- Email: [email protected]
Comparison of the four mouse fasciclin-containing genes expression patterns during valvuloseptal morphogenesis
Gene Expression Patterns 5 (2005) 593–600 www.elsevier.com/locate/modgep
Comparison of the four mouse fasciclin-containing genes expression patterns during valvuloseptal morphogenesis Andrew Lindsleya, Wei Lia, Jian Wanga, Nana Maedaa,b, Rhonda Rogersa, Simon J. Conwaya,* a
Cardiovascular Development Group, Herman B Wells Center for Pediatric Research, Riley Hospital for Children, Indiana University School of Medicine, 1044 West Walnut Street, R4 W379, Indianapolis, IN 46202, USA b Nara Medical University, Kashihara City, Nara 634-8521, Japan Received 6 December 2004; received in revised form 15 March 2005; accepted 18 March 2005
Abstract All four mammalian fasciclin-containing genes are expressed in the adult valves and are localized in partially overlapping and reciprocal patterns during cardiovascular development. Spatiotemporal comparison of the fasciclin-containing secreted adhesion genes, TGFbeta induced clone H3 (bigH3) and periostin, revealed that they are co-localized within the outflow tract endocardial cushions, but that bigH3 expression is restricted to the septal cushions within the atrioventricular canal. Conversely, the fasciclin-containing transmembrane gene, stabilin-1, is predominately expressed in the endocardial layer overlaying the cushions and lining the developing heart. However, expression of the fasciclin-containing transmembrane gene, stabilin-2 is only present in the post-natal mature valve endothelial cells. These data illustrate for the first time that the primitive endocardial cushions dynamically express multiple fasciclin-containing adhesion molecules as they undergo the key steps of seeding, proliferation, differentiation, fusion, mesenchymal condensation and remodeling during mouse heart development. q 2005 Elsevier B.V. All rights reserved. Keywords: fasciclin domain; TGFbeta induced clone H3; bigH3; periostin; stabilin-1; stabilin-2; Mouse heart development; Cardiac valve morphogenesis
1. Results and discussion Cardiac endocardial cushions are mesenchymal swellings that form within the wall of the embryonic heart as the primordia of the future valves and septa. While many of the genes involved in the formation of cushions have been identified (Gitler et al., 2003; de Lange et al., 2004; Lincoln et al., 2004) virtually nothing is known about what determines the positioning of the cushions, whether all cushions are alike and how these primitive cushions become mature valve leaflets with an attendant valve supporting apparatus. Initially, the mouse atrioventricular (AV) endocardial mesenchymal cushions are formed from overlying endothelial cells undergoing epithelial–mesenchymal transformation (EMT) around E9–9.5. Subsequently, the proximal outflow tract (OFT) mesenchymal cushions * Corresponding author. Tel.: C1 317 278 8780; fax: C1 317 278 5413. E-mail address: [email protected] (S.J. Conway).
1567-133X/$ - see front matter q 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.modgep.2005.03.005
are formed from cells derived from both endocardial cells via EMT and cardiac neural crest cells that colonize the OFT around E10–10.5 (Dor et al., 2003; Chang et al., 2004). The distal OFT cushions that form the septa between the aorta and pulmonary artery contain mesenchymal cells derived from the cardiac neural crest, but not endocardial cells (Kisanuki et al., 2001). Previously we have shown that the secreted cell adhesion molecule, periostin is expressed in the developing mouse heart (Kruzynska-Frejtag et al., 2001). Periostin contains four fasciclin domains homologous to similar motifs found in the Drosophila protein, fasciclin-I (Bastiani et al., 1987). The fasciclin-domain was linked to axonal guidance, cell sorting and adhesion during insect nervous system morphogenesis and is highly conserved, as it is found in both secreted and membraneanchored proteins of several species, including mammals, insects, sea urchins, plants, yeast and bacteria (Kawamoto et al., 1998). There are currently four fasciclin-containing mammalian genes (Fig. 1A), periostin, bigH3, stabilin-1 and stabilin-2, however, their roles during cardiac development are unknown. Periostin was initially cloned from a mouse
594
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 1. Phylogenetic and comparative developmental Northern analysis. (A) Based on sequence similarity, mouse, zebrafish and Drosophila fasciclincontaining genes were aligned (using the BLOSUM62 matrix), scored (using the Neighbor Joining method of Saitou and Nei, 1987) and a tree constructed using the average distance method. Alignment and calculations were implemented using the ClustalW software (European Bioinformatics Institute). The average distance (% divergence) between each branch is noted above the branch point. Note the clustering of vertebrate periostin and bigH3 in relation to Drosophila fasciclin-I and the more distant association of the stabilins to the other vertebrate fasciclin-containing genes. (B) Total RNA (30 mg/lane) was hybridized with partial mouse periostin (peri), bigH3, stabilin-1 (stab1), stabilin-2 (stab2) and GAPDH cDNA probes. Periostin (w3.2 kb), bigH3 (w2.6 kb) and stabilin-1 (w8 kb) transcripts are highly expressed throughout cardiovascular development and in the adult heart, while stabilin-2 (w8 kb) was only present in the adult heart. Note that while stabilin-1 expression levels are stable, both periostin and bigH3 levels vary during cardiac development and are down-regulated in the adult heart. Stabilin-2 expression is only seen in the adult heart and rest (i.e. body minus heart) samples. Note that GAPDH (w1.2 kb) is equally expressed in all samples and serves as a loading control.
