- Email: [email protected]
Comparison between the Hybrid Capture 2 and the hpVIR real-time PCR for detection of human papillomavirus in women with ASCUS or low grade dysplasia
Journal of Clinical Virology 45 (2009) 85–89
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Comparison between the Hybrid Capture 2 and the hpVIR real-time PCR for detection of human papillomavirus in women with ASCUS or low grade dysplasia Inger Gustavsson a,∗ , Ivana Juko-Pecirep a , Ingrid Backlund b , Erik Wilander a,b , Ulf Gyllensten a a b
Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Dag Hammarskjöldsväg 20, S-751 85 Uppsala, Sweden Section of Clinical Pathology, Uppsala University Hospital, Uppsala, Sweden
a r t i c l e
i n f o
Article history: Received 26 January 2009 Received in revised form 26 March 2009 Accepted 20 April 2009 Keywords: Cervical carcinoma Human papillomavirus Real-time PCR
a b s t r a c t Background: Human papillomavirus (HPV) testing is an important part of cervical carcinoma screening, and the most widely used assay for detection of HPV is Hybrid Capture 2 (HC2). Objectives: We compare the HC2 with the real-time PCR hpVIR assay for detection of HPV in follow-up smears of 398 women diagnosed with atypical squamous cells of unknown significance (ASCUS) or low grade cervical intraepithelial neoplasia (CIN 1) in their initial smear. Study design: The two assays target the same set of high-risk (HR) HPVs with exception of HPV68. hpVIR identify individual or groups of HPV types as well as their viral load, while HC2 identify HR HPVs without specification of type. Results: 34% (131/391) of the women were positive with HC2 and 45% (175/391) with hpVIR. 16% (63/391) were positive only with hpVIR and among those with cytology available 6% (3/52) had a CIN 2. The 3% (13/391) of women positive only with HC2 either contained low-risk HPVs or copy numbers below the cut-off for the hpVIR assay. Conclusion: The hpVIR assay has a similar sensitivity and specificity as HC2, but hpVIR detect a higher frequency of high-risk HPV infections. © 2009 Elsevier B.V. All rights reserved.
1. Background Cervical cancer is the second most common female cancer worldwide and caused by persistent infection with oncogenic HPV.1 Access to organized cytological screening has reduced cervical cancer mortality by 40–80%2 but the decline has leveled off3 possibly due to women failing to attend screening and limitations in the screening technique.4 Approximately 40 of the more than 130 HPV types identified infect anogenital epithelia and 13 types are classified as high-risk types for cervical cancer.5–7 HPV testing has better sensitivity and negative predictive value compared to Pap-smear cytology but is inferior in specificity.8–11 HPV viral load has been proposed as a marker for persistent infection and risk of development of cervical lesions.12–19 HPV testing is approved by the US Food and Drug Administration (FDA) as triage for women whose Pap test has been classified as atypical squamous cells of unknown significance (ASCUS)20 and several studies have advocated HPV as triage in screening.10,11 A meta-analysis concluded that HPV typing is more accurate than cytology for triage of severe cervical lesions (grade cervical intraepithelial neoplasia (CIN) 2 or worse).21
∗ Corresponding author. Tel.: +46 18 4714804/+46 731 404522 (Mobile); fax: +46 18 4714808. E-mail address: [email protected] (I. Gustavsson). 1386-6532/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2009.04.012
A number of techniques22–24 are available for detection of HPV, with the Hybrid Capture 2 (HC2, Qiagen Inc.) being the most widely used. 2. Objectives Our objective was to compare HC2 with a real-time PCR assay (hpVIR) that allows individual or groups of high-risk HPVs to be identified, for the analysis of smears with ASCUS cytology or mild dysplasia (CIN 1). 3. Study design 3.1. Patients We analyzed cervical smears from 398 women living in Uppsala, Sweden, diagnosed with atypical squamous cells of unknown significance (ASCUS) or with low-grade cervical intraepithelial neoplasia (CIN 1) in the regular cytological screening program. After 3 months the women were invited for a second cytological examination and one smear was taken for cytology and a second sample for HPV analysis. The study was approved for the organized cytological screening in Uppsala, Sweden.
86
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
3.2. HPV typing Liquid based cytology has not been used in the gynaecological screening in Uppsala county and the routine for HPV testing using the HC2 assay has been to apply the cervical smear sample on a glass similar to that for the Pap test. The cells were fixed but not stained, and removed for the HC2 test by scraping. Therefore one cervical smear was stained for cytological investigation (Pap test) and a second used for HPV detection. The specimen taken for HPV detection was also divided in two parts and analyzed with two different methods: 3.2.1. Hybrid Capture 2 (HC2) To remove the cells from the glass, the Qiagen sampling brush was soaked in transport medium and used to dislodge half of the cells on the glass slide and these were processed according the manufacturer’s specifications to detect HPV DNA. The HC2 HR probe cocktail used is intended to detect HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68. 3.2.2. Real-time PCR (hpVIR) DNA from the cells of the second half of the slide was purified using the ABI PRISMTM 6100 Nucleic Acid Prep Station and the kit recommended by the manufacturer (Applied Biosystems, Inc., Foster City, CA, USA). HPV was detected using an updated version of a previously described real-time PCR-based assay25 with four parallel real-time PCRs from each DNA sample. One reaction is used to quantify the amount of a human single copy gene (house keeping gene) (HMBS, Homo sapiens hydroxymethylbilane synthase; GenBank accession no. M95623.1) and the three other reactions detects and quantifies the following HR HPVs, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59. The result are presented as individual types, except for HPV18 and -45 which are detected as a group and HPV33, -52, and -58 which are also detected as a group. 3.2.3. Primers and probes Oligonucleotide primers and probes were designed using the Primer Express software (version 2.0; Applied Biosystems, Inc., Foster City, CA, USA). 3.2.4. Real-time PCR The real-time PCR assay was performed with the same volume and PCR cycle as described earlier.25 Standard curves ranging from 102 to 105 copies were established for each HPV type using plasmids containing the full genome of different HPV types. A highly significant linear relationship was seen between HPV copy number and threshold cycle (Ct ) for all HPV types (Fig. 1). The threshold for a positive HPV type was set to 10 copies per PCR. Similarly, a linear relationship was seen between copy number of the human HMBS gene and threshold cycle, and as threshold for inclusion in the study, a copy number of 10 genomic equivalents were used. 3.2.5. Direct sequencing Samples that were positive by HC2 but negative by hpVIR and with a Ct < 35 for the human single copy gene per PCR, were amplified with the GP5+/GP6+ PCR primer pair and the 150 bp amplicon sequenced. The GP5+/GP6+ PCR was performed in a 25 l volume containing 5 l template DNA, 1 u Taq polymerase platinum, 1× PCR buffer and 3.5 Mm MgCl2 (Invitrogen Corporation, Carlsbad, CA, USA), 0.5 M of each primer (Thermo Hybaid, Waltham, MA, USA), 200 M of each dNTP (Amersham, Uppsala, Sweden) and 3.1 g BSA (Sigma, St Louis, MO, USA). The thermal cycling consisted of an initial denaturation step (95 ◦ C, 10 min) followed by 40 cycles of denaturation (94 ◦ C, 30 s),
Fig. 1. Standard curves for HPV types detected by hpVIR assay. The threshold cycle (Ct ) number is plotted against number of HPV genomes (from plasmid dilutions). The points represent the mean of 6 independent measurements. (a) Standard curves for HPV16 (solid line), HPV31 (broken line) and HPV18/45 (dotted line) (reaction 1). r2 values: r2HPV16 = 0.9996; r2HPV31 = 0.9991; r2HPV18/45 = 0.9997. (b) Standard curves for HPV39 (solid line), HPV33/52/58 (broken line) and HPV35 (dotted line) (reaction 2). r2 values: r2HPV39 = 0.9971; r2HPV33/52/58 = 0.9987; r2HPV35 = 0.9998. (c) Standard curves for HPV59 (solid line), HPV51 (broken line) and HPV56 (dotted line) (reaction 4). r2 values: r2HPV59 = 0.9975; r2HPV51 = 0.9994; r2HPV56 = 0.9994.
