Comparison of efficacy of RNAi mediated by various nanoparticles in the rice striped stem borer (Chilo suppressalis)

Journal Pre-proof Comparison of efficacy of RNAi mediated by various nanoparticles in the rice striped stem borer (Chilo suppressalis)

Kangxu Wang, Yingchuan Peng, Jiasheng, Yue Peng, Xuesong Wang, Zihan Shen, Zhaojun Han PII:

S0048-3575(19)30459-6

DOI:

https://doi.org/10.1016/j.pestbp.2019.10.005

Reference:

YPEST 4467

To appear in:

Pesticide Biochemistry and Physiology

Received date:

19 May 2019

Revised date:

29 August 2019

Accepted date:

1 October 2019

Please cite this article as: K. Wang, Y. Peng, Jiasheng, et al., Comparison of efficacy of RNAi mediated by various nanoparticles in the rice striped stem borer (Chilo suppressalis), Pesticide Biochemistry and Physiology (2019), https://doi.org/10.1016/ j.pestbp.2019.10.005

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof Comparison of efficacy of RNAi mediated by various nanoparticles in the rice striped stem borer (Chilo suppressalis)

Kangxu Wanga,b* , Yingchuan Penga, Jiasheng (Jason) Chena, Yue Penga, Xuesong Wanga, Zihan Shena and Zhaojun Hana* Department of Entomology, College of Plant Protection, Nanjing Agricultural University/The

of

a

ro

Key Laboratory of Monitoring and Management of Plant Diseases and Insects (Ministry of

College of Food Science and Engineering, Nanjing University of Finance and Economics/The

lP

b

re

(Ministry of Education), Nanjing 210095, China.

-p

Agriculture)/The Key Laboratory of Integrated Management of Crop Diseases and Pests

Jiangsu Province Center of Cooperative Innovation for Modern Grain Circulation and Security,

To whom correspondence may be addressed. E-mail address: [email protected] (Z. Han) and

ur

⁎

na

Nanjing 210023, China

Jo

[email protected] (K. Wang).

ABSTRACT: RNA interference (RNAi) has proven to be a very promising prospect for insect pest control. However, low RNAi efficacy limits further development of this biotechnology for use on lepidopteran insects, including the rice striped stem borer (SSB) (Chilo suppressalis), one of the major destructive rice pests. In this work, the application of various nanoparticles (NPs) by which double-stranded RNA (dsRNA) could be encapsulated was evaluated as an alternative delivery strategy to potentially increase the bioactivity of dsRNA. Three NPs, chitosan, carbon

Journal Pre-proof quantum dot (CQD), and lipofectamine2000, complexed with dsRNA (to target the glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH)) were tested to examine their use in controlling SSB. Relative mRNA expressions were quantified using qPCR to evaluate knockdown efficiency of NP-dsRNA treated larvae, and the correlated dsRNA-mediated SSB larval mortality was tested. Thereafter, the content dynamics of hemolymph dsRNA after ingesting different NP-dsRNA were monitored in vivo; the hemolymph dsRNA content was in

of

ratios of 5.67, 9.43, and 1 with chitosan, CQD, and lipofectamine2000 induced samples,

ro

respectively. The results demonstrated that all three tested NPs led to efficient feeding delivery

-p

by improving both dsRNA stability and cellular uptake equally. Furthermore, there was a strong

re

correlation (r= 0.9854) between the hemolymph dsRNA contents and the average RNAi depletions in the non-gut tissues of SSB Overall, our results strongly suggest that due to its

lP

strong endosomal escaping ability, CQD was the most efficient carrier for inducing systemic

na

RNAi, and thereby causing effective gene silencing and mortality in SSB.

Jo

ur

KEYWORDS: RNAi; Pest control; Chilo suppressalis; Chitosan; CQD; Lipofectamine2000

Journal Pre-proof 1. Introduction The rice striped stem borer (SSB) (Chilo suppressalis) is one of the major destructive rice pests that causes severe yield losses in most rice-producing countries (He et al. 2012). The most popular strategy of SSB control is insecticides sprays. However, since SSB has developed high levels of resistance to some major insecticides, the traditional control methods are gradually losing their effectiveness (Su et al. 2014a, b). RNA interference (RNAi), a post-transcriptional

of

gene silencing phenomenon triggered by double-stranded RNA (dsRNA) (Zamore et al. 2000;

ro

Iwasaki et al. 2015), shows considerable potential for insect pest control by suppressing essential

-p

genes and thus leading to decreased fitness and/or mortality (Price and Gatehouse 2008; Zhang et

re

al. 2017; Zotti et al. 2018). Additionally, SSB daft genome data were recently reported (Yin et al.

lP

2014, 2016). Therefore, RNAi could be a prospective and useful tool to study both SSB control and functional genomics. However, our experience indicated that RNAi in SSB is hard to

na

achieve by dsRNA feeding, which is the most simple and cost-effective dsRNA delivery method

ur

for pest control, and a high concentration of injected dsRNA is required to achieve the

Jo

knockdown effect (Hui et al. 2011; Xu et al. 2018). Considering that RNAi efficacy for most lepidopteran insects is low (Terenius et al. 2011; Gu and Knipple 2013), extensive research is being conducted to examine some of the potential factors that influence the efficacy of lepidopteran RNAi, including dsRNA degradation and cellular uptake (Shukla et al. 2016; Chan and Snow 2017; Cooper et al. 2018). Thus, developing a reliable delivery method which could improve both dsRNA stability and cellular uptake is the main challenge in the widespread application of RNAi technology. Over the past few years, nanoparticle (NP)-mediated RNAi has been developed as a promising alternative strategy in pest management. Whyard et al. (2009) found that feeding dsRNA

