly, and annotation RNA-seq generated more than 92 million clean reads, each 100 nucleotides long (paired-end), for a total of 18.75 Gb of clean data. In each sample, the GC content was more than 47.52% (Table 2). The Trinity program was used to assemble the clean reads de novo. All of the high-quality clean reads were assembled into 78 408 unigenes for all samples, and at least 79.56% of the reads in each sample were mapped to the unigenes. The mean length of the assembled unigenes was 661.86 bp (Table 3, Fig. 2). To annotate the assembled unigenes, sequence similarity searches (E-value < 10−7 ) were performed against public databases, including NCBI NR, Swiss-Prot, GO, and COG. A total of 30 656 unigenes were successfully annotated in at least one database (Table 4).
Table 4 Number of unigenes functionally annotated in various public databases Database
Unigene
≥300 nt
≥1 000 nt
NR Swiss-Prot GO COG All
30 114 20 070 22 711 9 151 30 656
23 841 16 294 18 351 7 869 24 061
12 304 8 990 10 108 5 197 12 325
3.3. Identification of DEGs To identify genes involved in fruit ripening, we compared the transcripts in samples d0 and d6 using the DEseq program (Anders and Huber, 2010). The transcription level of each gene was estimated using the FPKM method. A total of 3 659 uni-
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
39
Comparative transcriptome analysis of Actinidia arguta fruits...
Fig. 2 Length distribution of unigenes
were mapped to the “binding” and “catalytic activity” groups. In the biological process category, the largest groups were “cellular processes” and “metabolic processes”. Of the 3 659 DEGs, 1 104 were annotated in the COG database. Most of the DEGs (27.3%) were included in the COG category “signal transduction mechanisms”, “transcription” and “replication, recombination and repair” (Fig. 5).
3.4. Identification of DEGs related to ethylene signaling The role of ethylene in fruit ripening has been well reported in other studies, and some genes involved in the ethylene signaling pathway were identified as DEGs between sample d0 and d6. Here, we used these genes as markers to confirm the accuracy of our RNA-seq data (Table 5). Most of the genes, including ACO, ERF, PG and Expansin, showed higher expression in sample d6. We investigated the expression levels of ACO (c79627) and PG (c99110) by qRT-PCR and found that both genes were upregulated during fruit ripening (Fig. 6), which were in agreement with the results of previous reports on pear and peach (Huang et al., 2014; Sanhueza et al., 2015).
Fig. 3 DEGs identified between d0 and d6 samples of A. arguta fruits
genes were differentially expressed between samples d0 and d6 (log2 ratio ≥ 2, FDR ≤ 0.01). In sample d6, the transcripts of 1 763 unigenes were downregulated, and 1 896 unigenes were upregulated (Fig. 3). GO analysis was employed to analyze the DEGs. Of the 2 983 DEGs, 2 379 were successfully annotated and categorized into GO groups (Fig. 4). The unigenes were mapped to three main categories: cellular component, molecular function, and biological process. In the cellular component category, the greatest number of genes was observed for the terms “cell part” and “cell”. In the molecular function category, most of the DEGs
3.5. Identification of differentially expressed transcription factors involved in fruit ripening In addition to the ERF transcription factor family, we identified several other transcription factor families that were upor downregulated in sample d6, including bHLH, NAC, MADS, and MYB (Table 6). In the present study, a MADS-box gene, SOC1 (c88292), was much lower in expression in sample d6 than in sample d0, and its change in transcription levels might have contributed to the ripening of A. arguta fruits (Table 6). Eight ERFs and five NACs were also identified as DEGs (Table 6). However, other transcription factors that showed differential expression profiles in our study such as bHLH and MYB have not been reported to participate in fruit ripening, but their differential expression in our samples suggests their involvement in
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
40
[mNS;February 28, 2018;21:25]
HUANG Guohui et al.
Fig. 4 Functional annotation of DEGs to GO categories Significantly up- or downregulated genes are marked in blue, and genes that did not show significant differential expression are indicated in red.