annealing (48 ◦ C, 30 s) and elongation (72 ◦ C, 30 s), and terminated by an elongation step (72 ◦ C, 7 min). The HPV PCR products were incubated in 37 ◦ C for 30 min with 2 units each of Shrimp Alkaline Phosphatase (USB Corporation, Cleveland, Ohio, USA) and Exonuclease 1 (New England Biolabs, Ipswich, MA, USA), and the enzymes inactivated at 80 ◦ C for 15 min. The amplicons were sequenced in both directions, using Big Dye 1.1 terminator chemistry (Applied Biosystems, Inc., Foster City, CA, USA) and the Applied Biosystems 3700 automated sequencer. The DNA sequences were compared to the known HPV sequences using BLAST (www.ncbi.nlm.nih.gov/BLAST), with E-values from <5 × 10−22 to <5 × 10−47 and alignments ranging from 70 bp to 95 bp in length.
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
87
Table 1 PCR primers and probes used in reaction 1–4 of the hpVIR assay. Reaction
Specificity
Primer namea
Primer sequence (5 –3 )
Probe sequence with labeled b fluorofores (5 –3 )
ORFc
Amplicon (bp)
1 1 1 1 1 1 1
HPV16 HPV16 HPV31 HPV31 HPV18 & 45 HPV18 HPV45
F16 R16 F31 R31 F18 R18 R45
AGCTCAGAGGAGGAGGATGAA GGTTACAATATTGTAATGGGCTC ACGATTCCACAACATAGGAGGA TACACTTGGGTTTCAGTACGAGGT CATTTTGTGAACAGGCAGAGC ACTTGTGCATCATTGTGGACC CAACACCTGTGCATCATTCTGA
FAM-CAGCTGGACAAGCAGAA-MGB
E7
78
NED-CCAACATGCTATGCAACGT-MGB
E6
81
VIC-CACAGGCATTGTTCCAT-MGB
E1
79
2 2 2 2 2 2 2 2
HPV33 & -52 HPV33 HPV58 HPV52 & -58 HPV35 HPV35 HPV39 HPV39
F33 & 52 R33 F58 R52 & 58 F35 R35 F39 R39
CGTCGCAGGCGTAAACGT ACAGGAGGCAGGTACACTGTGG TGCGTCGCAGACGTAAACGT ACAGGAGGCAGGTACACAGTGG ACCAAAGCCTGCTCCGTG AGTCGCACTCGCTTGGTG CGAGCAATTAGGAGAGTCAGAGG TGTGTGACGCTGTGGTTCAT
FAM-CACAGGCATTGTTCCAT-MGB
L1
86
VIC-AATCACAAACGACTTCGAGGG-MGB
E4
104
NED-ACCATGCAGTTAATCAC-MGB
E7
103
3 3
HMBS HMBS
HMBSF HMBSR
GGGTGGGATTCCCATCAG CGTTCTTGGTCTGGGTCACTAA
VIC-ATGCACGGCTCTAG-MGB
Intron
63
4 4 4 4 4 4
HPV51 HPV51 HPV56 HPV56 HPV59 HPV59
F51 R51 F56 R56 F59 R59
GCAAAAATTGGTGGACGAAAA ACGTTGGACGGGGCAAT CTCCGGAGGAAAAGCAATTG GATTTCATCTAATAGCACATGGTTGG TCCTACACAACGACCATACAAACTG GAATATTCCTCTGCATGATATTCGC
NED-AAAGGTTCCATGAAATAG-MGB
E6
62
FAM-ATTGTGACAGAAAAAG-MGB
E6
65
VIC-CTGATTTGAGCACAACAT-MGB
E6
70
a b c
F: Forward and R: Reverse. The 3 end is labeled with a dark fluorofor, MGB = Minor Groove Binder. Open reading frame.
4. Results We have extended a previously described18,19,25,26 assay for HPV typing and adapted it for the ABI 7900 HT real-time PCR instrument. The primer and probe sequences are shown in Table 1. Using the hpVIR assay, 391 samples had more than 10 copies per PCR of the HMBS gene, while 7 samples had less than 10 copies and were excluded from the following analyses. Of the 391 samples, 131 (34%) were positive with HC2 and 175 (45%) were positive with the hpVIR assay. The most common single infection was HPV16 (35%) (Table 2). Among the 175 women positive with hpVIR, 65 (37.1%)
Table 2 Frequency of HPV types in single and multiple infections as determined by the hpVIR assay. HPV type
n
Frequency (%)a
Single infections 16 33/52/58 18/45 31 56 51 35 39 59
38 28 16 10 8 6 2 1 1
35 25 15 9 7 5 2 1 1
Multiple infectionsb 16 33/52/58 18/45 56 31 39 51 59 35
44 28 24 19 11 13 7 3 1
29 19 16 13 7 9 5 2 1
a The frequency was calculated on the total number of positive samples in each category. b Multiple infection = the specific HPV type in combination with one or several of the types detected by hpVIR.
