Comparison of polymeric immunoglobulin receptor between fish and mammals

Accepted Manuscript Title: Comparison of polymeric immunoglobulin receptor between fish and mammals Authors: Xianghui Kong, Li Wang, Chao Pei, Jie Zhang, Xianliang Zhao, Li Li PII: DOI: Reference:

S0165-2427(18)30045-X https://doi.org/10.1016/j.vetimm.2018.06.002 VETIMM 9760

To appear in:

VETIMM

Received date: Revised date: Accepted date:

26-1-2018 22-4-2018 4-6-2018

Please cite this article as: Kong X, Li W, Pei C, Zhang J, Zhao X, Li L, Comparison of polymeric immunoglobulin receptor between fish and mammals, Veterinary Immunology and Immunopathology (2018), https://doi.org/10.1016/j.vetimm.2018.06.002 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Comparison of polymeric immunoglobulin receptor between fish and mammals

IP T

Xianghui Kong1,2,*,Li Wang1,2, Chao Pei2, Jie Zhang2, Xianliang Zhao2, Li Li2

College of Life Science, Henan Normal University, Henan province, PR China

2

College of Fisheries, Henan Normal University, Henan province, PR China

SC R

1

*

Correspondence: Xianghui Kong, E-mail: [email protected]

U

Tel: 86-373-3328507, Postal Address: No. 46, Jianshe Road, College of Fisheries,

A

N

Henan Normal University, Xinxiang 453007, PR China

M

Abstract

ED

Polymeric immunoglobulin receptor (pIgR) functions in transporting polymeric immunoglobulin across epithelial cells into external secretion in animals. During animal evolution, fish was situated at a transition point on the phylogenetic spectrum

PT

between species possessing only innate immunity (i.e., invertebrates) and species depending heavily on adaptive immunity (i.e., mammals). Previous studies reported

CC E

that fish and mammals significantly differ in pIgR. This review summarized the differences in pIgR structure, function, and transcriptional regulation between fish and mammals. A model of the transcriptional regulation of the pIgR gene was suggested. In

A

this model, microbes could activate Toll-like receptor, trigger the cascade reactions in the signaling pathway, and then activate transcription factors that regulate pIgR expression through combining with the pIgR promoter. This review provides some suggestions for further studies on the function and regulatory mechanism of pIgR in fish and other animals.

Keywords: Polymeric immunoglobulin receptor; Transcriptional expression; Fish; Mammal

1. Introduction

IP T

Polymeric immunoglobulin receptor (pIgR), which serves an important function in immunoglobulin transportation, is produced by the epithelial cells of the skin,

gastrointestinal tract, respiratory tract mucosa-associated lymphoid tissues, and

SC R

glandular epithelial cells of the liver and breast (Gurevich et al., 2003; Kaetzel, 2005;

Hamuro et al., 2007). pIgR plays an important role in mammalian immune response by transporting polymeric Ig across mucosal epithelial cells. pIg is produced in plasma

U

cells to secrete antibody in the lamina propria underlying the epithelium and is bound

N

by pIgR on the basolateral surface of epithelial cells. pIgR can transport pIg from the

A

basolateral surface onto the apical surface of epithelial cells by transcytosis (Gurevich

M

et al., 2003; Kaetzel, 2005; Hamuro et al., 2007). The transported pIg–pIgR complex presents on the apical surface of epithelial cells, and then secretory immunoglobulin

ED

(SIg) is released after proteolytic cleavage, which protects the mucosal tissues from invading pathogens and maintaining homeostasis in the mucosal immunity system

PT

(Gurevich et al., 2003; Kaetzel, 2005; Braathen et al., 2007; Baker et al., 2015). Based on the bioinformatic analyses of zebrafish genome encode multiple multigene families

CC E

of immunoglobulin domain-containing innate immune receptors, the pIgR-like family was defined, which is adjacent to the pIgR gene in gene cluster in zebrafish (Wcisel and Yoder, 2016), but the function is still unclear. In general, immune defense in animals is

A

implemented by the coordinated actions of innate immunity and adaptive immunity. Fish, as lower vertebrates, possess an incomplete adaptive immunity in which the

tetrameric IgM plays a crucial role in conferring specific immune protection. Mammals, as higher vertebrates, develop a complete adaptive immunity in which multiple immunoglobulins function in immune defense. Previous studies reported that bony fish and mammals significantly differ in pIgR (Asano and Komiyama, 2011; Kaetzel, 2014;

Wang, et al., 2017). The present review summarizes the differences in pIgR structure, function, and transcriptional regulation between fish and mammals to supply some suggestions for further studies on the molecular mechanism underlying pIgR transportation.

2. Structural differences between pIgR from fish and mammals

IP T

Mammalian pIgR is a type І transmembrane glycoprotein consisting of an extracellular region, a transmembrane region, and a cytoplasmic region (Kaetzel, 2005). The extracellular region in mammals is composed of five Ig-like domains (ILD1-5) and

SC R

a cleavage site (Gurevich et al., 2003; Kaetzel, 2005; Braathen et al., 2007; Hamuro et

al., 2007). The amino acid sequences of ILD1, ILD4, and ILD5 are highly conserved in mammals (Kaetzel, 2005). ILD1 is an important domain to bind with pIg. The cleavage

U

site is close to the transmembrane region. Moreover, if the cleavage site is hydrolyzed,

N

the proteolytic fragment of the extracellular region is the secretory component (SC). In

A

other vertebrates, the number of ILDs varies. For instance, the extracellular region of

M

pIgR in bird (Gallus gallus) (Wieland et al., 2004) and amphibian (Xenopus leavis) (Braathen et al., 2007) contains four ILDs, which correspond to ILD1, ILD3, ILD4, and

ED

ILD5 in mammals.

Previous studies have reported the amino acid sequences of pIgRs in different fish

PT

species, including fugu (Takifugu rubripes) (Hamuro et al., 2007), common carp (Cyprinoid carpio) (Rombout et al., 2008), orange-spotted grouper (Epinephelus

CC E

coioides) (Feng et al., 2009), rainbow trout (Oncorhynchus mykiss) (Zhang et al., 2010), Atlantic salmon (Salmo salar) (Tadiso et al., 2011), olive flounder (Paralichthys olivaceus) (Xu et al., 2013), turbot (Scophthalmus maximus) (Ding et al., 2013),

A

zebrafish (Danio rerio) (Kortum et al., 2014), Atlantic cod (Gadus morhua) (Rombout et al., 2014), grass carp (Ctenopharyngodon idellus) (Xu et al., 2015), and Qihe crucian carp (Carassius auratus) (Wang, et al., 2017). In general, fish pIgR also consists of an extracellular region, a transmembrane region, and a cytoplasmic region (Fig. 1). The extracellular region of pIgR consists of two ILDs, and each region of two ILDs indicates a high similarity among the different fishes based on multiple alignments (Wang, et al.,

2017). Comparison analyses among pIgR sequences indicate that the first and second ILDs in fish pIgR correspond to ILD1 and ILD5 of mammalian pIgR (Fig. 1). The finding is consistent with the results reported by Hamuro et al. (2007), Rombout et al. (2008), Feng et al. (2009), and Xu et al. (2015).