Fig. 5 Functional annotation of DEGs to COG categories
fruit ripening. These genes might participate in ethylene regulation by transcriptionally modulating ethylene biosynthesisrelated genes. Therefore, functional analysis of these transcription factors, particularly the transcriptional regulation of ethylene biosynthesis genes, is thus essential to the elucidation of their regulatory roles in the ripening of climacteric fruits.
We used qRT-PCR to investigate the expression profiles of ERF, NAC, MYC and MADS-box transcription factors during A. arguta fruit ripening. The expression of the ERF061 gene (c105131) increased at the beginning of fruit ripening and then decreased, whereas the ERF6 gene (c99193) was downregulated during fruit ripening. bHLH91 (c104633) expression was very low at day 0 and day 3, and peaked at day 6; another bHLH gene MYC (c98728) showed the highest expression at day 3 and
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
ARTICLE IN PRESS
JID: HPJ
[mNS;February 28, 2018;21:25]
41
Comparative transcriptome analysis of Actinidia arguta fruits... Table 5 DEGs related to ethylene biosynthesis and signal transduction pathway Gene ID c79627 c100439 c102197 c103091 c106294 c95357 c99110 c102430 c99110
Annotation ACO Expansin-A1 Expansin-A4 Expansin-A6 Expansin-A8 Expansin-B16 Polygalacturonase (PG) Polygalacturonase (PG) Polygalacturonase (PG)
Expression level d0-1 d0-2 20.55 26.05 4.02 4.90 7.80 10.40 38.69 45.74 39.78 62.78 0.42 0.17 43.24 35.30 40.08 40.44 48.42 42.03
d6-1 583.26 29.79 62.41 967.75 462.73 9.32 640.70 2 350.32 760.03
d6-2 491.37 40.80 68.26 1 232.00 551.02 17.18 434.31 1 943.51 532.36
FDR
log2 FC
Regulation
5.46E−47 4.61E−10 1.22E−13 2.39E−34 6.16E−37 2.61E−06 9.62E−09 3.28E−55 2.10E−10
4.45 2.91 2.77 4.63 3.22 5.45 3.72 5.67 3.78
Up Up Up Up Up Up Up Up Up
Note: FDR, false discovery rate; FC, fold change.
Fig. 6 qRT-PCR analysis of ethylene signal transduction genes during A. arguta fruit ripening
Table 6 DEGs related to transcription factors Gene ID MADS c88292 ERF c105131 c99193 c90424 c76172 c90613 c80164 c98282 c101022 NAC c105965 c80243 c93353 c106265 c97987 bHLH c104633 c98728 c105940 MYB c97736 c98256 c98898 c107690 c103442 Others c107076 c107797 c95723 c95152
Annotation
Expression level d0-1 d0-2
d6-1
d6-2
FDR
log2 FC
Regulation
MADS-box protein SOC1
1.65
1.51
0.58
0.23
3.09E−04
−2.02
Down
Ethylene-responsive transcription factor ERF061 Ethylene-responsive transcription factor ERF6 Ethylene-responsive transcription factor ERF2 Ethylene-responsive transcription factor ERF014 Ethylene-responsive transcription factor ERF114 Ethylene-responsive transcription factor ERF115 Ethylene-responsive transcription factor RAP2-12 Ethylene-responsive transcription factor TINY
21.52 223.39 2.46 3.40 10.35 4.76 21.38 3.86
19.68 126.21 2.48 2.96 4.85 3.07 17.66 2.96
121.34 20.33 0.13 0.17 0.14 0.00 2.56 0.77
112.63 35.39 0.61 0.88 0.29 0.00 1.60 0.54
3.42E−46 1.50E−04 4.77E−07 4.68E−06 1.74E−04 1.56E−11 2.16E−17 1.69E−05
2.44 −2.70 −2.82 −2.67 −5.17 ∞ −3.29 −2.44
Up Down Down Down Down Down Down Down
NAC domain-containing protein 72 NAC transcription factor 29 NAC domain-containing protein 18 NAC domain-containing protein 18 NAC domain-containing protein 90
58.21 2.75 7.76 118.22 0.36
42.45 4.73 8.54 118.88 0.23
242.83 0.15 33.88 710.09 2.53
187.02 0.65 49.96 743.62 1.48
2.57E−08 4.96E−03 1.07E−05 3.67E−43 2.39E−03
2.04 −3.32 2.29 2.55 2.72
Up Down Up Up Up
Transcription factor bHLH91 Transcription factor bHLH-MYC EMB1444 Transcription factor bHLH-MYC LHW
0.32 8.62 10.86
0.28 8.51 6.21
2.91 1.53 1.62
2.51 2.78 1.81
4.14E−10 5.03E−08 4.35E−04