Journal Pre-proof capsulated by liposomes induced effective RNAi in four different Drosophila species. Additionally, in the mosquito Anopheles gambiae, chitosan, carbon quantum dot (CQD), and amine functionalized silica NPs significantly increased the sensitivity of dsRNA feeding (Das et al. 2015). Moreover, in lepidopteran pests, NP-mediated RNAi utilizing the oral feeding method effectively silenced gene expression (He et al. 2013; Liu, et al., 2014; Xu, et al., 2014; Shen, et al., 2014; Li et al., 2019). Lastly, the transdermal delivery system could be an ideal NP-based

of

RNAi methodology for hemipteran pest control, according to Zheng et al. (2019).

ro

Here, we established a convenient and cost-effective system to achieve successful RNAi feeding,

-p

mediated by gene carriers in SSB. Furthermore, we compared the efficacy of three NPs (chitosan,

re

CQD, and lipofectamine2000) to perform NP-mediated dsRNA oral delivery methods in gene

lP

silencing and SSB control. To investigate the varying efficacies among different NPs in mediating RNAi feeding and gene knockdown, we evaluated their abilities to increase dsRNA

na

stability and cellular uptake for efficient RNAi. We hypothesized that the systemic spread of

ur

dsRNA between gut and non-gut tissues could explain the varying efficacies among the NPs examined in this study. The observed hemolymph dsRNA contents after feeding treatments

Jo

confirmed our hypothesis, which further indicated that NPs could affect the intestinal entrapment of dsRNA. Furthermore, we discussed the relationship between NP-mediated insect RNAi and endosomal escape, which potentially indicates that the varied endosomal escape abilities of different NP-capsulated dsRNA complexes could influence the performance of NP-mediated insect RNAi.

2. Materials and methods

Journal Pre-proof 2.1. C. suppressalis collection and larvae cultivation SSB was collected in Nanjing, Jiangsu Province, China. SSB larvae were reared and fed artificial food. The culture was maintained under a photoperiod of 16 h light, 8 h dark at 28 ℃ and >80% relative humidity, as described by Wang et al (2015). 2.2. dsRNA Synthesis

of

The dsRNA was designed to target the ubiquitously expressed gene, glycerol-3-phosphate

ro

dehydrogenase (G3PDH), which encodes a vital functional protein in SSB (Teng et al. 2012).

-p

pET-2P, which contains two T7 promoters and two T7 terminators, was used as the dsRNA expression vector. A 400 bp fragment of G3PDH and enhanced green fluorescent protein (EGFP)

re

gene were cloned using specific primers (Table 1) in the plasmid pET-2P within EcoR I sites.

lP

Thus, 2 dsRNA expression vectors were constructed and transformed into HT115 (DE3) cells. It

na

has been previously reported that dsRNAs can be abundantly expressed using this bacterial system (Yang and Han 2014). Then, bacterially expressed dsRNAs were purified using the

ur

phenol: chloroform: isoamyl alcohol method and supplemented with 0.4 U/µl of DNase and 0.2

Jo

µg/µl of RNase A treatments (Solis et al. 2009). The quality and quantity of dsRNAs were analyzed by electrophoresis and spectrophotometry (Figure S1). 2.3. Preparing dsRNA nanoparticles and feeding bioassays Chitosan encapsulated dsRNA complex was generated following the steps described by Zhang et al. (2015); 0.02% (wt/vol) chitosan solution was made by dissolving ≥75% deacetylated chitosan product (Sigma‐ Aldrich, Milwaukee, WI, USA) in 0.1 M sodium acetate buffer. A total of 100 µl chitosan solution was added to 32 µg of dsRNA in 100 µl sodium sulphate. After incubation at 55 ℃ for 1 min, this solution was immediately mixed by high speed vortexing for 30 secs to

Journal Pre-proof permit the formation of the chitosan/dsRNA NPs. CQDs were synthesized utilizing a microwave method (Das et al. 2015). Polyethylene glycol (PEG-200; 9 mL) was added to 3 mL of RNasefree water. A total of 100 mg polyethylenimine (PEI) in 2 mL RNase-free water was mixed with the PEG solution and the mixture was then microwaved at 800 W for 3 min. CQDs with dsRNA were suspended in a sodium sulfate solution at 4℃ and incubated overnight. CQD-NP dsRNA complex was at a 20:1 ratio. For dsRNA-lipid complex, the dsRNA was mixed with an

of

appropriate amount of lipofectamine2000 (Thermo Fisher Scientific, Waltham, MA, USA), a

ro

liposome transfection reagent, and incubated according to the manufacturer’s specifications.

-p

To measure the encapsulation efficacies of each NP, NP-dsRNA mixtures were centrifuged at

re

21,000 x g for 30 min, and the concentration of dsRNA in the supernatant was measured using a

lP

spectrophotometer. We calculated the difference between the starting dsRNA amounts and the remaining amounts in the supernatants, to determine the percentage of dsRNA entrapped in the

na

NPs. Prior to the feeding assay, artificial food was cut into rectangular pellets (5 mm x 5 mm x 3 mm) weighing 0.2 g. Each pellet was coated with a different NP-dsRNA solution containing

ur

approximately 5 µg of dsRNA and fed to a group of 10-15 three-day-old 2nd instar SSB larvae.

recorded daily.

Jo

Pellets were replaced every day for a total of six days. Mortality occurrences were observed and

2.4. RNA isolation, cDNA synthesis, and quantitative Real-Time PCR To examine RNAi effects, the expression level of target genes was determined by quantitative Real-Time PCR (qPCR). Some insects were collected 6 days after feeding and kept in liquid nitrogen. For each treatment, total RNA was extracted using a RNeasy Mini Kit (Qiagen, Valencia, CA, USA), from dissected guts, non-gut tissues, and whole SSB organisms (a total of 10-15 individuals). The quality and quantity of RNA was measured using 1% gel electrophoresis

Journal Pre-proof and a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific). The cDNA was reverse transcribed from 1 µg of total RNA with MMLV reverse transcriptase (TaKaRa, Dalian, Liaoning, China), according to the manufacturer's protocol. The qPCRs were performed following MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines. Amplification efficiency and correlation coefficient of each primer pairs were estimated by the five-point standard curve based on a range of serial dilution of cDNA.

of

The equation (E = [10(1/-slope)-1] x 100%) was used to calculate the amplification efficacy for

ro

each of the primer pairs. The qPCR was performed with AceQ® Universal SYBR® qPCR

-p

Master Mix (Vazyme, Nanjing, Jiangsu, China) on an ABI 7500 Real Time PCR system

re

(Applied Biosystems, Foster City, CA, USA). For each gene, at least three biological and three technical replicates were tested. E2F transcription factor 4 (E2F) and cytoplasmic actin A1 (ACT)

lP

were used as the internal controls, as described previously (Teng et al. 2012). The 2-△△Ct method

na

was used to calculate the relative expression level with ABI 7500 analysis software. The primers

ur

used for qPCR are listed in Table 1.