On the basis of the alignment of deduced amino acid sequences of pIgRs, the

IP T

corresponding function regions are shown among the different animals. In mammals, ILD1 contains the highly conserved Ig-binding sites and three complementarity-

SC R

determining region (CDR)-like loops (Coyne et al. 1994). A mutagenic analysis of three

CDR-like loops indicated that mutations could impair the ability of pIgR binding to dIgA. Each of the three CDR-like loops of ILD1 plays an important role in the binding

U

of dIgA in rabbits. However, in fish pIgR, the conserved Ig-binding site and three CDR-

N

like loops of ILD1 were not shown (Hamuro et al., 2007; Rombout et al., 2008; Feng

A

et al., 2009; Xu et al., 2013). On the basis of the only two ILDs in fish pIgR, the mechanism of pIgR binding to pIg differs between fish and mammals (Hamuro et al.,

M

2007; Rombout et al., 2008; Feng et al., 2009). Hamuro et al. (2007) proposed a putative

ED

binding model of pIg/pIgR that a short pIgR with two ILDs would be sufficient for binding with tetrameric IgM based on the structure of pIgR in fish. By contrast, dimeric or trimeric IgA in mammals would require a long pIgR with four or five ILDs. This

PT

hypothetical binding model of pIg/pIgR was supported by the finding reported by Norderhaug et al. (1999). When ILD2 and ILD3 were deleted from human pIgR, the

CC E

mutation pIgR can bind only to pentameric IgM but not to dimeric IgA (Norderhaug et al., 1999). These findings collectively indicate that the difference in number of ILDs in various species is not caused by alternative splicing but is in accordance with the

A

conversion of mucosal Ig from polymeric IgM to polymeric IgA during evolution. As a consequence, pIgR increases the number of ILDs to adapt to the conversion of mucosal Ig during evolution. However, the exact locations of the Ig-binding sites and the efficiency of pIgR binding to Ig in fish warrant further research. A previous study indicated that the five key amino acid residues (CWRDC) in the ILD1 of mammal (Fig. 2) are required for the β-pleated sheet to maintain the stability

of the Ig fold (Hamburger et al., 2004). In fish, except Atlantic cod, four key residues (CWDC) in ILD1 are conserved, suggesting that the CWDC of pIgR can assist in stabilizing the secondary structure in fish. The pIgR harbors some conserved key amino acid motifs, in which the common KYWC and DxGxYxC motifs (x stands for any amino acid) exist in ILD1while KxWC and DxGWYWC exist in ILD5 in fish.

IP T

3. Functional differences between pIgR from fish and mammals

pIgR could transport pIg across mucosal epithelial cells in mammals. Having

SC R

reached the apical surface, pIgR undergoes a cleavage event, in which the SC is released from cells either as a free form or the complex to bind with dIgA as SIgA (Luton and Mostov, 1999; Asano and Komiyama, 2011). In addition to their primary role in

U

providing SIgA in mucosal secretion, pIgR and SC possess multifaceted immune

N

functions, which have been confirmed in various in vitro and in vivo experiments.

A

When dIgA encounters the antigen, missed by the initial SIgA barrier in the lumen, dIgA is processed along the pIgR-mediated transcytosis to form the immune complex

M

and finally removed from the infected tissues in the lamina propria (Robinson et al.,

ED

2001). Furthermore, on the way to lumenal secretion, SIgA can neutralize pathogens invading into epithelial cells by intracellular neutralization (Schwartz-Cornil et al., 2002). Moreover, SIgA can exclude pathogens from the mucosal surface. Aside from

PT

protecting SIgA from proteolytic degradation and improving pIgA stability (Crottet and Corthésy, 1998; Ma et al., 1998), SC serves as a nonspecific microbial scavenger by

CC E

preventing epithelial cells from pathogen interaction (Dallas and Rolfe, 1998; de Oliveira et al., 2001). In fish, to date, the function of pIgR in mucosal immunity is mainly focused on the

A

binding of Ig to pIgR. As mentioned above, three CDR-like loops on ILD1 are absent in fish, and pIgR consists of only two ILDs. However, in fish, pIgR can still bind to IgM (Hamuro et al., 2007; Zhang et al., 2010; Xu et al., 2013) and IgT (also called IgZ) (Zhang et al., 2010), a type of immunoglobulin, which was discovered based on the genome analysis of several fish (Hansen et al., 2005; Danilova et al., 2005). In fugu, Hamuro et al. (2007) demonstrated that SC, with a molecular mass of 60 kDa, can bind

to tetrameric IgM in skin mucus. In rainbow trout, SC with a molecular mass 38 kDa, was detected only in the gut mucus and not in the serum (Zhang et al., 2010), suggesting that SC is associated with the IgM and IgT in gut mucus. In olive flounder, a recombinant pIgR can bind with IgM in skin mucus and serum (Xu et al., 2013), and a flounder SC

(37 kDa) can be detected in skin mucus and not in serum. The flounder

IgM, similar to mammalian SIg, needs to bind to pIgR and is transported into skin

IP T

mucus, whereas the flounder IgM is free of SC in serum. These findings in flounder, as

mentioned above, agree with the results reported in fugu and rainbow trout. The

trout, 37 kDa in olive flounder, and >20 kDa in other fish.

SC R

molecular mass of SC varies in different fish, i.e., 60 kDa in fugu, 38 kDa in rainbow

With regard to the N-glycosylation sites, in humans, seven putative N-

U

glycosylation sites were determined in the extracellular domain of pIgR (Eiffert et al.,

N

1991; Hughes et al., 1999). However, in fish, few N-glycosylated sites were predicted

A

in pIgR. For example, only one was predicted in pIgR from fugu and carp and none in grouper. Interestingly, seven O-glycosylation residues were predicted in the

M

extracellular region of pIgR in flounder. To date, whether the N-glycosylation of pIgR

ED

is necessary for its function remains controversial. In humans, some studies indicated that the glycosylated SC can facilitate pIgR transport and release into the mucus (Scheiffele and Füllekrug, 2000; Daly et al., 2007). Meanwhile, Prinsloo et al. (2006)

PT

reported that N-glycosylation of the recombinant SC is unnecessary to the interaction with pIg. In fish, the few N-glycosylated sites in pIgR in fugu and even none in grouper

CC E

and flounder did not affect its binding capability with the tetrameric IgM (Hamuro et al., 2007), implying that N-glycosylation is not required for pIgR binding to pIg in fish. Nevertheless, the effect of post-translational modification of SC on immunity warrants

A

further research.

A previous IgM-binding analysis on grouper confirmed that the recombinant pIgR,

associated with the IgM on the extracellular surface of cells, is similar to the function of native pIgR (Feng et al., 2009). Nevertheless, the affinity of the recombinant pIgR to IgM is relatively low probably because of the lack of joining (J) chain (Johansen et al., 2001), a small polypeptide, which is expressed in the mucosal and the glandular

plasma cells. In mammals, the J chain is particularly relevant to the binding of pIgA/M to the pIgR because of its significant impact on the intracellular polymerization of IgA/M (Brandtzaeg and Prydz, 1984; Hughes et al., 1990; Ghebremicael et al., 2008). Currently, some studies have proven the existence of the J chain in cartilaginous fish (Cannon et al., 2002; Hohman et al., 2003; Braathen et al., 2007). However, the function of the J chain remains unclear (Magadán-Mompó et al., 2013).

IP T

With regard to the immune function of pIgR in fish, pIgR can bind to IgM or IgT and then transport them into the skin or gut mucous. However, compared with those in

SC R

mammals, many of the immune roles of pIgR in fish remain unclear to date, such as removal of pathogen-SIg complexes from infected tissue, intracellular neutralization of invading pathogens, protection of SIg from proteolytic degradation, and nonspecific

U

scavenger function of free SC.

N

4. Basal and challenge-induced expression of pIgR in fish and

A

mammals

M

In mammals, the highest level of bovine plgR mRNA transcription is observed in the mammary gland. The signals from other tissues are either significantly low (in the

ED

liver, lung, small intestine, and kidney) or undetectable (in spleen) (Verbeet, et al., 1995). The tissue specificity of plgR gene expression in cow is in accordance with that

PT

in humans (Krajci et al.,1989). In bovine, pIgR mRNA is expressed in the sublingual and submandibular glands but not in the parotid gland. Higher protein levels are

CC E

observed in the sublingual glands than in the submandibular glands (Sakaguchi et al., 2013). The sublingual gland plays an important role in the first-line defense of the oral cavity in cattle in contrast to humans and rats. In the human colonic epithelial cell line

A

HT-29, pIgR expression is upregulated by butyrate, which is a product of bacterial fermentation (Kvale and Brandtzaeg, 1995). The expression of pIgR is upregulated in germ-free mice implanted with Bacterioides thetaiotaomicron, which is an important microbe in intestinal microbiota in mice and humans (Hooper et al., 2001), suggesting that pIgR expression is regulated by commensal bacteria. In addition, pIgR expression can be upregulated in HT-29 cells by double-stranded RNA, as a ligand for TLR3, and

lipopolysaccharide (LPS), as a ligand for TLR4 (Schneeman et al., 2005). The same results were also observed in HT-29 cells treated by reovirus (double-stranded RNA) (Pal et al., 2005) and bacteria (Entero bacteriaceae) with LPS on the surface (Bruno et al., 2010). In fish, pIgR mRNA is abundantly expressed in the skin, gill, intestine, and liver, showing the similar expression in zebrafish, common carp, grouper, Atlantic salmon,