contained multiple HPV types. The most common mixed infections were between HPV16 and the -33 group and between HPV16 and -18/45 (Table 3). The samples were divided in three groups; those positive with both assays (concordant) and those positive with only one of the two assays (discordant for either HC2 or hpVIR). The most common HPV types in the samples positive by both assays were HPV16 and the groups 33/52/58 and 18/45. 63 samples were positive with hpVIR and negative with HC2 (Table 3). To determine if hpVIR positive, HC2 negative, samples had lower amounts of HPV, we calculated HPV copy number and viral load (HPV copy number per human genome equivalent) in the samples with HPV16. Both the mean copy number and viral load were lower in the hpVIR positive, HC2 negative, samples (n = 16, mean copy number = 2,385, mean HPV16 viral load = 0.888) relative to samples that were positive by both assays (n = 50, mean copy number = 7,229, mean HPV16 viral load = 4.31). One of the samples that were negative with HC2 had
Table 3 Frequency of HPV types in different sets of samples as detected by HC2 and hpVIR. HPV typea 16 18/45 31 33/52/58 35 39 42 51 56 59 66 70 Not typed Total a b
hpVIR +ve, HC2 +ve 50 27 17 36 2 10
HC2 +ve, hpVIR −ve 1 1
HC2 −ve, hpVIR +ve 32 13 4 20 1 5
1 12 22 4
1 5 1 1 8
180b
High-risk HPV is shown in bold. Include mixed infections.
13
81b
88
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
Table 4 Percentage of HPV positive samples in different CIN grades as detected by hpVIR and HC2.
Table 6 Sensitivity, specificity, PPV and NPV for the HC2 and hpVIR assays for different clinical outcomes.
Cytology classification
n
No atypia ASCUS CIN 1 CIN 2/3
273 31 30 33
% HC2
% hpVIR
Clinical endpoint
Indicator
20 39 73 85
35 45 77 91
Cytology, a CIN 2+
Sensitivity Specificity PPV NPV
85 73 24 98
91 60 18 99
Cytology, CIN 3
Sensitivity Specificity PPV NPV
100 70 9 100
100 57 7 100
Table 5 Cytology for samples with discordant HPV typing results. HPV typea
Number of specimens
HC2 +ve, hpVIR −ve 16 31 42 66 70 Not typedb
1 1 1 1 1 8
HC2 −ve, hpVIR +ve 16
21
18/45c 31 33/52/58d 35 51 56 Multiple infectionse
6 2 16 1 1 2 14
Cytology (number of specimens) CIN 2 (1) Na (1) ASCUS (1) CIN 1 (1) ASCUS (1) Na (6), ASCUS (1), Nav (1) Na (16), CIN 1 (1), CIN 2 (1), Ni (1), Nav (2) Na (4), ASCUS (2) Na (1), CIN 2 (1) Na (13), ASCUS (1), CIN 2 (1), Ni (1) Na (1) CIN 1 (1) Na (2) Na (12), ASCUS (2)
Notes: Na = no atypia, Nav = not available, and Ni = not identifiable. a High-risk HPV are shown in bold. b Not typed = no HPV type obtained. c HPV18 and -45 are detected together. d HPV33, -52 and -58 are detected together. e Multiple infection = combination of categories distinguishable with hpVIR.
high amounts of HPV16 (copy number = 26,000, viral load = 11.0) and was diagnosed as a CIN 3. In 13 samples the hpVIR assay was negative while HC2 was positive. Two of these samples contained HPV16 and one HPV31 at copy numbers below the cut-off for HPV positivity (10 HPV copies per PCR), three contained low-risk HPVs (HPV42, -70, -66) (Table 3), while the remaining 8 samples did not yield a PCR product. Cytology classification from the Pap test was available for 367 of the 391 smears (94%). The HPV positivity increased with the severity of the lesions for both methods (normal cytology hpVIR 35%, HC2 20%; ASCUS hpVIR 45%, HC2 39%; CIN 1 hpVIR 77%, HC2 73%; CIN 2/3, hpVIR 91%, HC2 85%) (Table 4). Among the 13 HC2 positive, hpVIR negative, samples for which cytology information was available, one had a CIN 2 (Table 5). This sample was HPV16 positive by hpVIR but below the threshold of 10 copies per PCR (3.3 copies). Among the 63 smears that were hpVIR positive and HC2 negative, 3 samples had a CIN 2 and either HPV16, -31 or 33/52/58 (detected as a group). The HPV16 positive sample had a high viral load (11.0) and the other two moderate viral loads (0.046 and 0.097). The HC2 and hpVIR assays showed similar specificity and sensitivity for the clinical endpoints of CIN 2 or more severe lesions (CIN 2+), or CIN 3 (Table 6). The PPV was relatively low for both assays while the NPV was very high, consistent with the well-known fact that lack of HPV infection is protective. The kappa value was 0.60 (SE = 0.040). The only moderate agreement indicated by the kappa value is due partly to the higher analytical sensitivity of the PCR assay compared to HC2, resulting in an additional set of samples being HPV positive only with PCR. A second reason is that the HC2 probe cocktail is known to cross-react with some HPV types not included in the PCR assay.
a
HC2 (%)
hpVIR (%)
CIN 2 + CIN 3.
5. Discussion We have further developed our real-time PCR assay to detect three more high-risk HPVs and compared this assay to HC2, using a set of follow-up samples from women with a previous indication of mild dysplasia or ASCUS. A number of samples typed positive with hpVIR but negative with HC2. This could either reflect false positive results for hpVIR or the higher technical sensitivity of the PCR-based hpVIR assay. 51% of the samples that were positive only with hpVIR contained HPV16, known as the most important oncogenic type. Among samples positive with HC2 but negative by hpVIR a high frequency was found to be low-risk HPVs, consistent with reports that HC2 cross-hybridizes to at least 15 low-risk HPVs.27 Three samples had a HPV copy number below the cut-off for the hpVIR assay and would have been regarded as positive using a cutoff of 1 rather than 10 copies per PCR in the hpVIR. For both assays the HPV detection rate increased with severity of the cervical abnormalities. hpVIR had a slightly higher detection rate for CIN 2/3 lesions as compared to HC2, presumably due to the higher technical sensitivity of hpVIR. The specificity of HC2 (73%) was somewhat higher than for hpVIR (60%). In summary, our results show that the hpVIR assay compares favorably to HC2 for identification of high-risk HPV infections in women at follow-up of cervical smears with undefined lesions. The hpVIR assay also provides HPV type information rather than a combined estimate of high-risk types. Another advantage of the hpVIR assay is the decreased probability of sample contamination, since the real-time PCR is an essentially closed system. The laboratory procedure for hpVIR is also easily adaptable to a 96-well plate format and readily amendable to automation, making it suitable for large scale testing of samples in follow-up or primary screening. Conflicts of interest None declared. Acknowledgements We are grateful to all patients for their participation in the study. This work was funded by grants from the Swedish Cancer society (Grant number: 08 0596) and Knut and Alice Wallenberg Consortium North (WCN). References 1. Parkin DM, Bray F, Ferlay J, Pisani P. Estimating the world cancer burden: Globocan 2000. Int J Cancer 2001;94:153–6. 2. Bergstrom R, Sparen P, Adami HO. Trends in cancer of the cervix uteri in Sweden following cytological screening. Br J Cancer 1999;81:159–66. 3. Anttila A, Pukkala E, Soderman B, Kallio M, Nieminen P, Hakama M. Effect of organised screening on cervical cancer incidence and mortality in Finland, 1963–1995: recent increase in cervical cancer incidence. Int J Cancer 1999;83:59–65.
