Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3′H1 sequences between Tulipa fosteriana ‘Albert heijn’ and its reddish sport

Scientia Horticulturae 175 (2014) 16–26

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Comparison of anthocyanin components, expression of anthocyanin biosynthetic structural genes, and TfF3 H1 sequences between Tulipa fosteriana ‘Albert heijn’ and its reddish sport Yuan Yuan, Xiaohong Ma, Dongqin Tang ∗ , Yimin Shi ∗∗ School of Agriculture & Biology, Shanghai Jiao Tong University, Shanghai 200240, China

a r t i c l e

i n f o

Article history: Received 9 December 2013 Received in revised form 14 May 2014 Accepted 20 May 2014 Keywords: Tulip F3 H Flower color Anthocyanin Promoter Mutation

a b s t r a c t A reddish flower tulip sport Tulipa fosteriana ‘SN09’ was bred from a pink flower cultivar T. fosteriana ‘Albert heijn’ (AH). To investigate the molecular basis underlying this color difference, SN09 and AH were compared using biochemical and molecular approaches. Ultra performance liquid chromatography (UPLC) profiles revealed that major cyanidin 3-rutinoside and minor pelargonidin 3-rutinoside were accumulated in the petals of AH, whereas major pelargonidin anthocyanins (pelargonidin 3-acetylrutinoside and pelargonidin 3-rutinoside) and minor cyanidin 3-glucoside were detected in SN09. The total anthocyanin content in petals of AH and SN09 were not significantly different at Stage 4, and correlated with the expression patterns of dihydroflavonol 4-reductase (TfDFR1) and anthocyanidin synthase (TfANS1). In addition, more transcripts of chalcone synthase (TfCHS1), chalcone isomerase (TfCHI2), and flavanone 3hydroxylase (TfF3H1) contributed to higher accumulation of flavone and flavonol in SN09 than in AH. The transcription of flavonoid 3 -hydroxylase (TfF3 H1) was significantly lower in SN09 than in AH throughout flower development. Accordingly, the nucleotide sequences of TfF3 H1 in AH and SN09 were compared. Results showed that the deduced amino acids of TfF3 H1 in AH and SN09 were not different, but an extra fragment (255 bp) was found in the promoter of TfF3 H1 in SN09. Consequently, the promoters of TfF3 H1 in AH and SN09 were isolated, fused with the ˇ-glucuronidase (GUS), and then transformed to tobacco and Arabidopsis thaliana. Results demonstrated that the GUS activity in Arabidopsis with TfF3 H1 promoter from SN09 was only 5.4% of that from AH, suggesting that the insert mutation in the TfF3 H1 promoter hampered the accumulation of cyanidin anthocyanins in SN09 through the reduction of TfF3 H1 transcription. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Natural flower pigments generally consist of complex secondary metabolites, such as flavonoids, carotenoids and betalains (Tanaka et al., 2008). Among them, a colored class of flavonoids called anthocyanins confers a diverse range of colors from orange to red to violet and blue (Tanaka and Brugliera, 2013). Generally colorless

Abbreviations: ANS, anthocyanidin synthase; CaMV 35S, cauliflower mosaic virus 35S promoter; CHI, chalcone isomerase; CHS, chalcone synthase; DFR, dihydroflavonol 4-reductase; F3H, flavanone 3-hydroxylase; F3 H, flavonoid 3 hydroxylase; F3 5 H, flavonoid 3 ,5 -hydroxylase; FLS, flavonol synthase; FNS, flavone synthase; GUS, ˇ-glucuronidase; UPLC, ultra performance liquid chromatography. ∗ Corresponding author. Tel.: +86 21 34205730; fax: +86 21 34205730. ∗∗ Corresponding author. E-mail addresses: [email protected] (D. Tang), [email protected] (Y. Shi). http://dx.doi.org/10.1016/j.scienta.2014.05.032 0304-4238/© 2014 Elsevier B.V. All rights reserved.

(or weakly colored) flavones and flavonols stabilize and maintain anthocyanins in their colored forms (Asen et al., 1971). Carotenoids and betalains generally yield yellow or red colors (Tanaka et al., 2008). The biochemistry, genetics, and molecular biology of flavonoids, particularly with regard to anthocyanin pigmentation, have been well studied in Zea mays, Petunia hybrida, Antirrhinum majus, and Arabidopsis thaliana (Mol et al., 1998; Winkel-Shirley, 2001). Although hundreds of anthocyanins have been reported, reports have focused primarily on six common anthocyanidins: pelargonidin, cyanidin, peonidin, delphinidin, petunidin and malvidin. The biosynthetic pathway of cyanidin-, pelargonidin-, and delphinidinbased anthocyanins is illustrated in Fig. 1. Genes involved in this pathway include chalcone synthase (CHS), chalcone isomerase (CHI), flavanone 3-hydroxylase (F3H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS), UDP-glucose: anthocyanidin 3-O-glucosyltransferase (3GT), and modification genes (Grotewold,

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

17

Fig. 1. A simplified anthocyanin biosynthesis pathway. The enzymes for each step are indicated by uppercase letters. Abbreviations: CHS, chalcone synthase; CHI, chalcone isomerase; F3H, flavanone 3-hydroxylase; F3 H flavonoid 3 -hydroxylase; F3 5 H, flavonoid 3 ,5 -hydroxylase; FLS, flavonol synthase; FNS, flavone synthase; DFR, dihydroflavonol 4-reductase; ANS, anthocyanidin synthase; 3GT: UDP-glucose: anthocyanidin 3-O-glucosyltransferase.

2006) (Fig. 1). The hydroxylation pattern of the B-ring of dihydrokaempferol (DHK) in this pathway is of central importance in determining flower color. The B-ring of DHK being hydroxylated at the 3 position by F3 H leads to the synthesis of the pink-to-magenta cyanidin-based anthocyanins, being hydroxylated at the 3 and 5 positions by F3 5 H leads to the synthesis

of the violet-to-blue delphindin-based anthocyanins, and lack of hydroxylation leads to the synthesis of orange-to-red pelargonidinbased anthocyanins (Grotewold, 2006) (Fig. 1). In general, flowers that accumulate pelargonidin-based anthocyanins are postulated to carry mutations controlling F3 H activity (Forkmann, 1994).