3.11 −2.06 −2.36
Up Down Down
Transcription factor MYB-like Transcription factor MYB1R1 Putative MYB family transcription factor Transcription factor MYB-like LUX Transcription factor MYB-like TRY
2.26 3.79 3.59 32.99 14.12
2.25 3.97 4.35 25.68 12.82
0.28 0.33 0.54 3.90 3.56
0.29 0.70 0.81 5.72 3.47
2.10E−07 7.09E−07 6.07E−07 2.20E−30 1.34E−06
−3.05 −2.98 −2.62 −2.67 −2.00
Down Down Down Down Down
Heat shock factor protein HSF30 Transcription factor E2FC Transcription factor NAI1 Transcription factor UNE12
3.92 11.41 13.96 1.75
3.86 11.89 11.54 0.73
0.15 2.36 2.98 5.95
0.43 3.23 2.46 7.22
1.23E−14 4.48E−12 8.02E−07 3.83E−06
−3.82 −2.13 −2.29 2.37
Down Down Down Up
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
42
[mNS;February 28, 2018;21:25]
HUANG Guohui et al.
Fig. 7 qRT-PCR analysis of transcription factors during A. arguta fruit ripening
then decreased during the storage period. The NAC72 gene (c105965) was upregulated, whereas NAC29 (c80243) showed gradual downregulation during fruit ripening. The MADS-box gene SOC1 (c88292) exhibited progressive downregulation during the storage period. MYB-like (c97736) expression peaked at day 3 and then dramatically decreased during fruit ripening (Fig. 7).
4. Discussion The fruit of A. arguta is climacteric, and its ripening process is achieved by a burst of ethylene production. The role of ethylene
in fruit ripening involves the regulation of its biosynthesis and signal transduction (Seymour et al., 2013). Although the transcriptional regulation of fruit ripening has been reported in various studies (Chung et al., 2010; Martel et al., 2011; Ma et al., 2014), the identification of more transcription factors involved in fruit ripening remains important in expanding our knowledge of fruit ripening. In the present study, we compared the transcripts of A. arguta fruits before and after ripening and identified 3659 DEGs. The genes involved in the ethylene signaling pathway such as ACO (c79627) and PG (c99110) were identified as DEGs and their expression levels were investigated by qRT-PCR. The
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
[mNS;February 28, 2018;21:25]
43
Comparative transcriptome analysis of Actinidia arguta fruits... results of RNA-seq and qRT-PCR were coincided, indicating the accuracy of our RNA-seq data. More importantly, the transcription factor family bHLH, NAC, MADS, and MYB showed differential expression during fruit ripening. As one of the largest transcription factor families, MYB transcription factors are involved in cell development, cell cycling, and in responding to various hormones and environmental signals. For example, a previous study has shown that the overexpression of the MYB gene in Arabidopsis increases anthocyanin content (Takos et al., 2006). In our study, MYB-like (c97736) expression peaked at day 3 and then dramatically decreased during fruit ripening, thereby suggesting its role in fruit ripening. Because of the important roles of transcription factors in regulating fruit ripening, it would be interesting to study the transcriptional regulation of structural genes and protein interactions or that among various transcription factors. Our results provide abundant resources in this area and identified a new area for future research. In conclusion, we identified 3659 DEGs during A. arguta fruit ripening, which included several transcription factors. Functional analysis of these transcription factors may facilitate research on transcriptional regulation of fruit ripening, particularly that have not been reported to be involved in fruit ripening such as MYB and bHLH.
