Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis

CLB-08952; No. of pages: 8; 4C: Clinical Biochemistry xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Clinical Biochemistry journal homepage: www.elsevier.com/locate/clinbiochem

3Q2

Jan Radvanszky a,b,c,⁎, Milan Surovy c, Emilia Nagyova c, Gabriel Minarik b,c,d, Ludevit Kadasi a,c

4Q3 5 6 7

a

8

a r t i c l e

9 10 11 12 13

Article history: Received 4 July 2014 Received in revised form 13 January 2015 Accepted 15 January 2015 Available online xxxx

14 15 16 17 18 19

Keywords: Fluorescent dyes Genotyping High-resolution melting HRM Screening

Institute of Molecular Physiology and Genetics, Slovak Academy of Sciences, Vlarska 5, 833 34 Bratislava, Slovakia Geneton s.r.o., Cabanova 14, 841 02 Bratislava, Slovakia Department of Molecular Biology, Faculty of Natural Sciences, Comenius University, Mlynska dolina, 842 15 Bratislava 4, Slovakia d Institute of Molecular Biomedicine, Faculty of Medicine, Comenius University, Sasinkova 4, 811 08 Bratislava, Slovakia b

i n f o

R O

c

O

F

2

Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis

a b s t r a c t

P

Objectives: Different applications of high-resolution melting (HRM) analysis have been adopted for a wide range of research and clinical applications. This study compares the performance of selected DNA binding fluorescent dyes for their possible application in HRM. Design and methods: We compared twelve dyes with basic properties considered relevant for PCR amplification and melting curve analysis. These included PCR inhibition, fluorescence intensity, the ability to generate melting curves and their effect on melting temperature (Tm). Seven of these dyes with promising properties were then evaluated for possible use in basic HRM applications; such as small amplicon genotyping, genotyping of a 1 kb insertion/deletion polymorphism, probe-based genotyping and mutation screening. Results: Five dyes failed to exhibit promising properties during the first part of the study, and these were excluded from further testing. Of the remaining dyes, SYTO11, SYTO13 and SYTO16 showed better PCR inhibitory and Tm affecting properties compared to commercial HRM dyes LCGreen Plus, EvaGreen and ResoLight. Although the SYTO dyes generally exhibited good discrimination powers in HRM applications, SYTO11 and SYTO14 gave low signal intensity and lower quality results. Conclusions: Our results suggest that the best performing dyes for HRM are those commercially offered for HRM analyses. However, the performance of SYTO16 and SYTO13 was comparable to the HRM dyes in the majority of our assays, thus demonstrating that they are also quite suitable for both real-time PCR and HRM applications. © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

R

E

C

T

E

D

1Q1

37

R

41 39 38 40

Introduction

43 44

Conventional melting curve analysis (MCA) was first described to identify specific PCR products after real-time PCR amplification when nonspecific DNA binding fluorescent dyes were used to monitor amplification. The DNA melting curve was obtained by plotting fluorescence intensity as a function of increasing temperature when a dsDNA amplicon sample with DNA binding fluorescent dye was continuously heated through the amplicon's dissociation temperature [1]. Highresolution melting (HRM) analysis is a natural extension of this simple method to maximize the amount of information that can be extracted from MCA [2]. Because each dsDNA fragment has its characteristic melting behaviour determined by GC content and length and sequence composition [3], sequence alterations can lead to altered melting behaviour of the dsDNA fragment [4]. HRM analyses with saturating DNA binding dyes are flexible methods successfully adopted in many research and

47 48 49 50 51 52 53 54 55 56

U

45 46

N C O

Q5 42

⁎ Corresponding author at: Institute of Molecular Physiology and Genetics, Slovak Academy of Sciences, Vlarska 5, 833 34 Bratislava, Slovakia. E-mail address: [email protected] (J. Radvanszky).

clinical applications. These include single base change genotyping [5–7], insertion and deletion genotyping [8–10], mutation screening [11–13], sequence matching [14], methylation profiling [15], internal tandem duplication detection [16], mitochondrial haplotyping [17,18], and PCR instrument validation [19]. These applications depend on sequence differences resulting in alterations in duplex melting behaviour, manifesting as melting temperature shift and/or melting curve shape alterations. Although the most commonly used HRM dyes come from the LCGreen family (LCGreen I and LCGreen Plus) [20–22], reports describe other fluorescent dyes suitable for HRM applications. These include EvaGreen [23,24], SYTO9 [25–27] and ResoLight [28,29]. Despite the distinct applications described in the mentioned studies, no systematic studies have been published on comparison of these dyes' basic properties and their applicability in main HRM applications. The aim of this study is to compare twelve green fluorescent DNA binding dyes for possible use in HRM applications. The first part of our study investigated basic dye properties important in PCR amplification and product detection. These included fluorescence intensity enhancement in the presence of dsDNA, PCR inhibitory effect, the ability to generate melting curves and the effect on dsDNA melting temperature

http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010 0009-9120/© 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Q4 35 36

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76

91

Fluorescent DNA binding dyes

92

103 104

The following green fluorescent dyes were investigated in our study: EvaGreen (EG; Biotium, USA), LCGreen Plus (LC; Idaho Technology, USA), ResoLight (RL; Roche Applied Science, Germany), SYBR Green I (SG; Life Technologies/Molecular Probes, USA), SYTO11 (S11), SYTO12 (S12), SYTO13 (S13), SYTO14 (S14), SYTO16 (S16), SYTO21 (S21), SYTO24 (S24) and SYTO25 (S25) (Life Technologies/Molecular Probes, USA). Dye concentrations were calculated from the suppliers' stocksolution concentration; and were of fold (×) concentration for EG, LC, RL, SG, and of molar (μM) concentration for the SYTO dyes. The molar concentration of 1 × SG solution was determined by Zipper et al. (2004) as 1.96 μM and, according to manufacturer's information, that for 1× EG solution is 1.33 μM. LC and RS molar concentration information is unavailable.