18

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

Tulip (T. fosteriana) is a perennial, bulbous plant belonging to genus Tulipa, Liliaceae. Tulips are important commercial bulbous flowers that are widely used due to their wide variation in flower form and color. Detailed flower color analyses performed on tulips since the 1950s have revealed that the color of the tulip flower is determined by certain pigments: red, orange, pink, and purple colors are attributed to anthocyanin, and yellow color to carotenoid (Nieuwhof et al., 1990). In addition, 11 anthocyanins: 3-glucoside and 3-rutinoside of pelargonidin, cyanidin, and delphinidin; 3-acetylrutinoside of pelargonidin and cyanidin; two novel delphinidin 3-rutinosides with the acetyl group; and delphinidin 3,5-diglucoside have been identified in tulips (Torskangerpoll et al., 1999, 2005; Nakayama et al., 1999). However, little attention has been paid to the molecular mechanisms related to tulip flower pigmentation, in particular to anthocyanin biosynthesis in tulips. Moreover, the molecular mechanisms of flower color mutation in tulips have been rarely considered. Through selective breeding, a bud sport T. fosteriana ‘SN09’ with reddish flower was bred through spontaneous mutants from a pink flower tulip cultivar T. fosteriana ‘Albert heijn’ (AH). Most of the biological features of SN09, except for flower color, are identical with those of AH. However, the biochemical and molecular basis underlying the color change is still unclear. In this study, SN09 was compared with AH in terms of anthocyanin components, transcriptional profiles of anthocyanin biosynthetic structural genes previously isolated from T. fosteriana, and TfF3 H1 sequences (the key gene for the biosynthesis of cyanidin derivatives) to aid in understanding the color change in SN09 flower. 2. Materials and methods 2.1. Plant materials The pink flower tulip cultivar T. fosteriana ‘Albert heijn’ (AH) (Fig. 2A) and its reddish flower bud sport T. fosteriana ‘SN09’ (SN09) (Fig. 2B) were grown in the farms of Shanghai Jiao Tong University, Shanghai, China. For the measurement of total anthocyanin (TA) and total flavone and flavonol (TF) contents, and the expression analysis of anthocyanin biosynthetic structural genes, petal samples were collected at four different flower developmental stages, which were defined in our previous study (Yuan et al., 2013). Petal samples for the anthocyanin components analysis were collected at Stage 4. All samples were stored at −80 ◦ C till use. 2.2. Determination of TA, TF contents and analysis of anthocyanin components Fresh petal samples (0.5 g) were ground in liquid nitrogen and then extracted using 2 ml mixture solution (methanol: water: formic acid: trifluoroacetic acid = 70:27:2:1, v/v) with gentle shaking at 4 ◦ C for 24 h. Extracts were spun for 10 min at 12,000 rpm, leaving the extracts in the supernatant (Zhang et al., 2007). The supernatant liquid was filtered through sheets of filter paper (Hangzhou Special Paper Industry, China), and then filtered through a 0.22 ␮m filter (Millipore, USA). Chromatographic analysis was carried out by ultra-high performance liquid chromatography (UPLC; ACOUITY UPLC@ Online Community, Waters, USA) equipped with Waters ACQUITY Sample Manager, photodiode array spectra (PDA) e␭ detector and a reverse phase column ACQUITY UPLC@ BEH C18 (2.1 mm × 100 mm, 1.7 ␮m). Two solvents were used for elution at 45 ◦ C for 15 min with a flow rate of 0.5 ml min−1 : A (formic acid: water = 0.1: 99.9, v/v), B (formic acid:acetonitril = 0.1:99.9, v/v). The elution program was set as follows: initial, 93% A, 7% B; 1 min, 93% A, 7% B; 11 min, 82% A, 18% B; 11.5 min, 10% A, 90% B; 13 min, 10% A, 90% B; 13.1 min,

Fig. 2. UPLC profiles of anthocyanins in petals of T. fosteriana ‘Albert heijn’ (AH) (A), T. fosteriana ‘SN09’ (B), and T. ‘Pink Impression’ (PI) (C), and cyanidin 3-glucoside (D). Anthocyanin extracts from petals of AH, SN09, and PI, and the authentic standard cyanidin 3-glucoside were subjected to UPLC–Q-TOF–MS analysis as described in Section 2.

93% A, 7% B; 15 min, 93% A, 7% B. Aliquots of 2 ␮l were injected. PDA spectra were recorded between 200 nm and 800 nm. Each peak was preliminary identified by UPLC–quadruple–time of flight–mass spectrometry (UPLC–Q-TOF–MS, Waters, USA). The MS analysis was performed in positive ionization mode at the following operating conditions: gas (N2 ) temperature, 350 ◦ C; gas flow, 500 l h−1 ; reference cone voltage, 35.0 V; capillary, 3.0 kv; ion energy, 1.0; collision energy, 6.0 ev; mass range, m/z 100–1500 . The temperature was set at 45 ◦ C. Each peak was further confirmed from retention time and UV–vis spectral data by comparing with the anthocyanin components in Tulipa ‘Pink Impression’ (PI) (Torskangerpoll et al., 2005) and authentic standard. The quantification of TA and TF contents in different petal samples was measured semi-quantitatively from a simple linear regression using cyanidin (Sigma) for TA and rutin (quercetin 3rutinoside, Sigma) for TF as standards at 520 nm and 350 nm, respectively. TA and TF contents were calculated in microgram per gram fresh weight (as a quantity of cyanidin ␮g g−1 , and as a quantity of rutin ␮g g−1 , respectively) (Zhang et al., 2008). The individual anthocyanin content at each developmental stage was calculated according to its percentage in TA at the corresponding stage. 2.3. Real-time quantitative PCR analysis Total RNAs were extracted from petal samples using Plant RNAprep pure Kit (Tiangen, China). First strand cDNA was synthesized from total RNA using PrimeScriptTM RT reagent Kit (TaKaRa, China) according to the manufacturer’s instructions. For real-time quantitative PCR, 1.6 ␮l of dilute (1:50) RT reaction product (cDNA) were used in a 20 ␮l PCR reaction containing 0.2 ␮M of each primer, 10 ␮l SYBR® Premix Ex TaqTM II (TaKaRa, China) and 7.6 ␮l deionized water. The specific primers for the anthocyanin biosynthetic structural genes, namely, TfCHS1 (GenBank: KC261503), TfCHI2 (GenBank: KF792731), TfF3H1 (GenBank: KC261504), TfF3 H1

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

19

Table 1 Sequences of primers used in this study. The restriction enzyme sites Pst I and EcoR I were underlined. Primer name

Primer sequence (5 to 3 )

Description

TfCHS1-qF TfCHS1-qR TfCHI2-qF TfCHI2-qR TfF3H1-qF TfF3H1-qR TfF3 H1-qF TfF3 H1-qR TfDFR1-qF TfDFR1-qR TfANS1-qF TfANS1-qR TgActin-qF TgActin-qR

AGCCAGACCATCCTCCCA GCCAGCTTCAACTCCACC TTTCACTGTCATAGGCGTCT ACCTTCTGCGTGTATTGTTC GGCACCATCACCCTCCTT CGATAGACGGCTGCTGTTC CCTTCCTCCAAGCCATCA GTCGCTACCTTTCACATCCA GGCTGACGAACGGCTGACT TCCCAGCAGAGGATGTGAAG CGTCAGCTCCCTCACCTT TCCGAACCCTGTCCTTGT AGTCAGTCATACAGTGCCAATC TCATAAGAGAGTCGGTCAAATCC