IP T

flounder, and fugu (Hamuro et al., 2007; Rombout et al., 2008; Feng et al., 2009; Tadiso et al., 2011; Xu et al., 2013; Kortum et al., 2014). Fish pIgR is involved in mucosal

SC R

protection. To date, the molecular mechanism of pIgR in immunity has been unclear in

fish. The mRNA expression of pIgR initially increases significantly, decreases from the peak, and then slightly reaches the control level in the hindgut of common carp after a

U

bacterial (Vibrio anguillarum) stimulation (Wang, 2009). This finding is in accordance

N

with the result that pIgR is expressed in the skin, gill, stomach, intestine, kidney, and

A

spleen of turbot (Ding et al., 2013). However, the results mentioned above are inconsistent with the finding that pIgR transcript levels increase in the skin and spleen

M

of Atlantic salmon infected with ectoparasite Lepeophtheirus salmonis (Tadiso et al.,

ED

2011). This result can be ascribed to the different response mechanisms between bacterial and ectoparasite infection. In addition, the transcript levels of zebrafish pIgR are upregulated during bacterial (Streptococcus iniae) infection but are downregulated

PT

after viral (Snakehead rhabdovirus, SHRV) infection (Kortum et al., 2014). SHRV might suppress the immune response in zebrafish through downregulating pIgR

CC E

expression, which is similar to the response of CD300a/c in human dendritic cells (DCs) (Ju et al., 2008). The downregulation of CD300a/c transcript possibly results from the

A

virus-induced activation of TLR7 and TLR9 (Ju et al., 2008).

5. Transcription regulation of pIgR in fish and mammals 5.1 Transcription factor-binding sites in pIgR In mammals, the cytokine-inducible regulatory elements (e.g. NF-κB, STAT6, and IRF1) can combine in the 5′-flanking region, exon 1, and intron 1 of pIgR and trigger

the transcription of pIgR (Kushiro and Sato, 1997). This feature is extremely useful in the upregulation of pIgR expression (Kushiro and Sato, 1997). In fish, such as in T. rubripes, D. rerio, and G. morhua, the complete gene sequences of pIgR have been deposited in the GenBank database (Table 1). The binding sites of NF-κB, STAT6 and IRF1 could also be predicted and determined in the 5′-flanking region of pIgR and not in the exon 1 and intron 1 of pIgR by using the online software Ensemble

IP T

(http://www.ensembl.org/index.html) and JASPAR database (http://jaspar.genereg.net/) (Table. 1). Based on this finding, NF-κB, STAT6 and IRF1 could be identified as the

SC R

potential regulators in fish. In brief, the transcriptional expression of pIgR could be regulated via the cytokine TNF-α, IL-4/13A (or IL-4/13B), and IFN-γ in fish.

U

5.2 pIgR transcription via TLR signaling pathway

N

TLRs, as the pattern recognizing receptors on the cellular membrane of animals,

A

can recognize pathogen-associated molecular patterns of microbes and initiate cascade reactions in the TLR signaling pathway. Schneeman et al. (2005) demonstrated that the

M

induction of pIgR transcription via TLR signaling pathways is dependent on the same

ED

NF-κB binding site in the intron 1 of pIgR, wherein the NF-κB binding site is involved in the transcriptional regulation of pIgR (Bruno et al., 2011). pIgR expression is blocked in vivo in mice with the deletion of MyD88, a cytoplasmic adapter protein for TLR,

PT

compared with wild-type littermates (Frantz et al., 2012). Kaetzel (2014) proposed a model wherein TLRs in the epithelium of mammals can recognize the microbial

CC E

component, recruit MyD88, and initiate an NF-κB-dependent signaling pathway. The activated NF-κB and other transcription factors, which are translocated to the nucleus, can enhance the transcription of the pIgR gene (Kaetzel, 2014). Therefore, the

A

upregulation of pIgR expression is driven through the TLR signaling pathway under microbe infection (Bruno et al., 2011). In fish, pIgR expression was also thought to be mainly regulated through the TLR/MyD88/NF-κB signaling pathway. More than 20 TLRs have been identified and characterized in fish (Zhang et al., 2014). MyD88 genes also have been cloned in zebrafish (van der Sar et al., 2006), Japanese flounder (Takano et al., 2006), half-smooth

tongue sole (Cynoglossus semilaevis) (Yu et al., 2009), large yellow croaker (Pseudosciaena crocea) (Yao et al., 2009), Atlantic salmon (Skjaeveland et al., 2009), common carp (Kongchum et al., 2011), and orange-spotted grouper (Yan et al., 2012), exhibiting the homologous sequences with those in mammals. The expression levels of MyD88 are elevated in the head kidney, spleen, gill, and muscle of turbot after challenge with LPS, CpG oligodeoxynucleotide, and turbot reddish body iridovirus,

IP T

respectively (Lin et al., 2015). In fish TLR signaling pathway, the MyD88-depended transduction way plays the most prominent role after pathogen stimulation. Therefore,

SC R

the adapter MyD88 was focused in fish. However, MyD88 is not only one adapter, and

also as important as various adaptors or kinases downstream of the TLRs. In zebrafish and fugu, transcription factor-binding sites for NF-κB are predicted to be located in the

U

promoter sequence of pIgR. Thus, the transcriptional regulation of pIgR is possibly

N

closely related to the TLR signaling pathway. The transcription factor NF-κB, as an

A

important regulating element, plays an important role in the TLR/MyD88/NF-κB signaling pathway. The NF-κB family in mammals comprises five members, namely,

M

RelA, RelB, c-Rel, p105/p50(NF-κB1), and p100/p52(NF-κB2) (Ghosh and Hayden,

ED

2008). Members of the NF-κB family in zebrafish include p65, p100/p52, RelB, c-Rel, and p50, and the NF-κB protein sequence in zebrafish is highly homologous with the corresponding sequences in mammals (Correa et al., 2004). Subsequently, the members

PT

of the NF-κB family have been isolated from mandarin fish (Siniperca chuatsi), fugu, medaka (Oryzias latipes), and flounder (Yang et al., 2014).

CC E

In brief, it is demonstrated that TLR signaling pathways are the excellent

conservation in different fishes, which is generally performed through MyD88depended or MyD88-independed way. The TLR signaling pathways were involved in

A

the multiple adaptors such as MyD88 or SARM in zebrafish (Jault et al., 2004), IRAK4 in rainbow trout (Brietzke et al., 2014), IRAK1 in mandarin fish (Zhang et al., 2009), TRAF6 and TAK1 in grass carp (Zhao et al., 2013), as well as IκBα and NF-κB in rainbow trout (Sangrador-Vegas et al., 2005). Among these adaptors, some could regulate the transcript of pIgR via direct or indirect way.

5.3 pIgR transcription induced by cytokines The expression of pIgR can be modulated directly by cytokines. The main cytokines in regulating pIgR expression are tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), and interleukin-4 (IL-4 in mammal, IL-4/13A and IL-4/13B in fish), which play key roles in upregulating the expression of pIgR in response to various bacterial and viral infections (Piskurich et al., 1997; Traicoff et al., 2003; Johansen and

IP T

Kaetzel, 2011).