osteoblastic cell line (Takeshita et al., 1993) and subsequently shown to be preferentially expressed in periosteum of bone, periodontal ligament cells (Horiuchi et al., 1999; Kruzynska-Frejtag et al., 2004) and embryonic endocardial cushions (Kruzynska-Frejtag et al., 2001; Norris et al., 2004). A second mammalian fasciclincontaining gene, bigH3, was identified from a screen of human lung adenocarcinoma cell line (Skonier et al., 1992). Like periostin and fascilin-I, bigH3 contains four fasciclin domains and in vitro studies have suggested that bigH3 may functionally mimic other fasciclin-containing genes by mediating adhesion (Kim et al., 2000; LeBaron et al., 1995). Both periostin and bigH3 are secreted (although some periostin isoforms are membrane-bound); contain two putative heparin binding sequences; are induced by TGFb signaling and are known to bind various integrins (Gillan et al., 2002; Ferguson et al., 2003). The zebrafish genome also contains zperiostin and zbigH3 homologues, and both zebrafish and mouse bigH3 and periostin exhibit significant homology to Drosophila fasciclin-I (Fig. 1A), suggesting that the vertebrate genes are descendants of a common ancestral gene highly similar to Drosophila fasciclin-I. Mammals also have two additional fasciclin-containing transmembrane genes, stabilin-1 and stabilin-2. Stabilins
contain seven fasciclin domains (in addition to 18–20 epidermal growth factor, one X-link and 3–6 hyaluronanbinding domains) and represent a unique class of hyaluronan receptor homologues (Politz et al., 2002). Stabilins are expressed in a broad range of tissues including the adult liver, spleen, bone marrow, lymph nodes and heart and are specifically expressed in sinusoidal endothelial cells and activated macrophages. While the function and ligandbinding specificity of the stabilins have yet to be determined, it is interesting to note the key role of hyaluronan in cardiac cushion expansion and valve formation (Schroeder et al., 2003). Northern analysis (Fig. 1B) revealed that while periostin is the most abundantly expressed fasciclin, the other three fasciclin genes are also expressed in the mouse heart. Both periostin and bigH3 expression levels decreased coincident with development (decrease in bigH3 precedes periostin decrease), but stabilin-1 expression was invariant and stabilin-2 expression was absent altogether from the developing heart. In situ hybridization confirmed the complete absence of stabilin-2 mRNA from the developing heart (Figs. 2–4). Overlapping patterns of periostin and bigH3 were present in the E9.5 deciduae, chorionic plate and heart as
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
595
Fig. 2. Distribution of fasciclin genes in E9.5 mouse embryos following in situ hybridization. (A–D) Radial sections through lateral half of deciduae. Both periostin (A) and bigH3 (B) are co-expressed in mesenchymal decidual cells in the maternal (m; region indicated by double headed arrow) region of future placenta and not the ectoplacental plate (ep), while stabilin-1 (C) is robustly expressed in endotheial cells lining of the maternal blood space and Reichert’s membrane (indicated by arrow). Stabilin-2 expression is confined to endotheial cells overlying the giant trophoblast cells at the junction between the basal layer and decidual component (indicated by arrow) of the placenta (D). However, all four genes are absent from the future labyrinthine part of the primitive placenta. (E–H) Frontal sections through E9.5 embryo along the plane of the AV junction (50!). Note co-expression of periostin (E) and bigH3 (F) in the mesenechyme of the cardiac AV cushions (arrow) and partially overlapping expression in the chorionic plate. Both are also expressed at lower levels in the mesenchyme surrounding the hindgut and cardinal veins, whilst only periostin is expressed in the yolk sac blood islands (arrowheads). Stabilin-1 (G) is expressed throughout the embryonic and extra-embyonic endothelial cells. Note expression in endothelial cells adjacent to primitive trabeculae (arrow) and lining the vasculature. Stabilin-2 expression is confined to a few extra-embryonic yolk sac endothelial cells (arrow in H), but is absent from the embryo proper. Abbreviations: nt, neural tube; v, ventricular myocardium. Scale bars: 200 mm in D,F; 100 mm in G,H.
well as several sites of mutually exclusive expression (Fig. 2E,F). Cardiovascular expression of periostin and bigH3 is confined to AV endocardial cushion cells following EMT and is absent from the overlying endothelial cells. Whilst stabilin-2 expression is absent from the E9.5 embryo itself and restricted to only a few cells in the decidua and yolk sac, stabilin-1 was reciprocally expressed with periostin/bigH3 throughout the endothelial cells of the deciduae and embryo (Fig. 2C,G). Following the onset of EMT in the OFT at wE10, both periostin and bigH3 are coexpressed in the OFT cushions (Fig. 3A,B). However unlike periostin, bigH3 is also expressed in the OFT myocardium and adjacent branchial arch mesenchyme (Fig. 3B). Similarly, at wE12 both periostin and bigH3 are robustly expressed in OFT and AV cushions, but bigH3 levels are significantly higher in the OFT when compared to the AV (Fig. 3J). Conversely, stabilin-1 expression is present in isolated endothelial cells throughout the E10 and E12 embryo and extra-embryonic tissues (Fig. 3C,K). Following
completion of ventricular septation and initial valvular remodeling by wE14, periostin and bigH3 are similarly expressed in the OFT valve leaflets, while only periostin is expressed in all four AV leaflets. The presence of bigH3 in the endocardial AV cushion has previously been noted (Ferguson et al., 2003), although our data reveal that while bigH3 expression is present in both the mitral and tricuspid septal leaflet mesenchyme, it is absent from the smaller lateral periostin-expressing leaflet mesenchyme (Fig. 4H). This non-overlapping complementary expression of periostin and bigH3 in the lateral AV leaflets indicates that not all cushions are generic, but in addition to the differences in timing of EMT and OFT-restricted colonization by cardiac neural crest, the various cardiac cushions differ in both gene expression and molecular regulation. Additionally, bigH3 is uniquely expressed within the ductus arteriousus (Fig. 4E) that provides one of the three temporary shunts permitting fetal circulation and enabling most of the blood to bypass the liver and lungs (Conway et al., 2003). Stabilin-1
596
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 3. Distribution of fasciclin-containing genes during valvulogensis following in situ hybridization. (A–D) Sagittal serial sections through E10 hearts. Periostin (A) and bigH3 (B) continue to be co-expressed in the endocardial cushion mesenchyme of the AV canal (indicated by arrows in A and B) and in OFT (o) cushions cells. Note that in contrast to periostin, bigH3 expression is also present in branchial arch mesenchyme and OFT myocardium (indicated by arrowheads in B). (C) Stabilin-1 is expressed in a reciprocal pattern in the endothelial cells overlying both the OFT and AV endocardial cushions (arrow), in addition to endothelial cells lining both the atrial (a) and ventricular (v) chambers. However, stabilin-2 expression is confined to endothelial sinus cells in the hepatic primordia in the septum transversum (arrow in D). (E–H) Sagittal high power sections through E10.5 hearts. Whilst both periostin (E) and bigH3 (F) are robustly expressed in AV endocardial cushion mesenchyme they are absent from the overlying endothelial cells (indicated by arrows). Stabilin-1 (G is phase and H is darkfield views) is absent from the mesenchyme, but expressed in endothelial cells (indicated by arrows). (I–L) Sagittal sections through E12 hearts. While periostin (I) is robustly expressed in both the OFT and AV endocardial cushions, bigH3 (J) is differentially expressed with lower expression in the AV cushions (arrow in J). Both periostin and bigH3 are co-expressed in the pericardium overlying the ventricle (v), while only periostin is expressed in the peripheral nerves (indicated by * in I). BigH3 is also weakly expressed in presumptive chondrocytes (indicated by * in J). Stabilin-1 expression is still confined to the endothelial cells lining the heart and absent in the underlying endocardial cushion cells (K,L). Stabilin-2 is robustly expressed in the liver primodia and some expression can be seen in the body wall overlying the pericardial cavity. Scale bars: 1 mm in J–L; 200 mm in D; 50 mm in G.