Real-time PCR primers for six anthocyanin biosynthetic structural genes

TfF3 H1-F TfF3 H1-R

ATGGAAGCTCAACCTCTCCTCCT TCACTCCTTCCCATACGCCCTCGCT

Primers for cloning TfF3 H1AH and TfF3 H1SN

F GW1 F GW2 F GW3

GGAAGCGGAAGCGAGATCACGAGC CGATTGCTGAAGTTGGCATCGTGG AAGAGGGGACCGTGGATCTTGGAG

Primers for cloning the 5 flanking regions of TfF3 H1 in AH and SN09

PTfF3 H1-F PTfF3 H1-R

AACTGCAGGCAGGTCTATGGTCAGAGAACAG CGGAATTCGGTGGGTGAGGAATGTGGCGGT

Primers for cloning PTfF3 H1AH and PTfF3 H1SN

(GenBank: KC261505), TfDFR1 (GenBank: KC261506) and TfANS1 (GenBank: KC261507) were shown in Table 1. The PCR reactions were performed on a Chromo4 opticon Thermal Cycler (Bio-Rad, USA) with a temperature program starting with 3 min at 94 ◦ C, followed by 40 cycles of 15 s at 94 ◦ C, 20 s at 56 ◦ C and 25 s at 72 ◦ C. Fluorescence was measured at the end of each annealing step. Amplification was followed by a melting curve analysis. The expression of each gene was calculated by the comparative Ct method (Simon, 2003), which based on the relative expression of the target gene versus the reference gene TgActin (GenBank: AB456684).

2.4. Isolation of coding and 5 flanking regions of TfF3 H1 in AH and SN09 To isolate the coding regions of TfF3 H1 in AH and SN09, firststrand cDNA was synthesized using PrimeScriptTM  1st Strand cDNA Synthesis Kit (TaKaRa, China) from total RNA extracted from petal samples at Stage 4. Coding regions of TfF3 H1 in AH and SN09 were amplified by using high-fidelity PrimeSTAR® Max DNA Polymerase (TaKaRa, China) and designated as TfF3 H1AH and TfF3 H1SN, respectively. The primers were designed according to the open reading frame (ORF) sequences of TfF3 H1 in AH and SN09 (Table 1). The reaction mixture in a total volume of 50 ␮l contained 25 ␮l PrimeSTAR Max Premix, 1 ␮l first strand cDNA, 2 ␮l of each primer (10 ␮M), and 20 ␮l sterilized distilled water. The PCR cycling parameters were as follows: 3 min at 94 ◦ C, followed by 35 cycles of 10 s at 98 ◦ C, 15 s at 56 ◦ C, 2 min at 72 ◦ C, and 10 min at 72 ◦ C. The amplified fragments, after treated by DNA A-Tailing Kit (TaKaRa, China), were subcloned into the pMD18-T vector (TaKaRa, China) and sequenced by the Invitrogen Trading (Shanghai) Co., Ltd (Shanghai, China). The 5 flanking regions of TfF3 H1 in AH and SN09 were isolated using Genome Walking Kit (TaKaRa, China) according to the manufacturer’s instructions. Total genomic DNA were isolated from AH and SN09 using the CTAB method (Tai and Tanksley, 1990). The specific primers for isolation were shown in Table 1. The amplified fragments were subcloned and sequenced as described above. The putative transcriptional start site (TSS) and cis-elements in the 5 flanking region of TfF3 H1AH were predicted by the Softberry database (http://linux1.softberry.com/berry.phtml?topic=tsssp &group=programs&subgroup=promoter) and the PLACE database

(http://www.dna.affrc.go.jp/cDNA/place), respectively (Lescot et al., 2002). 2.5. Construction of the PTfF3 H1AH-GUS and PTfF3 H1SN-GUS fusion vectors To construct the binary vectors consisting of ˇ-glucuronidase (GUS) coding sequence driven by the promoters of TfF3 H1AH and TfF3 H1SN, 820 and 1075 bp of the 5 flanking regions of TfF3 H1AH and TfF3 H1SN were isolated from AH and SN09 using the same specific primers, named PTfF3 H1AH and PTfF3 H1SN, respectively. The forward primer contained a Pst I restriction site, and the reverse primer included an EcoR I restriction site. The amplification of PTfF3 H1AH and PTfF3 H1SN was performed using PrimeSTAR® Max DNA Polymerase (TaKaRa, China) as described above. The Pst I/EcoR I DNA fragments were cloned into the corresponding sites of pCambia1391Z to construct the PTfF3 H1AH-GUS and PTfF3 H1SNGUS fusion vectors. The vectors, pCambia1391Z and PBI121 (GUS is regulated by the CaMV 35S promoter) were used as the negative and positive control, respectively. These constructs, verified by sequencing, were introduced into Agrobacterium tumefaciens strain GV3101 by the freeze-thaw method (Holsters et al., 1978). 2.6. Agrobacterium-mediated transient expression in tobacco leaves and transformation of Arabidopsis To evaluate whether the promoter activity of PTfF3 H1SN differed from that of PTfF3 H1AH, the Agrobacterium-mediated transient expression assays were performed using tobacco (Nicotiana benthamiana) leaves according to the method described by Kapila et al. (1997). Three leaves were infiltrated and served as replications. After infiltration, plants were grown in an artificial climate chamber for 3–5 days at a constant temperature of 28 ◦ C. To determine the exact GUS activity driven by PTfF3 H1AH and PTfF3 H1SN, the Agrobacterium-mediated transformations of A. thaliana (Columbia ecotype) were carried out using the floral dip method (Zhang et al., 2006). For each construct, the transformed tobacco leaves, and the hygromycin-resistant (for pCambia 1391Z and fusion vectors) and kanamycin-resistant (for pBI121) independent transgenic Arabidopsis seedlings were used for histochemical staining. Three of transgenic Arabidopsis seedlings were randomly selected for GUS quantitative analysis.

