- Email: [email protected]
RIF test in clinical samples with suspected tuberculosis
Journal of Microbiological Methods 152 (2018) 48–51
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Comparison of the Purelyse® – IS6110 nested PCR with the Xpert® MTB/RIF test in clinical samples with suspected tuberculosis
T
Carlos German Lemus-Minora,b, Diego Fernando Ovalle-Marroquic, J. Gustavo Vazquez-Jimenezb, Diana Laura Reales-Agüerob, Perla Michelle Sepulveda-Alcantarab, ⁎ Jesús René Rodriguez-Sánchezb, Raúl Diaz-Molinad, Jesús René Machado-Contrerasb, a
Laboratorio Estatal de Salud Pública de Baja California, Instituto de Servicios de Salud Pública del Estado de B.C. (ISESALUD), Mexico Laboratorio de Patogénesis Molecular, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Mexico c Dirección de Enseñanza y Vinculación, Instituto de Servicios de Salud Pública del Estado de B.C. (ISESALUD), Mexico d Laboratorio de Bioquímica, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Mexico b
A R T I C LE I N FO
A B S T R A C T
Keywords: IS6110 TB Purelyse® Xpert® MTB/RIF
Tuberculosis (TB) has a high incidence, prevalence and mortality in the world. Due to its high level of transmission and long-term pharmacological treatment, it is important to have sensitive and specific diagnostic tests. Recently, the PureLyse® system, which is a novel DNA extraction method, was proposed to be an important tool for molecular diagnosis of TB. Here, we compare the PureLyse® system followed by an IS6110 nested PCR (PureLyse® – IS6110 nested PCR) with the Xpert® MTB/RIF test for Mycobacterium tuberculosis complex (MTBC) identification in 40 clinical samples. Among the 40 samples, 26 samples were positive and 14 negative for the Xpert® MTB/RIF test as well as for the PureLyse® - IS6110 nested PCR. According to the Xpert® MTB/RIF test, positive samples presented different bacillary concentrations from “High” to “Very low” and rifampin resistance was observed in 5 samples. The concordance of both molecular methods makes the PureLyse® - IS6110 nested PCR suitable for MTBC detection in patients for low-income resources.
1. Introduction TB is responsible of 1.3 million deaths all over the world and 10.4 million patients lived with this disease in 2016 (World Heatlh Organization, 2018). An early diagnosis of a suspected patient with TB is essential for its clinical management. Currently, the available laboratory methodologies for a suspected patient with tuberculosis are: the microscopic examination through the acid-fast bacilli alcohol (AFB) examination, the Löwenstein-Jensen (L-J) medium for Mycobacterium species cultivation, and the Nucleic-acid amplification tests (NAAT) (Farzam et al., 2015). Although the microscopic examination is a fast and cheap procedure, it has a low sensitivity and specificity (Choi et al., 2014). Additionally, it is difficult to standardize this method in all laboratories, affecting the result of the test (Drobniewski et al., 2003). On the other hand, the L-J medium is generally considered the “Goldstandard” to diagnose TB. However some of the inconveniences is its long period to have a confirmatory result which take from 4 to 8 weeks and even in some cases this time frame could be extended due to a contaminated sample, affecting the administration of therapy (Reed
et al., 2016). The complexity of the cell wall from MTBC species makes it harder to perform DNA extraction compared to other bacteria. It has been proposed that its identification depends on: the target sequence selected to amplify, as well as the efficiency of DNA extraction (Aldous et al., 2005; Ravansalar et al., 2016). The Xpert® MTB/RIF (Cepheid, Sunnyvale, CA, USA) is one of the most widely used NAAT for the diagnosis of TB and identification of resistance to rifampin, which began in December 2010, after its endorsement by the WHO (Lawn et al., 2013). This highly automated system performs a nucleic acid extraction and a nested RpoB real-time PCR, with all reagents within the cartridge (Helb et al., 2010). This system is recommended for use in state and regional laboratories of countries where TB prevails. However, the instrument and its cartridges remain expensive (Walzl et al., 2018) and cannot be part of laboratories that perform only microscopic examination in the primary care centers, where most people with TB are (Walzl et al., 2018). On the other hand, Claremont Biosolutions® (Upland, CA, USA) developed the Purelyse system® which is a miniaturized method, operated by a 6 V battery that enables agitation of beads for mechanical
⁎ Corresponding author at: Laboratorio de Patogénesis Molecular, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Relojeros 1775, Colonia Libertad, C.P. 21030 Mexicali Baja California, Mexico. E-mail address: [email protected] (J.R. Machado-Contreras).
https://doi.org/10.1016/j.mimet.2018.07.002 Received 16 May 2018; Received in revised form 21 June 2018; Accepted 6 July 2018 Available online 20 July 2018 0167-7012/ © 2018 Elsevier B.V. All rights reserved.