Jo

2.5. Method for detecting dsRNA content For both in vivo and in vitro detection of dsRNA content, the method was modified from our previous reports (Wang et al. 2016, 2018). As we already know, the dsRNA from an exogenous gene (for example, EGFP) has a similar dynamic to that of an endogenous gene, after ruling out the gene base level.26 Therefore, the 400 bp dsRNA of EGFP was used for detection assays. Here, a RNeasy micro kit (Qiagen) was used to isolate dsRNAs from dsRNA feeding and incubated samples. cDNA was generated using specific primers from the total RNA sample following the protocols described in the PrimeScript™ Reverse Transcriptase kit (TaKaRa). Then, dsRNA content was quantified using the formula derived from the calibration of

Journal Pre-proof experiments with serially diluted dsRNA and probe based qPCR (TaKaRa Premix Ex Taq), as described above in the SYBR qPCR procedures (Figure S2). The primers used for dsRNA detection are mentioned in table 1. 2.6. Incubation of NP-dsRNA complex with midgut homogenate The midguts were dissected from 10-15 2nd instar SSB individuals and were homogenized using

of

a TissueLyser LT machine (Qiagen). Then the supernatants were collected by centrifuging at

ro

20,000 x g for 30 min at 4 ℃. The total protein concentrations between different samples were equalized to 2000 ng/µL by spectrophotometry. Then, RNase-free water was added to the NP-

-p

dsRNA solution containing 500 ng of dsEGFP, making a total of 30 µL solution which was then

re

incubated with 20 µL of midgut homogenate at RT for 0, 10, and 60 min, respectively. The

lP

dsRNA content in each sample was calculated by following RNA isolation, cDNA synthesis, and

na

qPCR calibration procedures. The experiment was performed at least three times. 2.7. In vitro gut dsRNA accumulation

ur

For in vitro SSB gut dsRNA accumulation assays, the method was modified from Wang et. al.

Jo

(2018). Whole gut tissues were collected from 3-day-old 2nd instar larvae, and samples were placed in saline. EX-CELL® 405 Serum-Free Medium for Insect Cells (Sigma-Aldrich, St. Louis, MO, USA) was used to dilute the NP-dsRNA solution to a concentration of 10 ng/µL dsEGFP-culture mixture. Dissected guts were rinsed at least three times with RNase-free water before being extended on wax, and the solution was then pipetted (25 ℃ with 90-100% of relative humidity) until the midgut area was fully covered. The dsEGFP-culture mixture was replaced approximately every 5 min to avoid evaporation. Gut tissues were washed thoroughly with RNase-free water after incubation, and midguts were then extracted. In this assay, at least

Journal Pre-proof 10 individual midguts for each treatment were used for RNA isolation and cDNA synthesis. The dsRNA absorbed in the midgut was then tested via probe based qPCR. 2.8. In vivo detection of hemolymph dsRNA content after feeding treatment The dsRNA feeding treatment was administered via drinking (Yang and Han 2014). The insects were first subjected to starvation for 4 h to stimulate their appetite. 20 µL NP-dsRNA solution

of

containing 400 ng of dsEGFP was fed to 10 3-day-old 2nd instar larvae. Thereafter, the larvae

ro

were routinely fed dsRNA-free artificial food. 100 µL hemolymph was then collected from each sample (10 individuals). Following RNA isolation and reverse transcription, the contents of

-p

dsRNA in hemolymph were evaluated utilizing probe qPCR.

lP

re

2.9. Statistical analysis

Values are showed as mean ± SE. All statistical analyses were carried out using Prism 8 software

Jo

3. Results

ur

na

(GraphPad, La Jolla, CA, USA), and differences were considered significant when P < 0.05.

3.1. Gene silencing induced by NP-carried dsRNA Each NP evaluated to determine their RNAi efficacy showed approximately 95% loading efficiency. The qPCR results showed that feeding SSB larvae the dsG3PDH-chitosan conjugate significantly reduced the expression of the corresponding gene to 45% in the gut, 67% in the other tissues, and 57% in the whole organism (Figure 1). Additionally, feeding of the dsG3PDHCQD complex to SSB larvae reduced their gene expression levels to 41% in the gut, 45% in the other tissues, and 43% in the whole organism (Figure 1). In contrast, feeding of the

Journal Pre-proof lipofectamine2000 NP conjugated with dsRNA did not effectively reduce the mRNA levels of the target genes in the non-gut tissues, but did however cause a 52% reduction in gene expression levels in the gut tissues (Figure 1). At the organism level, lipofectamine2000 conjugated with dsG3PDH was able to knockdown the target gene expression level to 69%, while feeding of the dsG3PDH-lipofectamine2000-NP conjugate did not remarkably reduce the mRNA level of the non-gut target gene (Figure 1). We also tested the RNAi efficacy of naked

of

dsRNA, and results showed that feeding the same amount of naked dsRNA to SSB larvae,

ro

targeting the same genes, did not trigger significant mRNA reduction (Figure 1). Overall, there

-p

was a greater reduction of gene expression levels by NP-dsRNA complexes in gut tissues than in

re

other tissues (Figure 1).

lP

3.2. Mortality induced by NP-carried dsRNA

Six days after chitosan-, CQD-, and lipofectamine2000 NP-dsEGFP conjugates were fed to SSB

na

larvae, 92%, 89%, and 86% of SSB larval individuals were found, respectively. The control NP-

ur

dsEGFP treatment was used to eliminate the mortality caused by the NP compounds, and

Jo

Abbott’s formula was used to calculate the corrected mortality (CM) induced by dsRNA-NP conjugates. Two days after NP-dsG3PDH feeding, the CM was 20%, 48%, and 5% of individuals for chitosan, CQD, and lipofectamine2000, respectively (Figure 2). By the fourth day, the CM increased to 48%, 66%, and 19% for chitosan, CQD, and lipofectamine2000, respectively (Figure 2). Lastly, on the sixth day, mortality reached 55%, 70%, and 32% for chitosan, CQD, and lipofectamine2000, respectively (Figure 2).