TNF-α, as a major pro-inflammatory cytokine, can act at an early stage of the

SC R

inflammatory reaction and orchestrate the subsequent cascade of events (Bradley, 2008;

Waters et al., 2013). In humans, TNF-α, as a key cytokine in regulating pIgR transcription, can bind to the cell surface receptor and then initiate the NF-κB signal

U

transduction pathway to trigger the activation and nuclear translocation of the

N

transcription factor RelA/p50 (Dunne and O’Neill, 2003; Bonizzi and Karin, 2004). One NF-κB binding site is located in the intron 1 of human pIgR, and two NF-κB

A

binding sites are identified in the 5′-flanking region of the pIgR gene, the mutation of

M

which causes a modest decrease in pIgR promoter activity in response to TNF

ED

(Takenouchi-Ohkubo et al., 2000). In fish, the TNF-α gene has been cloned and characterized in rainbow trout (Laing et al., 2001), gilthead sea bream (Sparus auratus) (García-Castillo et al., 2002), common carp (Saeij et al., 2003), catfish (Ictalurus

PT

punctatus) (Zou et al., 2003), zebrafish (Savan et al., 2005), sea bass (Dicentrarchus labrax) (Nascimento et al., 2007), barred knifejaw (Oplegnathus fasciatus) (Kim et al.,

CC E

2009), grass carp (Zhang et al., 2012), and turbot (Ronza et al., 2015). In fish, the TNFα gene shows the similar function to that in mammals (García-Castillo et al., 2004; Roca et al., 2008; Grayfe et al., 2008; Lam et al., 2011). In zebrafish embryonic cells infected

A

with infectious pancreatic necrosis virus (IPNV), TNF-α and transcriptional regulator NF-κB are upregulated. Treatment of the virus-infected cells with a siRNA targeting TNF-α inhibits NF-κB expression (Wang et al., 2011). This result suggests that TNF-α functions as a regulatory factor that enhances NF-κB expression after IPNV infection in zebrafish. IFN-γ, a regulatory cytokine in the innate and adaptive immunity, could upregulate

pIgR expression (Johansen and Kaetzel, 2011). In human, IFN-γ binding signal is transduced by the Janus kinase (JAK), signal transducer and activator of transcription 1 (STAT1) pathway. Signaling through the IFN-γ receptor triggers the activation and nuclear translocation of STAT1 dimers and results in the de novo transcription of IRF1 and association of IRF1 with a binding site in exon 1 of the pIgR gene (Johansen and Kaetzel, 2011). In zebrafish, the IFN-γ-JAK-STAT1 pathway is conserved compared

IP T

with that in humans (Aggad et al., 2010; Song et al., 2011), suggesting that IFN-γ regulates pIgR transcriptional expression in fish. IFN-γ has been identified in a broad

SC R

range of fish, and two IFN-γ genes (IFN-γ1and IFN-γ2) have been found in some fish (Long et al., 2006; Stolte et al., 2008; Sieger et al., 2009). In zebrafish, IFN-γ1 and IFN-

γ2 can bind to distinct receptors containing the conserved binding regions of JAK1 and

U

JAK2 (JAK2a and JAK2b), but only JAK2a is involved in the IFN-γ signaling pathway

N

(Aggad et al., 2010). Two STAT1 (STAT1a and STAT1b) are co-orthologs of STAT1 in

A

humans (Song et al., 2011). In zebrafish embryonic cells, IFN-γ, STAT1, and IRF1 are upregulated after infection with IPNV (Wang et al., 2011). Thus, the IFN-γ/JAK/STAT1

M

pathway in zebrafish could regulate IRF1 transcription (Fig. 2). As mentioned above,

ED

IRF1, as a transcription factor, plays an important role in regulating pIgR transcription in humans. Among the 12 genes in the IRF family in zebrafish, the expression of IRF1 is the most abundant in the immune-associated tissues and is significantly induced after

PT

virus infection. Therefore, IRF1 has been identified as a positive regulator of the IFN antiviral response in zebrafish (Feng et al., 2009).

CC E

IL-4, as an important member of the class I cytokine family, can upregulate pIgR

expression in mammals (Johansen and Kaetzel, 2011). The biological function of IL-4 is performed through interacting with IL-4R (Ozaki and Leonard, 2002; Leung et al.,

A

2004; Lee et al., 2008) and then incurs nuclear translocation of activated STAT6 dimers, which associate with a STAT6 binding site in intron 1 of pIgR (Schjerven et al., 2000). The molecular characterizations and functions of IL-4, IL-4R, and downstream elements in the signaling pathway of pIgR transcription regulation have been well documented in mammals (Shimoda et al., 1996; Takeda et al., 1996; Barner et al., 1998; Mckenzie et al., 1999). In fish, a series of IL-4-like genes was identified in the

pufferfish (Tetraodon nigroviridis) (Li et al., 2007), zebrafish (Ohtani et al., 2008), medaka (Ohtani et al., 2008), seabass, spotted gar (Lepisosteus oculatus), rainbow trout, and common carp (Wang and Secombes, 2015). Two teleost IL-4-like genes have been discovered in fish, which were renamed as IL-4/13A and IL-4/13B (Ohtani et al., 2008; Biswas et al.,2016). A high constitutive expression of IL-4-like has been detected in the gill and skin of trout, suggesting that it plays an important role in mucosal tissue

IP T

(Takizawa et al., 2011). In addition, IL-4 is upregulated in the epidermis of rainbow

trout within 9 days after infection with Ichthyobodo necator relative to that in

SC R

uninfected fish (Chettri et al., 2014). In zebrafish injected with the recombinant IL-4-

like (rIL-4-like), dendritic cell-specific ICAM-3-grabbing non-integrin (Lin et al., 2009) or IgZ isoform (Hu et al., 2010) increases in peripheral blood leucocytes (PBL). In

U

zebrafish, rIL-4-like administrated for 3 days can increase the number of IgM+ B cells

A

N

in PBL and significantly upregulate the expression of STAT6 (Zhu et al., 2012).

5.4 pIgR transcription regulation model

M

In fish and mammals, TLRs and cytokines can regulate the transcriptional

ED

expression of pIgR. Therefore, a regulation model is proposed for the transcriptional expression of pIgR (Fig. 3), in which TLR is activated through the TLR/MyD88/NFκB signaling pathway after microbe challenge. NF-κB is activated and driven to

PT

combine with the regulation region of pIgR and initiates the transcriptional expression of pIgR. In fish, with regard to pIgR transcriptional expression via the TLR/MyD88/NF-

CC E

κB signaling pathway, further studies need to be carried out to address the underlying molecular mechanism. Currently, the transcription factors IRF1, STAT6, and NF-κB can combine in

A

certain regions of pIgR and initiate the transcription expression of the pIgR gene, although the binding sites in pIgR are different between fish and mammals. On the basis of these findings, the regulation model of pIgR (Fig. 3) was postulated, in which the cytokine TNF-α can bind to the receptor TNFR1 and activate the cascade reactions to drive the transcription factor NF-κB to combine with the regulation sequence of pIgR and finally initiate pIgR transcription. The cytokine IL-4 can bind to the receptor IL4R

and then drive the transcription factor STAT6 to bind with the regulation site of pIgR and finally propel pIgR transcription. Cytokine IFN-γ can bind to IFNγR, activate STAT1 to express the transcription factor IRF1, which can combine with the regulation region of pIgR, and finally initiate pIgR transcription.

IP T

6. Conclusions and perspectives pIgR plays an important role in immune defense, which could bind and transport pIg across the epithelial cell in animals. The composition difference of the pIgR

SC R

functional region between fish and mammals shows two ILDs in fish and five ILDs in

mammals. The transcription of pIgR could be modulated by some cytokines or microbes. A model of transcriptional regulation of gene pIgR was suggested, in which cytokines

U

and microbes could trigger the cascade reactions in the signaling pathway and finally

N

activate transcription factors to regulate pIgR expression through combining with the

A

regulation region of pIgR. However, compared with that in mammals, the molecular

M

mechanism of pIgR transcription regulation in fish is less addressed. Therefore, future studies should elucidate the regulatory mechanism of pIgR transcription in fish to

ED

achieve a comprehensive understanding for the transcription difference between fish and mammals. This review could serve as a theoretical guideline for further studies on

PT

the pIgR function and regulatory mechanism in fish and other animals.

CC E

Acknowledgments

This work was sponsored by The Joint Fund of Natural Science Foundation of China and Henan Province (U1604104), Program for Innovative Research Team in Science

A

and Technology in the University of Henan Province (15IRTSTHN018) and Henan Province Innovative Research Team in Science and Technology (201706081). The authors would like to thank their colleagues for the valuable suggestions on the overall manuscript preparation.