105

Measurement of dye fluorescence intensity

106

115 116

We compared fluorescence intensity of pure dyes dissolved in ultrapure water in a final concentration of 2 μM/1× and the same concentration of dyes dissolved in water in the presence of 100 ng human genomic DNA. The DNA was isolated from leukocytes by Puregene™ DNA Purification Kit (Qiagen, Germany). Mixes were prepared in quadruplicate and fluorescence intensity was measured by Safire2 microplate fluorimeter (Tecan, Switzerland) using the Magellan Standard Tracker V5.03 (Tecan, Switzerland) software. Excitation and emission detection wavelengths used were 470 nm (± 20 nm) and 510 nm (±20 nm), respectively, in accordance with the used filter settings in the LightScanner and LightCycler instruments.

t1:1 t1:2

Table 1 Primer sequences and amplicon properties.

107 108 109 110 111 112 113 114

t1:3

t1:22 t1:23 t1:24

Primers

Amplicon1 Amplicon2

U

t1:4 t1:5 t1:6 t1:7 t1:8 t1:9 t1:10 t1:11 t1:12 t1:13 t1:14 t1:15 t1:16 t1:17 t1:18 t1:19 t1:20 t1:21

C

101 Q7 102 Q8

E

99 100

R

97 98

R

95 96

O

93 94

C

87 88

N

85 86

F

89 90

The primer sequences and amplicon properties used in our study are summarized in Table 1, with PCR components in Suppl. Tab. 1. and amplification conditions in Suppl. Tab. 2. Tm and GC content were calculated using the online tool at the http://www.basic.northwestern.edu/ biotools/oligocalc.html [30]. Ultrapure water with a resistivity of 18.2 MΩ·cm at 25 °C was used in our applications and was generated using the Millipore Direct-Q 3 UV Water Purification System (Millipore Corporation/EMD Millipore, USA). Materials, methods and analyses utilised in this study are as follows:

83 84 Q6

118 119

O

82

Real-time PCR of amplicon1 was used to determine the inhibition effect of the studied dyes on PCR amplification. Six different reactions, prepared in quadruplicates, were prepared for each dye. The input DNA of 50 ng remained constant in each reaction while the final dye concentrations varied, and were 0.1 ×, 0.5 ×, 1 ×, 1.5 ×, 2 × and 2.5 × (0.2 μM, 1 μM, 2 μM, 3 μM, 4 μM and 5 μM). Amplifications were performed on a 96-multiwell plate format LightCycler 480 II System (Roche Applied Science, Germany). Excitation and emission wavelengths of 465 nm and 510 nm (default detection format for SYBR Green I/HRM dye detection), respectively, were used for signal detection and data analysis was done by LightCycler 480 SW 1.5.1 software. The median Ct value was calculated for each dye concentration and the slope of the trendline generated by plotting the median Ct value against dye concentration was used as an indicator of the degree of amplification inhibition.

Amplicon3 (small amplicon) Amplicon4 (Alu deletion spec.) Amplicon5 (Alu insertion spec.) Amplicon6 (screening) Probe2 (unlabeled probe)

Ampl1-for Ampl1-rev Ampl2-for Ampl2-rev W24X-for W24X-rev 486 405 486 Alu-REV-ins FM_cox1_var1_F FM_cox1_var1_R Probe2

120 121 122 123 124 125 126 127 128 129 130 131 132

Determination of dye applicability in conventional MCA and dye concentra- 133 tion effect on Tm 134

R O

Materials and methods

117

Amplifications of amplicon2 were carried out in the absence of dye. Amplification products were pooled together, carefully mixed and quantified on agarose gel using 1 kb Plus DNA Ladder (Fermentas, Lithuania) and GelQuant imaging application (DNR Bio-Imaging Systems, Israel). Four different dilutions were prepared from the pooled samples, with approximately 100 ng, 75 ng, 50 ng and 25 ng of amplicon. These amplicon dilutions were prepared using ultrapure water. Six dilutions were prepared in water from each dye: 0.2×, 1 ×, 2×, 3×, 4× and 5× (0.4 μM, 2 μM, 4 μM, 6 μM, 8 μM and 10 μM). Aliquots of one PCR product dilution were mixed with equal volume aliquots of each dye dilution; resulting in 100 ng final amplicon amount and 1 × (2 μM) final dye concentration. The prepared samples were overlaid with 15 μl of mineral oil (Sigma-Aldrich, USA), heated to 98 °C for 30 s and then cooled to 25 °C, with subsequent heating and fluorescence monitoring from 60 °C to 98 °C using a 96-well LightScanner HRM instrument (Idaho Technology, USA). LightScanner software version 2.0 was used for analyses. Following this testing of the dyes' ability to generate melting curves during dsDNA denaturation, quadruplicates of all combinations of above-mentioned PCR product and dye dilution were prepared by mixing 5 μl of dye solution with 5 μl of amplicon dilution, overlaid with 15 μl of mineral oil (Sigma-Aldrich, USA). Melting curves were generated and analysed as described above. Each dye was tested in a separate plate therefore each of the dyes was melted under slightly different conditions, specifically with respect to the exposure time and data acquisition frequency. During HRM on the LightScanner the default heating rate of 0.1 °C per second was used with a variable number of

P

81

Determination of dye PCR inhibitory effect

T

79 80

(Tm). The second part determined the applicability of dyes which performed well in the first instance for the most commonly used HRM applications; such as basic genotyping approaches for known sequence alterations and screening of unknown sequence variations.