20

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

2.7. GUS activity assay GUS histochemical staining of transformed tobacco leaves and transgenic Arabidopsis seedlings was performed according to the method described by Jefferson (1987). The GUS activities in the transgenic Arabidopsis seedlings were measured using 4-methyl umbelliferyl ˇ-d-glucuronide (MUG, Sigma) as the substrate (Jefferson, 1987). Quantitative fluorometric assays of GUS activity were carried out using a Hitachi 850 Fluorescence spectrophotometer (Hitachi, Japan). Relative GUS activity was expressed as picomole MUG per minute per milligram protein. Total protein concentration was determined according to the method described by Bradford (1976). Three replicates were performed for each sample. 2.8. Statistical analysis Data were shown by the mean ± SE of three replicates. Data were analyzed using variance (ANOVA), and the means were compared by the Duncan’s New Multiple Range test (P < 0.05) using the SPSS 11.5 software package (SPSS, USA). 3. Results 3.1. Anthocyanin components in the petals of AH and SN09 The UPLC chromatogram of anthocyanin components captured at 520 nm, shows two peaks (Peaks 3 and 4) and four peaks (Peaks 1, 2, 4, 5) in the petals of AH and SN09, respectively (Fig. 2A and B). The UPLC retention time (tR ), UV–vis spectral properties, and mass spectrometric data are summarized in Table 2. Both Peaks 1 and 3 produced the fragment ion at m/z 287, which is the typical ion for cyanidin, indicating that they were cyanidin derivatives. They exhibited molecular ions at m/z 449 and 595, respectively, which could be fragmented into the major fragment at m/z 287 by the loss of a glucose and a rutinose, respectively. Peaks 2, 4, and 5 produced the fragment ion at m/z 271 and exhibited molecular ions at m/z 595, 579, and 621, respectively. Given that m/z 271 is the typical ion for pelargonidin, the results suggest that the ions were pelargonidin plus glucosylglucose, rutinose, and acetylated rutinose, respectively. The ratios of A440 /Avis-max of Peaks 1 to 5 were 23.7%, 36.0%, 25.6%, 35.0%, and 34.7%, respectively, indicating that each glycoside was linked to the 3-position of the corresponding anthocyanidin (Giusti and Wrolstad, 2001). In addition, the spectral datum for the A310 /Avis-max of Peak 5 was 71.2%, suggesting the anthocyanidin was acetylated (Giusti and Wrolstad, 2001). According to the mass spectrometric and UV–vis spectra data, Peaks 1–5 were tentatively identified as cyanidin 3glucoside, pelargonidin 3-glucosylglucoside, cyanidin 3-rutinoside, pelargonidin 3-rutinoside, and pelargonidin 3-acetylrutinoside, respectively. These anthocyanins were further confirmed by comparing with the anthocyanin components in PI (cyanidin 3-rutinoside, 11.6%; pelargonidin 3-rutinoside, 73.4%; and pelargonidin 3acetylrutinoside, 15.0%) (Torskangerpoll et al., 2005) and authentic standard. Results showed that Peaks 1, 3, 4, and 5 were found to correspond with cyanidin 3-glucoside, cyanidin 3-rutinoside, pelargonidin 3-rutinoside, and pelargonidin 3-acetylrutinoside respectively (Fig. 2). Peak 2, which was tentatively identified as pelargonidin 3-glucosylglucoside for the first time in this study, could not be confirmed by published data or authentic standard currently. In conclusion, two anthocyanin pigments, namely, cyanidin 3-rutinoside and pelargonidin 3-rutinoside, were found to accumulate in the petals of AH. Four anthocyanin pigments, including cyanidin 3-glucoside, pelargonidin 3-rutinoside, pelargonidin

Fig. 3. Total anthocyanin (TA) (A) and total flavone and flavonol (TF) (B) contents in the petals of AH and SN09 at four developmental stages. The content of individual anthocyanin in AH and SN09 (C) at each stage was calculated according to its percentage in TA at the corresponding stage. Pigment extracts were subjected to UPLC analysis to determine the TA and TF contents. The contents of TA and TF were calculated in microgram per gram fresh weight (as a quantity of cyanidin and rutin ␮g g−1 , respectively). The vertical bars represent S.E. for three replicate measurements. Significant differences at 0.05 level between two values were indicated by different lowercase letters.

3-acetylrutinoside, and an unconfirmed anthocyanin, were found to accumulate in the petals of SN09. 3.2. Changes in TA, TF, and individual anthocyanin contents in the petals of AH and SN09 throughout flower development In both AH and SN09, TA content increased constantly during flower development, whereas TF content decreased slightly and showed no significant differences among different stages (Fig. 3A and B). The TA content was not significantly different between AH and SN09 at Stage 4, but the TF content in SN09 was significantly higher than that in AH at each stage (Fig. 3A and B). The individual anthocyanin content of AH and SN09 constantly increased during flower development (Fig. 3C). In AH, cyanidin 3rutinoside accumulated faster than pelargonidin 3-rutinoside. The cyanidin 3-rutinoside and pelargonidin 3-rutinoside contents at Stage 4 were 13.4- and 7.9-fold higher, respectively, than those at Stage 1. In addition, the percentage of cyanidin 3-rutinoside

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

21

Table 2 The UPLC retention time (tR ), UV–vis spectral properties, mass spectrometric data, and identification of anthocyanin components in petal samples of AH and SN09. Peak

tR (min)

M+ (m/z)a

MS (m/z)

UV–vis absorption max (nm)b

1 2 3 4 5 a b

2.43 3.19 3.22 4.28 7.60

449.1 595.2 595.2 579.2 621.2

287.0 271.0 287.0 271.0 271.0

518 508 523 508 512

Identification A440 /Avis-max (%) 23.7 36.0 25.6 35.0 34.7

A310 /Avis-max (%) 13.6 11.9 12.9 10.6 71.2

Cyanidin 3-glucoside Unconfirmed anthocyanin Cyanidin 3-rutinoside Pelargonidin 3-rutinoside Pelargonidin 3-acetylrutinoside

M+ : molecular ion. max : maximum absorption wavelength in visible (nm).

in TA increased from 69.5% to 79.4% during flower development, and the percentage of pelargonidin 3-rutinoside in TA decreased correspondingly. By contrast, pelargonidin derivatives accumulated rapidly in SN09 during development. Among these anthocyanins, pelargonidin 3-acetylrutinoside content increased most remarkably from 10.4 ␮g g−1 to 265.1 ␮g g−1 , exhibiting a 25.4-fold increase. At Stage 4 of flower development, major cyanidin 3-rutinoside (79.4%) and minor pelargonidin 3-rutinoside (20.6%) had accumulated in the petals of AH. Conversely, major pelargonidin derivatives (pelargonidin 3-acetylrutinoside, 75.3% and pelargonidin 3-rutinoside, 9.4%) and minor cyanidin 3-glucoside (3.7%) had accumulated in the petals of SN09. The cyanidin and pelargonidin anthocyanins content in the petals of AH were 20.6- and 0.2-fold, respectively, of the corresponding anthocyanidin-based anthocyanins in the petals of SN09. 3.3. Transcriptional profiles of anthocyanin biosynthetic structural genes in AH and SN09 throughout flower development The temporal expression profiles of six anthocyanin biosynthetic structural genes, namely, TfCHS1, TfCHI2, TfF3H1, TfF3 H1, TfDFR1 and TfANS1, in AH and SN09 were compared. The transcript levels of all test genes increased gradually during flower development in both AH and SN09 (Fig. 4). The genes showed different transcriptional profiles between AH and SN09 could be classified into three groups. Group one included TfCHS1, TfCHI2, and TfF3H1, whose transcriptions were significantly higher in SN09 than in AH at most stages (Fig. 4A–C). The expression levels of TfCHS1, TfCHI2, and TfF3H1 in SN09 were 2.5-, 1.6-, and 2.7-fold higher, respectively, than those in AH at Stage 4. Group two only included TfF3 H1, whose transcription was significantly lower in SN09 than in AH at every stage (Fig. 4D). The expression levels of TfF3 H1 in AH were 13.9-, 16.3-, 19.6-, and 23.3-fold, higher than those in SN09 at each stage. Group three included TfDFR1 and TfANS1, whose expression levels showed no significant difference between AH and SN09 at most stages, particularly at Stage 4 (Fig. 4E and F). 3.4. Sequence comparison of coding and promoter regions of TfF3 H1 between AH and SN09 The coding regions of TfF3 H1 from AH and SN09 were isolated and designated as TfF3 H1AH and TfF3 H1SN, respectively (GenBank: KC256779 and KC256780). Ten independent clones carrying TfF3 H1AH and TfF3 H1SN were sequenced. The results showed that TfF3 H1AH and TfF3 H1SN were both 1533 bp in length. Eleven different nucleotides were found between TfF3 H1AH and TfF3 H1SN at positions 291, 321, 360, 465, 543, 591, 837, 1107, 1245, 1351, and 1464 bp from the translation start codon. However, the different nucleotides did not result in any difference in the deduced amino acid residue (Fig. 5). Furthermore, the 5 flanking regions of TfF3 H1AH (1901 bp in length) and TfF3 H1SN (1646 bp in