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
2.4.1. First round, IS6110 nested PCR Identification of the sequence IS6110 of the MTBC was carried out with two consensus PCR reactions previously described by Khosravi et al. (2017). Briefly, the first round was performed using the following primer sequences. Forward primer: 5′-ATCGTGGAAGCGACCCGCCAG CCCAGGAT-3′ and reverse primer: 5′-CGGGACCACCCGCGGCAAAGCC CGCAGGAC-3′. The reaction volumes were, 12.5 μl of PCR Mastermix 2× (Thermo Fisher Scientific, MA, USA), 6.25 pmol of each primer, and 8 μl of the DNA sample in a final volume of 25 μl. The temperature protocol was: initial denaturation 5 min at 95 °C, followed by 30 cycles at 95 °C for 30 s for denaturation, annealing 63 °C for 30 s, 72 °C for 30 s as extension and final extension at 72 °C for 4 min. The first round amplifies a 220 pb fragment from the IS6110 sequence (Khosravi et al., 2017).
disruption of the sample and DNA extraction (Vandeventer et al., 2011). This system is suitable for DNA extraction of microorganisms with complex cell wall, such as bacteria from the MTBC (Ferguson et al., 2016). In a previous study, the PureLyse® system was compared with a clinically validated method of DNA extraction from sputum samples through a single round real time PCR targeting the IS6110 sequence. In 29 TB clinical samples the PureLyse® showed a sensitivity of 91.7% (95% CI: 80–100%). However, in samples ≥1 ml of volume, the sensitivity reached as high as 100% (95% CI: 80.8–100%) (Ferguson et al., 2016). Here we present a study comparing the PureLyse® - IS6110 nested PCR with the Xpert® MTB/RIF test for MTBC detection in forty clinical samples. 2. Material and methods
2.4.2. Second round, IS6110 nested PCR The mixture of reagents from the second round of PCR was performed at the same time of the first reaction and was preserved at 4 °C to prevent contamination. The sequence primers were: forward primer, 5′ CCTGCGAGCGTAGGCGTCGG 3′ and reverse primer, 5′ CTCGTCCA GCGCCGCTTCGG 3′. The reaction volumes were: 12.5 μl of PCR Mastermix 2× (Thermo Fisher Scientific, Massachusetts, USA), 6.25 pmol of each primer and 1 μl from the first round PCR, to a final reaction of 25 μl. The unique modifications of the temperature conditions from the first round were the annealing at 68 °C and the amplification protocol was for 35 cycles, which produces a 123 bp amplicon (Khosravi et al., 2017).
2.1. Sample treatment and processing The present study was carried out by the Molecular Pathogenesis Laboratory (School of Medicine, Universidad Autónoma de Baja California) and the Department of Tuberculosis of the Baja California State Laboratory of Public Health (ISESALUD), from June 2017 to March 2018. The study was approved by the ISESALUD review board. Once the Department of Tuberculosis received the sample, decontamination and liquefaction was performed with 1:1, 4% NaOH (sodium hydroxide). Then, the sample was incubated for 15 min and centrifuged at 3500 RPM for 20 min. The supernatant was carefully discarded and the resulting pellet was re-suspended in 3 ml of saline solution (0.9% sodium chloride). One milliliter was used for Xpert® MTB/RIF test, 1 ml for the PureLyse® - IS6110 nested PCR and the last milliliter was neutralized with HCl 1 N to inoculate the Löwenstein-Jensen medium and for AFB microscopy examination.
2.4.3. Identification of the PCR products Five microliters of the PCR products, from each PCR round, were mixed with 1 μl of 100× Gelred® (Biotium, Fremont, CA, USA) in 6× loading buffer (Huang et al., 2010) and electrophoresed in a 2% molecular biology agarose gel (IBI Scientific, Dubuque, IA, USA) at 100 V for 50 min. The gel electrophoresis was visualized in a GelDoc imaging system (Biorad, Hercules, CA, USA).