D

77 78

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

E

2

Primer/probe sequences

Amplicon length

Amplicon GC content

References

5′TTAACCTTATGTGTGACATGTTCTAA 5′AGAATGGTCCTGCACCAGTAA 5′GAAGTAGTGATCGTAGCACACGTTCTTGCA 5′TTGGGGCACGCTGCAGACGATCCTG 5′AAAATGAAGAGGACGGTGAG 5′GAACAAACACTCCACCAGCA 5′CTCAGGGCTTATCTAAAGTGGC 5′CTGTATACTCAGCTACTAGGGT 5′CTCAGGGCTTATCTAAAGTGGC 5′TGGGCACAGTGGCTTATATTT 5′GGTCATGGGGTTATAATGA 5′ACAGCATAGTAATAGCCGC 5′GCGTGATTGTTGTTGCCTTTATGTG-C6a

225 bp

36%

NA

202 bp

54%

NA

54 bp

46%

NA

493 bp

54%

Mahadevan et al. [32]

381 bp

52%

Radvansky et al. [10]

439 bp

39%

Radvansky et al. [18]

25 bp

44%

Radvansky et al. [18]

Tm and GC content were calculated using the online tool at the http://www.basic.northwestern.edu/biotools/oligocalc.html. NA = not applicable. a Underlined nucleotides cover the polymorphic sites and the nucleotides with bold and italics are mismatched nucleotides to lower the probe Tm.

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

Results

204

Dye fluorescence intensity and PCR amplification inhibition

205 206

Measurement of fluorescence enhancement after adding dsDNA allowed determination of the following dye order from greatest enhancement to least; SG, S24, RL, S13, S16, S21, S11, EG, LC, S14, S12 and S25 (Fig. 1). Testing dye inhibitory effect revealed that S13 and S16 were least inhibitory. These resulted in slightly decreased Ct values with increasing dye concentration, and trendline slopes of − 0.75 and −0.27, respectively (Table 2). They were followed by EG, S11 and RL with slightly increasing Ct values and trendline slopes of 0.23, 0.41 and 0.51, respectively. However, S11 delivered an interpretable signal only above 3 μM concentration, and this was ragged with low quality and intensity. LC showed a somewhat higher inhibition rate with trendline slope of 1.03, SG had moderate inhibition with a slope of about 2.68 and S21 showed a trendline slope of 18.49, although calculated only from the values obtained at 0.2 μM and 1 μM, but no detectable amplification signal appeared above these concentrations. Of the remaining dyes; S24 had amplification signal only at 1 μM dye concentration, S14 had a

187 188 189 190 191 192 193 194 195 196 197 198 199 200

207 208 209 210 211 212 213 214 215 216 217 218 219 220 221

C

185 186

E

183 184

R

181 182

R

180

N C O

178 179

U

176 177

F

203

174 175

Fig. 1. Fluorescence intensity of the dyes. Dyes are ordered based on the percentual enhancement of their fluorescence intensity in the presence of dsDNA when compared to the basic fluorescence of the pure dyes dissolved in water.

O

201 202

Based on the results of the first part of the study, the following seven best-performing dyes were included in further analyses; EG, LC, RL, S11, S13, S14 and S16. The tested HRM applications included three genotyping methods (small amplicon single base genotyping, genotyping of larger sequence variation and genotyping of single base changes using unlabelled oligonucleotide probes) and a screening method. All HRM applications were performed in a 96-well LightScanner instrument (Idaho Technology, USA) using the default excitation and emission detection wavelengths of 470 nm (± 20 nm) and 510 nm, respectively. Analyses were performed as described above, except of probe-based genotyping where fluorescence monitoring was performed from 40 °C to 95 °C. At least three samples from each genotype group were tested with each dye. Small amplicon genotyping of G to A transition mutation in the human GJB2 gene was achieved by amplifying a 54 bp fragment (amplicon3). Testing of dye applicability for genotyping of larger sequence alterations was performed using our previously described protocol for the genotyping of 1 kb Alu insertion/deletion polymorphism in the human DMPK gene [31]. Here, 486 was the common primer, 405 the deletion-specific primer [32] and Alu-REV-ins the insertionspecific primer. The 486 and 405 primers are located outside the deleted region and their amplification product is a 493 bp deletion-specific allele (amplicon4). The Alu-REV-ins primer is located inside the deleted region and its combination with the 486 primer produces a 381 bp insertion-specific amplicon (amplicon5). Unlabelled oligonucleotide probe-based genotyping and unknown sequence variation screening were tested in one reaction by amplifying a 439 bp fragment of the mitochondrial cox1 gene of Fascioloides magna (amplicon6) by asymmetric PCR as previously described [33]. The 25 bp oligonucleotide probe was blocked at the 3′ end by amino-modified C6 (Probe2) and it covered three polymorphic sites; two transitions (T/C and A/G) and one transversion (A/T). Two additional mismatches were incorporated in the probe structure to lower its melting temperature.

172 173

low intensity, uninterpretable amplification signal with very slight in- 222 crease in fluorescence at all tested concentrations and S12 and S25 223 had no detectable amplification signal in tested dye ranges. 224

R O

171

167

Melting curve generation ability and determination of dye concentration 225 effect on Tm 226

P

High-resolution melting applications

165 166

Of all tested dyes, only S12 provided no detectable fluorescent signal change in tested dye and amplicon concentrations during heating of the samples. S11, S14 and S16 did not detect the amplicon in the smallest investigated dye concentration, while LC, SG, S21, S24 and S25 were unable to detect amplicon at higher dye concentrations because Tm was increased above the 98 °C instrument detection limit (Fig. 2). Comparison of Tm values demonstrated that increasing the dye concentration increased amplicon Tm in all amplicon–dye concentration combinations, although the extent of this effect varied amongst the dyes. Three groups were established based on Tm increase; (1) S13, S11, S16 and S14 fell in the range of 4.5 °C to 6.6 °C; (2) EG had 10.7 °C and RL 11.3 °C and (3) LC, SG S21, S24 and S25. Since these latter dyes increased Tm beyond the detection limit, their Tm increase was calculated from the lowest determined Tm value and the 98 °C upper detection limit of the instrument. This ranged from 10.8 °C for LC to 12.4 °C for S24 (Table 2). Tm also increased with decreasing amplicon concentrations, and this was particularly noted in higher dye concentrations. Dye concentrations where decreasing amplicon concentrations initiated Tm increase were approximately 0.5× for LC, EG, RL, SG, 1 μM for S21, S24 and S25, and 3 μM for S11, S13, S14 and S16.