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89 4. Horn PL, Lowell DM, LiVolsi VA, Boyle CA. Reproducibility of the cytologic diagnosis of human papillomavirus infection. Acta Cytol 1985;29:692–4. 5. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst 1995;87:796–802. 6. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003;348:518–27. 7. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12–9. 8. Cuzick J, Beverley E, Ho L, Terry G, Sapper H, Mielzynska I, et al. HPV testing in primary screening of older women. Br J Cancer 1999;81:554–8. 9. Schiffman M, Herrero R, Hildesheim A, Sherman ME, Bratti M, Wacholder S, et al. HPV DNA testing in cervical cancer screening: results from women in a high-risk province of Costa Rica. JAMA 2000;283:87–93. 10. Clavel C, Masure M, Bory JP, Putaud I, Mangeonjean C, Lorenzato M, et al. Human papillomavirus testing in primary screening for the detection of high-grade cervical lesions: a study of 7932 women. Br J Cancer 2001;84:1616–23. 11. Petry KU, Menton S, Menton M, van Loenen-Frosch F, de Carvalho Gomes H, Holz B, et al. Inclusion of HPV testing in routine cervical cancer screening for women above 29 years in Germany: results for 8466 patients. Br J Cancer 2003;88:1570–7. 12. Josefsson AM, Magnusson PK, Ylitalo N, Sorensen P, Qwarforth-Tubbin P, Andersen PK, et al. Viral load of human papilloma virus 16 as a determinant for development of cervical carcinoma in situ: a nested case-control study. Lancet 2000;355:2189–93. 13. Ylitalo N, Sorensen P, Josefsson AM, Magnusson PK, Andersen PK, Ponten J, et al. Consistent high viral load of human papillomavirus 16 and risk of cervical carcinoma in situ: a nested case-control study. Lancet 2000;355:2194–8. 14. Healey SM, Aronson KJ, Mao Y, Schlecht NF, Mery LS, Ferenczy A, et al. Oncogenic human papillomavirus infection and cervical lesions in aboriginal women of Nunavut, Canada. Sex Transm Dis 2001;28:694–700. 15. Sun CA, Liu JF, Wu DM, Nieh S, Yu CP, Chu TY. Viral load of high-risk human papillomavirus in cervical squamous intraepithelial lesions. Int J Gynaecol Obstet 2002;76:41–7. 16. Hernandez D, Ornelas L, Guido M, Apresa T, Alvarado I, Salcedo M, et al. Association between high-risk human papillomavirus DNA load and precursor lesions of cervical cancer in Mexican women. Gynecol Oncol 2003;90:310–7.
89
17. Dalstein V, Riethmuller D, Pretet JL, Le Bail Carval K, Sautiere JL, Carbillet JP, et al. Persistence and load of high-risk HPV are predictors for development of high-grade cervical lesions: a longitudinal French cohort study. Int J Cancer 2003;106:396–403. 18. Moberg M, Gustavsson I, Gyllensten U. Type-specific associations of human papillomavirus load with risk of developing cervical carcinoma in situ. Int J Cancer 2004;112:854–9. 19. Moberg M, Gustavsson I, Wilander E, Gyllensten U. High viral loads of human papillomavirus predict risk of invasive cervical carcinoma. Br J Cancer 2005;92:891–4. 20. Wright Jr TC, Cox JT, Massad LS, Twiggs LB, Wilkinson EJ. 2001 Consensus Guidelines for the management of women with cervical cytological abnormalities. JAMA 2002;287:2120–9. 21. Arbyn M, Buntinx F, Van Ranst M, Paraskevaidis E, Martin-Hirsch P, Dillner J. Virologic versus cytologic triage of women with equivocal Pap smears: a metaanalysis of the accuracy to detect high-grade intraepithelial neoplasia. J Natl Cancer Inst 2004;96:280–93. 22. Carozzi F, Bisanzi S, Sani C, Zappa M, Cecchini S, Ciatto S, et al. Agreement between the AMPLICOR Human Papillomavirus Test and the Hybrid Capture 2 assay in detection of high-risk human papillomavirus and diagnosis of biopsy-confirmed high-grade cervical disease. J Clin Microbiol 2007;45: 364–9. 23. Soderlund-Strand A, Rymark P, Andersson P, Dillner J, Dillner L. Comparison between the Hybrid Capture II test and a PCR-based human papillomavirus detection method for diagnosis and posttreatment follow-up of cervical intraepithelial neoplasia. J Clin Microbiol 2005;43: 3260–6. 24. Kulmala SM, Syrjanen S, Shabalova I, Petrovichev N, Kozachenko V, Podistov J, et al. Human papillomavirus testing with the hybrid capture 2 assay and PCR as screening tools. J Clin Microbiol 2004;42:2470–5. 25. Moberg M, Gustavsson I, Gyllensten U. Real-time PCR-based system for simultaneous quantification of human papillomavirus types associated with high risk of cervical cancer. J Clin Microbiol 2003;41:3221–8. 26. Josefsson A, Livak K, Gyllensten U. Detection and quantitation of human papillomavirus by using the fluorescent 5 exonuclease assay. J Clin Microbiol 1999;37:490–6. 27. Poljak M, Marin IJ, Seme K, Vince A. Hybrid Capture II HPV Test detects at least 15 human papillomavirus genotypes not included in its current high-risk probe cocktail. J Clin Virol 2002;25(Suppl. 3):S89–97.