3.3 Stability of NP-dsRNA conjugates within midgut homogenates

Journal Pre-proof As shown in Figure 3, naked dsRNA degraded the fastest within homogenates. After a 10 min incubation period, the remaining dsEGFP detectable in the naked dsRNA solution was only 17%, while 90%, 94%, and 83% of dsEGFP remained in the solution containing the chitosan-, CQD-, and lipofectamine2000-NP-dsRNA conjugates, respectively (Figure 3). Sixty minutes after incubation, 75%, 71%, and 70% dsEGFP remained for chitosan, CQD, and lipofectamine2000 encapsulated dsRNA, respectively; however, the remaining dsEGFP was almost undetectable in

of

the naked dsRNA sample (Figure 3). Moreover, to determine whether our methods could

ro

efficiently recover dsRNA from the different NP-encapsulated dsRNA samples, an additional

-p

experiment was conducted to compare the quantity and quality of isolated dsRNAs from

re

different samples; our method was indeed able to extract dsRNAs from chitosan-, CQD-, and

lP

lipofectamine2000-NP-dsRNA samples with similar efficiency (Figure S3).

na

3.4. Accumulation of NPs conjugated with dsRNA in SSB midguts

ur

The initial concentration of dissected SSB midguts combined with 10 ng/µL of different NP-

Jo

dsEGFP conjugates after a 5 min incubation period was the same for each treatment, which might have resulted from quick adhesion to the midgut surface and limited cellular uptake associated with the short incubation time. Thus, this initial concentration was used as a control to eliminate the influences of tissue surface adhesion, and subsequent increases in the midgut dsRNA content were used to evaluate cellular uptake (calculated as the relative content during the first quarter hour of observation (Figure 4). The relative content of the naked dsEGFP reached 2.61 after 15 min incubation; however, the relative content of chitosan, CQD, and lipofectamine2000 NPs conjugated with dsEGFP was higher: 7.06, 7.71, and 7.48, respectively (Figure 4).

Journal Pre-proof 3.5. In vivo content dynamics of ingested dsEGFP in the SSB hemolymph Comparison of in vitro gut homogenates and accumulation experiments strongly suggested that the key factor(s) determining efficacy variation among dsRNAs conjugated with different NPs potentially occurs/occur after entering intestinal cells. The hemolymph dsEGFP contents of the larvae fed with different NP samples were all undetectable 0 min after ingestion (Figure 5). Thereafter, 10 min after feeding, the dsEGFP concentration of both the chitosan and CQD

of

carried dsRNA significantly increased to 10.37 and 19.12 fg/μl, respectively; however, the

ro

dsEGFP content of the lipofectamine2000-dsRNA conjugate remained undetectable (Figure 5).

-p

Moreover, the length of the increase phase and the peak level reached in the hemolymph of

re

different NPs conjugated with dsEGFP were quite different. The peak appeared at approximately

lP

50 min in the chitosan, CQD, and lipofectamine2000 treated samples (42.27, 62.92, and 11.37 fg/μl, respectively) (Figure 5). After 90 min, the hemolymph content of chitosan-, CQD-, and

na

lipofectamine2000-dsRNA treated samples decreased to 11.47, 22.71, and 0 fg/μl, respectively.

ur

The curve models were constructed to analyze the dsRNA hemolymph concentration-time integrals after feeding SSB larvae the three NP-dsRNA conjugates (Figure 5). Correspondingly,

Jo

the relative hemolymph dsRNA contents in the feeding treatments were 5.67, 9.43, and 1 for chitosan, CQD, and lipofectamine2000 induced samples, respectively. These results showed a strong correlation (0.9854) between the hemolymph contents and the RNAi depletions induced by feeding different NP-dsG3PDH conjugates to SSB larvae (see Figures 1&5).

4. Discussion

Journal Pre-proof RNAi has proven to be a very promising prospect for insect pest control, but some factors, such as rapid in vivo degradation and difficult cellular uptake of dsRNA, could cause low efficacy in many insect species, which restricts the further development of this biotechnology (Cooper et al. 2018). Fortunately, the application of a variety of nanoparticles (NPs) by which dsRNA could be encapsulated provides an alternative delivery strategy to potentially increase the bioactivity of dsRNA by enhancing both in vivo persistence and cellular uptake ability (Whyard et al. 2009;

of

Zhang et al. 2010; He et al. 2013; Das et al. 2015). However, there remains a gap in

ro

entomological research within this field, particularly regarding lepidopteran insects, considering

-p

they are very insensitive to RNAi. Therefore, the rice stem borer, a major destructive

re

lepidopteran pest of rice, was chosen to systematically test the RNAi effect induced by three representative NPs, chitosan, CQD, and lipofectamine2000. Our results indicate that we have

lP

successfully established a NP based RNAi feeding system for SSB larvae. Moreover, we found

na

that NP-capsulated dsRNAs could not trigger a mRNA reduction in non-gut tissues as efficiently as they could in gut tissues, especially chitosan and lipofectamine2000 capsulated dsRNAs. Thus,

ur

we wanted to further discover the key factor(s) determining the NP based RNAi feeding efficacy

Jo

by describing these phenomena.