D

170

163 164

T

168 169

data acquisition points per °C, depending on the exposure time in each experiment (LightScanner Operator's Manual rev 04; Idaho Technology, USA and personal communication with Kall Symons and Cameron Gundry from BioFire Defense). For exposure times the automatic mode of the LightScanner software was selected that resulted in 84 (for S12 and S14), 96 (for LC, S11 and S25) or 108 (for EG, RL, SG, S13, S16, S21 and S24) fluorescence acquisitions per °C as determined from the data files of each run. Other melting parameters used were the same for all dyes.

E

161 162

3

227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246

Suitability of EG, LC, RL, S11, S13, S14 and S16 for different HRM 247 applications 248 Both homozygous and heterozygous samples were clearly distinguishable in the 54 bp small amplicon genotyping assay with all studied dyes. However, S14 gave peaks of lower quality because of low signal intensity (Fig. 3). In the three-primer based Alu insertion/deletion genotyping assay all seven dyes were sufficiently sensitive to differentiate each of the three genotypes, although, S14 again furnished lower quality signal than the other dyes (Fig. 3). In the unlabelled probe-based genotyping assay the amplicon was generated using asymmetric PCR from a mitochondrial sequence, thus results from heterozygous samples were not tested. Samples included in the analyses had four different mitochondrial haplotypes, Ha1, Ha3, Ha4 and Ha6, differentiated by three polymorphic sites covered by the probe (Fig. 3). The fully complementary probe/target duplex with CAA in the polymorphic sites melted at the highest temperature (Ha1). Lower Tm was established for the probe/target duplex containing one mismatch with TAA in the polymorphic sites (Ha6), and even lower Tm resulted from a duplex with one mismatch with CAT constellation

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266

4 t2:1 t2:2 t2:3

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

Table 2 Summary of the results obtained for the investigated dyes. Dye

t2:4 t2:5

Excitation/emission maxima for DNA in nma

Fluorescence enhancement in %b

PCR inhibition slope (R2)

Ability to generate melting curves

Maximum Tm shift in °C

1,03 (0,69) 0,23 (0,52) 0,51 (0,92) 0,41 (0,13)

Yes Yes Yes Yes

HRM applications Small amplicon genotyping

Alu in/del genotyping

Probe based genotyping

Mutation screening

10,8d 10,7 11,3 6,0

Yes Yes Yes Yes

Yes Yes Yes Yes

Yes Yes Yes Yes — low quality NA Yes — low quality No

Yes Yes Yes Yes

LCGreen Plus EvaGreen ResoLight SYTO11

460/475c 500/530e 487/503f 508/527a

241 602 2002 622

t2:10 t2:11

SYTO12 SYTO13

499/522a 488/509a

153 921

NA −0,75 (0,61)

No Yes

NA 4,5

NA Yes

NA Yes

t2:12

SYTO14

517/549a

168

NA

Yes

6,6

a

892 786 2207 93 2544

−0,23 (0,69) 18,49 (1) NA NA 2,68 (0,84)

Yes Yes Yes Yes Yes

5,4 11,2d 12,4d 10,9d 12d

Yes — low quality Yes NA NA NA NA

Yes — low quality Yes NA NA NA NA

SYTO16 SYTO21 SYTO24 SYTO25 SYBR Green I

488/518 494/517a 490/515a 521/556a 495/521c

O

t2:13 t2:14 t2:15 t2:16 t2:17

F

t2:6 t2:7 t2:8 t2:9

Yes NA NA NA NA

NA Yes No Yes NA NA NA NA

NA = not applicable. a According to the SYTO Green-Fluorescent Nucleic Acid Stains product sheet (Molecular Probes by Life Technologies). b Fluorescence enhancement when bound to dsDNA if the basic fluorescence is considered as 100%. c According to Herrmann et al. [22], manufacturer's specifications for LCGreen Plus about the optimum range for excitation and emission are 440–470 nm and 470–520 nm, respectively. d Tm increased above the 98 °C detection limit; Tm shift calculated between the lowest measured Tm and 98 °C. e According to the EvaGreen Dye Product information (Biotium). f According to the LightCycler 480 ResoLight Dye Product information (Roche Applied Sciences).

267

280

(Ha3). The lowest Tm was determined in the probe/target duplex containing two mismatches with CGT in the polymorphic sites (Ha4). Here, LC, EG, RL and S16 returned the best results with comparable quality. Samples with each genotype were also distinguishable with S11 and S13 although the melting peaks were slightly ragged. Meanwhile, melting of the probe/target duplex was undetectable with S14. The feasibility of using the studied dyes in mutation screening was tested by evaluating the 439 bp dsDNA fragment's melting behaviour. In the whole amplicon, the four different mitochondrial haplotypes differed in several homozygous nucleotide positions (Fig. 3); however, haplotypes Ha1 and Ha6 differed from each other in a single C/T polymorphic site. The HRM assay distinguished all included haplotypes with all tested dyes except S14, with which melting transition was not sufficiently detected.