References

IP T

Aggad, D., Stein, C., Sieger, D., Mazel, M., Boudinot, P., Herbomel, P., Levraud, J.P., Lutfalla, G., Leptin, M., 2010. In vivo analysis of Ifn-γ1 and Ifn-γ2 signaling in zebrafish. J Immunol 185,6774-6782. Asano, M., Komiyama, K., 2011. Polymeric immunoglobulin receptor. J Oral Sci 53,147-156. Baker, K., Blumberg, R.S., Kaetzel, C.S., 2015. Immunoglobulin Transport and Immunoglobulin Receptors. Mucosal Immunol 1, 349-407. Barner, M., Mohrs, M., Brombacher, F., Kopf, M., 1998. Differences between IL-4R alpha-deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr Biol 8, 669-672. Biswas, G., Nagamine, R., Hikima, J., Sakai, M., Kono, T., 2016. Inductive immune responses in

SC R

the Japanese pufferfish (Takifugu rubripes) treated with recombinant IFN-γ, IFN-γrel, IL-4/13A and IL-4/13B. Int Immunopharmacol 31,50-56.

M

A

N

U

Bonizzi, G., Karin, M., 2004. The two NF-κB activation pathways and their role in innate and adaptive immunity. Trends Immunol 25, 280-288 Braathen, R., Hohman, V.S., Brandtzaeg P, Johansen F.E., 2007. Secretory Antibody Formation: Conserved Binding Interactions between J Chain and Polymeric Ig Receptor from Humans and Amphibians. J Immunol 178,1589-1597. Bradley, J.R., 2008. TNF-α mediated inflammatory disease. J Pathol 214,149-160. Brandtzaeg, P., Prydz, H., 1984. Direct evidence for an integrated function of J chain and secretory component in epithelial transport of immunoglobulins. Nature 311,71-73. Brietzke, A., Goldammer, T., Rebl, H., Korytář, T., Köllner, B., Yang, W., Rebl, A., Seyfert, H., 2014. Characterization of the interleukin 1 receptor-associated kinase 4 (irak4)-encoding gene

ED

in salmonid fish: the functional copy is rearranged in oncorhynchus mykiss and that factor can impair tlr signaling in mammalian cells. Fish Shellfish Immunol 36, 206-214.

A

CC E

PT

Bruno, M.E., Frantz, A.L., Rogier, E.W., Johansen, F.E., Kaetzel, C.S., 2011, Regulation of the polymeric immunoglobulin receptor by the classical and alternative NF-κB pathways in intestinal epithelial cells. Mucosal Immunol 4, 468-478. Bruno, M.E., Rogier, E.W., Frantz, A.L., Stefka, A.T., Thompson, S.N., Kaetzel, C.S., 2010. Regulation of the polymeric immunoglobulin receptor in intestinal epithelial cells by Enterobacteriaceae: implications for mucosal homeostasis. Immunol Invest 39, 356-382. Cannon, J.P., Haire, R.N., Litman, G.W., 2002. Identification of diversified genes that contain immunoglobulin-like variable regions in a protochordate. Nat Immuno 3,1200-1207. Chettri, J.K., Kuhn, J.A., Jaafar, R.M., Kania, P.W., Moller, O.S., Buchmann, K., 2014. Epidermal response of rainbow trout to Ichthyobodo necator: immunohistochemical and gene expression studies indicate a Th1-/Th2-like switch. J Fish Dis 37,771-783. Correa, R.G., Tergaonkar, V., Ng, J.K., 2004. Characterization of NF-κΒ/IκΒ proteins in zebrafish and their involvement in notochord development. Mol Cell Biol 24, 5257-5268. Coyne, R.S., Siebrecht, M., Peitsch, M.C., Casanova, J.E., 1994. Mutational analysis of polymeric immunoglobulin receptor/ligand interactions Evidence for the involvement of multiple complementarity determining region (CDR)-like loops in receptor domain I. J Biol Chem 269, 31620-31625.

A

CC E

PT

ED

M

A

N

U

SC R

IP T

Crottet, P., Corthésy, B,. 1998. Secretory component delays the conversion of secretory IgA into antigen-binding competent F(ab')2: a possible implication for mucosal defense. J Immunol 161, 5445-5453. Dallas, S.D., Rolfe, R.D., 1998. Binding of Clostridium difficile toxin A to human milk secretory component. J Med Microbiol 47, 879-888. Daly, K.A., Digby, M., Lefèvre, C., Mailer, S., Thomson, P., Nicholas, K., Williamson, P., 2007. Analysis of the expression of immunoglobulins throughout lactation suggests two periods of immune transfer in the tammar wallaby (Macropus eugenii). Vet Immunol Immunopathol 120, 187-200. Danilova, N., Bussmann, J., Jekosch, K., Steiner, L.A., 2005. The immunoglobulin heavy-chain locus in zebrafish: identification and expression of a previously unknown isotype, immunoglobulin Z .Nat Immunol 6, 295-302. de Oliveira, I.R., de Araújo, A.N., Bao, S.N., Giugliano, L.G., 2001. Binding of lactoferrin and free secretory component to enterotoxigenic Escherichia coli. FEMS Microbiol Lett 203,29-33. Ding, B., Sheng, X., Tang, X., Xing, J., Zhan, W., 2013. Molecular cloning and expression analysis of the pIgR gene in Scophthalmus maximus. J Fish Sci China 20,792-801.(in Chinese) Dunne, A., O'Neill, L.A.J., 2003. The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci STKE, 171, re3. Eiffert, H., Quentin, E., Wiederhold, M., Hillemei, S., Decker, J., Weber, M., Hilschmann, N., 1991. Determination of the molecular structure of the human free secretory component. Biol Chem Hoppe Seyler 372, 119-128. Feng, L.N., Lu, D.Q., Bei, J.X., Chen, J.L., Liu.Y., Zhang Y., Liu, X.C., Meng, Z.N., Wang L., Lin, H.R., 2009. Molecular cloning and functional analysis of polymeric immunoglobulin receptor gene in orange-spotted grouper (Epinephelus coioides). Comp Biochem Phys B 154, 282-289. Frantz, A.L., Rogier, E.W., Weber, C.R., Shen, L., Cohen, D.A., Fenton, L.A., Bruno, M.E., Kaetzel, C.S., 2012. Targeted deletion of MyD88 in intestinal epithelial cells results in compromised antibacterial immunity associated with downregulation of polymeric immunoglobulin receptor, mucin-2, and antibacterial peptides. Mucosal Immunol 5, 501-512. García-Castillo, J., Chaves-Pozo, E., Olivares, P., Pelegrín, P., Meseguer, J., Mulero, V., 2004. The tumor necrosis factor alpha of the bony fish seabream exhibits the in vivo proinflammatory and proliferative activities of its mammalian counterparts, yet it functions in a species-specific manner. Cell Mol Life Sci 61, 1331-1340. García-Castillo, J., Pelegrín, P., Mulero, V., Meseguer, J., 2002. Molecular cloning and expression analysis of tumor necrosis factor alpha from a marine fish reveal its constitutive expression and ubiquitous nature. Immunogenetics 54,200-207. Ghebremicael, S.B., Hasenstein, J.R., Lamont, S.J., 2008. Association of interleukin-10 cluster genes and Salmonella response in the chicken. Poult Sci 87,22-26. Ghosh, S., & Hayden, M. S., 2008. New regulators of NF-κB in inflammation, Nat Rev Immunol 8, 837-848.

Grayfer, L., Walsh, J.G., Belosevic, M., 2008. Characterization and functional analysis of goldfish (Carassius auratus L.) tumor necrosis factor-alpha. Dev Comp Immunol 32,532-543. Gurevich, P., Zusman, I., Moldavsky, M., Szvalb, S., Elhayany, A., Halperin, R., Gurevich, E., BenHur, H., 2003. Secretory immune system in human intrauterine development: immunopathomorphological analysis of the role of secretory component (pIgR/SC) in immunoglobulin transport. Int J Mol Med 12, 289-297.