expression remains robust in endothelial cells in the fetus, placenta and fetal membranes throughout development and expression is also present in isolated mesenchymal cushion cells (Fig. 4C,F,L,M). Stabilin-2 is largely restricted to the embryonic hepatic primordia and fetal liver (Fig. 3L) throughout development. The newborn (data not shown) and adult patterns of these four fasciclin-containing genes are similar, as all four are present in two reciprocal patterns. bigH3 and periostin are expressed in the fibrous mesenchyme of the mature valve leaflet while stabilin-1 and -2 are expressed in the overlying endothelium (Fig. 5). However, the patterns are not entirely complimentary, as periostin, but not bigH3 is also expressed in the valvular suspensory apparatus. In addition to the heart, there is non-overlapping expression of periostin and bigH3 (Fig. 4J,K) in the future vertebral periostium
and endochondrial condensations of the future vertebrae, respectively. Conversely, stabilin-2 expression is restricted to just a few endothelial cells overlying the leaflets, but stabilin-1 is widely expressed throughout the endothelial cells that line the great vessels and all four chambers of the heart. Significantly, mouse stabilin-2 protein has been shown to be present in adult cardiac valves (Falkowski et al., 2003). As it is unclear when valvulogenesis ends, if at all (Paranya et al., 2001), the continued adult cardiac expression of all four fasciclins suggests a role in valvular homeostasis. Given these expression differences it is unlikely that periostin and bigH3 or stabilin-1 and -2 are totally redundant during development and valvular maintenance, although this has yet to be tested transgenically. The developing valve leaflets are clearly outlined by the expression of membrane-bound stabilin-1 (and both stabilins
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
597
Fig. 4. Distribution of fasciclin-containing genes in E14 fetuses following in situ hybridization. (A–C) Transverse serial sections through spinal cord (nt) and adjacent vertebrae. All four fasciclin-containing genes are not expressed in the spinal cord, but periostin, bigH3 and stabilin-1 are expressed in surrounding tissues. Periostin (A) is present in the periostium around the skeleton while bigH3 (B) is expressed within the chondrogenic elements themselves. Stabilin-1 (C) is expressed in endothelial cells around spinal cord and throughout the fetus. (D–F) Transverse sections through the heart. Robust periostin (D) and bigH3 (E) expression is observed in the cardiac cushions, and weaker expression is evident in the proximal aorta (ao) and isolated cardiac fibroblasts around the OFT cushions. Note that while bigH3 is robustly expressed in the walls of the ductus arteriousus (arrow in E), periostin is only expressed in the mesenchyme adjacent to the ductus arteriosus. Whilst Stabilin-1 is still expressed in the endothelial cells lining the fused endocardial septum and the epicardial cells covering the heart, punctate expression can now be seen in isolated mesechymal cells in the AV septum (arrow in F). (G–I) Transverse serial sections through AV canal. Periostin (G) is strongly expressed in both leaflets of the mitral (m) and tricuspid (t) valve mesenchyme, whilst bigH3 is only expressed in the large septal leaflet mesenchyme, but is largely absent from the lateral leaflet mesenchmye (indicated by arrows in H). aSMA staining (I), brown DAB staining in the myocardium, of adjacent section to those depicted in G and H, illustrating extent of mesenchmye. Punctate stabilin-1 expression is present in the OFT endocardial cushion mesenchyme (L,M), epicardium (arrow in M, arrowheads in L) as well as endothelial cells (arrow in M) lining the aortic (ao) and pulmonary (p) outlets. Darkfield (J,K) and phase (J 0 and K 0 ) images illustrate co-expression of periostin and bigH3 in the OFT (arrows) during cardiac development and partial co-expression during chondrogenesis. Note that while periostin is restricted to the periostium surrounding the rib (indicated by *), bigH3 is expressed in both the periostium and condensed chondrocytes. Abbreviations: lv, left ventricle; rv, right ventricle; da, descending aorta; s, septum. Scale bars: 1 mm in C; 200 mm in G; 50 mm in M.
in the adult), while both secreted periostin and bigH3 are expressed in the adjacent mesenchyme (Fig. 6). These reciprocal patterns are similar to those reported for Smad6, PDGFRa, Runx2, Fog1, Msx1 (mesenchymal) and FoxC2
(endothelial) expression during endocardial cushion development (Gitler et al., 2003). The distinct localization of these four fasciclin-containing genes indicates coordinated roles during valvuloseptal morphogenesis and distinct extracellular matrix
598
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 5. Distribution of fasciclin-containing genes in adult hearts following in situ hybridization. (A–D) Periostin expression remains robust in aortic valve leaflet fibrous mesenchyme (arrows in A), chordae tendi and the cardiac fibroblasts (arrowhead) that anchor the valves within the papillary muscles. bigH3 is predominantly expressed in only the valve leaflet fibrous mesenchyme (arrows in B) and is absent from the papillary muscle attachment site (arrowhead in B). Note that periostin (A insert) is widely expressed in the adult lung but bigH3 (B insert) is expressed in a restricted pattern. Stabilin-1 is expressed in the endothelial cells lining the leaflets (arrow in C), and in isolated endothelial cells in adult lungs (C insert). Limited punctuate stabilin-2 (arrow in D) expression is present in endothelial cells covering the leaflets (D insert is phase image of leaflet). Abbreviations: la, left atria; lv, left ventricle; m, mitral leaflet; s, septum. Scale bars: 5 mm in C; 100 mm in D.
profiles amongst the individual valve leaflets. Significantly, studies in Drosophila have shown that fasciclin-containing genes facilitate cell sorting via homophilic binding of their fasciclin-domains (Zinn et al., 1988). Thus, similar fasciclin– fasciclin associations may also occur between vertebrate fasciclin-containing genes, constituting a conserved novel extracellular signaling pathway (Ferguson et al., 2003) via potential receptor–ligand interactions.
sequenced to confirm identity. The following primers were used: bigH3 (NM009369, 594 bp band) 5 0 CAACAACATCCAGCAGATCATT, 3 0 TGGTTCAGAAGCAAA GTCTTCA; stabilin-1 (NM138672, 669 bp band), 5 0 CCAACTTCTCCACCTTCTATGG, 3 0 CTGAATCATCAAAGGGTTCACA; stabilin-2 (NM138673, 490 bp band), 5 0 TCTGAACCTTTGAAAGCTCCTC, 3 0 GACAACCCCAGACTAACCAGAG and the cloning/analysis of periostin has been previously described (Kruzynska- Frejtag et al., 2001).
2. Experimental procedures 2.2. Northern blot analysis 2.1. Isolation of mouse fasciclin-containing cDNA probes Probes were generated via PCR amplification of adult mouse heart cDNA using established methods (KruzynskaFrejtag et al., 2001). PCR products were cloned into the pCRII-TOPO vector (Invitrogen, Carlsbad, CA) and
Total RNA was isolated from pooled mouse embryonic (E10.5, E13.5, E17.5), newborn, and adult hearts and run on a 1% formaldehyde/MOPS denaturing gel (Ambion, Austin, TX) and transferred to positivelycharged nylon membrane (Amersham, Piscataway, NJ).
Fig. 6. Summary diagram of fasciclin-containing expression patterns in the mouse heart. Schematic idealized representation of sagittal E11 primordial heart (A). Tissues expressing each gene are highlighted in blue. Both periostin and bigH3 are expressed in the OFT and AV cushion mesenchyme whilst stabilin-1 is restricted to the adjacent endothelial cells covering the cushions. Stabilin-2 is not detected in the early heart. Schematic idealized representation of fourchambered view of mature neonatal heart (B). Periostin is present in all valve leaflets as well as the supporting valvular suspensory apparatus. In contrast, bigH3 is only present in the medial valve leaflet mesenchmye and is absent from the suspensory apparatus. Stabilin-1 remains active in the endothelial cells and in isolated presumptive capillary endothelial cells. Stabilin-2 is expressed in isolated endothelial cells lining the valve leaflets.