2.2. Xpert® MTB/RIF processing One third of the treated sample was analyzed with the Xpert® MTB/ RIF system according to the manufacturer's instructions. Briefly, 1 ml from the re suspended pellet was mixed with 1.5 ml of the sample treatment buffer, incubated at room temperature for 15 min and transferred to the system cartridge. Finally, the result was ready in 2 h.
3. Results A total of 40 samples were processed through the Xpert® MTB/RIF test, the PureLyse®- IS6110 nested PCR and for L-J media cultivation. Thirty-six samples were sputum and the remaining samples were: (1) pleural effusion, (1) bronchial secretion, (1) bone biopsy and (1) gastric juice. The only sample that required an overnight digestion with Proteinase K at 55 °C before the PureLyse® DNA extraction was the bone biopsy. For Xpert® MTB/RIF test, fourteen samples were negative and 26 samples were positive. Based on this test, positive samples present different bacillary concentrations, from “High” to “Very Low”. Among the 26 positive samples, 9 samples were “High”, 5 samples were “Medium”, 6 samples were “Low” and the last 6 samples presented “Very Low” bacillary concentrations (Supplementary Table 1). Additionally, the rifampicin resistance was observed in 5 samples. Regarding the PureLyse - IS6110 nested PCR, we considered a positive sample for MTBC if one of the PCR amplicons (220 bp and 123 bp) were visualized in the gel electrophoresis. Notably, the positives samples observed in Xpert® MTB/RIF test were also positive in the PureLyse IS6110 nested PCR (Table 1). Particularly, positive samples with “high”, “medium” or “low” bacillary concentration, presented the 220 bp and 123 bp PCR products from the first and second round, respectively. For “very low” concentration samples, only the 123 bp from the second round was observed. On the other hand, we observed 14 positive samples, 12 negative and four contaminated based on the L-J media cultivation. Due to financial sources, L-J medium was not accessible in all samples analyzed. AFB examination was evaluated in 38 samples (19 positive and 19 negative). Five of the 19 negative samples for AFB examination resulted positive for both NAATs performed. These negative samples for AFB examination had very low or low concentrations
2.3. Mycobacterial cultivation and AFB microscopy examination The sample was cultured in Lowenstein-Jensen medium at 37 °C and inspected daily for bacteria growth for 8 weeks. The isolates were analyzed using biochemical tests as nitrate reduction, catalase inhibition and niacin production (Palomino et al., 2008). AFB microscopy examination was performed throught Ziehl-Neelsen staining. 2.4. PureLyse® DNA extraction According with the manufacturer's recommendations for sputum DNA extraction, the sample was mixed with equal's volume (1 ml) of 4× binding buffer and incubated for 10 min. Next, with a 3 cc. syringe the liquid was collected and connected into the Purelyse® chamber. The liquid was passed through the chamber with the 6 V battery turned on, resulting in the cell disruption and DNA binding to the beads. After, 1 ml of wash buffer, made from 1× binding buffer and 0.025% of Tween 80, Biotech grade (BioBasic, Buffalo, NY, USA) was passed through the chamber. Next the chamber was purged by drawing air into the syringe and passing it through the chamber twice. The elution of the DNA was performed with 100 μl of elution buffer drawing the buffer into the chamber, displacing the air and with the battery on for 30 s. Finally, the chamber was purged with air to ensure that the entire elution buffer with the DNA was in the 1.5 ml microtube. The DNA samples were stored at 4 °C until their analysis by the IS6110 nested PCR. 49
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
TB coinfection. The selection of these samples could bias the current frequency of samples resistant to rifampin. Subsequent studies, where the criteria of the evaluated samples are extended, could give a more accurate answer about the frequency of rifampin resistance in TB patients. Identification of rifampin resistance could be evaluated with a nested-multiplex PCR proposed by Mokrousov et al. (2003). This method identifies the three main mutations in codons 516, 526, and 531of the rpoB gene, associated with the 70–95% of rifampin resistance, that could be included in the IS6110 nested PCR to obtain both results at the same time. Finally, AFB examination showed 5 of 19 negative samples positive for MTBC for both molecular methods evaluated. The sensitivity of these tests on pulmonary smear-negative samples has been reported from 60 to 40% (Miller et al., 2011). However it is important to perform future studies comparing the PureLyse® IS6110 nested PCR with the Xpert® MTB/RIF test in smear-negative samples. In conclusion, to our knowledge, the present study is the first that compares the PureLyse® system followed by an IS6110 nested PCR with the Xpert® MTB/RIF test, in clinical samples. One of our limitations was the low number of samples processed through both molecular methods, however, further studies are required to evaluate the PureLyse® in larger cohorts and coupled with other variants such as nested real time PCR that would make it faster to get a result and evaluate the impact of this method in high burden TB countries.