281

Discussion

282 283

As HRM based applications became more popular and widespread, new HRM analytic instruments were developed and modified [34,35]. Contemporaneously, new DNA binding fluorescent “saturating” dyes have been developed and commercially offered for HRM experiments. These include LCGreen and LCGreen Plus from Idaho Technology, EvaGreen from Biotium and ResoLight from Roche Applied Sciences. In addition, other DNA binding dyes used originally in other applications have proven effective as real-time PCR dyes and potential candidate for HRM applications. The SYTO9, SYTO13, SYTO16 and SYTO82 fluorescent dyes most commonly used as nucleic acid stains in both eukaryotic and prokaryotic cells performed very well in systematic comparison studies and proved to be highly efficient reporter dyes in real-time PCR [36–38]. SYTO9 has also been applied in HRM [25,26,39]. SYTO dyes generally differ in (1) excitation and emission spectra, (2) fluorescence enhancement on nucleic acid binding, (3) cell permeability and/ or (4) DNA/RNA selectivity and binding affinity (SYTO product sheet, Life Technologies/Molecular Probes, USA). Therefore, we compared the three HRM dyes, LCGreen Plus, EvaGreen and ResoLight, and SYTO11-14, SYTO16, SYTO21, SYTO24 and SYTO25 belonging to the “green” branch of the SYTO dye family for basic properties important in PCR amplification, amplicon detection and selected HRM applications. Although Herrmann et al. [22] reported that SYBR Green I is less efficient in HRM applications, we included it because it is still commonly

284 285 286 287 288 289 290 291 292 293 Q9 294 295 296 297 298 299 300 301 302 303 304

P

E

D

used in real-time PCR and conventional MCA and can serve as a crosscontrol to other studies. Dyes S16 and S13 had almost no amplification inhibitory effect in the tested amplicon and concentration range; as also reported by Gudnason et al. [37] and Eischeid [38]. The determined Ct values showed low inhibitory effect for EG, S11 and RL. S11 was unable to show amplification in low concentrations and provided only low signal intensity even in higher concentrations, which is in accordance with its low overall fluorescence intensity determined above. LC had higher inhibitory effect than EG and RL, but not as high as SG which we classified to have medium inhibition factor. This dye, however, recorded lower inhibitory effect here than its high inhibition reported by Gudnason et al. [37]. S21 and S24 showed the greatest inhibition, completely inhibiting PCR in higher concentrations precisely as reported by Eischeid [38]. S14, S12 and S25 gave a very weak or complete lack of amplification signal and also recorded both the weakest overall fluorescence and fluorescence intensity elevation in the presence of dsDNA. As S11, S14 and S25 were able to detect dsDNA amplicon during MCA, their weaker performance can be most probably attributed to the less effective overlap of their excitation and emission spectra (508 nm/527 nm for S11, 517 nm/549 nm for S14 and 521 nm/556 nm for S25) with the filters used by the LightCycler (465 nm/510 nm). Experimental concentrations of S14 were extended to 8 μM, 10 μM and 12 μM to test whether higher concentration of the dye enabled generation of stronger amplification signal, but these concentrations also failed to increase signal quality (data not presented). On the other hand, S12 has more matching spectral properties (499 nm/522 nm) with the filters used by LightCycler. Taken together, since S12 increased fluorescence intensity only minimally and was not able to detect dsDNA amplicon neither during MCA, nor during realtime PCR experiments, we concluded that the detection problem was most likely not caused by spectral incompatibility. Increased amplicon Tm with increasing DNA binding dye concentration was described in Ririe et al.'s initial study [1]. In addition, Monis et al. [36] observed that different dyes exert different Tm effects. They suggested that different dyes can have different stabilizing effects on the dsDNA that can be determined by the binding strength of dye molecules to dsDNA or by the number of dye molecules bound per unit of DNA. Gudnason et al. [37] added that the dye's binding strength or stabilizing effect can influence not only the determined Tm values, but also PCR inhibition, preferential dye-binding to certain sequences and

T

C

E

R

278 279

R

276 277

O

274 275

C

272 273

N

270 271

U

268 269

R O

t2:18 t2:19 t2:20 t2:21 t2:22 t2:23 t2:24

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344

5

U

N C O

R

R

E

C

T

E

D

P

R O

O

F

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

Fig. 2. Tm values measured in combinations of different dye and PCR amplicon concentrations. Filled squares show combinations where amplicons were not detected. Non-filled columns show combinations where amplicons were not detected because of Tm increase above the instrument detection limit. SYTO12 did not detect amplicons in neither of the tested combination. The seemingly disproportional Tm increase in the 25 ng/5 μM combination of SYTO14 was caused by a double peak that appeared at a lower concentration combination (25 ng/4 μM). At this particular combination the lower Tm part was, however, stronger therefore we took into account the lower Tm maintaining thus a proportional Tm increase. In contrast, at 25 ng/5 μM the higher Tm part of the double peak was stronger therefore we took into account these Tm values. The resulting Tm increase therefore seems to be disproportional to the rest of the data. When we measured the lower Tm part of the double peak the Tm increase was more proportional.

345 346 347 348 349 350

primer-dimer generation. Our results supported these author's assertions by demonstrating that increasing dye concentration increased amplicon Tm in all studied amplicon concentrations with all dyes, and that dyes which affect Tm to lesser extents also possess lower PCR inhibitory effect. This also supports the suggestion of Gudnason et al. [37] that it should be possible to predict the significance of amplification

inhibition effect for specific DNA binding dyes based solely on the Tm shift. Our tested dyes are divided into the three following groups based on Tm increase; (1) S13, S16, S11 and S14 have the least effect on Tm. (2) EG and RL demonstrated higher effect on Tm but were able to detect the amplicon in all studied dye and amplicon concentrations and (3) SG, S21, S24 and S25 affect Tm most remarkably; increasing it