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Membrane was prehybridized for 3 h at 60 8C, and hybridized overnight with [32P]-radiolabeled probes (cloned following RT-PCR as described above). Following stringent washing, membranes were exposed to autoradiography film, and the resulting images analyzed for expression levels. Membranes were stripped using 0.1% SDS buffer at 80 8C and rehybridized with successive fasciclin probes. GAPDH was used as an internal standard for the amount and integrity of RNA present. 2.3. In situ hybridization and imunohistochemistry Both sense and anti-sense [35S]UTP-radiolabeled RNA probes were transcribed and used for in situ hybridization on at least 6–8 mouse embryos at each stage using established techniques (Conway, 1996). Specific signal was only observed when sections were hybridized with the anti-sense probe. Immunostaining of alpha smooth muscle actin (aSMA; 1:5000 dilution; Sigma, St Louis, MO) using the ABC kit (Vector) following manufacturer’s directions, was performed on adjacent sections to verify that bigH3 and periostin mRNA expression was absent from surrounding aSMAexpressing AV myocardium.
Acknowledgements We would like to thank the members of the Conway Laboratory for their thoughtful comments and reading of this manuscript. These studies were supported in part by National Institutes of Health grants HL52813, HL33756 and HL60714.
References Bastiani, M.J., Harrelson, A.L., Snow, P.M., Goodman, C.S., 1987. Expression of fasciclin I and II glycoproteins on subsets of axon pathways during neuronal development in the grasshopper. Cell 48 (5), 745–755. Chang, C.P., Neilson, J.R., Bayle, J.H., Gestwicki, J.E., Kuo, A., Stankunas, K., et al., 2004. A field of myocardial-endocardial NFAT signaling underlies heart valve morphogenesis. Cell 118 (5), 649–663. Conway, S.J., 1996. In situ hybridization of cell and tissue sections. In: Cotter, F.E. (Ed.), Methods in Molecular Medicine, Molecular Diagnosis of Cancer. Humana Press Inc., Totowa, NJ, USA, pp. 193– 206 (Chapter 15). Conway, S.J., Kruzynska-Frejtag, A., Kneer, P.L., Machnicki, M., Koushik, S.V., 2003. What cardiovascular defect does my prenatal mouse mutant have, and why? Genesis 35 (1), 1–21. de Lange, F.J., Moorman, A.F., Anderson, R.H., Manner, J., Soufan, A.T., de Gier-de Vries, C., et al., 2004. Lineage and morphogenetic analysis of the cardiac valves. Circ. Res. 95 (6), 645–654. Dor, Y., Klewer, S.E., McDonald, J.A., Keshet, E., Camenisch, T.D., 2003. VEGF modulates early heart valve formation. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 271 (1), 202–208.
599
Falkowski, M., Schledzewski, K., Hansen, B., Goerdt, S., 2003. Expression of stabilin-2, a novel fasciclin-like hyaluronan receptor protein, in murine sinusoidal endothelia, avascular tissues, and at solid/liquid interfaces. Histochem. Cell Biol. 120 (5), 361–369. Ferguson, J.W., Mikesh, M.F., Wheeler, E.F., LeBaron, R.G., 2003. Developmental expression patterns of Beta-ig (betaIG-H3) and its function as a cell adhesion protein. Mech. Dev. 120 (8), 851–864. Gillan, L., Matei, D., Fishman, D.A., Gerbin, C.S., Karlan, B.Y., Chang, D.D., 2002. Periostin secreted by epithelial ovarian carcinoma is a ligand for alpha(V)beta(3) and alpha(V)beta(5) integrins and promotes cell motility. Cancer Res. 62 (18), 5358–5364. Gitler, A.D., Lu, M.M., Jiang, Y.Q., Epstein, J.A., Gruber, P.J., 2003. Molecular markers of cardiac endocardial cushion development. Dev. Dyn. 228 (4), 643–650. Horiuchi, K., Amizuka, N., Takeshita, S., Takamatsu, H., Katsuura, M., Ozawa, H., et al., 1999. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J. Bone Miner. Res. 14 (7), 1239–1249. Kawamoto, T., Noshiro, M., Shen, M., Nakamasu, K., Hashimoto, K., Kawashima-Ohya, Y., et al., 1998. Structural and phylogenetic analyses of RGD-CAP/big-h3, a fasciclin-like adhesion protein expressed in chick chondrocytes. Biochim. Biophys. Acta 1395, 288–292. Kim, J.E., Kim, S.J., Lee, B.H., Park, R.W., Kim, K.S., Kim, I.S., 2000. Identification of motifs for cell adhesion within the repeated domains of transforming growth factor-beta-induced gene, betaig-h3. J. Biol. Chem. 275 (40), 30907–30915. Kisanuki, Y.Y., Hammer, R.E., Miyazaki, J., Williams, S.C., Richardson, J.A., Yanagisawa, M., 2001. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev. Biol. 230 (2), 230–242. Kruzynska-Frejtag, A., Machnicki, M., Rogers, R., Markwald, R.R., Conway, S.J., 2001. Periostin (an osteoblast-specific factor) is expressed within the embryonic mouse heart during valve formation. Mech. Dev. 103 (1–2), 183–188. Kruzynska-Frejtag, A., Wang, J., Maeda, M., Rogers, R., Krug, E., Hoffman, S., et al., 2004. Periostin is expressed within the developing teeth at the sites of epithelial–mesenchymal interaction. Dev. Dyn. 229 (4), 857–868. LeBaron, R.G., Bezverkov, K.I., Zimber, M.P., Pavelec, R., Skonier, J., Purchio, A.F., 1995. Beta IG-H3, a novel secretory protein inducible by transforming growth factor-beta, is present in normal skin and promotes the adhesion and spreading of dermal fibroblasts in vitro. J. Invest. Dermatol. 104 (5), 844–849. Lincoln, J., Alfieri, C.M., Yutzey, K.E., 2004. Development of heart valve leaflets and supporting apparatus in chicken and mouse embryos. Dev. Dyn. 230 (2), 239–250. Norris, R.A., Kern, C.B., Wessels, A., Moralez, E.I., Markwald, R.R., Mjaatvedt, C.H., 2004. Identification and detection of the periostin gene in cardiac development. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 281 (2), 1227–1233. Paranya, G., Vineberg, S., Dvorin, E., Kaushal, S., Roth, S.J., Rabkin, E., et al., 2001. Aortic valve endothelial cells undergo transforming growth factor-beta-mediated and non-transforming growth factor-betamediated transdifferentiation in vitro. Am. J. Pathol. 159 (4), 1335–1343. Politz, O., Gratchev, A., McCourt, P.A., Schledzewski, K., Guillot, P., Johansson, S., et al., 2002. Stabilin-1 and -2 constitute a novel family of fasciclin-like hyaluronan receptor homologues. Biochem. J. 362 (Pt 1), 155–164. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425.
600
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Schroeder, J.A., Jackson, L.F., Lee, D.C., Camenisch, T.D., 2003. Form and function of developing heart valves: coordination by extracellular matrix and growth factor signaling. J. Mol. Med. 81 (7), 392–403. Skonier, J., Neubauer, M., Madisen, L., Bennett, K., Plowman, G.D., Purchio, A.F., 1992. cDNA cloning and sequence analysis of beta ig-h3, a novel gene induced in a human adenocarcinoma cell line after treatment with transforming growth factor-beta. DNA Cell Biol. 11 (7), 511–522.
Takeshita, S., Kikuno, R., Tezuka, K., Amann, E., 1993. Osteoblastspecific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I. Biochem. J. 294 (Pt 1), 271–278. Zinn, K., McAllister, L., Goodman, C.S., 1988. Sequence analysis and neuronal expression of fasciclin I in grasshopper and Drosophila. Cell 53 (4), 577–587.