In some organisms, including the nematode species (Caenorhabditis elegans) and the red flour beetle (T. castaneum), RNAi works systemically (i.e. systemic RNAi) (Tomoyasu et al. 2008). In C. elegans, a gene sid-1 (systemic RNAi defective-1) encodes a dsRNA channel, essential for the systemic RNAi response (Feinberg and Hunter 2003). However, there is no evidence of the involvement of these genes in systemic RNAi, which suggests that the mechanism for systemic RNAi may vary among insects (Tomoyasu et al. 2008). Instead of the SID-1 channel related mechanism, researchers proposed that the clathrin- mediated endocytosis pathway played a more

Journal Pre-proof important role in dsRNA uptake in several insects, such as T. castaneum, the desert locust (Schistocerca gregaria), the migratory locust (Locusta migratoria), the oriental fruit fly (Bactrocera dorsalis), and the Drosophila S2 culture cell strain (Cooper et al. 2018). Unfortunately, the exact mechanism of cellular dsRNA uptake in insects remains elusive. Although the SSB is not categorized as an RNAi sensitive species, an extremely high concentration of injected dsRNA (e.g. >4 µg/ul) could still induce significant systemic RNAi

of

effects (Xu et al. 2018). Normally, the systemic RNAi process includes dsRNA cellular uptake

ro

and spreading of RNAi signals between cells. In our case, with regards to SSB, the influence of

-p

RNAi feeding on the genes of gut tissues is an environmental RNAi process, because the gene

re

silencing occurs in response to environmentally encountered (feeding) dsRNA (Whangbo and

lP

Hunter 2008). Specifically, systemic RNAi in SSB involves the environmental RNAi process achieved by the uptake of NP capsulated dsRNA in intestinal lumen cells and followed by the

na

systemic spread of the RNAi signal into non-gut tissues. Therefore, we hypothesized that the

ur

factors involved in this process could be the key to answer our question.

Jo

Two extra in vitro experiments that represent different steps in environmental RNAi were conducted to address this issue; we tested the stability of dsRNA which was capsulated by different NPs in SSB midgut homogenates and also compared the gut accumulation ability of different NPs conjugated with dsRNA. We found that all three NPs significantly prevented the degradation and promoted the cellular uptake of naked dsRNA equally. On the one hand, rapid degradation of treated dsRNA mediated by various nucleases in the lepidopteran midgut and/or hemolymph limits RNAi efficacy (Wang et al., 2016), while NP capsulated dsRNA complexes could survive the effects of nucleases (Das et al., 2015). On the other hand, most insects lack the SID-1 channel related mechanisms and uptake of dsRNA happens through Clathrin- mediated

Journal Pre-proof endocytosis (Joga et al., 2016). This is a slow process, and NPs are required to enhance the penetration ability of the cell membrane by potentially utilizing alternative receptors and/or other endocytic entry pathways such as phagocytosis, macropinocytosis, and caveolae-mediated endocytosis (Ma 2014). Interestingly, our RNAi results in figure 1 showed that the CQD-capsulated dsG3PDH was able to improve the RNAi efficiency in both the guts and non-gut tissues, while the RNAi efficiency

of

induced by chitosan and lipofectamine2000 was much higher in the guts than in the non-gut

ro

tissues. Therefore, we hypothesized that the systemic difference of dsRNA spreading between

-p

gut and non-gut tissues could address our concerns. Our results demonstrating the variations in

re

peak level and persistence time among different NP-capsulated dsRNA and the strong correlation

lP

(0.9854) between the hemolymph contents of dsEGFP and the depletions induced by different NP-dsG3PDH feeding strongly supports our hypothesis that CQD-capsulated dsRNA was more

na

efficient at inducing systemic RNAi than chitosan and lipofectamine2000 induced samples.

ur

These results further suggest that the varied intestinal entrapment ability of the different NPs could strongly influence the feeding knockdown efficiency among these NPs and the subsequent

Jo

induction of systemic RNAi in SSB.

Successful delivery of dsRNA depends on the capacity of NPs to enter the cell, reach the cytoplasm, and then release the cargo (Ma 2014). In most cases, NPs are internalized by an endocytosis and endo-lysosomal pathway. Therefore, endosomal escape is of particular importance for the delivery of dsRNA (Wagner 2012). Recent mechanistic researches on NP intracellular trafficking found that inefficient endosomal escape could significantly limit dsRNA delivery efficacy (Gilleron et al. 2013; Sahay et al. 2013). Entrapment in the hostile endolysosomal vesicles and degradation by lysosomal nuclease could be a dead end for dsRNA

Journal Pre-proof delivery (Ma 2014). CQDs, synthesized from PEG and PEI, are now being widely used for medical purpose (Das et al. 2015) due to their ability to avoid trafficking to degradative lysosomes (Shi et al. 2009). The buffering capacity of CQD leads to osmotic swelling and rupture of endosomes (Akinc et al. 2005; Breunig et al. 2008), resulting in the easy release of these complexes into the cytoplasm; a number of dsRNAs could then induce gene silencing in gut cells, while remaining amounts of dsRNA would be transported into hemolymph and

of

eventually induce efficient systemic RNAi in other cells. Unfortunately, both lipid NP and

ro

chitosan lack the ability to sufficiently induce endosomal escape (Sahay et al. 2013; Ragelle et al.

-p

2013). Thus, only small amounts of dsRNA could be released into the cytoplasm, which should

re

however be enough to knockdown gene expression in intestinal cells; however, in our experiment, the SSB hemolymph dsRNA contents of chitosan or lipofectamine2000 involved

lP

treatments was approximately only one-third that of the CQD mediated feeding groups.

na

Therefore, chitosan- and lipofectamine2000- capsulated dsRNA were far less efficient at

ur

systematically inducing gene suppression in SSB compared to CQD mediated RNAi assays. In conclusion, in the present study, we established a NP based, cost-effective method to achieve

Jo

successful RNAi feeding in the lepidopteran pest, SSB and evaluated the efficacy of chitosan-, carbon quantum dot-, and lipofectamine2000 NP-mediated RNAi. We report that all NPs tested were efficient at feeding delivery, equally improving both dsRNA stability and cellular uptake. However, due to its strong endosomal escaping ability, CQD was the most efficient carrier for inducing systemic RNAi in SSB. We believe that this NP-based biotechnology has the potential to become an eco-friendly, targeted, and economic pest management method and it will aid biotechnology advancement and further research focusing on more efficacious induction of RNAi.