Acknowledgments The Innovative Program for Fruit Tree Research of Liaoning Province, China (LNGSCYTX-13/14-4) supported this study.
R E F E R E N C E S Adams-Phillips, L., Barry, C., Giovannoni, J., 2004. Signal transduction systems regulating fruit ripening. Trends Plant Sci, 9: 331–338. Ampa, K., Saito, T., Okawa, K., Ohara, H., Kondo, S., 2017. Effects of ethephon and abscisic acid application on ripening-related genes in ‘Kohi’ kiwifruit (Actinidia chinensis) on the vine. Hortic Plant J, 3: 29–33. Anders, S., Huber, W., 2010. Differential expression analysis for sequence count data. Genome Biol, 11: R106. Benjamini, Y., Yekutieli, D., 2001. The control of the false discovery rate in multiple testing under dependency. Ann Stat, 29: 1165–1188. Chung, M.Y., Vrebalov, J., Alba, R., Lee, J., McQuinn, R., Chung, J.D., Klein, P., Giovannoni, J., 2010. A tomato (Solanum lycopersicum) APETALA2/ERF gene, SlAP2a, is a negative regulator of fruit ripening. Plant J, 64: 936–947. Giovannoni, J.J., 2004. Genetic regulation of fruit development and ripening. Plant Cell, 16 (Suppl): S170–S180. Grabherr, M.G., Haas, B.J., Yassour, M., Levin, J.Z., Thompson, D.A., Amit, I., Adiconis, X., Fan, L., Raychowdhury, R., Zeng, Q., 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol, 29: 644–652. Huang, G., Li, T., Li, X., Tan, D., Jiang, Z., Wei, Y., Li, J., Wang, A., 2014. Comparative transcriptome analysis of climacteric fruit of Chinese pear (Pyrus ussuriensis) reveals new insights into fruit ripening. PLoS One, 9, E107562. Ireland, H.S., Yao, J.L., Tomes, S., Sutherland, P.W., Nieuwenhuizen, N., Gunaseelan, K., Winz, R.A., David, K.M., Schaffer, R.J., 2013. Apple SEPALLATA1/2-like genes control fruit flesh development and ripening. Plant J, 73: 1044–1056.
Kevany, B.M., Tieman, D.M., Taylor, M.G., Cin, V.D., Klee, H.J., 2007. Ethylene receptor degradation controls the timing of ripening in tomato fruit. Plant J, 51: 458–467. Lai, J.J., Li, Z.Z., Man, Y.P., Lei, R., Wang, Y.C., 2015. Genetic diversity of five wild Actinidia arguta populations native to China as revealed by SSR markers. Sci Hortic, 191: 101–107. Langmead, B., Trapnell, C., Pop, M., Salzberg, S.L., 2009. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol, 10: R25. Lelièvre, J.M., Latchè, A., Jones, B., Bouzayen, M., Pech, J.C., 1997. Ethylene and fruit ripening. Physiol Plant, 101: 727–739. Li, B., Dewey, C.N., 2011. RSEM: accurate transcript quantification from RNA-seq data with or without a reference genome. BMC Bioinf, 12: 323. Li, T., Li, X., Tan, D., Jiang, Z., Wei, Y., Li, J., Du, G., Wang, A., 2014. Distinct expression profiles of ripening related genes in the ‘Nanguo’ pear (Pyrus ussuriensis) fruits. Sci Hortic, 171: 78–82. Li, T., Tan, D., Liu, Z., Jiang, Z., Wei, Y., Zhang, L., Li, X., Yuan, H., Wang, A., 2015. Apple MdACS6 regulates ethylene biosynthesis during fruit development involving ethylene-responsive factor. Plant Cell Physiol, 56: 1909–1917. Ma, N., Feng, H., Meng, X., Li, D., Yang, D., Wu, C., Meng, Q., 2014. Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation and softening. BMC Plant Biol, 14: 351. Martel, C., Vrebalov, J., Tafelmeyer, P., Giovannoni, J.J., 2011. The tomato MADS-box transcription factor RIPENING INHIBITOR interacts with promoters involved in numerous ripening processes in a COLORLESS NONRIPENING-dependent manner. Plant Physiol, 157: 1568–1579. Osorio, S., Scossa, F., Fernie, A.R., 2013. Molecular regulation of fruit ripening. Front Plant Sci, 4: 198. Sanhueza, D., Vizoso, P., Balic, I., Campos-Vargas, R., Meneses, C., 2015. Transcriptomic analysis of fruit stored under cold conditions using controlled atmosphere in Prunus persica cv. “Red Pearl”. Front Plant Sci, 6: 788. Seymour, G.B., Ostergaard, L., Chapman, N.H., Knapp, S., Martin, C., 2013. Fruit development and ripening. Annu Rev Plant Biol, 64: 219–241. Srivastava, A., Handa, A.K., 2005. Hormonal regulation of tomato fruit development: a molecular perspective. J Plant Growth Regul, 24: 67–82. Takos, A.M., Jaffé, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol, 142: 1216–1232. Tan, D., Li, T., Wang, A., 2013. Apple 1-aminocyclopropane-1-carboxylic acid synthase genes, MdACS1 and MdACS3a, are expressed in different systems of ethylene biosynthesis. Plant Mol Biol Rep, 31: 204–209. Trapnell, C., Williams, B.A., Pertea, G., Mortazavi, A., Kwan, G., van Baren, M.J., Salzberg, S.L., Wold, B.J., Pachter, L., 2010. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol, 28: 511–515. Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R., Schuch, W., Giovannoni, J., 2002. A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science, 296: 343–346. Wang, A., Tan, D., Takahashi, A., Li, T.Z., Harada, T., 2007. MdERFs, two ethylene-response factors involved in apple fruit ripening. J Exp Bot, 58: 3743–3748. Xiao, Y.Y., Chen, J.Y., Kuang, J.F., Shan, W., Xie, H., Jiang, Y.M., Lu, W.J., 2013. Banana ethylene response factors are involved in fruit ripening through their interactions with ethylene biosynthesis genes. J Exp Bot, 64: 2499–2510. Yang, S.F., Hoffman, N.E., 1984. Ethylene biosynthesis and its regulation in higher plants. Annu Rev Plant Physiol, 35: 155–189.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002
JID: HPJ
ARTICLE IN PRESS
44 Yang, Y., Ma, R.J., Zhang, B.B., Song, Z.Z., Zhang, C.H., Guo, S.L., Yu, M.L., 2016. Different expression analysis in fruit softening and ethylene biosynthetic pathways in peaches of different flesh textures. Hortic Plant J, 2: 75–81. Yin, X.R., Allan, A.C., Chen, K.S., Ferguson, I.B., 2010. Kiwifruit EIL and ERF genes involved in regulating fruit ripening. Plant Physiol, 153: 1280–1292.
[mNS;February 28, 2018;21:25]
HUANG Guohui et al. Zhu, M., Chen, G., Zhou, S., Tu, Y., Wang, Y., Dong, T., Hu, Z., 2014. A new tomato NAC (NAM/ATAF1/2/CUC2) transcription factor, SlNAC4, functions as a positive regulator of fruit ripening and carotenoid accumulation. Plant Cell Physiol, 55: 119–135.
Please cite this article as: HUANG Guohui et al., Comparative transcriptome analysis of Actinidia arguta fruits reveals the involvement of various transcription factors in ripening, Horticultural Plant Journal (2018), https://doi.org/10.1016/j.hpj.2018.01.002