Comparison of the four mouse fasciclin-containing genes expression patterns during valvuloseptal morphogenesis Andrew Lindsleya, Wei Lia, Jian Wanga, Nana Maedaa,b, Rhonda Rogersa, Simon J. Conwaya,* a
Cardiovascular Development Group, Herman B Wells Center for Pediatric Research, Riley Hospital for Children, Indiana University School of Medicine, 1044 West Walnut Street, R4 W379, Indianapolis, IN 46202, USA b Nara Medical University, Kashihara City, Nara 634-8521, Japan Received 6 December 2004; received in revised form 15 March 2005; accepted 18 March 2005
Abstract All four mammalian fasciclin-containing genes are expressed in the adult valves and are localized in partially overlapping and reciprocal patterns during cardiovascular development. Spatiotemporal comparison of the fasciclin-containing secreted adhesion genes, TGFbeta induced clone H3 (bigH3) and periostin, revealed that they are co-localized within the outflow tract endocardial cushions, but that bigH3 expression is restricted to the septal cushions within the atrioventricular canal. Conversely, the fasciclin-containing transmembrane gene, stabilin-1, is predominately expressed in the endocardial layer overlaying the cushions and lining the developing heart. However, expression of the fasciclin-containing transmembrane gene, stabilin-2 is only present in the post-natal mature valve endothelial cells. These data illustrate for the first time that the primitive endocardial cushions dynamically express multiple fasciclin-containing adhesion molecules as they undergo the key steps of seeding, proliferation, differentiation, fusion, mesenchymal condensation and remodeling during mouse heart development. q 2005 Elsevier B.V. All rights reserved. Keywords: fasciclin domain; TGFbeta induced clone H3; bigH3; periostin; stabilin-1; stabilin-2; Mouse heart development; Cardiac valve morphogenesis
1. Results and discussion Cardiac endocardial cushions are mesenchymal swellings that form within the wall of the embryonic heart as the primordia of the future valves and septa. While many of the genes involved in the formation of cushions have been identified (Gitler et al., 2003; de Lange et al., 2004; Lincoln et al., 2004) virtually nothing is known about what determines the positioning of the cushions, whether all cushions are alike and how these primitive cushions become mature valve leaflets with an attendant valve supporting apparatus. Initially, the mouse atrioventricular (AV) endocardial mesenchymal cushions are formed from overlying endothelial cells undergoing epithelial–mesenchymal transformation (EMT) around E9–9.5. Subsequently, the proximal outflow tract (OFT) mesenchymal cushions * Corresponding author. Tel.: C1 317 278 8780; fax: C1 317 278 5413. E-mail address: [email protected] (S.J. Conway).
1567-133X/$ - see front matter q 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.modgep.2005.03.005
are formed from cells derived from both endocardial cells via EMT and cardiac neural crest cells that colonize the OFT around E10–10.5 (Dor et al., 2003; Chang et al., 2004). The distal OFT cushions that form the septa between the aorta and pulmonary artery contain mesenchymal cells derived from the cardiac neural crest, but not endocardial cells (Kisanuki et al., 2001). Previously we have shown that the secreted cell adhesion molecule, periostin is expressed in the developing mouse heart (Kruzynska-Frejtag et al., 2001). Periostin contains four fasciclin domains homologous to similar motifs found in the Drosophila protein, fasciclin-I (Bastiani et al., 1987). The fasciclin-domain was linked to axonal guidance, cell sorting and adhesion during insect nervous system morphogenesis and is highly conserved, as it is found in both secreted and membraneanchored proteins of several species, including mammals, insects, sea urchins, plants, yeast and bacteria (Kawamoto et al., 1998). There are currently four fasciclin-containing mammalian genes (Fig. 1A), periostin, bigH3, stabilin-1 and stabilin-2, however, their roles during cardiac development are unknown. Periostin was initially cloned from a mouse
594
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 1. Phylogenetic and comparative developmental Northern analysis. (A) Based on sequence similarity, mouse, zebrafish and Drosophila fasciclincontaining genes were aligned (using the BLOSUM62 matrix), scored (using the Neighbor Joining method of Saitou and Nei, 1987) and a tree constructed using the average distance method. Alignment and calculations were implemented using the ClustalW software (European Bioinformatics Institute). The average distance (% divergence) between each branch is noted above the branch point. Note the clustering of vertebrate periostin and bigH3 in relation to Drosophila fasciclin-I and the more distant association of the stabilins to the other vertebrate fasciclin-containing genes. (B) Total RNA (30 mg/lane) was hybridized with partial mouse periostin (peri), bigH3, stabilin-1 (stab1), stabilin-2 (stab2) and GAPDH cDNA probes. Periostin (w3.2 kb), bigH3 (w2.6 kb) and stabilin-1 (w8 kb) transcripts are highly expressed throughout cardiovascular development and in the adult heart, while stabilin-2 (w8 kb) was only present in the adult heart. Note that while stabilin-1 expression levels are stable, both periostin and bigH3 levels vary during cardiac development and are down-regulated in the adult heart. Stabilin-2 expression is only seen in the adult heart and rest (i.e. body minus heart) samples. Note that GAPDH (w1.2 kb) is equally expressed in all samples and serves as a loading control.
osteoblastic cell line (Takeshita et al., 1993) and subsequently shown to be preferentially expressed in periosteum of bone, periodontal ligament cells (Horiuchi et al., 1999; Kruzynska-Frejtag et al., 2004) and embryonic endocardial cushions (Kruzynska-Frejtag et al., 2001; Norris et al., 2004). A second mammalian fasciclincontaining gene, bigH3, was identified from a screen of human lung adenocarcinoma cell line (Skonier et al., 1992). Like periostin and fascilin-I, bigH3 contains four fasciclin domains and in vitro studies have suggested that bigH3 may functionally mimic other fasciclin-containing genes by mediating adhesion (Kim et al., 2000; LeBaron et al., 1995). Both periostin and bigH3 are secreted (although some periostin isoforms are membrane-bound); contain two putative heparin binding sequences; are induced by TGFb signaling and are known to bind various integrins (Gillan et al., 2002; Ferguson et al., 2003). The zebrafish genome also contains zperiostin and zbigH3 homologues, and both zebrafish and mouse bigH3 and periostin exhibit significant homology to Drosophila fasciclin-I (Fig. 1A), suggesting that the vertebrate genes are descendants of a common ancestral gene highly similar to Drosophila fasciclin-I. Mammals also have two additional fasciclin-containing transmembrane genes, stabilin-1 and stabilin-2. Stabilins
contain seven fasciclin domains (in addition to 18–20 epidermal growth factor, one X-link and 3–6 hyaluronanbinding domains) and represent a unique class of hyaluronan receptor homologues (Politz et al., 2002). Stabilins are expressed in a broad range of tissues including the adult liver, spleen, bone marrow, lymph nodes and heart and are specifically expressed in sinusoidal endothelial cells and activated macrophages. While the function and ligandbinding specificity of the stabilins have yet to be determined, it is interesting to note the key role of hyaluronan in cardiac cushion expansion and valve formation (Schroeder et al., 2003). Northern analysis (Fig. 1B) revealed that while periostin is the most abundantly expressed fasciclin, the other three fasciclin genes are also expressed in the mouse heart. Both periostin and bigH3 expression levels decreased coincident with development (decrease in bigH3 precedes periostin decrease), but stabilin-1 expression was invariant and stabilin-2 expression was absent altogether from the developing heart. In situ hybridization confirmed the complete absence of stabilin-2 mRNA from the developing heart (Figs. 2–4). Overlapping patterns of periostin and bigH3 were present in the E9.5 deciduae, chorionic plate and heart as
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
595
Fig. 2. Distribution of fasciclin genes in E9.5 mouse embryos following in situ hybridization. (A–D) Radial sections through lateral half of deciduae. Both periostin (A) and bigH3 (B) are co-expressed in mesenchymal decidual cells in the maternal (m; region indicated by double headed arrow) region of future placenta and not the ectoplacental plate (ep), while stabilin-1 (C) is robustly expressed in endotheial cells lining of the maternal blood space and Reichert’s membrane (indicated by arrow). Stabilin-2 expression is confined to endotheial cells overlying the giant trophoblast cells at the junction between the basal layer and decidual component (indicated by arrow) of the placenta (D). However, all four genes are absent from the future labyrinthine part of the primitive placenta. (E–H) Frontal sections through E9.5 embryo along the plane of the AV junction (50!). Note co-expression of periostin (E) and bigH3 (F) in the mesenechyme of the cardiac AV cushions (arrow) and partially overlapping expression in the chorionic plate. Both are also expressed at lower levels in the mesenchyme surrounding the hindgut and cardinal veins, whilst only periostin is expressed in the yolk sac blood islands (arrowheads). Stabilin-1 (G) is expressed throughout the embryonic and extra-embyonic endothelial cells. Note expression in endothelial cells adjacent to primitive trabeculae (arrow) and lining the vasculature. Stabilin-2 expression is confined to a few extra-embryonic yolk sac endothelial cells (arrow in H), but is absent from the embryo proper. Abbreviations: nt, neural tube; v, ventricular myocardium. Scale bars: 200 mm in D,F; 100 mm in G,H.