Contents lists available at ScienceDirect
Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv
Comparison between the Hybrid Capture 2 and the hpVIR real-time PCR for detection of human papillomavirus in women with ASCUS or low grade dysplasia Inger Gustavsson a,∗ , Ivana Juko-Pecirep a , Ingrid Backlund b , Erik Wilander a,b , Ulf Gyllensten a a b
Department of Genetics and Pathology, Rudbeck Laboratory, University of Uppsala, Dag Hammarskjöldsväg 20, S-751 85 Uppsala, Sweden Section of Clinical Pathology, Uppsala University Hospital, Uppsala, Sweden
a r t i c l e
i n f o
Article history: Received 26 January 2009 Received in revised form 26 March 2009 Accepted 20 April 2009 Keywords: Cervical carcinoma Human papillomavirus Real-time PCR
a b s t r a c t Background: Human papillomavirus (HPV) testing is an important part of cervical carcinoma screening, and the most widely used assay for detection of HPV is Hybrid Capture 2 (HC2). Objectives: We compare the HC2 with the real-time PCR hpVIR assay for detection of HPV in follow-up smears of 398 women diagnosed with atypical squamous cells of unknown significance (ASCUS) or low grade cervical intraepithelial neoplasia (CIN 1) in their initial smear. Study design: The two assays target the same set of high-risk (HR) HPVs with exception of HPV68. hpVIR identify individual or groups of HPV types as well as their viral load, while HC2 identify HR HPVs without specification of type. Results: 34% (131/391) of the women were positive with HC2 and 45% (175/391) with hpVIR. 16% (63/391) were positive only with hpVIR and among those with cytology available 6% (3/52) had a CIN 2. The 3% (13/391) of women positive only with HC2 either contained low-risk HPVs or copy numbers below the cut-off for the hpVIR assay. Conclusion: The hpVIR assay has a similar sensitivity and specificity as HC2, but hpVIR detect a higher frequency of high-risk HPV infections. © 2009 Elsevier B.V. All rights reserved.
1. Background Cervical cancer is the second most common female cancer worldwide and caused by persistent infection with oncogenic HPV.1 Access to organized cytological screening has reduced cervical cancer mortality by 40–80%2 but the decline has leveled off3 possibly due to women failing to attend screening and limitations in the screening technique.4 Approximately 40 of the more than 130 HPV types identified infect anogenital epithelia and 13 types are classified as high-risk types for cervical cancer.5–7 HPV testing has better sensitivity and negative predictive value compared to Pap-smear cytology but is inferior in specificity.8–11 HPV viral load has been proposed as a marker for persistent infection and risk of development of cervical lesions.12–19 HPV testing is approved by the US Food and Drug Administration (FDA) as triage for women whose Pap test has been classified as atypical squamous cells of unknown significance (ASCUS)20 and several studies have advocated HPV as triage in screening.10,11 A meta-analysis concluded that HPV typing is more accurate than cytology for triage of severe cervical lesions (grade cervical intraepithelial neoplasia (CIN) 2 or worse).21
∗ Corresponding author. Tel.: +46 18 4714804/+46 731 404522 (Mobile); fax: +46 18 4714808. E-mail address: [email protected] (I. Gustavsson). 1386-6532/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2009.04.012
A number of techniques22–24 are available for detection of HPV, with the Hybrid Capture 2 (HC2, Qiagen Inc.) being the most widely used. 2. Objectives Our objective was to compare HC2 with a real-time PCR assay (hpVIR) that allows individual or groups of high-risk HPVs to be identified, for the analysis of smears with ASCUS cytology or mild dysplasia (CIN 1). 3. Study design 3.1. Patients We analyzed cervical smears from 398 women living in Uppsala, Sweden, diagnosed with atypical squamous cells of unknown significance (ASCUS) or with low-grade cervical intraepithelial neoplasia (CIN 1) in the regular cytological screening program. After 3 months the women were invited for a second cytological examination and one smear was taken for cytology and a second sample for HPV analysis. The study was approved for the organized cytological screening in Uppsala, Sweden.
86
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
3.2. HPV typing Liquid based cytology has not been used in the gynaecological screening in Uppsala county and the routine for HPV testing using the HC2 assay has been to apply the cervical smear sample on a glass similar to that for the Pap test. The cells were fixed but not stained, and removed for the HC2 test by scraping. Therefore one cervical smear was stained for cytological investigation (Pap test) and a second used for HPV detection. The specimen taken for HPV detection was also divided in two parts and analyzed with two different methods: 3.2.1. Hybrid Capture 2 (HC2) To remove the cells from the glass, the Qiagen sampling brush was soaked in transport medium and used to dislodge half of the cells on the glass slide and these were processed according the manufacturer’s specifications to detect HPV DNA. The HC2 HR probe cocktail used is intended to detect HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68. 3.2.2. Real-time PCR (hpVIR) DNA from the cells of the second half of the slide was purified using the ABI PRISMTM 6100 Nucleic Acid Prep Station and the kit recommended by the manufacturer (Applied Biosystems, Inc., Foster City, CA, USA). HPV was detected using an updated version of a previously described real-time PCR-based assay25 with four parallel real-time PCRs from each DNA sample. One reaction is used to quantify the amount of a human single copy gene (house keeping gene) (HMBS, Homo sapiens hydroxymethylbilane synthase; GenBank accession no. M95623.1) and the three other reactions detects and quantifies the following HR HPVs, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, and 59. The result are presented as individual types, except for HPV18 and -45 which are detected as a group and HPV33, -52, and -58 which are also detected as a group. 3.2.3. Primers and probes Oligonucleotide primers and probes were designed using the Primer Express software (version 2.0; Applied Biosystems, Inc., Foster City, CA, USA). 3.2.4. Real-time PCR The real-time PCR assay was performed with the same volume and PCR cycle as described earlier.25 Standard curves ranging from 102 to 105 copies were established for each HPV type using plasmids containing the full genome of different HPV types. A highly significant linear relationship was seen between HPV copy number and threshold cycle (Ct ) for all HPV types (Fig. 1). The threshold for a positive HPV type was set to 10 copies per PCR. Similarly, a linear relationship was seen between copy number of the human HMBS gene and threshold cycle, and as threshold for inclusion in the study, a copy number of 10 genomic equivalents were used. 3.2.5. Direct sequencing Samples that were positive by HC2 but negative by hpVIR and with a Ct < 35 for the human single copy gene per PCR, were amplified with the GP5+/GP6+ PCR primer pair and the 150 bp amplicon sequenced. The GP5+/GP6+ PCR was performed in a 25 l volume containing 5 l template DNA, 1 u Taq polymerase platinum, 1× PCR buffer and 3.5 Mm MgCl2 (Invitrogen Corporation, Carlsbad, CA, USA), 0.5 M of each primer (Thermo Hybaid, Waltham, MA, USA), 200 M of each dNTP (Amersham, Uppsala, Sweden) and 3.1 g BSA (Sigma, St Louis, MO, USA). The thermal cycling consisted of an initial denaturation step (95 ◦ C, 10 min) followed by 40 cycles of denaturation (94 ◦ C, 30 s),
Fig. 1. Standard curves for HPV types detected by hpVIR assay. The threshold cycle (Ct ) number is plotted against number of HPV genomes (from plasmid dilutions). The points represent the mean of 6 independent measurements. (a) Standard curves for HPV16 (solid line), HPV31 (broken line) and HPV18/45 (dotted line) (reaction 1). r2 values: r2HPV16 = 0.9996; r2HPV31 = 0.9991; r2HPV18/45 = 0.9997. (b) Standard curves for HPV39 (solid line), HPV33/52/58 (broken line) and HPV35 (dotted line) (reaction 2). r2 values: r2HPV39 = 0.9971; r2HPV33/52/58 = 0.9987; r2HPV35 = 0.9998. (c) Standard curves for HPV59 (solid line), HPV51 (broken line) and HPV56 (dotted line) (reaction 4). r2 values: r2HPV59 = 0.9975; r2HPV51 = 0.9994; r2HPV56 = 0.9994.