A

Danio rerio,” Mol Immunol 40,759-771.

N

U

SC R

IP T

Hamburger, A.E., Jr, A.P.W., Bjorkman, P.J., 2004. Crystal structure of a polymeric immunoglobulin binding fragment of the human polymeric immunoglobulin receptor. Structure 12,1925-1935. Hamuro, K., Suetake, H., Saha, N. R., Kikuchi, K., Suzuki, Y., 2007. A teleost polymeric Ig receptor exhibiting two Ig-like domains transports tetrameric IgM into the skin. J Immunol 178, 56825689. Hansen, J.D., Landis, E.D., Phillips, R.B., 2005. Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: Implications for a distinctive B cell developmental pathway in teleost fish. Proc Natl Acad Sci USA 102, 6919-6924. Hohman, V.S., Stewart, S.E., Rumfelt, L.L., Greenberg, A.S., Avila, D.W., Flajnik, M.F., Steiner, L.A., 2003. J chain in the nurse shark: implications for function in a lower vertebrate. J Immunol 170, 6016-6023. Hooper, L.V., Wong, M.H., Thelin, A., Hansson, L., Falk, P.G., Gordon, J.I., 2001. Molecular analysis of commensal host-microbial relationships in the intestine. Science 291,881-884. Hu, Y.L., Xiang, L.X., Shao, J.Z., 2010. Identification and characterization of a novel immunoglobulin Z isotype in zebrafish: Implications for a distinct B cell receptor in lower vertebrates. Mol Immunol 47,738-746. Hughes, G.J., Frutiger, S., Paquet, N., Jaton, J.C., 1990. The amino acid sequence of rabbit J chain in secretory immunoglobulin A. Biochem J 271, 641-647. Hughes, G.J., Reason, A.J., Savoy, L.A., Jaton, J.C., Frutiger-Hughes, S., 1999. Carbohydrate moieties in human secretory component. Biochim Biophys Acta 1434, 86-93. Jault, C., Pichon, L., Chluba, J., 2004. Toll-like receptor gene family and TIR-domain adapters in

A

CC E

PT

ED

M

Johansen, F.E., Braathen, R., Brandtzaeg, P., 2001. The J chain is essential for polymeric Ig receptormediated epithelial transport of IgA. J Immunol 167,5185-5192. Johansen, F.E., Kaetzel, C.S., 2011. Regulation of the polymeric immunoglobulin receptor and IgA transport: new advances in environmental factors that stimulate pIgR expression and its role in mucosal immunity. Mucosal Immunol 4, 598–602. Ju, X., Zenke, M., Hart, D.N., Clark, G.J., 2008. CD300a/c regulate type I interferon and TNF-alpha secretion by human plasmacytoid dendritic cells stimulated with TLR7 and TLR9 ligands. Blood 112,1184-1194. Kaetzel, C.S., 2005. The polymeric immunoglobulin receptor: bridging innate and adaptive immune responses at mucosal surfaces. Immunol Rev 206, 83-99. Kaetzel, C.S., 2014. Coevolution of mucosal immunoglobulins and the polymeric immunoglobulin receptor: evidence that the commensal microbiota provided the driving force. ISRN Immunol 2014, 1-20. Kim, M.S., Hwang, Y.J., Yoon, K.J., Zenke, K., Nam, Y. K., Kim., S.K., Kim, K.H., 2009. Molecular cloning of rock bream (Oplegnathus fasciatus) tumor necrosis factor-alpha and its effect on the respiratory burst activity of phagocytes. Fish Shellfish Immunol 27, 618-624. Kongchum, P., Hallerman, E.M., Hulata, G., David, L., Palti, Y., 2011. Molecular cloning, characterization and expression analysis of TLR9, MyD88 and TRAF6 genes in common carp (Cyprinus carpio). Fish Shellfish Immunol 30, 361-371. Kortum, A.N., Rodriguez-Nunez, I., Yang, J., Shim, J., Runft, D., O’Driscoll, M.L., Haire, R.N., Cannon, J.P., Turner, P.M., Litman, R.T., Kim, C.H., Neely, M.N., Litman, G.W., Yoder, J.A., 2014. Differential expression and ligand binding indicate alternative functions for zebrafish

A

CC E

PT

ED

M

A

N

U

SC R

IP T

polymeric immunoglobulin receptor (pIgR) and a family of pIgR-like (PIGRL) proteins. Immunogenetics ,66, 267-279. Krajci, P., Solberg, R., Sandberg, M., Oyen, O., Jahnsen, T., Brandzaeg, P.,1989. Molecular cloning of the human transmembrane secretory component (poly-Ig receptor) and its mRNA expression in human tissues. Biochem Biophys Res Commun 158, 783-789. Kushiro, A., Sato, T., 1997. Polymeric immunoglobulin receptor gene of mouse: sequence, structure and chromosomal location. Gene 204, 277-282. Kvale, D., Brandtzaeg, P., 1995. Constitutive and cytokine induced expression of HLA molecules, secretory component, and intercellular adhesion molecule-1 is modulated by butyrate in the colonic epithelial cell line HT-29. Gut 36,737-742. Laing, K.J., Wang, T., Zou, J., Holland, J., Hong, S., Bols, N., Hirono, I., Aoki, T., Secombes, C.J., 2001. Cloning and expression analysis of rainbow trout Oncorhynchus mykiss tumour necrosis factor-α. Eur J Biochem 268,1315-1322. Lam, W.S., Wu, S.Y., Lin, S.J., Lin, C.C., Chen,Y. M., Wang, H.C., Chen, T.Y., Lin, H.T., Lin, H.Y., 2011. The expression of two novel orange-spotted grouper (Epinephelus coioides) TNF genes in peripheral blood leukocytes, various organs, and fish larvae. Fish Shellfish Immunol 30, 618-629. Lee, S.O., Pinder, E., Chun, J.Y., Lou, W., Sun, M., Gao, A.C., 2008. Interleukin-4 stimulates androgen-independent growth in LNCaP human prostate cancer cells. Prostate 68, 85-91. Leung, D.Y.M., Boguniewicz, M., Howell, M.D., Nomura, I., Hamid, Q.A., 2004. New insight into atopic dermatitis. J Clin Invest 113, 651-657. Li, J.H., Shao, J.Z., Xiang, L.X., Wen, Y., 2007. Cloning, characterization and expression analysis of pufferfish interleukin-4 cDNA: The first evidence of Th2-type cytokine in fish. Mol Immunol 44, 2078-2086. Lin, A.F., Xiang, L.X., Wang, Q.L., Dong, W.R., Gong, Y.F., & Shao, J.Z., 2009. The DC-SIGN of zebrafish: insights into the existence of a CD209 homologue in a lower vertebrate and its involvement in adaptive immunity. J Immunol 183, 7398-7410 Lin, J.Y., Hu, G.B., Yu, C.H., Li, S., Liu, Q.M., Zhang, S.C., 2015. Molecular cloning and expression studies of the adapter molecule myeloid differentiation factor 88 (MyD88) in turbot (Scophthalmus maximus). Dev Comp Immunol 52,166-171. Long, S., Milev-milovanovic, I., Wilson, M., Bengten, E., Clem, L.W., & Miller, N.W., Chinchar, V.G., 2006. Identification and expression analysis of cDNAs encoding channel catfish type I interferons. Fish Shellfish Immunol 21,42-59. Luton, F., Mostov, K.E., 1999. Transduction of basolateral-to-apical signals across epithelial cells: ligand-stimulated transcytosis of the polymeric immunoglobulin receptor requires two signals. Mol Biol Cell 10, 1409-1427. Ma, J.K., Hikmat, B.Y., Wycoff, K., Vine, N.D., Chargelegue, D., Yu, L., Hein, M.B., Lehner, T., 1998. Characterization of a recombinant plant monoclonal secretory antibody and preventive immunotherapy in humans. Nat Med 4, 601-606. Magadán-Mompó, S., Sánchez-Espinel, C., Gambón-Deza, F., 2013. Immunoglobulin genes of the turtles. Immunogenetics 65, 227-237. Mckenzie, G.J., Fallon, P.G., Emson, C.L., Grencis, R.K., Mckenzie, A.N., 1999. Simultaneous disruption of interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type 2mediated responses. J Exp Med 189, 1565-1572.