length) were amplified and sequenced (GenBank: KF146886 and KF751606). The results showed no difference except for an extra fragment with a length of 255 bp found in the 5 flanking region of TfF3 H1SN at 326 bp upstream of the ATG translation start codon, unlike in the corresponding region of TfF3 H1AH (Fig. 6A). BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) results indicated that the inserted fragment was not homologous with any landed sequence in the GenBank. After detailed comparison, the nucleotide sequence of this fragment also exhibited no terminal inverted repeats, no features of the hAT or CACTA families, or miniature inverted repeat transposable elements (Kunze and Weil, 2002) (Fig. 6B). 3.5. Expression of TfF3 H1 promoter-GUS fusion The putative TSS and cis-elements in the 5 flanking region of TfF3 H1AH were predicted by the Softberry and PLACE databases. The results showed that the putative TSS was located at 24 bp upstream of the ATG translation start codon, and the inserted fragment was located between the CAAT boxes and the TATA box (Fig. 6C). Based on promoter prediction, 820 bp (−796 to +24 relative to the TSS) and 1075 bp (−1051 to +24 relative to the TSS) of the 5 flanking regions of TfF3 H1AH and TfF3 H1SN were isolated using the same specific primers, and named PTfF3 H1AH and PTfF3 H1SN, respectively. Then plant expression vectors were constructed by fusing PTfF3 H1AH and PTfF3 H1SN with the GUS gene (Fig. 7A), after which they were transformed to tobacco leaves. Histochemical staining showed that an apparent blue color appeared in the leaf tissues transformed with the PTfF3 H1AH-GUS and CaMV 35SGUS expression vectors, whereas a faint blue color appeared in leaf tissues transformed with PTfF3 H1SN-GUS expression vector. No blue color was seen in the tissues transformed with pCambia1391Z (Fig. 7B), indicating that PTfF3 H1AH drove high GUS expression, but the GUS expression driven by PTfF3 H1SN was too weak to be identified. To determine the exact GUS activity driven by PTfF3 H1AH and PTfF3 H1SN, the plant expression vectors were further individually transformed into A. thaliana using the floral dip method. Transgenic lines carrying pCambia1391Z (5 lines), PTfF3 H1AH-GUS (5 lines), PTfF3 H1SN-GUS (4 lines), and CaMV35S-GUS (7 lines) were regenerated, and all hygromycin- and kanamycin-resistant independent transgenic plants were confirmed through PCR (data not shown). The histochemical staining results of the transgenic Arabidopsis seedlings were consistent with the results of the transformed tobacco leaves (Fig. 7C). Promoter activity was evaluated by detecting GUS activity. In the transformed seedlings, high levels of GUS activity were detected under the control of PTfF3 H1AH and CaMV35S, whereas very weak GUS expression was detected under the control of PTfF3 H1SN. Almost no GUS activity was observed in the negative control (Fig. 7D). The GUS activity driven by PTfF3 H1AH was 92.3% of that driven by CaMV35S, showing no significant difference, whereas the GUS activity driven by PTfF3 H1SN

22

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

Fig. 4. Transcriptional profiles of six anthocyanin biosynthetic genes in petals of AH and SN09 during flower development. TgActin (AB456684) was used as internal control. Six genes were investigated, including TfCHS1 (KC261503) (A), TfCHI2 (KF792731) (B), TfF3H1 (KC261504) (C), TfF3 H1 (KC261505) (D), TfDFR1 (KC261506) (E) and TfANS1 (KC261507) (F). The vertical bars represent S.E. for three technological replicate reactions. Significant differences at 0.05 level between two values for each gene were indicated by lowercase letters.

was only about 5.4% of the activity driven by PTfF3 H1AH in Arabidopsis seedlings (Fig. 7D). 4. Discussion High-performance liquid chromatography with mass spectrometry (HPLC–MS) is commonly used to identify anthocyanin components in flowers, such as peonies (Jia et al., 2008; Zhang et al., 2007) and tulip (Torskangerpoll et al., 1999), as well as in fruits, such as blueberries, cranberries (Prior et al., 2001) and raspberries (Chen et al., 2007). In this study, the tentative anthocyanin was identified using a combination of UPLC–Q–TOF–MS and UV–vis spectroscopy. First, Peaks 1 and 3 were identified as cyanidin derivatives and Peaks 2, 4, and 5 were identified as pelargonidin derivatives for producing the typical fragment ions of cyanidin and pelargonidin, respectively. Then, the type and the position of glycoside of each anthocyanin was identified from the subtracted value of the fragment ion from the molecular ion (M+ ) and the ratios of A440 /Avis-max of each Peak (Giusti and Wrolstad, 2001). In addition, the spectral datum for the A310 /Avis-max of Peak 5 was consistent with its mass spectrometry result. Cyanidin 3-rutinoside, pelargonidin 3-rutinoside and pelargonidin 3-acetylrutinoside were firstly identified in Tulipa gesneriana ‘Queen Wilhelmina’(Torskangerpoll et al., 1999), later, their distribution was analyzed in the petals of Tulipa ‘Pink Impression’ (PI) (Torskangerpoll et al., 2005). Accordingly, Peaks 3, 4, and 5 were confirmed from the retention time