annealing (48 ◦ C, 30 s) and elongation (72 ◦ C, 30 s), and terminated by an elongation step (72 ◦ C, 7 min). The HPV PCR products were incubated in 37 ◦ C for 30 min with 2 units each of Shrimp Alkaline Phosphatase (USB Corporation, Cleveland, Ohio, USA) and Exonuclease 1 (New England Biolabs, Ipswich, MA, USA), and the enzymes inactivated at 80 ◦ C for 15 min. The amplicons were sequenced in both directions, using Big Dye 1.1 terminator chemistry (Applied Biosystems, Inc., Foster City, CA, USA) and the Applied Biosystems 3700 automated sequencer. The DNA sequences were compared to the known HPV sequences using BLAST (www.ncbi.nlm.nih.gov/BLAST), with E-values from <5 × 10−22 to <5 × 10−47 and alignments ranging from 70 bp to 95 bp in length.
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
87
Table 1 PCR primers and probes used in reaction 1–4 of the hpVIR assay. Reaction
Specificity
Primer namea
Primer sequence (5 –3 )
Probe sequence with labeled b fluorofores (5 –3 )
ORFc
Amplicon (bp)
1 1 1 1 1 1 1
HPV16 HPV16 HPV31 HPV31 HPV18 & 45 HPV18 HPV45
F16 R16 F31 R31 F18 R18 R45
AGCTCAGAGGAGGAGGATGAA GGTTACAATATTGTAATGGGCTC ACGATTCCACAACATAGGAGGA TACACTTGGGTTTCAGTACGAGGT CATTTTGTGAACAGGCAGAGC ACTTGTGCATCATTGTGGACC CAACACCTGTGCATCATTCTGA
FAM-CAGCTGGACAAGCAGAA-MGB
E7
78
NED-CCAACATGCTATGCAACGT-MGB
E6
81
VIC-CACAGGCATTGTTCCAT-MGB
E1
79
2 2 2 2 2 2 2 2
HPV33 & -52 HPV33 HPV58 HPV52 & -58 HPV35 HPV35 HPV39 HPV39
F33 & 52 R33 F58 R52 & 58 F35 R35 F39 R39
CGTCGCAGGCGTAAACGT ACAGGAGGCAGGTACACTGTGG TGCGTCGCAGACGTAAACGT ACAGGAGGCAGGTACACAGTGG ACCAAAGCCTGCTCCGTG AGTCGCACTCGCTTGGTG CGAGCAATTAGGAGAGTCAGAGG TGTGTGACGCTGTGGTTCAT
FAM-CACAGGCATTGTTCCAT-MGB
L1
86
VIC-AATCACAAACGACTTCGAGGG-MGB
E4
104
NED-ACCATGCAGTTAATCAC-MGB
E7
103
3 3
HMBS HMBS
HMBSF HMBSR
GGGTGGGATTCCCATCAG CGTTCTTGGTCTGGGTCACTAA
VIC-ATGCACGGCTCTAG-MGB
Intron
63
4 4 4 4 4 4
HPV51 HPV51 HPV56 HPV56 HPV59 HPV59
F51 R51 F56 R56 F59 R59
GCAAAAATTGGTGGACGAAAA ACGTTGGACGGGGCAAT CTCCGGAGGAAAAGCAATTG GATTTCATCTAATAGCACATGGTTGG TCCTACACAACGACCATACAAACTG GAATATTCCTCTGCATGATATTCGC
NED-AAAGGTTCCATGAAATAG-MGB
E6
62
FAM-ATTGTGACAGAAAAAG-MGB
E6
65
VIC-CTGATTTGAGCACAACAT-MGB
E6
70
a b c
F: Forward and R: Reverse. The 3 end is labeled with a dark fluorofor, MGB = Minor Groove Binder. Open reading frame.
4. Results We have extended a previously described18,19,25,26 assay for HPV typing and adapted it for the ABI 7900 HT real-time PCR instrument. The primer and probe sequences are shown in Table 1. Using the hpVIR assay, 391 samples had more than 10 copies per PCR of the HMBS gene, while 7 samples had less than 10 copies and were excluded from the following analyses. Of the 391 samples, 131 (34%) were positive with HC2 and 175 (45%) were positive with the hpVIR assay. The most common single infection was HPV16 (35%) (Table 2). Among the 175 women positive with hpVIR, 65 (37.1%)
Table 2 Frequency of HPV types in single and multiple infections as determined by the hpVIR assay. HPV type
n
Frequency (%)a
Single infections 16 33/52/58 18/45 31 56 51 35 39 59
38 28 16 10 8 6 2 1 1
35 25 15 9 7 5 2 1 1
Multiple infectionsb 16 33/52/58 18/45 56 31 39 51 59 35
44 28 24 19 11 13 7 3 1
29 19 16 13 7 9 5 2 1
a The frequency was calculated on the total number of positive samples in each category. b Multiple infection = the specific HPV type in combination with one or several of the types detected by hpVIR.