IP T

Nascimento, D.S., Pereira, P.J.B., Reis, M.I.R., do Vale, A., Zou, J., Silva, M.T., Secombes, C.J., dos Santos, N.M.S., 2007. Molecular cloning and expression analysis of sea bass (Dicentrarchus labrax L) tumor necrosis factor-α (TNF-α). Fish Shellfish Immunol 23,701710. Norderhaug, I.N., Johansen, F.E., Krajci, P., Brandtzaeg, P., 1999. Domain deletions in the human polymeric Ig receptor disclose differences between its dimeric IgA and pentameric IgM interaction. Eur J Immunol 29, 3401-3409. Ohtani, M., Hayashi, N., Hashimoto, K., Nakanishi, T., Dijkstra, J.M., 2008. Comprehensive clarification of two paralogous interleukin 4/13 loci in teleost fish. Immunogenetics 60, 383397. Ozaki, K., Leonard, W.J., 2002. Cytokine and cytokine receptor pleiotropy and redundancy. J Biol Chem 277, 29355-29358.

SC R

Pal, K., Kaetzel, C.S., Brundage, K., Cunningham, C.A., Cuff, C.F.,2005. Regulation of polymeric immunoglobulin receptor expression by reovirus, J. Gen. Virol. 86, 2347-2357.

Piskurich, J.F., Youngman, K.R., Phillips, K.M., Hempen, P.M., Blanchard, M.H., France J.A., Kaetzel C.S., 1997. Transcriptional regulation of the human polymeric immunoglobulin receptor gene by interferon-gamma. Mol Immunol 34, 75-91.

U

Prinsloo, E., Oosthuizen, V., Muramoto, K., Naude, R.J., 2006. In vitro refolding of recombinant

N

human free secretory component using equilibrium gradient dialysis. Prot Expr Purif 47, 179185.

A

Robinson, J.K., Blanchard, T.G., Levine, A.D., Emancipator, S.N., Lamm, M.E., 2001. A mucosal

M

IgA-mediated excretory immune system in vivo. J Immunol 166, 3688-3692.

A

CC E

PT

ED

Roca, F.J., Mulero, I., López-muñoz, A., Sepulcre, M.P., Renshaw, S.A., Meseguer, J., Mulero V., 2008. Evolution of the inflammatory response in vertebrates: fish TNF-alpha is a powerful activator of endothelial cells but hardly activates phagocytes. J Immunol 181,5071-5081. Rombout, J.H.W.M., van der Tuin, S.J.L., Yang, G., Schopman, N., Mroczek, A., Hermsen, T., Taverne-Thiele, J.J., 2008. Expression of the polymeric Immunoglobulin Receptor (pIgR) in mucosal tissues of common carp (Cyprinus carpio L). Fish Shellfish Immunol 24,620-628. Rombout, J.H.W.M., Yang, G., Kiron, V., 2014. Adaptive immune responses at mucosal surfaces of teleost fish. Fish Shellfish Immunol 40, 634-643. Ronza, P., Bermúdez, R., Losada, A.P., Sitjàbobadilla, A., Pardo, B.G., Quiroga, M.I., 2015. Immunohistochemical detection and gene expression of TNF-α in turbot (Scophthalmus maximus) enteromyxosis. Fish Shellfish Immunol 47,368-376. Saeij, J.P.J., Stet, R.J.M., Vries, B.J.D., Muiswinkel, W.B.V., Wiegertjes, G.F., 2003. Molecular and functional characterization of carp TNF: a link between TNF polymorphism and trypanotolerance. Dev Comp Immunol 27, 29-41. Sakaguchi, K., Yokota, H., Miyasho, T., Maeda, N., Nakamura, K., Onaga, T., Koiwa, M., Matsuda, K., Okamoto, M., Hirayama, K., Taniyama, H., 2013. Polymeric immunoglobulin receptor expression and local immunoglobulin A production in bovine sublingual, submandibular and parotid salivary glands. Vet J 197, 291–296. Sangrador-Vegas, A., Smith, T.J., Cairns, M.T., 2005. Cloning and characterization of a homologue of the alpha inhibitor of NF-κB in Rainbow trout (Oncorhynchus mykiss). Vet Immunol Immunopathol 103,1-7.

A

N

U

SC R

IP T

Savan, R., Kono, T., Igawa, D., Sakai, M., 2005. A novel tumor necrosis factor (TNF) gene present in tandem with theTNF-α gene on the same chromosome in teleosts. Immunogenetics 57, 140150. Scheiffele, P., Füllekrug, J., 2000. Glycosylation and protein transport. Essays Biochem 36,27-35. Schjerven, H., Brandtzaeg, P., Johansen, F.E., 2000. Mechanism of IL-4-mediated up-regulation of the polymeric Ig receptor: role of STAT6 in cell type-specific delayed transcriptional response. J Immunol 165, 3898-3906. Schneeman, T.A., Bruno, M.E., Schjerven, H., Johansen, F.E., Chady, L., & Kaetzel, C.S., 2005. Regulation of the polymeric Ig receptor by signaling through TLRs 3 and 4: linking innate and adaptive immune responses. J Immunol 175,376-384. Schwartz-cornil, I., Benureau, Y., Greenberg, H., Hendrickson, B.A., Cohen, J., 2002. Heterologous protection induced by the inner capsid proteins of rotavirus requires transcytosis of mucosal immunoglobulins. J Virol 76, 8110-8117. Shimoda, K., Deursent, J.V., Sangster, M.Y., Sarawar, S.R., Carson, R.T., Tripp, R.A., Chu, C., Quelle, F.W., Nosaka, T., Vignali, D.A.A., 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380,630-633. Sieger, D., Stein, C., Neifer, D., Van der Sar, A.M., Leptin, M., 2009. The role of gamma interferon in innate immunity in the zebrafish embryo. Dis Model Mech 2,571-581. Skjaeveland, I., Iliev, D.B., Strandskog, G., Jørgensen, J.B., 2009. Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar). Dev Comp Immunol 33,1011-1017. Song, H., Yan, Y.L., Titus, T., He, X., Postlethwait, J.H., 2011. The role of stat1b in zebrafish

M

hematopoiesis. Mech Dev,128, 442-456.

A

CC E

PT

ED

Stolte, E., Savelkoul, H., Wiegertjes, G., Flik, G., Verburg-Van Kemenade, B., 2008. Differential expression of two interferon-gamma genes in common carp (Cyprinus carpio L). Dev Comp Immunol 32,1467-1481. Tadiso, T.M., Sharma, A., Hordvik, I., 2011. Analysis of polymeric immunoglobulin receptor and CD300-like molecules from Atlantic salmon. Mol Immunol 49,462-473. Takano, T., Kondo, H., Hirono, I., Saito-Taki, T., Endo, M., Aoki, T., 2006. Identification and characterization of a myeloid differentiation factor 88 (MyD88) cDNA and gene in Japanese flounder, Paralichthys olivaceus. Dev Comp Immunol 30,807–816. Takeda, K., Tanaka, T., Shi, W., Matsumoto, M., Minami, M., Kashiwamura, S., Nakanishi, K., Yoshida, N., Kishimoto, T., Akira, S., 1996. Essential role of Stat6 in IL-4 signalling. Nature 380,627-630. Takenouchi-Ohkubo, N., Takahashi, T., Tsuchiya, M., Mestecky, J., Moldoveanu, Z., Moro, I., 2000. Role of nuclear factor-κ B in the expression by tumor necrosis factor-α of the human polymeric immunoglobulin receptor (pIgR) gene. Immunogenetics 51,289-295. Takizawa, F., Koppang, E.O., Ohtani, M., Nakanishi, T., Hashimoto, K., Fischer, U., Dijkstra, J.M., 2011. Constitutive high expression of interleukin-4/13A and GATA-3 in gill and skin of salmonid fishes suggests that these tissues form Th2-skewed immune environments. Mol Immunol 48,1360-1368. Traicoff, J.L., Marchis, L.D., Ginsburg, B.L., Zamora, R.E., Khattar, N.H., Blanch, V.J., 2003. Characterization of the human polymeric immunoglobulin receptor (pIgR) 3'UTR and