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

351 352 353 354 355 356

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

U

N

C

O

R

R

E

C

T

E

D

P

R O

O

F

6

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415

F

O

R O

376 377

P

374 375

D

372 373

enhancement of both S11 and S14 in the presence of dsDNA was amongst the weakest, and they exhibited a weak signal in real-time PCR too. Moreover, it should be mentioned again, that the emission and excitation maxima of S11 and S14 do not exactly match the parameters of the LightScanner HRM instrument since it uses 470 (±20) nm/510 nm filter settings for excitation and emission scanning, respectively. Taken together, although they had promising properties for successful PCR amplification, their weaker performance in HRM applications can be attributed to the spectral incompatibility resulting in lower signal intensity they generate. Although S11 and S13 were also distinguished between different genotypes, the best quality results in probe-based genotyping assays were obtained from LC, EG, RL and S16. To test whether increased SYTO dye concentration can improve result quality of probe-based genotyping, we added solutions of each SYTO dye directly to the appropriate reactions post PCR (to increase final concentration from 2 μM to 4 μM) and remelted the reactions. This, however, did not lead to melting curve quality improvement (data not presented). Additionally we decided to further test the possibility of improving result quality by increasing the concentrations of two selected SYTO dyes. We repeated the amplification reactions for probe-based genotyping again, without the presence of any dye to minimise the possible dye effect on amplification. Following PCR we added S13 and S14 to replicates of each sample to the final concentrations of 2 μM, 4 μM and 6 μM. This, however, did not improve result quality noticeably (data not presented). In contrast to S14, S13 has good overlap of spectral properties with the instrument filters, therefore it should be further studied whether the shortness of the probe-target regions or other factors are responsible for this lower result quality of S13 in probe-based genotyping. In addition to Tm, increased dye concentrations also affect melting peak height and shape. Although peaks were generally higher with increased product concentrations of all dyes, this increase was observed only up to a certain concentration which differed slightly in different amplicon concentrations. The peaks then became lower above these concentrations; generally commencing around 2–4 μM. Setting a generally applicable optimal dye concentration for all possible applications is quite challenging. While excessively low dye concentration can leave dsDNA fragments undetected, can lower signal quality or can lead to non-saturating conditions, excessively high dye concentrations give decreased signal and lower melting peak height because of fluorescent dye self-quenching. This may result from increased energy transfer by dye molecule collisions [45]. Gudnason et al. [37] reported self-quenching in a number of fluorescent dyes and that the maximum fluorescent signal was obtained at concentrations between 2 and 5 μM. Eischeid [38] set the optimal concentration of S11 to 2 μM and S13 and S16 to 10 μM to achieve high fluorescence and low PCR inhibition. Although our results support the optimal concentrations determined by Gudnason et al., we recommend that optimum dye concentration should be determined for each application and each dye in individual reaction standardisation processes, rather than using a previously determined universal dye concentration. In general, the presented results led us to conclude that the best dyes for HRM are those commercially offered for HRM analysis. Members of the SYTO dye family, particularly S16 and S13, however, performed comparably to the specialised HRM dyes in the majority of our assays. This demonstrated that in addition to their value in real-time PCR, these dyes are also suitable for HRM applications. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.clinbiochem.2015.01.010.

E

370 371

T

368 369

C

366 367

E

364 365

R

363

R

361 362

N C O

359 360

beyond instrumental detection limit even at low dye concentrations. It is noted here that LC is assigned to our second group of dyes rather than to the third because it increased Tm beyond the detection limit only in the highest dye and lowest amplicon concentrations, while the other four dyes achieved this at remarkably lower dye concentrations. Tm was also affected by altering amplicon concentrations as a result of altered dye-based stabilisation of dsDNA complexes by changing dye:dsDNA ratio. Although Ririe et al. [1] reported dependence of Tm on the number of starting copies of target DNA with SYBR Green I, the concentration of template DNA is generally considered negligible in HRM [4,40]. During mutation screening, for example, the Tm difference between each melting curve is generally eliminated by temperatureshifts. Accuracy of Tm estimations, however, plays crucial role in genotyping assays. For such applications, the key to ensuring consistent Tms is to control the dye:dsDNA ratio. Generally it is done by standardising the amount of DNA used or by the use of precisely standardized reaction conditions. In addition, variation in Tm can be eliminated using internal calibrators [41,42] or by increasing MgCl2 concentration [43]. High concentrations of MgCl2, however, can reduce heteroduplex formation [44]. A variation to these options would be to use a dye with minimal Tm shifting effect. It should be accentuated here, that the PCR amplicons were diluted in water instead of a PCR buffer. The highest amplicon concentration was initially left undiluted (containing 1× concentrated PCR buffer with 2 mM MgCl2), however, finally it was also diluted by adding an equal volume of dye solution resulting in a 0.5× concentrated PCR buffer with 1 mM MgCl2. In similar manner, each amplicon dilution therefore resulted in further decreasing PCR buffer and MgCl2 concentrations. As it was remarked by the reviewers of this manuscript, results observed with the amplicon dilutions will not exactly reflect what would be observed using these dyes under normal amplification conditions following PCR (with respect to Tm in particular, possibly also the shape of the melt profile). It is known that DNA melting behaviour will be different under different buffer and cation concentrations. The same might also apply to the behaviour of the different dyes, so the performance reported in this paper may be better or worse for these dyes in different buffer conditions. In the light of these remarks, our highest amplicon concentration is the most closest to the normal post PCR conditions and represents the most reliable results. As it is clearly visible for all compared dyes on Suppl. Fig. 1 the dye concentration effect was more pronounced with decreasing amplicon concentrations and thus with reduced PCR buffer and MgCl2 concentrations. This may be explained by the observation of Ng et al. [43] that higher concentrations of MgCl2 can eliminate the dye dependent inverse correlation between Tm and DNA concentration. Although they reported this for LCGreen Plus it was also visible using all dyes tested by us. Such dependence, however, seems to be less pronounced for the SYTO dyes when compared to the other dyes tested here. Crucial factors for efficient PCR amplification and precise HRM based analyses, such as determined Tm values and PCR inhibition properties, are influenced by dye-binding strength, consequently S11, S13, S14 and S16 can be considered promising candidates for HRM applications. Meanwhile, SG, S12, S21, S24 and S25 were excluded from further testing because of less satisfying primary results. Apart from S14, all tested dyes in all HRM assays distinguished the included genotypes. Although S14 distinguished different genotypes in small amplicon and 1 kb Alu insertion/deletion genotyping, it exhibited lower quality than the other dyes. In the probe-based genotyping and the screening assay S14 did not detect melting transitions efficiently. The fluorescence intensity