Table 1 Comparison of PureLyse® – IS6110 nested PCR with the Xpert MTB/RIF® test. b
All samples (No. 40)
PureLyse® - IS6110 nested PCRa
Pos Neg
Xpert MTB/RIF® test
40 26 14
Pos
Neg
26 26 0
14 0 14
a PCR conditions for IS6110 nested PCR were described by Khosravi et al., 2017. A Sample was considered positive if one of the two amplicons were visualized after the gel electrophoresis. b The Xpert MTB/RIF® test was performed according to the manufacturer's instructions.
according with the Xpert® MTB/RIF test. AFB results were not available in two samples (Supplementary Table 1). 4. Discussion One of the biggest challenges in our country against TB, is its laboratory diagnosis. The majority of our health centers perform microscopic examination for acid-fast bacilli observation, which most of the time is, the only method available for TB patients. Actually, molecular methods based on PCR, have a great potential to identify MTBC directly from clinical samples, obtaining results the same day (Choi et al., 2014). Although, the Xpert® MTB/RIF system is one of the most used tests for molecular detection of TB, it is difficult to be accessible in patients with low resources (Ferguson et al., 2016). Particularly, the cost of the Xpert®MTB/RIF cartridge in our country is about 90$ and the GeneXpert machine is around 17,000$, compared to the PureLyse® cartridge that costs around 13$ giving a final cost of 20$ when the material and reagents for PCR were included. The Xpert®MTB/RIF has been compared with other in-house PCR assays obtaining different results. Armand et al. (2011), compared the Xpert® MTB/RIF test with an IS6110 real time PCR in 117 clinical specimens. For smear-positive specimens, a sensitivity of 100% was reported in both methods, while in smear-negative specimens the Xpert® MTB/RIF test showed 48% compared to 69% from the IS6110 real time PCR assay. On the other hand, Miller et al. (2011), observed a concordance of 100% between the Xpert® MTB/RIF test and IS6110 Real-time PCR in smear-culture positive specimens. However, in smear-culture negative specimens the sensitivity was 60% and 75% for pulmonary and extrapulmonary specimens for Xpert® MTB/RIF test and for the IS6110 Real Time PCR showed 40% and 0% for both types of specimens. The present study identified 26 positive and 14 negative samples for MTBC identification through two molecular methods. The different bacillary concentrations observed by Xpert® MTB/RIF test, allowed us to evaluate the PureLyse® IS6110 nested PCR in pauci-bacillary samples, that is, one of the biggest challenges in the TB patients (Sharma et al., 2018). A previous study compared the PureLyse® system with a clinically validated DNA extraction protocol, through the amplification of the insertion IS6110 by real time PCR. Among the twenty-nine samples evaluated, 24 were positive by the clinically validated method and 22 as well for the PureLyse® system (91.66%). However, in samples ≥1 ml, both methods were concordant (Ferguson et al., 2016). Unlike our study, we performed a nested PCR to increase the sensitivity of the assay that allowed us to identify pauci-bacillary samples. On the other hand, the rifampin resistance was observed in five samples (12.5%) from the forty samples according to the Xpert® MTB/ RIF. This frequency was high compared with Halse et al. (2010), where 3 rifampin resistant samples (2.1%) were reported in a cohort of 140 samples. In Mexico's Public Health Laboratories, the Xpert® MTB/RIF method is used in patients that have first line drug failure or with HIV/