and UV–vis spectra data by comparing with the anthocyanin components in PI in this study. Peak 2 was tentatively identified as pelargonidin 3-glucosyglucoside by MS and UV–vis analysis, however, it could not be confirmed by published data or authentic standard currently, and need detailed analysis in the future. AH flowers accumulate cyanidin 3-rutinoside as a major anthocyanin, and SN09 flowers contain major pelargonidin derivatives at Stage 4, corresponding to the petal color (adaxial sides) of AH described as 73 A and SN09 described as 37 B according to the Royal Horticultural Society Color Card. These results are also consistent with previous investigations stating that garden varieties of tulips with pink flowers belong to the cyanidin type (i.e., the cyanidin content exceeds 50% of the total anthocyanidin content), and those with orange and flesh pink flowers belong to the pelargonidin type (Nieuwhof et al., 1990). Variation in flower color is generally the result of differences in either the amount or components of flower pigments (Nakatsuka et al., 2005b). In the present study, AH and SN09 exhibited no significant difference in the TA content at Stage 4, suggesting that distinct components other than the different accumulation amounts of anthocyanins between AH and SN09 may contribute to the different flower colors. Similar results have been found in gentian (Nakatsuka et al., 2005b), crape myrtle (Zhang et al., 2008), and Saintpaulia (Sato et al., 2011). By contrast, the TF content in SN09 was significantly higher than that in AH at Stage4. Since flavones and flavonols typically act as co-pigments and influence anthocyanin hues in anthocyanin-based flowers (Asen et al.,

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

23

Fig. 5. Comparison between sequences of TfF3 H1AH and TfF3 H1SN. TfF3 H1AH and TfF3 H1SN are the coding regions of TfF3 H1 in AH and SN09, respectively. The numbering of nucleotides relative to the ATG translation start codon is shown on the left side of two sequences. The different nucleotides between TfF3 H1AH and TfF3 H1SN are marked by ‘’, the deduced amino acid residues are shown in bold uppercase letters and the corresponding codons where the different nucleotides are located are marked with black boxes.

1971), this result indicated that higher TF content in SN09 compared with that in AH might be involved in the color change in SN09 flower. Similar effects of the co-pigmentation on anthocyanin hues were also observed by other authors (González-Manzano et al., 2009; Schwarz et al., 2005; Zhang et al., 2008). Changes in anthocyanin amount or components are generally correlated with the changes in either structural or regulatory genes involved in the anthcoyanin biosynthetic pathway (Tornielli et al., 2009). Based on the UPLC profiles of AH and SN09, the transcriptional profiles of six anthocyanin biosynthetic structural genes in AH and SN09 were further investigated. In both AH and SN09, the increase in transcripts of TfCHS1, TfCHI2, TfF3H1, TfDFR1, and TfANS1 was accompanied by the increase in the TA content in petals throughout flower development. Given that the TF content only slightly changed during this process, the results suggested that the transcriptional patterns of these genes correlated well with the accumulation of anthocyanins in AH and SN09, which were consistent with the results of our previous study (Yuan et al., 2013) and similar to the results in other species, such as petunia (Brugliera et al., 2002), apple (Honda et al., 2002), and gentian (Nakatsuka et al., 2005a). The comparison of the transcriptional profiles of the genes between AH and SN09 showed that the TfCHS1, TfCHI2, and TfF3H1 transcripts were more abundant in SN09 than that in AH, but the TfDFR1 and TfANS1 transcripts were not significantly different between SN09 and AH at stage 4. Given that the petals of SN09 and AH had similar TA content, but a significantly higher TF content was observed in the petals of SN09 compared with that in AH, this

result suggested that higher expression levels of TfCHS1, TfCHI2, and TfF3H1 might be responsible for the higher TF content in SN09 compared with that in AH. These results were in accordance with the fact that in flavonoid biosynthesis, early biosynthetic genes, such as CHS, CHI and F3H, are involved in the synthesis of flavones, flavonols, and anthocyanins, whereas late biosynthetic genes, such as DFR and ANS, are only involved in proanthocyanin and anthocyanin biosynthesis (Quattrocchio et al., 2006). These findings were also consistent with the results reported in other studies (Schwinn et al., 2006; Takos et al., 2006; Xu et al., 2012). Given that the transcription of anthocyanin biosynthetic structural gene was generally regulated by corresponding transcription factors (Koes et al., 2005), the differences in transcription of TfCHS1, TfCHI2, and TfF3H1 between AH and SN09 may attribute to the differential expression levels of corresponding transcription factors. Similar results have been reported in lily (Yamagishi et al., 2012), apple (Chagné et al., 2013), and gentian (Nakatsuka et al., 2008). In contrast to the expression patterns of TfCHS1, TfCHI2, TfF3H1, TfDFR1, and TfANS1, the expression level of TfF3 H1 was significantly lower in SN09 than that in AH throughout flower development, corresponding to the distinct accumulation patterns of cyanidin anthocyanins in the petals between AH and SN09. The results indicated that TfF3 H1 transcription was positively correlated with cyanidin accumulation in AH and SN09, and the reduction of TfF3 H1 transciption hampered the biosynthesis of cyanidin anthocyanins in petals and contributed to the color change in SN09 flower. This finding agrees with the statement that the down-regulation of F3 H

24

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

Fig. 6. Structures and nucleotide sequences of PTfF3 H1AH and PTfF3 H1SN. (A) Schematic representation of PTfF3 H1AH and PTfF3 H1SN (not to scale). (B) Nucleotide sequence of the inserted fragment in PTfF3 H1SN. The numbering of nucleotides is shown on the left side. (C) Nucleotide sequence of PTfF3 H1AH. The putative transcription site is underlined and designated as +1. The CAAT boxes and TATA box are underlined and their names are given the corresponding elements. The insertion site of the fragment is marked by ‘’. The numbering of nucleotides relative to the transcription start site is shown on the left side.

alters the proportion of cyanidin-based anthocyanins in flowers and results in the change in flower color (Tornielli et al., 2009). This finding is also consistent with the results found in morning glory (Hoshino et al., 2003), petunia (Tsuda et al., 2004), tobacco (Nakatsuka et al., 2007), and violet-colored torenia (Nakamura et al., 2010). Different nucleotides between TfF3 H1AH and TfF3 H1SN did not result in different amino acid residues, suggesting that the reduction in TfF3 H1SN transcription was not caused by the mutations in the coding region. Later, the comparison of the promoter sequences of TfF3 H1AH and TfF3 H1SN showed that no difference in nucleotide sequence, except for the inserted fragment between the CAAT boxes and the TATA box found in the PTfF3 H1SN but not in PTfF3 H1AH. To investigate the effect of the inserted mutation on the promoter activity of PTfF3 H1SN, we evaluated the promoter activities of PTfF3 H1AH and PTfF3 H1SN in leaves of tobacco and Arabidopsis seedlings. PTfF3 H1SN only induced weak GUS expression in tobacco leaves and seedlings of transgenic Arabidopsis, whereas PTfF3 H1AH promoter resulted in high GUS expression in the same tissues under identical conditions. The results indicated that the reduction of TfF3 H1 transcription may be caused by the mutation in PTfF3 H1SN. This result may be caused by the fact that