U

357 358

7

Fig. 3. Results and schematic depiction of the four HRM assays tested. In the small amplicon genotyping assay, the amplicon containing the G allele had higher Tm while the A allele melted at lower temperature. Heterozygotes show double peaks, or peaks with a “shoulder”. In the Alu insertion/deletion assay, the homozygous samples for the insertion showed a higher Tm (after temperature shifting at 5% of fluorescence) than those homozygous for the deletion. Heterozygous samples showed the lowest Tm, while all three genotypes were primarily distinguished by melting curve shape differences. In the probe-based genotyping and screening testing we used four samples belonging to different mitochondrial haplotypes. In the 439 bp amplicon the different haplotypes differed in 13 possible variable positions. Probe2 covered three polymorphic sites and genotyping of these sites allowed the determination of each of the corresponding haplotypes. Probe/target duplex containing two mismatches (Ha4) melted at the lowest temperature, followed by Ha3 (one mismatch), Ha6 (one mismatch) and Ha1 (the fully complementary probe/target duplex).

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

416 417 418 419 420 421 422 423 424 425 426 Q10 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474

485 486

We would like to thank Dr. Ivica Králová-Hromadová and Dr. Eva Bazsalovicsová (Parasitological Institute of the Slovak Academy of Sciences, Hlinkova 3, 040 01 Košice, Slovakia) for kindly providing the Fascioloides magna DNA samples and the corresponding haplotype information. This contribution is the result of implementation of the project: REVOGENE — Research Centre for Molecular Genetics (26240220067ITMS) supported by the R&D Operational Programme funded by the ERDF and by a grant from the Slovak Grant Agency of Science (VEGA 2/0027/12).

487

References

488 Q11 489 490 491 492 493 494 495 496 497 498 Q12 499 500 501 Q13 502 503 504 Q14 505 506 507 508 509 510 511 512 513 Q15 514 515 516 517 518 519 520 521 522 523 524 525 526 527 Q16 528 529 530 531 532 533 534 535 536 Q17 537 538 539 540 Q18 541 542

[1] Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 1997;245: 154–60. [2] Gingeras TR, Higuchi R, Kricka LJ, Lo YM, Wittwer CT. Fifty years of molecular (DNA/ RNA) diagnostics. Clin Chem 2005;51:661–71. [3] Ririe KM, Rasmussen RP, Wittwer CT. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem 1997;245: 154–60. [4] Montgomery J, Wittwer CT, Palais R, Zhou L. Simultaneous mutation scanning and genotyping by high-resolution DNA melting analysis. Nat Protoc 2007;2:59–66. [5] Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, Wittwer CT. Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 2003;49:396–406. [6] Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003;49: 853–60. [7] Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, et al. Genotyping of singlenucleotide polymorphisms by high-resolution melting of small amplicons. Clin Chem 2004;50:1156–64. [8] Pornprasert S, Phusua A, Suanta S, Saetung R, Sanguansermsri T. Detection of alphathalassemia-1 Southeast Asian type using real-time gap-PCR with SYBR Green1 and high resolution melting analysis. Eur J Haematol 2008;80:510–4. [9] Prathomtanapong P, Pornprasert S, Phusua A, Suanta S, Saetung R, Sanguansermsri T. Detection and identification of beta-thalassemia 3.5 kb deletion by SYBR Green1 and high resolution melting analysis. Eur J Haematol 2009;82:159–60. [10] Radvansky J, Resko P, Surovy M, Minarik G, Ficek A, Kadasi L. High-resolution melting analysis for genotyping of the myotonic dystrophy type 1 associated Alu insertion/deletion polymorphism. Anal Biochem 2010;398:126–8. [11] Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003;49: 853–60. [12] Reed GH, Wittwer CT. Sensitivity and specificity of single-nucleotide polymorphism scanning by high-resolution melting analysis. Clin Chem 2004;50:1748–54. [13] Willmore C, Holden JA, Zhou L, Tripp S, Wittwer CT, Layfield LJ. Detection of c-kitactivating mutations in gastrointestinal stromal tumors by high-resolution amplicon melting analysis. Am J Clin Pathol 2004;122:206–16. [14] Zhou L, Vandersteen J, Wang L, Fuller T, Taylor M, Palais B, et al. High-resolution DNA melting curve analysis to establish HLA genotypic identity. Tissue Antigens 2004;64: 156–64. [15] White HE, Hall VJ, Cross NC. Methylation-sensitive high-resolution melting-curve analysis of the SNRPN gene as a diagnostic screen for Prader–Willi and Angelman syndromes. Clin Chem 2007;53:1960–2. [16] Vaughn CP, Elenitoba-Johnson KS. High-resolution melting analysis for detection of internal tandem duplications. J Mol Diagn 2004;6:211–6. [17] Bazsalovicsova E, Kralova-Hromadova I, Radvanszky J, Beck R. The origin of the giant liver fluke, Fascioloides magna (Trematoda: Fasciolidae) from Croatia determined by high-resolution melting screening of mitochondrial cox1 haplotypes. Parasitol Res 2013;112:2661–6. [18] Radvansky J, Bazsalovicsova E, Kralova-Hromadova I, Minarik G, Kadasi L. Development of high-resolution melting (HRM) analysis for population studies of Fascioloides magna (Trematoda: Fasciolidae), the giant liver fluke of ruminants. Parasitol Res 2011;108:201–9. [19] von KH, Bergmann T, Wiesel M, Kaufmann AM. The use of melting curves as a novel approach for validation of real-time PCR instruments. Biotechniques 2011;51: 179–84.

C

E

R

R

O

C

483 484

N

481 482

U

479 480

F

478

O

Acknowledgements

T

477

R O

The authors declare no conflict of interest.