contained multiple HPV types. The most common mixed infections were between HPV16 and the -33 group and between HPV16 and -18/45 (Table 3). The samples were divided in three groups; those positive with both assays (concordant) and those positive with only one of the two assays (discordant for either HC2 or hpVIR). The most common HPV types in the samples positive by both assays were HPV16 and the groups 33/52/58 and 18/45. 63 samples were positive with hpVIR and negative with HC2 (Table 3). To determine if hpVIR positive, HC2 negative, samples had lower amounts of HPV, we calculated HPV copy number and viral load (HPV copy number per human genome equivalent) in the samples with HPV16. Both the mean copy number and viral load were lower in the hpVIR positive, HC2 negative, samples (n = 16, mean copy number = 2,385, mean HPV16 viral load = 0.888) relative to samples that were positive by both assays (n = 50, mean copy number = 7,229, mean HPV16 viral load = 4.31). One of the samples that were negative with HC2 had
Table 3 Frequency of HPV types in different sets of samples as detected by HC2 and hpVIR. HPV typea 16 18/45 31 33/52/58 35 39 42 51 56 59 66 70 Not typed Total a b
hpVIR +ve, HC2 +ve 50 27 17 36 2 10
HC2 +ve, hpVIR −ve 1 1
HC2 −ve, hpVIR +ve 32 13 4 20 1 5
1 12 22 4
1 5 1 1 8
180b
High-risk HPV is shown in bold. Include mixed infections.
13
81b
88
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89
Table 4 Percentage of HPV positive samples in different CIN grades as detected by hpVIR and HC2.
Table 6 Sensitivity, specificity, PPV and NPV for the HC2 and hpVIR assays for different clinical outcomes.
Cytology classification
n
No atypia ASCUS CIN 1 CIN 2/3
273 31 30 33
% HC2
% hpVIR
Clinical endpoint
Indicator
20 39 73 85
35 45 77 91
Cytology, a CIN 2+
Sensitivity Specificity PPV NPV
85 73 24 98
91 60 18 99
Cytology, CIN 3
Sensitivity Specificity PPV NPV
100 70 9 100
100 57 7 100
Table 5 Cytology for samples with discordant HPV typing results. HPV typea
Number of specimens
HC2 +ve, hpVIR −ve 16 31 42 66 70 Not typedb
1 1 1 1 1 8
HC2 −ve, hpVIR +ve 16
21
18/45c 31 33/52/58d 35 51 56 Multiple infectionse
6 2 16 1 1 2 14
Cytology (number of specimens) CIN 2 (1) Na (1) ASCUS (1) CIN 1 (1) ASCUS (1) Na (6), ASCUS (1), Nav (1) Na (16), CIN 1 (1), CIN 2 (1), Ni (1), Nav (2) Na (4), ASCUS (2) Na (1), CIN 2 (1) Na (13), ASCUS (1), CIN 2 (1), Ni (1) Na (1) CIN 1 (1) Na (2) Na (12), ASCUS (2)
Notes: Na = no atypia, Nav = not available, and Ni = not identifiable. a High-risk HPV are shown in bold. b Not typed = no HPV type obtained. c HPV18 and -45 are detected together. d HPV33, -52 and -58 are detected together. e Multiple infection = combination of categories distinguishable with hpVIR.
high amounts of HPV16 (copy number = 26,000, viral load = 11.0) and was diagnosed as a CIN 3. In 13 samples the hpVIR assay was negative while HC2 was positive. Two of these samples contained HPV16 and one HPV31 at copy numbers below the cut-off for HPV positivity (10 HPV copies per PCR), three contained low-risk HPVs (HPV42, -70, -66) (Table 3), while the remaining 8 samples did not yield a PCR product. Cytology classification from the Pap test was available for 367 of the 391 smears (94%). The HPV positivity increased with the severity of the lesions for both methods (normal cytology hpVIR 35%, HC2 20%; ASCUS hpVIR 45%, HC2 39%; CIN 1 hpVIR 77%, HC2 73%; CIN 2/3, hpVIR 91%, HC2 85%) (Table 4). Among the 13 HC2 positive, hpVIR negative, samples for which cytology information was available, one had a CIN 2 (Table 5). This sample was HPV16 positive by hpVIR but below the threshold of 10 copies per PCR (3.3 copies). Among the 63 smears that were hpVIR positive and HC2 negative, 3 samples had a CIN 2 and either HPV16, -31 or 33/52/58 (detected as a group). The HPV16 positive sample had a high viral load (11.0) and the other two moderate viral loads (0.046 and 0.097). The HC2 and hpVIR assays showed similar specificity and sensitivity for the clinical endpoints of CIN 2 or more severe lesions (CIN 2+), or CIN 3 (Table 6). The PPV was relatively low for both assays while the NPV was very high, consistent with the well-known fact that lack of HPV infection is protective. The kappa value was 0.60 (SE = 0.040). The only moderate agreement indicated by the kappa value is due partly to the higher analytical sensitivity of the PCR assay compared to HC2, resulting in an additional set of samples being HPV positive only with PCR. A second reason is that the HC2 probe cocktail is known to cross-react with some HPV types not included in the PCR assay.
a
HC2 (%)
hpVIR (%)
CIN 2 + CIN 3.
5. Discussion We have further developed our real-time PCR assay to detect three more high-risk HPVs and compared this assay to HC2, using a set of follow-up samples from women with a previous indication of mild dysplasia or ASCUS. A number of samples typed positive with hpVIR but negative with HC2. This could either reflect false positive results for hpVIR or the higher technical sensitivity of the PCR-based hpVIR assay. 51% of the samples that were positive only with hpVIR contained HPV16, known as the most important oncogenic type. Among samples positive with HC2 but negative by hpVIR a high frequency was found to be low-risk HPVs, consistent with reports that HC2 cross-hybridizes to at least 15 low-risk HPVs.27 Three samples had a HPV copy number below the cut-off for the hpVIR assay and would have been regarded as positive using a cutoff of 1 rather than 10 copies per PCR in the hpVIR. For both assays the HPV detection rate increased with severity of the cervical abnormalities. hpVIR had a slightly higher detection rate for CIN 2/3 lesions as compared to HC2, presumably due to the higher technical sensitivity of hpVIR. The specificity of HC2 (73%) was somewhat higher than for hpVIR (60%). In summary, our results show that the hpVIR assay compares favorably to HC2 for identification of high-risk HPV infections in women at follow-up of cervical smears with undefined lesions. The hpVIR assay also provides HPV type information rather than a combined estimate of high-risk types. Another advantage of the hpVIR assay is the decreased probability of sample contamination, since the real-time PCR is an essentially closed system. The laboratory procedure for hpVIR is also easily adaptable to a 96-well plate format and readily amendable to automation, making it suitable for large scale testing of samples in follow-up or primary screening. Conflicts of interest None declared. Acknowledgements We are grateful to all patients for their participation in the study. This work was funded by grants from the Swedish Cancer society (Grant number: 08 0596) and Knut and Alice Wallenberg Consortium North (WCN). References 1. Parkin DM, Bray F, Ferlay J, Pisani P. Estimating the world cancer burden: Globocan 2000. Int J Cancer 2001;94:153–6. 2. Bergstrom R, Sparen P, Adami HO. Trends in cancer of the cervix uteri in Sweden following cytological screening. Br J Cancer 1999;81:159–66. 3. Anttila A, Pukkala E, Soderman B, Kallio M, Nieminen P, Hakama M. Effect of organised screening on cervical cancer incidence and mortality in Finland, 1963–1995: recent increase in cervical cancer incidence. Int J Cancer 1999;83:59–65.