well as several sites of mutually exclusive expression (Fig. 2E,F). Cardiovascular expression of periostin and bigH3 is confined to AV endocardial cushion cells following EMT and is absent from the overlying endothelial cells. Whilst stabilin-2 expression is absent from the E9.5 embryo itself and restricted to only a few cells in the decidua and yolk sac, stabilin-1 was reciprocally expressed with periostin/bigH3 throughout the endothelial cells of the deciduae and embryo (Fig. 2C,G). Following the onset of EMT in the OFT at wE10, both periostin and bigH3 are coexpressed in the OFT cushions (Fig. 3A,B). However unlike periostin, bigH3 is also expressed in the OFT myocardium and adjacent branchial arch mesenchyme (Fig. 3B). Similarly, at wE12 both periostin and bigH3 are robustly expressed in OFT and AV cushions, but bigH3 levels are significantly higher in the OFT when compared to the AV (Fig. 3J). Conversely, stabilin-1 expression is present in isolated endothelial cells throughout the E10 and E12 embryo and extra-embryonic tissues (Fig. 3C,K). Following
completion of ventricular septation and initial valvular remodeling by wE14, periostin and bigH3 are similarly expressed in the OFT valve leaflets, while only periostin is expressed in all four AV leaflets. The presence of bigH3 in the endocardial AV cushion has previously been noted (Ferguson et al., 2003), although our data reveal that while bigH3 expression is present in both the mitral and tricuspid septal leaflet mesenchyme, it is absent from the smaller lateral periostin-expressing leaflet mesenchyme (Fig. 4H). This non-overlapping complementary expression of periostin and bigH3 in the lateral AV leaflets indicates that not all cushions are generic, but in addition to the differences in timing of EMT and OFT-restricted colonization by cardiac neural crest, the various cardiac cushions differ in both gene expression and molecular regulation. Additionally, bigH3 is uniquely expressed within the ductus arteriousus (Fig. 4E) that provides one of the three temporary shunts permitting fetal circulation and enabling most of the blood to bypass the liver and lungs (Conway et al., 2003). Stabilin-1
596
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 3. Distribution of fasciclin-containing genes during valvulogensis following in situ hybridization. (A–D) Sagittal serial sections through E10 hearts. Periostin (A) and bigH3 (B) continue to be co-expressed in the endocardial cushion mesenchyme of the AV canal (indicated by arrows in A and B) and in OFT (o) cushions cells. Note that in contrast to periostin, bigH3 expression is also present in branchial arch mesenchyme and OFT myocardium (indicated by arrowheads in B). (C) Stabilin-1 is expressed in a reciprocal pattern in the endothelial cells overlying both the OFT and AV endocardial cushions (arrow), in addition to endothelial cells lining both the atrial (a) and ventricular (v) chambers. However, stabilin-2 expression is confined to endothelial sinus cells in the hepatic primordia in the septum transversum (arrow in D). (E–H) Sagittal high power sections through E10.5 hearts. Whilst both periostin (E) and bigH3 (F) are robustly expressed in AV endocardial cushion mesenchyme they are absent from the overlying endothelial cells (indicated by arrows). Stabilin-1 (G is phase and H is darkfield views) is absent from the mesenchyme, but expressed in endothelial cells (indicated by arrows). (I–L) Sagittal sections through E12 hearts. While periostin (I) is robustly expressed in both the OFT and AV endocardial cushions, bigH3 (J) is differentially expressed with lower expression in the AV cushions (arrow in J). Both periostin and bigH3 are co-expressed in the pericardium overlying the ventricle (v), while only periostin is expressed in the peripheral nerves (indicated by * in I). BigH3 is also weakly expressed in presumptive chondrocytes (indicated by * in J). Stabilin-1 expression is still confined to the endothelial cells lining the heart and absent in the underlying endocardial cushion cells (K,L). Stabilin-2 is robustly expressed in the liver primodia and some expression can be seen in the body wall overlying the pericardial cavity. Scale bars: 1 mm in J–L; 200 mm in D; 50 mm in G.