Journal Pre-proof Acknowledgements We thank Dr. Huidong Wang (Department of Entomology, NAU) for nanoparticles preparing, Dr. Jun Zhao (Department of Entomology, NAU) for SSB rearing, and Dr. Kai Wang (Department of Bioinformatics, University of Michigan-Ann Arbor) for data analyzing. This work was supported by the National Natural Science Foundation of China (31672053), and the

ro

of

Special Fund for Agro-scientific Research in the Public Interest of China (201303017).

-p

References

re

1. Akinc A, Thomas M, Klibanov AM, Langer R (2005) Exploring polyethylenimine-mediated

lP

DNA transfection and the proton sponge hypothesis. J Gene Med 7:657–663. doi: 10.1002/jgm.696

na

2. Breunig M, Hozsa C, Lungwitz U, et al (2008) Mechanistic investigation of poly(ethylene

ur

imine)-based siRNA delivery: Disulfide bonds boost intracellular release of the cargo. J

Jo

Control Release 130:57–63. doi: 10.1016/j.jconrel.2008.05.016 3. Chan SY, Snow JW (2017) Uptake and impact of natural diet-derived small RNA in invertebrates: Implications for ecology and agriculture. RNA Biol 14:402–414. doi: 10.1080/15476286.2016.1248329 4. Cooper AMW, Silver K, Zhang J, et al (2018) Molecular mechanisms influencing efficiency of RNA interference in insects. Pest Manag Sci. doi: 10.1002/ps.5126 5. Das S, Debnath N, Cui YJ, et al (2015) Chitosan, Carbon Quantum Dot, and Silica Nanoparticle Mediated dsRNA Delivery for Gene Silencing in Aedes aegypti: A

Journal Pre-proof Comparative Analysis. ACS Appl Mater Interfaces 7:19530–19535. doi: 10.1021/acsami.5b05232 6. Feinberg EH, Hunter CP (2003) Transport of dsRNA into cells by the transmembrane protein SID-1. Science 301:1545–1547. doi: 10.1126/science.1087117 7. Gilleron J, Querbes W, Zeigerer A, et al (2013) Image-based analysis of lipid nanoparticle-

of

mediated siRNA delivery, intracellular trafficking and endosomal escape. Nat Biotechnol

ro

31:638–646. doi: 10.1038/nbt.2612

-p

8. Gu L, Knipple DC (2013) Recent advances in RNA interference research in insects: Implications for future insect pest management strategies. Crop Prot 45:36–40. doi:

lP

re

10.1016/j.cropro.2012.10.004

9. He B, Chu Y, Yin M, et al (2013) Fluorescent nanoparticle delivered dsRNA toward genetic

na

control of insect pests. Adv Mater 25:4580–4584. doi: 10.1002/adma.201301201

ur

10. He Y, Zhang J, Chen J, Shen J (2012) Using synergists to detect multiple insecticide resistance in field populations of rice stem borer. Pestic Biochem Physiol 103:121–126. doi:

Jo

10.1016/j.pestbp.2012.04.008

11. Hui XM, Yang LW, He GL, et al (2011) RNA interference of ace1 and ace2 in Chilo suppressalis reveals their different contributions to motor ability and larval growth. Insect Mol Biol 20:507–518. doi: 10.1111/j.1365-2583.2011.01081.x 12. Iwasaki S, Sasaki HM, Sakaguchi Y, et al (2015) Defining fundamental steps in the assembly of the Drosophila RNAi enzyme complex. Nature 2:. doi: 10.1038/nature14254 13. Joga MR, Zotti MJ, Smagghe G, et al (2016) RNAi Efficiency, Systemic Properties, and

Journal Pre-proof Novel Delivery Methods for Pest Insect Control: What We Know So Far. Front Physiol 7:553. doi: 10.3389/fphys.2016.00553 14. Li J, Qian J, Xu Y, et al (2019) A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management. ACS Sustainable Chem Eng 7(6): 63166322.

of

15. Liu K, Xu Z, Yin M, et al (2014) A multifunctional perylenediimide derivative (DTPDI) can

ro

be used as a recyclable specific Hg 2+ ion sensor and an efficient DNA delivery carrier. J

-p

Mater Chem B, 2(15), 2093-2096.

16. Ma D (2014) Enhancing endosomal escape for nanoparticle mediated siRNA delivery. 6415–

lP

re

6425. doi: 10.1039/c4nr00018h

17. Price DRG, Gatehouse J a. (2008) RNAi-mediated crop protection against insects. Trends

na

Biotechnol 26:393–400. doi: 10.1016/j.tibtech.2008.04.004

ur

18. Ragelle H, Vandermeulen G, Préat V (2013) Chitosan-based siRNA delivery systems. J

Jo

Control Release 172:207–218. doi: 10.1016/j.jconrel.2013.08.005 19. Sahay G, Querbes W, Alabi C, et al (2013) Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling. Nat Biotechnol 31:653 20. Shen D, Zhou F, Xu Z, et al (2014) Systemically interfering with immune response by a fluorescent cationic dendrimer delivered gene suppression. J Mater Chem B 2(29): 46534659. 21. Shi D, Cho HS, Huth C, et al (2009) Con ugation of uantum dots and e nanotubes for medical diagnosis and treatment. doi

.