I. Gustavsson et al. / Journal of Clinical Virology 45 (2009) 85–89 4. Horn PL, Lowell DM, LiVolsi VA, Boyle CA. Reproducibility of the cytologic diagnosis of human papillomavirus infection. Acta Cytol 1985;29:692–4. 5. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst 1995;87:796–802. 6. Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003;348:518–27. 7. Walboomers JM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189:12–9. 8. Cuzick J, Beverley E, Ho L, Terry G, Sapper H, Mielzynska I, et al. HPV testing in primary screening of older women. Br J Cancer 1999;81:554–8. 9. Schiffman M, Herrero R, Hildesheim A, Sherman ME, Bratti M, Wacholder S, et al. HPV DNA testing in cervical cancer screening: results from women in a high-risk province of Costa Rica. JAMA 2000;283:87–93. 10. Clavel C, Masure M, Bory JP, Putaud I, Mangeonjean C, Lorenzato M, et al. Human papillomavirus testing in primary screening for the detection of high-grade cervical lesions: a study of 7932 women. Br J Cancer 2001;84:1616–23. 11. Petry KU, Menton S, Menton M, van Loenen-Frosch F, de Carvalho Gomes H, Holz B, et al. Inclusion of HPV testing in routine cervical cancer screening for women above 29 years in Germany: results for 8466 patients. Br J Cancer 2003;88:1570–7. 12. Josefsson AM, Magnusson PK, Ylitalo N, Sorensen P, Qwarforth-Tubbin P, Andersen PK, et al. Viral load of human papilloma virus 16 as a determinant for development of cervical carcinoma in situ: a nested case-control study. Lancet 2000;355:2189–93. 13. Ylitalo N, Sorensen P, Josefsson AM, Magnusson PK, Andersen PK, Ponten J, et al. Consistent high viral load of human papillomavirus 16 and risk of cervical carcinoma in situ: a nested case-control study. Lancet 2000;355:2194–8. 14. Healey SM, Aronson KJ, Mao Y, Schlecht NF, Mery LS, Ferenczy A, et al. Oncogenic human papillomavirus infection and cervical lesions in aboriginal women of Nunavut, Canada. Sex Transm Dis 2001;28:694–700. 15. Sun CA, Liu JF, Wu DM, Nieh S, Yu CP, Chu TY. Viral load of high-risk human papillomavirus in cervical squamous intraepithelial lesions. Int J Gynaecol Obstet 2002;76:41–7. 16. Hernandez D, Ornelas L, Guido M, Apresa T, Alvarado I, Salcedo M, et al. Association between high-risk human papillomavirus DNA load and precursor lesions of cervical cancer in Mexican women. Gynecol Oncol 2003;90:310–7.
89
17. Dalstein V, Riethmuller D, Pretet JL, Le Bail Carval K, Sautiere JL, Carbillet JP, et al. Persistence and load of high-risk HPV are predictors for development of high-grade cervical lesions: a longitudinal French cohort study. Int J Cancer 2003;106:396–403. 18. Moberg M, Gustavsson I, Gyllensten U. Type-specific associations of human papillomavirus load with risk of developing cervical carcinoma in situ. Int J Cancer 2004;112:854–9. 19. Moberg M, Gustavsson I, Wilander E, Gyllensten U. High viral loads of human papillomavirus predict risk of invasive cervical carcinoma. Br J Cancer 2005;92:891–4. 20. Wright Jr TC, Cox JT, Massad LS, Twiggs LB, Wilkinson EJ. 2001 Consensus Guidelines for the management of women with cervical cytological abnormalities. JAMA 2002;287:2120–9. 21. Arbyn M, Buntinx F, Van Ranst M, Paraskevaidis E, Martin-Hirsch P, Dillner J. Virologic versus cytologic triage of women with equivocal Pap smears: a metaanalysis of the accuracy to detect high-grade intraepithelial neoplasia. J Natl Cancer Inst 2004;96:280–93. 22. Carozzi F, Bisanzi S, Sani C, Zappa M, Cecchini S, Ciatto S, et al. Agreement between the AMPLICOR Human Papillomavirus Test and the Hybrid Capture 2 assay in detection of high-risk human papillomavirus and diagnosis of biopsy-confirmed high-grade cervical disease. J Clin Microbiol 2007;45: 364–9. 23. Soderlund-Strand A, Rymark P, Andersson P, Dillner J, Dillner L. Comparison between the Hybrid Capture II test and a PCR-based human papillomavirus detection method for diagnosis and posttreatment follow-up of cervical intraepithelial neoplasia. J Clin Microbiol 2005;43: 3260–6. 24. Kulmala SM, Syrjanen S, Shabalova I, Petrovichev N, Kozachenko V, Podistov J, et al. Human papillomavirus testing with the hybrid capture 2 assay and PCR as screening tools. J Clin Microbiol 2004;42:2470–5. 25. Moberg M, Gustavsson I, Gyllensten U. Real-time PCR-based system for simultaneous quantification of human papillomavirus types associated with high risk of cervical cancer. J Clin Microbiol 2003;41:3221–8. 26. Josefsson A, Livak K, Gyllensten U. Detection and quantitation of human papillomavirus by using the fluorescent 5 exonuclease assay. J Clin Microbiol 1999;37:490–6. 27. Poljak M, Marin IJ, Seme K, Vince A. Hybrid Capture II HPV Test detects at least 15 human papillomavirus genotypes not included in its current high-risk probe cocktail. J Clin Virol 2002;25(Suppl. 3):S89–97.