expression remains robust in endothelial cells in the fetus, placenta and fetal membranes throughout development and expression is also present in isolated mesenchymal cushion cells (Fig. 4C,F,L,M). Stabilin-2 is largely restricted to the embryonic hepatic primordia and fetal liver (Fig. 3L) throughout development. The newborn (data not shown) and adult patterns of these four fasciclin-containing genes are similar, as all four are present in two reciprocal patterns. bigH3 and periostin are expressed in the fibrous mesenchyme of the mature valve leaflet while stabilin-1 and -2 are expressed in the overlying endothelium (Fig. 5). However, the patterns are not entirely complimentary, as periostin, but not bigH3 is also expressed in the valvular suspensory apparatus. In addition to the heart, there is non-overlapping expression of periostin and bigH3 (Fig. 4J,K) in the future vertebral periostium
and endochondrial condensations of the future vertebrae, respectively. Conversely, stabilin-2 expression is restricted to just a few endothelial cells overlying the leaflets, but stabilin-1 is widely expressed throughout the endothelial cells that line the great vessels and all four chambers of the heart. Significantly, mouse stabilin-2 protein has been shown to be present in adult cardiac valves (Falkowski et al., 2003). As it is unclear when valvulogenesis ends, if at all (Paranya et al., 2001), the continued adult cardiac expression of all four fasciclins suggests a role in valvular homeostasis. Given these expression differences it is unlikely that periostin and bigH3 or stabilin-1 and -2 are totally redundant during development and valvular maintenance, although this has yet to be tested transgenically. The developing valve leaflets are clearly outlined by the expression of membrane-bound stabilin-1 (and both stabilins
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
597
Fig. 4. Distribution of fasciclin-containing genes in E14 fetuses following in situ hybridization. (A–C) Transverse serial sections through spinal cord (nt) and adjacent vertebrae. All four fasciclin-containing genes are not expressed in the spinal cord, but periostin, bigH3 and stabilin-1 are expressed in surrounding tissues. Periostin (A) is present in the periostium around the skeleton while bigH3 (B) is expressed within the chondrogenic elements themselves. Stabilin-1 (C) is expressed in endothelial cells around spinal cord and throughout the fetus. (D–F) Transverse sections through the heart. Robust periostin (D) and bigH3 (E) expression is observed in the cardiac cushions, and weaker expression is evident in the proximal aorta (ao) and isolated cardiac fibroblasts around the OFT cushions. Note that while bigH3 is robustly expressed in the walls of the ductus arteriousus (arrow in E), periostin is only expressed in the mesenchyme adjacent to the ductus arteriosus. Whilst Stabilin-1 is still expressed in the endothelial cells lining the fused endocardial septum and the epicardial cells covering the heart, punctate expression can now be seen in isolated mesechymal cells in the AV septum (arrow in F). (G–I) Transverse serial sections through AV canal. Periostin (G) is strongly expressed in both leaflets of the mitral (m) and tricuspid (t) valve mesenchyme, whilst bigH3 is only expressed in the large septal leaflet mesenchyme, but is largely absent from the lateral leaflet mesenchmye (indicated by arrows in H). aSMA staining (I), brown DAB staining in the myocardium, of adjacent section to those depicted in G and H, illustrating extent of mesenchmye. Punctate stabilin-1 expression is present in the OFT endocardial cushion mesenchyme (L,M), epicardium (arrow in M, arrowheads in L) as well as endothelial cells (arrow in M) lining the aortic (ao) and pulmonary (p) outlets. Darkfield (J,K) and phase (J 0 and K 0 ) images illustrate co-expression of periostin and bigH3 in the OFT (arrows) during cardiac development and partial co-expression during chondrogenesis. Note that while periostin is restricted to the periostium surrounding the rib (indicated by *), bigH3 is expressed in both the periostium and condensed chondrocytes. Abbreviations: lv, left ventricle; rv, right ventricle; da, descending aorta; s, septum. Scale bars: 1 mm in C; 200 mm in G; 50 mm in M.
in the adult), while both secreted periostin and bigH3 are expressed in the adjacent mesenchyme (Fig. 6). These reciprocal patterns are similar to those reported for Smad6, PDGFRa, Runx2, Fog1, Msx1 (mesenchymal) and FoxC2
(endothelial) expression during endocardial cushion development (Gitler et al., 2003). The distinct localization of these four fasciclin-containing genes indicates coordinated roles during valvuloseptal morphogenesis and distinct extracellular matrix
598
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Fig. 5. Distribution of fasciclin-containing genes in adult hearts following in situ hybridization. (A–D) Periostin expression remains robust in aortic valve leaflet fibrous mesenchyme (arrows in A), chordae tendi and the cardiac fibroblasts (arrowhead) that anchor the valves within the papillary muscles. bigH3 is predominantly expressed in only the valve leaflet fibrous mesenchyme (arrows in B) and is absent from the papillary muscle attachment site (arrowhead in B). Note that periostin (A insert) is widely expressed in the adult lung but bigH3 (B insert) is expressed in a restricted pattern. Stabilin-1 is expressed in the endothelial cells lining the leaflets (arrow in C), and in isolated endothelial cells in adult lungs (C insert). Limited punctuate stabilin-2 (arrow in D) expression is present in endothelial cells covering the leaflets (D insert is phase image of leaflet). Abbreviations: la, left atria; lv, left ventricle; m, mitral leaflet; s, septum. Scale bars: 5 mm in C; 100 mm in D.
profiles amongst the individual valve leaflets. Significantly, studies in Drosophila have shown that fasciclin-containing genes facilitate cell sorting via homophilic binding of their fasciclin-domains (Zinn et al., 1988). Thus, similar fasciclin– fasciclin associations may also occur between vertebrate fasciclin-containing genes, constituting a conserved novel extracellular signaling pathway (Ferguson et al., 2003) via potential receptor–ligand interactions.
sequenced to confirm identity. The following primers were used: bigH3 (NM009369, 594 bp band) 5 0 CAACAACATCCAGCAGATCATT, 3 0 TGGTTCAGAAGCAAA GTCTTCA; stabilin-1 (NM138672, 669 bp band), 5 0 CCAACTTCTCCACCTTCTATGG, 3 0 CTGAATCATCAAAGGGTTCACA; stabilin-2 (NM138673, 490 bp band), 5 0 TCTGAACCTTTGAAAGCTCCTC, 3 0 GACAACCCCAGACTAACCAGAG and the cloning/analysis of periostin has been previously described (Kruzynska- Frejtag et al., 2001).
2. Experimental procedures 2.2. Northern blot analysis 2.1. Isolation of mouse fasciclin-containing cDNA probes Probes were generated via PCR amplification of adult mouse heart cDNA using established methods (KruzynskaFrejtag et al., 2001). PCR products were cloned into the pCRII-TOPO vector (Invitrogen, Carlsbad, CA) and
Total RNA was isolated from pooled mouse embryonic (E10.5, E13.5, E17.5), newborn, and adult hearts and run on a 1% formaldehyde/MOPS denaturing gel (Ambion, Austin, TX) and transferred to positivelycharged nylon membrane (Amersham, Piscataway, NJ).
Fig. 6. Summary diagram of fasciclin-containing expression patterns in the mouse heart. Schematic idealized representation of sagittal E11 primordial heart (A). Tissues expressing each gene are highlighted in blue. Both periostin and bigH3 are expressed in the OFT and AV cushion mesenchyme whilst stabilin-1 is restricted to the adjacent endothelial cells covering the cushions. Stabilin-2 is not detected in the early heart. Schematic idealized representation of fourchambered view of mature neonatal heart (B). Periostin is present in all valve leaflets as well as the supporting valvular suspensory apparatus. In contrast, bigH3 is only present in the medial valve leaflet mesenchmye and is absent from the suspensory apparatus. Stabilin-1 remains active in the endothelial cells and in isolated presumptive capillary endothelial cells. Stabilin-2 is expressed in isolated endothelial cells lining the valve leaflets.
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Membrane was prehybridized for 3 h at 60 8C, and hybridized overnight with [32P]-radiolabeled probes (cloned following RT-PCR as described above). Following stringent washing, membranes were exposed to autoradiography film, and the resulting images analyzed for expression levels. Membranes were stripped using 0.1% SDS buffer at 80 8C and rehybridized with successive fasciclin probes. GAPDH was used as an internal standard for the amount and integrity of RNA present. 2.3. In situ hybridization and imunohistochemistry Both sense and anti-sense [35S]UTP-radiolabeled RNA probes were transcribed and used for in situ hybridization on at least 6–8 mouse embryos at each stage using established techniques (Conway, 1996). Specific signal was only observed when sections were hybridized with the anti-sense probe. Immunostaining of alpha smooth muscle actin (aSMA; 1:5000 dilution; Sigma, St Louis, MO) using the ABC kit (Vector) following manufacturer’s directions, was performed on adjacent sections to verify that bigH3 and periostin mRNA expression was absent from surrounding aSMAexpressing AV myocardium.