the insertion between the CAAT boxes and TATA box altered the promoter structure, substantially affected the interaction between the transcription initiation complex and the promoter, as well as reduced the transcription efficiency of the downstream gene (Smale, 2001; Smale and Kadonaga, 2003). Similar results have been reported in snapdragon flowers (Martin and Gerats, 1993), Vitis vinifera (Kobayashi et al., 2004), and Saintpaulia sp. (Sato et al., 2011). In most cases, visible flower color changes are caused by changes in the amount and components of flower pigments, which are generally the result of mutations in genes involved in the flavonoid biosynthetic pathway (Tsuda et al., 2004). In the present study, our results indicated that the insert mutation in TfF3 H1SN promoter, which greatly hampered the accumulation of cyanidin derivatives in the petals of SN09 through the reduction of TfF3 H1SN transcription, contributed to the color change in SN09 flower. In addition, higher TF content in SN09 compared with that in AH, which was related to the higher expression levels of TfCHS1, TfCHI2, and TfF3H1, may also be involved in the flower color change in SN09. To the best of our knowledge, this report is the first to document a molecular analysis of flower color mutation in tulip plants. The results could serve as a theoretical basis for conducting breeding programs

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

25

Fig. 7. Histochemical GUS staining of transformed tobacco leaves and transgenic Arabidopsis seedlings, and GUS activities in transgenic Arabidopsis seedlings transformed with PTfF3 H1AH-GUS and PTfF3 H1SN-GUS, respectively. (A) The T-DNA regions of the PTfF3 H1AH-GUS and PTfF3 H1SN-GUS fusion vectors. The relative positions of promoter fragments are shown with respect to the transcription start site. Histochemical GUS staining of tobacco leaves (B) and Arabidopsis seedlings (C) transformed with pCambia1391Z, PTfF3 H1AH-GUS, PTfF3 H1SN-GUS, and PBI121. (D) GUS activities directed by PTfF3 H1AH, PTfF3 H1SN, and CaMV 35S promoters in transgenic Arabidopsis seedlings. The mean of GUS activity is averaged from three independent experiments. The vertical bars represent S.E. for replicate reactions. Significant differences at 0.05 level between two values were indicated by lowercase letters.

directed toward flower colors using molecular approaches in the future. Acknowledgments This research was supported by the Key Project of Science and Technology Commission of Shanghai, China (No. 13391901002). We are grateful to the Instrumental Analysis Center of Shanghai Jiao Tong University (SJTU, Shanghai, China) for technical advice on UPLC analysis. The pCambia1391Z vector was a kind gift from Dr. Kexuan Tang in FUDAN-SJTU-NOTTINGHAM PLANT BIOTECHNONOGY R&D CENTER SJTU CENTER of SJTU. References Asen, S., Stewart, R., Norris, K., 1971. Co-pigmentation effect of quercetin glycosides on absorption characteristics of cyanidin glycosides and color of Red Wing azalea. Phytochemistry 10, 171–175. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Brugliera, F., Barri-Rewell, G., Holton, T.A., Mason, J.G., 2002. Isolation and characterization of a flavonoid 3 hydroxylase cDNA clone corresponding to the Ht1 locus of Petunia hybrida. Plant J. 19, 441–451.

Chagné, D., Lin-Wang, K., Espley, R.V., Volz, R.K., How, N.M., Rouse, S., Brendolise, C., Carlisle, C.M., Kumar, S., De Silva, N., 2013. An ancient duplication of apple MYB transcription factors is responsible for novel red fruit-flesh phenotypes. Plant Physiol. 161, 225–239. Chen, F., Sun, Y., Zhao, G., Liao, X., Hu, X., Wu, J., Wang, Z., 2007. Optimization of ultrasound-assisted extraction of anthocyanins in red raspberries and identification of anthocyanins in extract using high-performance liquid chromatography–mass spectrometry. Ultrason. Sonochem. 14, 767–778. Forkmann, G., 1994. Genetics of flavonoids. In: Harborne, J.B. (Ed.), The Flavonoids. Springer, New York, pp. 537–564. Giusti, M.M., Wrolstad, R.E., 2001. Characterization and Measurement of Anthocyanins by UV–Visible Spectroscopy, Current Protocols in Food Analytical Chemistry. John Wiley & Sons, Inc., New York, pp. F1.2.1–F1.2.13. ˜ González-Manzano, S., Duenas, M., Rivas-Gonzalo, J.C., Escribano-Bailón, M.T., Santos-Buelga, C., 2009. Studies on the copigmentation between anthocyanins and flavan-3-ols and their influence in the colour expression of red wine. Food Chem. 114, 649–656. Grotewold, E., 2006. The genetics and biochemistry of floral pigments. Annu. Rev. Plant Biol. 57, 761–780. Holsters, M., De Waele, D., Depicker, A., Messens, E., Van Montagu, M., Schell, J., 1978. Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. Genet. MGG 163, 181–187. Honda, C., Kotoda, N., Wada, M., Kondo, S., Kobayashi, S., Soejima, J., Zhang, Z., Tsuda, T., Moriguchi, T., 2002. Anthocyanin biosynthetic genes are coordinately expressed during red coloration in apple skin. Plant Physiol. Biochem. 40, 955–962. Hoshino, A., Morita, Y., Choi, J.D., Saito, N., Toki, K., Tanaka, Y., Iida, S., 2003. Spontaneous mutations of the flavonoid 3 -hydroxylase gene conferring