Funding The present work was supported by the 2a Convocatoria Especial de Apoyo a Proyectos de Investigación, (U.A.B.C.), Grant no.: 1985. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mimet.2018.07.002. Acknowledgements The authors thank to Vinh-Bao Nguyen, MBS, Research Associate, Claremont Biosolutions, LLC for technical assistance about sputum sample processing. Specially thanks to Esperanza Flores-Romo and Claudia Serrano-Flores from the Baja California State Laboratory of Public Health for the assistance provided. Declaration of interest None. References Aldous, W.K., Pounder, J.I., Cloud, J.L., Woods, G.L., 2005. Comparison of six methods of extracting Mycobacterium tuberculosis DNA from processed sputum for testing by quantitative real-time PCR. J. Clin. Microbiol. 43 (5), 2471–2473. https://doi.org/10. 1128/JCM.43.5.2471-2473.2005. Armand, S., Vanhuls, P., Delcroix, G., Courcol, R., Lemaitre, N., 2011. Comparison of the Xpert MTB/RIF Test with an IS6110-TaqMan real-time PCR assay for direct detection of Mycobacterium tuberculosis in respiratory and nonrespiratory specimens. J. Clin. Microbiol. 49 (5), 1772–1776. https://doi.org/10.1128/JCM.02157-10. Choi, Y., Jeon, B.Y., Shim, T.S., Jin, H., Cho, S.N., Lee, H., 2014. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis. Diagn. Microbiol. Infect. Dis. 80 (4), 299–303. https://doi.org/10.1016/j. diagmicrobio.2014.08.009. Drobniewski, F.A., Caws, M., Gibson, A., Young, D., 2003. Modern laboratory diagnosis of tuberculosis. Lancet Infect. Dis. 3 (3), 141–147. https://doi.org/10.1016/S14733099(03)00544-9. Farzam, B., Imani Fooladi, A.A., Izadi, M., Hossaini, H.M., Feizabadi, M.M., 2015. Comparison of cyp141 and IS6110 for detection of Mycobacterium tuberculosis from clinical specimens by PCR. J. Infect. Public Health 8 (1), 32–36. https://doi.org/10. 1016/j.jiph.2014.08.005. Ferguson, T.M., Weigel, K.M., Lakey Becker, A., Ontengco, D., Narita, M., Tolstorukov, I., Doebler, R., Cangelosi, G., Niemz, A., 2016. Pilot study of a rapid and minimally instrumented sputum sample preparation method for molecular diagnosis of tuberculosis. Sci. Rep. 6 (1). https://doi.org/10.1038/srep19541. Halse, T.A., Edwards, J., Cunningham, P.L., Wolfgang, W.J., Dumas, N.B., Escuyer, V.E., Musser, K.A., 2010. Combined real-time PCR and rpoB gene pyrosequencing for rapid
50
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
assays for detection of rifampin-resistant Mycobacterium tuberculosis in sputum smears. Antimicrob. Agents Chemother. 47 (7), 2231–2235. Palomino, J.C., Martin, A., Von Groll, A., Portaels, F., 2008. Rapid culture-based methods for drug-resistance detection in Mycobacterium tuberculosis. J. Microbiol. Methods 75 (2), 161–166. https://doi.org/10.1016/j.mimet.2008.06.015. Ravansalar, H., Tadayon, K., Ghazvini, K., 2016. Molecular typing methods used in studies of Mycobacterium tuberculosis in Iran: a systematic review. Iran J. Microbiol. 8 (5), 338–346. Reed, J.L., Walker, Z.J., Basu, D., Allen, V., Nicol, M.P., Kelso, D.M., McFall, S.M., 2016. Highly sensitive sequence specific QPCR detection of Mycobacterium tuberculosis complex in respiratory specimens. Tuberculosis (Edinb) 101, 114–124. https://doi. org/10.1016/j.tube.2016.09.002. Sharma, S., Dahiya, B., Sreenivas, V., Singh, N., Raj, A., Sheoran, A., Yadav, A., Gupta, K.B., Mehta, P.K., 2018. Comparative evaluation of GeneXpert MTB/RIF and multiplex PCR targeting mpb64 and IS6110 for the diagnosis of pleural TB. Future Microbiol 13, 407–413. https://doi.org/10.2217/fmb-2017-0147. Vandeventer, P.E., Weigel, K.M., Salazar, J., Erwin, B., Irvine, B., Doebler, R., Nadim, A., Cangelosi, G.A., Niemz, A., 2011. Mechanical disruption of lysis-resistant bacterial cells by use of a miniature, low-power, disposable device. J. Clin. Microbiol. 49 (7), 2533–2539. https://doi.org/10.1128/JCM.02171-10. Walzl, G., McNerney, R., du Plessis, N., Bates, M., McHugh, T.D., Chegou, N.N., Zumla, A., 2018. Tuberculosis: advances and challenges in development of new diagnostics and biomarkers. Lancet Infect. Dis. https://doi.org/10.1016/S1473-3099(18)30111-7. pii: S1473-3099(18)30111-7. World Heatlh Organization, 2018. Global Tuberculosis Report 2017. http://www.who. int/tb/publications/global_report/en/, Accessed date: 16 April 2018.