[20] Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem 2003;49: 853–60. [21] Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, et al. Genotyping of singlenucleotide polymorphisms by high-resolution melting of small amplicons. Clin Chem 2004;50:1156–64. [22] Herrmann MG, Durtschi JD, Bromley LK, Wittwer CT, Voelkerding KV. Amplicon DNA melting analysis for mutation scanning and genotyping: cross-platform comparison of instruments and dyes. Clin Chem 2006;52:494–503. [23] White HE, Hall VJ, Cross NC. Methylation-sensitive high-resolution melting-curve analysis of the SNRPN gene as a diagnostic screen for Prader–Willi and Angelman syndromes. Clin Chem 2007;53:1960–2. [24] Twist GP, Gaedigk R, Leeder JS, Gaedigk A. High-resolution melt analysis to detect sequence variations in highly homologous gene regions: application to CYP2B6. Pharmacogenomics 2013;14:913–22. [25] Krypuy M, Newnham GM, Thomas DM, Conron M, Dobrovic A. High resolution melting analysis for the rapid and sensitive detection of mutations in clinical samples: KRAS codon 12 and 13 mutations in non-small cell lung cancer. BMC Cancer 2006; 6:295. [26] Pornprasert S, Sitthichai P, Waneesorn J, Kongthai K, Singboottra P. Rapid identification of heterozygous and homozygous hemoglobin constant spring by SYTO9 with a high resolution melting analysis. Clin Lab 2012;58:829–33. [27] Cui G, Zhang L, Xu Y, Cianflone K, Ding H, Wang DW. Development of a high resolution melting method for genotyping of risk HLA-DQA1 and PLA2R1 alleles and ethnic distribution of these risk alleles. Gene 2013;514:125–30. [28] Schutz E, von AN. Influencing factors of dsDNA dye (high-resolution) melting curves and improved genotype call based on thermodynamic considerations. Anal Biochem 2009;385:143–52. [29] Drobna Z, Del Razo LM, Garcia-Vargas G, Sanchez-Ramirez B, Gonzalez-Horta C, Ballinas-Casarrubias L, et al. Identification of the GST-T1 and GST-M1 null genotypes using high resolution melting analysis. Chem Res Toxicol 2012;25:216–24. [30] Kibbe WA. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res 2007;35:W43–6. [31] Radvansky J, Resko P, Surovy M, Minarik G, Ficek A, Kadasi L. High-resolution melting analysis for genotyping of the myotonic dystrophy type 1 associated Alu insertion/deletion polymorphism. Anal Biochem 2010;398:126–8. [32] Mahadevan MS, Foitzik MA, Surh LC, Korneluk RG. Characterization and polymerase chain reaction (PCR) detection of an Alu deletion polymorphism in total linkage disequilibrium with myotonic dystrophy. Genomics 1993;15:446–8. [33] Radvansky J, Bazsalovicsova E, Kralova-Hromadova I, Minarik G, Kadasi L. Development of high-resolution melting (HRM) analysis for population studies of Fascioloides magna (Trematoda: Fasciolidae), the giant liver fluke of ruminants. Parasitol Res 2011;108:201–9. [34] Herrmann MG, Durtschi JD, Bromley LK, Wittwer CT, Voelkerding KV. Amplicon DNA melting analysis for mutation scanning and genotyping: cross-platform comparison of instruments and dyes. Clin Chem 2006;52:494–503. [35] Herrmann MG, Durtschi JD, Wittwer CT, Voelkerding KV. Expanded instrument comparison of amplicon DNA melting analysis for mutation scanning and genotyping. Clin Chem 2007;53:1544–8. [36] Monis PT, Giglio S, Saint CP. Comparison of SYTO9 and SYBR Green I for real-time polymerase chain reaction and investigation of the effect of dye concentration on amplification and DNA melting curve analysis. Anal Biochem 2005;340: 24–34. [37] Gudnason H, Dufva M, Bang DD, Wolff A. Comparison of multiple DNA dyes for realtime PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature. Nucleic Acids Res 2007;35:e127. [38] Eischeid AC. SYTO dyes and EvaGreen outperform SYBR Green in real-time PCR. BMC Res Notes 2011;4:263. [39] Cui G, Zhang L, Xu Y, Cianflone K, Ding H, Wang DW. Development of a high resolution melting method for genotyping of risk HLA-DQA1 and PLA2R1 alleles and ethnic distribution of these risk alleles. Gene 2013;514:125–30. [40] Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, Wittwer CT. Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 2003;49:396–406. [41] Seipp MT, Durtschi JD, Liew MA, Williams J, Damjanovich K, Pont-Kingdon G, et al. Unlabeled oligonucleotides as internal temperature controls for genotyping by amplicon melting. J Mol Diagn 2007;9:284–9. [42] Gundry CN, Dobrowolski SF, Martin YR, Robbins TC, Nay LM, Boyd N, et al. Base-pair neutral homozygotes can be discriminated by calibrated high-resolution melting of small amplicons. Nucleic Acids Res 2008;36:3401–8. [43] Ng JW, Holt DC, Andersson P, Giffard PM. DNA concentration can specify DNA melting point in a high-resolution melting analysis master mix. Clin Chem 2014;60: 414–6. [44] Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, Wittwer CT. Amplicon melting analysis with labeled primers: a closed-tube method for differentiating homozygotes and heterozygotes. Clin Chem 2003;49:396–406. [45] Chen RF, Knutson JR. Mechanism of fluorescence concentration quenching of carboxyfluorescein in liposomes: energy transfer to nonfluorescent dimers. Anal Biochem 1988;172:61–77.

P

476

Conflict of interest statement

D

475

J. Radvanszky et al. / Clinical Biochemistry xxx (2015) xxx–xxx

E

8

Please cite this article as: Radvanszky J, et al, Comparison of different DNA binding fluorescent dyes for applications of high-resolution melting analysis, Clin Biochem (2015), http://dx.doi.org/10.1016/j.clinbiochem.2015.01.010

543 544 545 546 547 548 549 Q19 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 Q20 566 567 568 Q21 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 Q22 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620