/ .

on carbon

Journal Pre-proof 22. Shukla JN, Kalsi M, Sethi A, et al (2016) Reduced stability and intracellular transport of dsRNA contribute to poor RNAi response in lepidopteran insects. RNA Biol 13:656–669. doi: 10.1080/15476286.2016.1191728 23. Solis CF, Santi-Rocca J, Perdomo D, et al (2009) Use of bacterially expressed dsrna to downregulate entamoeba histolytica gene expression. PLoS One 4:. doi:

of

10.1371/journal.pone.0008424

ro

24. Su J, Zhang Z, Wu M, Gao C (2014a) Geographic susceptibility of Chilo suppressalis Walker (Lepidoptera: Crambidae), to chlorantraniliprole in China. Pest Manag Sci 70:989–995. doi:

-p

10.1002/ps.3640

re

25. Su J, Zhang Z, Wu M, Gao C (2014b) Changes in Insecticide Resistance of the Rice Striped

lP

Stem Borer (Lepidoptera: Crambidae). J Econ Entomol 107:333–341. doi: 10.1603/EC13285

na

26. Teng X, Zhang Z, He G, et al (2012) Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects. J Insect Sci 12:1–

ur

17. doi: 10.1673/031.012.6001

Jo

27. Terenius O, Papanicolaou A, Garbutt JS, et al (2011) RNA interference in Lepidoptera: An overview of successful and unsuccessful studies and implications for experimental design. J Insect Physiol 57:231–245. doi: 10.1016/j.jinsphys.2010.11.006 28. Tomoyasu Y, Miller SC, Tomita S, et al (2008) Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium. Genome Biol 9:R10. doi: 10.1186/gb-2008-9-1-r10 29. Wagner E (2012) Polymers for siRNA Delivery: Inspired by Viruses to be Targeted,

Journal Pre-proof Dynamic, and Precise. Acc Chem Res 45:1005–1013. doi: 10.1021/ar2002232 30. Wang B, Wang Y, Zhang Y, et al (2015) Genome-wide analysis of esterase-like genes in the striped rice stem borer, Chilo suppressalis. Genome 58:323–331. doi: 10.1139/gen-20140082 31. Wang K, Peng Y, Fu W, et al (2018) Key factors determining variations in RNA interference

of

efficacy mediated by different double-stranded RNA lengths in Tribolium castaneum. Insect

ro

Mol Biol 1–11. doi: 10.1111/imb.12546

-p

32. Wang K, Peng Y, Pu J, et al (2016) Variation in RNAi efficacy among insect species is attributable to dsRNA degradation in??vivo. Insect Biochem Mol Biol 77:1–9. doi:

lP

re

10.1016/j.ibmb.2016.07.007

33. Whangbo JS, Hunter CP (2008) Environmental RNA interference. Trends Genet 24:297–305.

na

doi: 10.1016/j.tig.2008.03.007

ur

34. Whyard S, Singh AD, Wong S (2009) Ingested double-stranded RNAs can act as species-

Jo

specific insecticides. Insect Biochem Mol Biol 39:824–32. doi: 10.1016/j.ibmb.2009.09.007 35. Xu Z, He B, Wei W, et al (2014) Highly water-soluble perylenediimide-cored poly (amido amine) vector for efficient gene transfection. J Mater Chem B 2(20): 3079-3086. 36. Xu L, Zhao J, Sun Y, et al (2018) Constitutive overexpression of cytochrome P450 monooxygenase genes contributes to chlorantraniliprole resistance in Chilo suppressalis (Walker). Pest Manag Sci. doi: 10.1002/ps.5171 37. Yang J, Han Z jun (2014) Efficiency of Different Methods for dsRNA Delivery in Cotton Bollworm (Helicoverpa armigera). J Integr Agric 13:115–123. doi: 10.1016/S2095-

Journal Pre-proof 3119(13)60511-0 38. Yin C, Liu Y, Liu J, et al (2014) ChiloDB: a genomic and transcriptome database for an important rice insect pest Chilo suppressalis. Database (Oxford) 2014:1–7. doi: 10.1093/database/bau065 39. Yin C, Shen G, Guo D, et al (2016) InsectBase: A resource for insect genomes and

of

transcriptomes. Nucleic Acids Res 44:D801–D807. doi: 10.1093/nar/gkv1204

ro

40. Zamore PD, Tuschl T, Sharp P a, Bartel DP (2000) RNAi: double-stranded RNA directs the

-p

ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101:25–33. doi:

re

10.1016/S0092-8674(00)80620-0

lP

41. Zhang J, Khan SA, Heckel DG, Bock R (2017) Next-Generation Insect-Resistant Plants: RNAi-Mediated Crop Protection. Trends Biotechnol 35:871–882. doi:

na

10.1016/j.tibtech.2017.04.009

ur

42. Zhang X, Zhang J, Zhu KY (2010) Chitosan/double-stranded RNA nanoparticle-mediated RNA interference to silence chitin synthase genes through larval feeding in the African

Jo

malaria mosquito (Anopheles gambiae). Insect Mol Biol 19:683–693. doi: 10.1111/j.13652583.2010.01029.x

43. Zhang X, Mysore K, Flannery E, et al (2015) Chitosan/Interfering RNA Nanoparticle Mediated Gene Silencing in Disease Vector Mosquito Larvae. JoVE e52523. doi: doi:10.3791/52523 44. Zheng Y, Hu Y, Yan S, et al (2019) A polymer/detergent formulation improves dsRNA penetration through the body wall and RNAi‐induced mortality in the soybean aphid Aphis

Journal Pre-proof glycines. Pest Manag Sci 75(7): 1993-1999. 45. Zotti M, dos Santos EA, Cagliari D, et al (2018) RNA interference technology in crop protection against arthropod pests, pathogens and nematodes. Pest Manag Sci 74:1239–1250.