identification of Mycobacterium tuberculosis and determination of rifampin resistance directly in clinical specimens. J. Clin. Microbiol. 48 (4), 1182–1188. https:// doi.org/10.1128/JCM.02149-09. Helb, D., Jones, M., Story, E., Boehme, C., Wallace, E., Ho, K., Kop, J., Owens, M.R., Rodgers, R., Banada, P., Safi, H., Blakemore, R., Lan, N.T., Jones-López, E.C., Levi, M., Burday, M., Ayakaka, I., Mugerwa, R.D., McMillan, B., Winn-Deen, E., Christel, L., Dailey, P., Perkins, M.D., Persing, D.H., Alland, D., 2010. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J. Clin. Microbiol. 48 (1), 229–237. https://doi.org/10.1128/JCM. 01463-09. Huang, Q., Baum, L., Fu, W.L., 2010. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis. Clin. Lab. 56 (3–4), 149–152. Khosravi, A.D., Alami, A., Meghdadi, H., Hosseini, A.A., 2017. Identification of Mycobacterium tuberculosis in clinical specimens of patients suspected of having extrapulmonary tuberculosis by application of nested PCR on five different genes. Front. Cell. Infect. Microbiol. 7, 3. Lawn, S.D., Mwaba, P., Bates, M., Piatek, A., Alexander, H., Marais, B.J., Cuevas, L.E., McHugh, T.D., Zijenah, L., Kapata, N., Abubakar, I., McNerney, R., Hoelscher, M., Memish, Z.A., Migliori, G.B., Kim, P., Maeurer, M., Schito, M., Zumla, A., 2013. Advances in tuberculosis diagnostics: the Xpert MTB/RIF assay and future prospects for a point-of-care test. Lancet Infect. Dis. 13 (4), 349–361. https://doi.org/10.1016/ S1473-3099(13)70008-2. Miller, M.B., Popowitch, E.B., Backlund, M.G., Ager, E.P., 2011. Performance of Xpert MTB/RIF RUO assay and IS6110 real-time PCR for Mycobacterium tuberculosis detection in clinical samples. J. Clin. Microbiol. 49 (10), 3458–3462. https://doi.org/ 10.1128/JCM.05212-11. Mokrousov, I., Otten, T., Vyshnevskiy, B., Narvskaya, O., 2003. Allele-specific rpoB PCR
51
Contents lists available at ScienceDirect
Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth
Comparison of the Purelyse® – IS6110 nested PCR with the Xpert® MTB/RIF test in clinical samples with suspected tuberculosis
T
Carlos German Lemus-Minora,b, Diego Fernando Ovalle-Marroquic, J. Gustavo Vazquez-Jimenezb, Diana Laura Reales-Agüerob, Perla Michelle Sepulveda-Alcantarab, ⁎ Jesús René Rodriguez-Sánchezb, Raúl Diaz-Molinad, Jesús René Machado-Contrerasb, a
Laboratorio Estatal de Salud Pública de Baja California, Instituto de Servicios de Salud Pública del Estado de B.C. (ISESALUD), Mexico Laboratorio de Patogénesis Molecular, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Mexico c Dirección de Enseñanza y Vinculación, Instituto de Servicios de Salud Pública del Estado de B.C. (ISESALUD), Mexico d Laboratorio de Bioquímica, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Mexico b
A R T I C LE I N FO
A B S T R A C T
Keywords: IS6110 TB Purelyse® Xpert® MTB/RIF
Tuberculosis (TB) has a high incidence, prevalence and mortality in the world. Due to its high level of transmission and long-term pharmacological treatment, it is important to have sensitive and specific diagnostic tests. Recently, the PureLyse® system, which is a novel DNA extraction method, was proposed to be an important tool for molecular diagnosis of TB. Here, we compare the PureLyse® system followed by an IS6110 nested PCR (PureLyse® – IS6110 nested PCR) with the Xpert® MTB/RIF test for Mycobacterium tuberculosis complex (MTBC) identification in 40 clinical samples. Among the 40 samples, 26 samples were positive and 14 negative for the Xpert® MTB/RIF test as well as for the PureLyse® - IS6110 nested PCR. According to the Xpert® MTB/RIF test, positive samples presented different bacillary concentrations from “High” to “Very low” and rifampin resistance was observed in 5 samples. The concordance of both molecular methods makes the PureLyse® - IS6110 nested PCR suitable for MTBC detection in patients for low-income resources.