IP T

differential expression of pIgR mRNA during colon tumorigenesis. J Biomed Sci 10,792-804. van der Sar, A.M., Stockhammer, O.W., van der Laan C., Spaink, H.P., Bitter W., Meijer, A.H., 2006. MyD88 innate immune function in a zebrafish embryo infection model. Infect Immun 74, 2436-2441. Verbeet, M.P., Vermeer, H., Warmerdam, G.C.M., de Boer, H.A., Lee, S.H., 1995. Cloning and characterization of the bovine polymeric immunoglobulin receptor-encoding cDNA ,Gene, 164, 329-333. Wang, L., 2009. Study on function of the polymeric immunoglobulin receptor in Common carp (Cyprinus carpio L.). Master Dissertation in Shandong Normal University, China (in Chinese) Wang, L., Zhang, J., Kong, X.H., Pei, C., Zhao, X.L., Li, L., 2017. Molecular characterization of polymeric immunoglobulin receptor and expression response to Aeromonas hydrophila challenge in Carassius auratus. Fish Shellfish Immunol 70,372-380.

N

U

SC R

Wang, T., Secombes, C.J., 2015. The evolution of IL-4 and IL-13 and their receptor subunits. Cytokine 75, 8-13 Wang, W.L., Liu, W., Gong, H.Y., Hong, J.R., Lin, C.C., Wu, J.L.，2011. Activation of cytokine expression occurs through the TNFα/NF-κB-mediated pathway in birnavirus-infected cells. Fish Shellfish Immunol 31,10-21. Waters, J.P., Pober, J.S., Bradley, J.R., 2013. Tumour necrosis factor in infectious disease. J Pathol 230,132-147 Wcisel, D.J., Yoder, J.A., 2016. The confounding complexity of innate immune receptors within

A

and between teleost species. Fish Shellfish Immunol 53,24-34.

A

CC E

PT

ED

M

Wieland, W.H., Orzáez, D., Lammers, A., Parmentier, H.K., Verstegen, M.W., Schots, A., 2004. A functional polymeric immunoglobulin receptor in chicken (Gallus gallus) indicates ancient role of secretory IgA in mucosal immunity. Biochem J 380, 669-676. Xu, G.J., Wang, C., Meng, Q.L., Liu, F., Liu, F., Chen, X.L., 2015. Cloning of polymeric immunoglobulin receptor gene fragment in grass carp Ctenopharyngodon idellus using degenerate primers designed by CODEHOP. J DaLian Ocean Univ 30,138-142. (in Chinese) Xu, G.J., Zhan, W.B., Ding, B.J., Sheng, X.Z., 2013. Molecular cloning and expression analysis of polymeric immunoglobulin receptor in flounder (Paralichthys olivaceus). Fish Shellfish Immunol 35,653–660. Yan, Y., Cui, H.C., Wei, J.G., Huang, Y.H., Huang, X.H., Qin, Q.W., 2012. Functional genomic studies on an immune- and antiviral-related gene of MyD88 in orange-spotted grouper, Epinephelus coioides. Chin Sci Bull 57,3277-3287. Yang, B.Z., Zhang, M., Wang, K.J., 2014. Role of NF-κB Signal Pathway in the Innate Immune System of Fish. Biotechnol Bull 1, 46-52. Yao, C.L., Kong, P., Wang, Z.Y., Ji, P.F., Liu, X.D., Cai, M.Y., Han, X.Z., 2009. Molecular cloning and expression of MyD88 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol 26,249-255. Yu, Y., Zhong, Q.W., Zhang, Q.Q., Wang, Z.G., Li, C.M., Yan, F.S., Jiang, L.M., 2009. Full-length sequence and expression analysis of a myeloid differentiation factor 88 (MyD88) in halfsmooth tongue sole Cynoglossus semilaevis. Int J Immunogenet 36,173-182. Zhang, A.Y., Chen, D.Y., Wei, H., Du, L.Y., Zhao, T.Q., Wang, X.Y., Zhou, H., 2012. Functional characterization of TNF-α in grass carp head kidney leukocytes: induction and involvement in the regulation of NF-κB signaling. Fish Shellfish Immunol 33,1123-1132.

Zhang, C.Z., Yin, Z.X., He, W., Chen, W.J., Luo, Y.W., Lu, Q.X., Weng, S.P., Yu, X.Q., He, J., 2009. Cloning of IRAK1 and its upregulation in symptomatic mandarin fish infected with ISKNV. Biochem Biophys Res Commun 383, 298-302.

IP T

Zhang, J., Kong, X., Zhou, C., Li, L., Nie, G., Li, X., 2014. Toll-like receptor recognition of bacteria in fish: Ligand specificity and signal pathways. Fish Shellfish Immunol 41,380-388. Zhang, Y.A., Salinas, I., Li, J., Parra, D., Bjork, S., Xu, Z., Lapatra, S.E., Bartholomew, J., Sunyer, J.O., 2010. IgT, a primitive immunoglobulin class specialized in mucosal immunity. Nat Immunol 11,827-835. Zhao, F., Li, Y.W., Pan, H.J., Wu, S.Q., Shi, C.B., Luo, X.C., Li, A.X., 2013. Grass carp (Ctenopharyngodon idella) TRAF6 and TAK1: Molecular cloning and expression analysis after Ichthyophthirius multifiliis infection. Fish Shellfish Immunol 34,1514-1523.

SC R

Zhu, L.Y., Pan, P.P., Fang, W., Shao, J.Z., Xiang, L.X., 2012. Essential role of IL-4 and IL-4Rα

interaction in adaptive immunity of zebrafish: insight into the origin of Th2-like regulatory mechanism in ancient vertebrates. J Immunol 188, 5571-5584.

Zou, J., Secombes, C.J., Long, S., Miller, N., Clem, L.W., Chincha, V.G., 2003. Molecular

U

identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus

A

CC E

PT

ED

M

A

N

punctatus). Dev Comp Immunol 27,845-858.

fish 5’-UTR SP

5’-UTR SP

ILD1

ILD2

ILD1

ILD3

ILD5

ILD4

TM

ILD5

Cy

TM

3’UTR

Cy

3’-UTR

mammal pIgR cDNA functional region comparison between fish and mammals. UTR, untranslated

IP T

Fig. 1

A

CC E

PT

ED

M

A

N

U

SC R

region; SP, signal peptide; ILD, Ig-like domain; TM, transmembrane region; Cy, cytoplasmic region.

IFNgR

IL4R

TLR

TNFR1

MyD88 IRF1 STAT1

STAT6

IkB

+1

STAT6

IRF1

STAT1 STAT

IRF1

P50 P65

+1

STAT

IRF

U

NF-kB

SC R

PIGR

IP T

P50 P65

N

Fig. 3. Transcriptional regulation model of pIgR gene. Based on the transcription factor

A

binding sites in the promoter sequence of the pIgR gene in fish and mammals, the cytokines and microbes could combine with the corresponding receptors and activate

M

the cascade reactions in cells. Then, the activated transcription factors bind to the

ED

different sites in the promoter region of pIgR and initiate the transcription of pIgR. In the schematic, the rhombuses represent the transcription factor-binding sites in the

A

CC E

PT

promoter sequence of the pIgR gene.

Table 1 Predicted binding sites of IRF1, STAT6, and NF-κB in the 5′-flanking region of pIgR in fish Accession NO. T. rubripes NC_018911.1 D. rerio NC_007113.6 G. morhua

NF-κB motif

STAT6 motif

None

TTTTTCCTCCGAATG

AATAACTTTTTTTTTTTTTT

TATTTCTTAAAAAAA

TTTGTCTTTCTGTTTGTTTCA TTTTTCCTCCGAATG

GGGTATTTTC

AGGTGCAACCCCA

TGGACTTTAC

A

CC E

PT

ED

M

A

N

U

SC R

KJ460333.1

IRF1 motif

IP T

Species