Jo

ur

na

lP

re

-p

ro

of

doi: 10.1002/ps.4813

Journal Pre-proof Table 1. Primers used for this study. Size (bp)

dsG3PDH CCTTAAGATCCCTTGTGC

CACACGCCTATTCCTGCC

400

dsEGFP

CATCTGCACCACCGGCAAGCT

GGCGAGCTGCACGCTGCC

400

G3PDH q

GTTGTGCCTCACCAATTTGTCAG

GCCACCTTCAGCGATGTCG

111

E2F q

ATTGCTGTGTGATAAAGAAGAAC

AGAAGGTGGTGGACTCAAC

136

ACT q

GTATGGAATCTTGCGGTATC

GGTCCTTACGGATGTCAA

75

EGFP q

CATCTGCACCACCGGCAAG

AGGTCAGGGTGGTCACGAG

59

of

Reverse

-p

ro

Forward

re

Fragment

Jo

ur

na

lP

ds: double-stranded; q: quantitative real-time PCR

Journal Pre-proof Table 2. Corrected Mortality of SSB Larvae Induced by RNAi Mediated by Various Nanoparticle Conjugated dsRNAs Targeting on Different Genes. a Target genes

Nanoparticle-dsRNAs (NP-dsRNAs) Chitosan

Carbon quantum dots (CQD)

Lipofectamine 2000

2 days (%)

20±3b

48±8c

5±4a

4 days (%)

48±3ab

66±2b

19±6a

6 days (%)

55±5b

70±4b

32±3a

of

Glycerol-3-phosphate dehydrogenase (G3PDH)

Observing period

Jo

ur

na

lP

re

-p

ro

a Corrected mortality caused by dsRNA targeting G3PDH was calculated with mortality in control larvae fed on dsEGFP. Within each row, means followed by the same letter are not significantly different. Tukey−Kramer HSD test; n ≥ 3; P = 0.05.

Journal Pre-proof Figure legends Figure 1. NP-dsRNA mediated knockdown assay for SSB gene G3PDH. EGFP was used as a control. Relative mRNA levels of these genes were determined on sixth day after initiation of feeding the larvae with NP-dsRNA complexes. Relative mRNA levels of G3PDH in larvae fed on Chi, chitosan; CQD, carbon quantum dot; and Lipo, lipofectamine2000-dsRNA complexes, respectively. Total RNA isolated from dissected guts, non-gut tissues, and whole organisms were

of

used in qPCR to determine relative mRNA levels of target genes using both E2F and ACT

ro

expression for normalization. The data shown are means ± SE (n ≥ , Student’s t test; * P < . 5;

-p

** P < 0.01).

re

Figure 2. Corrected Mortality of SSB Larvae Induced by RNAi Mediated by Nanoparticles

lP

Conjugated dsG3PDH. Corrected mortality caused by dsRNA targeting G3PDH was calculated with mortality in control larvae fed on dsEGFP. Different letters on the treatment group indicate

na

significant differences at P<0.05 (Kruskal–Wallis test).

ur

Figure 3. In vitro dsRNA persistence capacities associated with different NPs capsulated

Jo

complexes in SSB midgut homogenates. NP encapsulated dsEGFP (500 ng in 30 µL solution) with 20 µL SSB midgut homogenates was incubated at 25°C for indicated period. Nuclease-free water was used as the negative control. Chi, chitosan; CQD, carbon quantum dot; and Lipo, lipofectamine2000. Values are relative to the control that was arbitrarily fixed at 100%. Results represent the means of at least five independent experiments. Statistical analyses were performed using Student’s t-test (mean ± SE; *P < 0.05; **P < 0.01).

Journal Pre-proof Figure 4. Cellular uptake ability associated with different NPs capsulated dsRNA. Different NPsdsEGFP complexes were incubated (in vitro) with SSB midgut samples over the experimental period. Chi, chitosan; CQD, carbon quantum dot; and Lipo, lipofectamine2000. Statistical analyses were performed using Student’s t-test. Values are reported as the mean ± SE (n ≥ ; *P < 0.05; **P < 0.01). Figure 5. Hemolymph content dynamics of ingested dsEGFP. Different NP-dsEGFP complexes

of

were fed into individuals, and a total of 100 µL hemolymph was then collected from 10

ro

individuals over the experimental period. RNA was isolated from 100 µL hemolymph, and the

-p

samples were incubated at 65 °C for 5 min, prior to reverse transcription, to denature the dsRNA.

re

The remaining dsEGFP was then transformed to cDNA, and its content was analyzed with probe

lP

qPCR. The curve models were constructed to analyze the dsRNA hemolymph concentration-time integrals in the three NPs-dsEGFP treatments (Chi, chitosan, y=-4.96+1.72x-0.01729x2 ; CQD,

na

carbon quantum dot, y=-1.026+2.202x-0.02185x2 ; and Lipo, lipofectamine2000, y=-

Jo

ur

6.15+0.6121x-0.00605x2 ). Values are mean ± SE; n ≥ .

Journal Pre-proof Figure captions for supporting information Figure S1. The dsRNAs used in this study. The quality of produced dsEGFP and dsG3PDH were analyzed by electrophoresis. M: DNA Marker.

Figure S2. Calibration curve for dsEGFP quantification. Ct values were plotted against the log10

of

transformed quantity of dsEGFP (pg) in 10 µg samples. The data were described via the

ro

construction of linear regression models (dsEGFP, y = -2.904x + 24.5, R = 0.993). Values are

re

-p

reported as the mean ± SE (n ≥ ).

lP

Figure S3. Relative dsRNA recovery rate of NP-dsRNA solution. A total 20 µL of 20 ng/µL NPdsEGFP solution were prepared for our dsRNA recovery assays. After RNA isolation, the

na

samples were incubated at 65 °C for 5 min, prior to reverse transcription, to denature the dsRNA.

ur

The remaining dsEGFP was then transformed to cDNA by using specific primer, and its content was analyzed with probe qPCR. Chi, chitosan; CQD, carbon quantum dot; and Lipo, . Statistical analyses were performed using Student’s t-test. Values are

Jo

lipofectamine

reported as the mean ± SE.

Journal Pre-proof Highlights: Three NPs, chitosan, CQD, and lipofectamine2000 were tested for controlling SSB larvae via RNAi. All three NPs tested were efficient for feeding delivery by equally improving both dsRNA stability and cellular uptake.

Jo

ur

na

lP

re

-p

ro

of

Due to the strong endosomal escaping ability, CQD was the most efficient carrier for inducing systemic RNAi.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8