Acknowledgements We would like to thank the members of the Conway Laboratory for their thoughtful comments and reading of this manuscript. These studies were supported in part by National Institutes of Health grants HL52813, HL33756 and HL60714.
References Bastiani, M.J., Harrelson, A.L., Snow, P.M., Goodman, C.S., 1987. Expression of fasciclin I and II glycoproteins on subsets of axon pathways during neuronal development in the grasshopper. Cell 48 (5), 745–755. Chang, C.P., Neilson, J.R., Bayle, J.H., Gestwicki, J.E., Kuo, A., Stankunas, K., et al., 2004. A field of myocardial-endocardial NFAT signaling underlies heart valve morphogenesis. Cell 118 (5), 649–663. Conway, S.J., 1996. In situ hybridization of cell and tissue sections. In: Cotter, F.E. (Ed.), Methods in Molecular Medicine, Molecular Diagnosis of Cancer. Humana Press Inc., Totowa, NJ, USA, pp. 193– 206 (Chapter 15). Conway, S.J., Kruzynska-Frejtag, A., Kneer, P.L., Machnicki, M., Koushik, S.V., 2003. What cardiovascular defect does my prenatal mouse mutant have, and why? Genesis 35 (1), 1–21. de Lange, F.J., Moorman, A.F., Anderson, R.H., Manner, J., Soufan, A.T., de Gier-de Vries, C., et al., 2004. Lineage and morphogenetic analysis of the cardiac valves. Circ. Res. 95 (6), 645–654. Dor, Y., Klewer, S.E., McDonald, J.A., Keshet, E., Camenisch, T.D., 2003. VEGF modulates early heart valve formation. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 271 (1), 202–208.
599
Falkowski, M., Schledzewski, K., Hansen, B., Goerdt, S., 2003. Expression of stabilin-2, a novel fasciclin-like hyaluronan receptor protein, in murine sinusoidal endothelia, avascular tissues, and at solid/liquid interfaces. Histochem. Cell Biol. 120 (5), 361–369. Ferguson, J.W., Mikesh, M.F., Wheeler, E.F., LeBaron, R.G., 2003. Developmental expression patterns of Beta-ig (betaIG-H3) and its function as a cell adhesion protein. Mech. Dev. 120 (8), 851–864. Gillan, L., Matei, D., Fishman, D.A., Gerbin, C.S., Karlan, B.Y., Chang, D.D., 2002. Periostin secreted by epithelial ovarian carcinoma is a ligand for alpha(V)beta(3) and alpha(V)beta(5) integrins and promotes cell motility. Cancer Res. 62 (18), 5358–5364. Gitler, A.D., Lu, M.M., Jiang, Y.Q., Epstein, J.A., Gruber, P.J., 2003. Molecular markers of cardiac endocardial cushion development. Dev. Dyn. 228 (4), 643–650. Horiuchi, K., Amizuka, N., Takeshita, S., Takamatsu, H., Katsuura, M., Ozawa, H., et al., 1999. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J. Bone Miner. Res. 14 (7), 1239–1249. Kawamoto, T., Noshiro, M., Shen, M., Nakamasu, K., Hashimoto, K., Kawashima-Ohya, Y., et al., 1998. Structural and phylogenetic analyses of RGD-CAP/big-h3, a fasciclin-like adhesion protein expressed in chick chondrocytes. Biochim. Biophys. Acta 1395, 288–292. Kim, J.E., Kim, S.J., Lee, B.H., Park, R.W., Kim, K.S., Kim, I.S., 2000. Identification of motifs for cell adhesion within the repeated domains of transforming growth factor-beta-induced gene, betaig-h3. J. Biol. Chem. 275 (40), 30907–30915. Kisanuki, Y.Y., Hammer, R.E., Miyazaki, J., Williams, S.C., Richardson, J.A., Yanagisawa, M., 2001. Tie2-Cre transgenic mice: a new model for endothelial cell-lineage analysis in vivo. Dev. Biol. 230 (2), 230–242. Kruzynska-Frejtag, A., Machnicki, M., Rogers, R., Markwald, R.R., Conway, S.J., 2001. Periostin (an osteoblast-specific factor) is expressed within the embryonic mouse heart during valve formation. Mech. Dev. 103 (1–2), 183–188. Kruzynska-Frejtag, A., Wang, J., Maeda, M., Rogers, R., Krug, E., Hoffman, S., et al., 2004. Periostin is expressed within the developing teeth at the sites of epithelial–mesenchymal interaction. Dev. Dyn. 229 (4), 857–868. LeBaron, R.G., Bezverkov, K.I., Zimber, M.P., Pavelec, R., Skonier, J., Purchio, A.F., 1995. Beta IG-H3, a novel secretory protein inducible by transforming growth factor-beta, is present in normal skin and promotes the adhesion and spreading of dermal fibroblasts in vitro. J. Invest. Dermatol. 104 (5), 844–849. Lincoln, J., Alfieri, C.M., Yutzey, K.E., 2004. Development of heart valve leaflets and supporting apparatus in chicken and mouse embryos. Dev. Dyn. 230 (2), 239–250. Norris, R.A., Kern, C.B., Wessels, A., Moralez, E.I., Markwald, R.R., Mjaatvedt, C.H., 2004. Identification and detection of the periostin gene in cardiac development. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 281 (2), 1227–1233. Paranya, G., Vineberg, S., Dvorin, E., Kaushal, S., Roth, S.J., Rabkin, E., et al., 2001. Aortic valve endothelial cells undergo transforming growth factor-beta-mediated and non-transforming growth factor-betamediated transdifferentiation in vitro. Am. J. Pathol. 159 (4), 1335–1343. Politz, O., Gratchev, A., McCourt, P.A., Schledzewski, K., Guillot, P., Johansson, S., et al., 2002. Stabilin-1 and -2 constitute a novel family of fasciclin-like hyaluronan receptor homologues. Biochem. J. 362 (Pt 1), 155–164. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425.
600
A. Lindsley et al. / Gene Expression Patterns 5 (2005) 593–600
Schroeder, J.A., Jackson, L.F., Lee, D.C., Camenisch, T.D., 2003. Form and function of developing heart valves: coordination by extracellular matrix and growth factor signaling. J. Mol. Med. 81 (7), 392–403. Skonier, J., Neubauer, M., Madisen, L., Bennett, K., Plowman, G.D., Purchio, A.F., 1992. cDNA cloning and sequence analysis of beta ig-h3, a novel gene induced in a human adenocarcinoma cell line after treatment with transforming growth factor-beta. DNA Cell Biol. 11 (7), 511–522.
Takeshita, S., Kikuno, R., Tezuka, K., Amann, E., 1993. Osteoblastspecific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I. Biochem. J. 294 (Pt 1), 271–278. Zinn, K., McAllister, L., Goodman, C.S., 1988. Sequence analysis and neuronal expression of fasciclin I in grasshopper and Drosophila. Cell 53 (4), 577–587.