26

Y. Yuan et al. / Scientia Horticulturae 175 (2014) 16–26

reddish flowers in the three morning glory species. Plant Cell Physiol. 44, 990–1001. Jefferson, R.A., 1987. Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5, 387–405. Jia, N., Shu, Q.Y., Wang, L.S., Du, H., Xu, Y.J., Liu, Z.A., 2008. Analysis of petal anthocyanins to investigate coloration mechanism in herbaceous peony cultivars. Sci. Hortic. 117, 167–173. Kapila, J., De Rycke, R., Van Montagu, M., Angenon, G., 1997. An Agrobacteriummediated transient gene expression system for intact leaves. Plant Sci. 122, 101–108. Kobayashi, S., Goto-Yamamoto, N., Hirochika, H., 2004. Retrotransposon-induced mutations in grape skin color. Science 304, 982. Koes, R., Verweij, W., Quattrocchio, F., 2005. Flavonoids: a colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 10, 236–242. Kunze, R., Weil, C., 2002. The hAT and CACTA superfamilies of plant transposons. Mobile DNA II 2, 565–610. Lescot, M., Déhais, P., Thijs, G., Marchal, K., Moreau, Y., Van de Peer, Y., Rouzé, P., Rombauts, S., 2002. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 30, 325–327. Martin, C., Gerats, T., 1993. Control of pigment biosynthesis genes during petal development. Plant Cell 5, 1253. Mol, J., Grotewold, E., Koes, R., 1998. How genes paint flowers and seeds. Trends Plant Sci. 3, 212–217. Nakamura, N., Fukuchi-Mizutani, M., Fukui, Y., Ishiguro, K., Suzuki, K., Tanaka, Y., 2010. Generation of red flower varieties from blue Torenia hybrida by redirection of the flavonoid pathway from delphinidin to pelargonidin. Plant Biotechnol. 27, 375–383. Nakatsuka, T., Abe, Y., Kakizaki, Y., Yamamura, S., Nishihara, M., 2007. Production of red-flowered plants by genetic engineering of multiple flavonoid biosynthetic genes. Plant Cell Rep. 26, 1951–1959. Nakatsuka, T., Haruta, K.S., Pitaksutheepong, C., Abe, Y., Kakizaki, Y., Yamamoto, K., Shimada, N., Yamamura, S., Nishihara, M., 2008. Identification and characterization of R2R3-MYB and bHLH transcription factors regulating anthocyanin biosynthesis in gentian flowers. Plant Cell Physiol. 49, 1818–1829. Nakatsuka, T., Nishihara, M., Mishiba, K., Yamamura, S., 2005a. Temporal expression of flavonoid biosynthesis-related genes regulates flower pigmentation in gentian plants. Plant Sci. 168, 1309–1318. Nakatsuka, T., Nishihara, M., Mishiba, K., Yamamura, S., 2005b. Two different mutations are involved in the formation of white-flowered gentian plants. Plant Sci. 169, 949–958. Nakayama, M., Yamaguchi, M., Urashima, O., Kan, Y., Fukui, Y., Yamaguchi, Y., Koshioka, M., 1999. Anthocyanins in the dark purple anthers of Tulipa gesneriana: identification of two novel delphinidin 3-O-(6-O-(acetyl-␣-rhamnopyranosyl)␤-glucopyranosides). Biosci. Biotechnol. Biochem. 63, 1509–1511. Nieuwhof, M., Van Raamsdonk, L., Van Eijk, J.P., 1990. Pigment composition of flowers of Tulipa species as a parameter for biosystematic research. Biochem. Syst. Ecol. 18, 399–404. Prior, R.L., Lazarus, S.A., Cao, G., Muccitelli, H., Hammerstone, J.F., 2001. Identification of procyanidins and anthocyanins in blueberries and cranberries (Vaccinium spp.) using high-performance liquid chromatography/mass spectrometry. J. Agric. Food Chem. 49, 1270–1276. Quattrocchio, F., Baudry, A., Lepiniec, L., Grotewold, E., 2006. The regulation of flavonoid biosynthesis. In: Grotewold, E. (Ed.), The Science of Flavonoids. Springer, New York, pp. 97–122. Sato, M., Kawabe, T., Hosokawa, M., Tatsuzawa, F., Doi, M., 2011. Tissue cultureinduced flower-color changes in Saintpaulia caused by excision of the transposon

inserted in the flavonoid 3 ,5 -hydroxylase (F3 5 H) promoter. Plant Cell Rep. 30, 929–939. Schwarz, M., Picazo-Bacete, J.J., Winterhalter, P., Hermosín-Gutiérrez, I., 2005. Effect of copigments and grape cultivar on the color of red wines fermented after the addition of copigments. J. Agric. Food Chem. 53, 8372–8381. Schwinn, K., Venail, J., Shang, Y., Mackay, S., Alm, V., Butelli, E., Oyama, R., Bailey, P., Davies, K., Martin, C., 2006. A small family of MYB-regulatory genes controls floral pigmentation intensity and patterning in the genus Antirrhinum. Plant Cell Online 18, 831–851. Simon, P., 2003. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics 19, 1439–1440. Smale, S.T., 2001. Core promoters: active contributors to combinatorial gene regulation. Genes Dev. 15, 2503–2508. Smale, S.T., Kadonaga, J.T., 2003. The RNA polymerase II core promoter. Annu. Rev. Biochem 72, 449–479. Tai, T.H., Tanksley, S.D., 1990. A rapid and inexpensive method for isolation of total DNA from dehydrated plant tissue. Plant Mol. Biol. Rep. 8, 297–303. Takos, A.M., Jaffé, F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006. Lightinduced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 142, 1216–1232. Tanaka, Y., Brugliera, F., 2013. Flower colour and cytochromes P450. Philos. Trans. R. Soc. B: Biol. Sci. 368, 20120432. Tanaka, Y., Sasaki, N., Ohmiya, A., 2008. Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J. 54, 733–749. Tornielli, G., Koes, R., Quattrocchio, F., 2009. The genetics of flower color. In: Gerats, T., Strommer, J. (Eds.), Petunia. Springer, New York, pp. 269–299. ˇ Torskangerpoll, K., Fossen, T., Andersen, R.M., 1999. Anthocyanin pigments of tulips. Phytochemistry 52, 1687–1692. Torskangerpoll, K., Nørbæk, R., Nodland, E., Øvstedal, D.O., Andersen, Ø.M., 2005. Anthocyanin content of Tulipa species and cultivars and its impact on tepal colours. Biochem. Syst. Ecol. 33, 499–510. Tsuda, S., Fukui, Y., Nakamura, N., Katsumoto, Y., Yonekura-Sakakibara, K., FukuchiMizutani, M., Ohira, K., Ueyama, Y., Ohkawa, H., Holton, T.A., 2004. Flower color modification of Petunia hybrida commercial varieties by metabolic engineering. Plant Biotechnol. 21, 377–386. Winkel-Shirley, B., 2001. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 126, 485–493. Xu, Y., Feng, S., Jiao, Q., Liu, C., Zhang, W., Chen, W., Chen, X., 2012. Comparison of MdMYB1 sequences and expression of anthocyanin biosynthetic and regulatory genes between Malus domestica Borkh. cultivar ‘Ralls’ and its blushed sport. Euphytica 185, 157–170. Yamagishi, M., Yoshida, Y., Nakayama, M., 2012. The transcription factor LhMYB12 determines anthocyanin pigmentation in the tepals of Asiatic hybrid lilies (Lilium spp.) and regulates pigment quantity. Mol. Breed. 30, 913–925. Yuan, Y., Ma, X., Shi, Y., Tang, D., 2013. Isolation and expression analysis of six putative structural genes involved in anthocyanin biosynthesis in Tulipa fosteriana. Sci. Hortic. 153, 93–102. Zhang, J., Wang, L., Shu, Q., Liu, Z., Li, C., Wei, X., Tian, D., 2007. Comparison of anthocyanins in non-blotches and blotches of the petals of Xibei tree peony. Sci. Hortic. 114, 104–111. Zhang, J., Wang, L.S., Gao, J.M., Shu, Q.Y., Li, C.H., Yao, J., Hao, Q., Zhang, J.J., 2008. Determination of anthocyanins and exploration of relationship between their composition and petal coloration in crape myrtle (Lagerstroemia hybrid). J. Integr. Plant Biol. 50, 581–588. Zhang, X., Henriques, R., Lin, S.S., Niu, Q.W., Chua, N.H., 2006. Agrobacteriummediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1, 641–646.