1. Introduction TB is responsible of 1.3 million deaths all over the world and 10.4 million patients lived with this disease in 2016 (World Heatlh Organization, 2018). An early diagnosis of a suspected patient with TB is essential for its clinical management. Currently, the available laboratory methodologies for a suspected patient with tuberculosis are: the microscopic examination through the acid-fast bacilli alcohol (AFB) examination, the Löwenstein-Jensen (L-J) medium for Mycobacterium species cultivation, and the Nucleic-acid amplification tests (NAAT) (Farzam et al., 2015). Although the microscopic examination is a fast and cheap procedure, it has a low sensitivity and specificity (Choi et al., 2014). Additionally, it is difficult to standardize this method in all laboratories, affecting the result of the test (Drobniewski et al., 2003). On the other hand, the L-J medium is generally considered the “Goldstandard” to diagnose TB. However some of the inconveniences is its long period to have a confirmatory result which take from 4 to 8 weeks and even in some cases this time frame could be extended due to a contaminated sample, affecting the administration of therapy (Reed
et al., 2016). The complexity of the cell wall from MTBC species makes it harder to perform DNA extraction compared to other bacteria. It has been proposed that its identification depends on: the target sequence selected to amplify, as well as the efficiency of DNA extraction (Aldous et al., 2005; Ravansalar et al., 2016). The Xpert® MTB/RIF (Cepheid, Sunnyvale, CA, USA) is one of the most widely used NAAT for the diagnosis of TB and identification of resistance to rifampin, which began in December 2010, after its endorsement by the WHO (Lawn et al., 2013). This highly automated system performs a nucleic acid extraction and a nested RpoB real-time PCR, with all reagents within the cartridge (Helb et al., 2010). This system is recommended for use in state and regional laboratories of countries where TB prevails. However, the instrument and its cartridges remain expensive (Walzl et al., 2018) and cannot be part of laboratories that perform only microscopic examination in the primary care centers, where most people with TB are (Walzl et al., 2018). On the other hand, Claremont Biosolutions® (Upland, CA, USA) developed the Purelyse system® which is a miniaturized method, operated by a 6 V battery that enables agitation of beads for mechanical
⁎ Corresponding author at: Laboratorio de Patogénesis Molecular, Facultad de Medicina Mexicali, Universidad Autónoma de Baja California, Relojeros 1775, Colonia Libertad, C.P. 21030 Mexicali Baja California, Mexico. E-mail address: [email protected] (J.R. Machado-Contreras).
https://doi.org/10.1016/j.mimet.2018.07.002 Received 16 May 2018; Received in revised form 21 June 2018; Accepted 6 July 2018 Available online 20 July 2018 0167-7012/ © 2018 Elsevier B.V. All rights reserved.
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
2.4.1. First round, IS6110 nested PCR Identification of the sequence IS6110 of the MTBC was carried out with two consensus PCR reactions previously described by Khosravi et al. (2017). Briefly, the first round was performed using the following primer sequences. Forward primer: 5′-ATCGTGGAAGCGACCCGCCAG CCCAGGAT-3′ and reverse primer: 5′-CGGGACCACCCGCGGCAAAGCC CGCAGGAC-3′. The reaction volumes were, 12.5 μl of PCR Mastermix 2× (Thermo Fisher Scientific, MA, USA), 6.25 pmol of each primer, and 8 μl of the DNA sample in a final volume of 25 μl. The temperature protocol was: initial denaturation 5 min at 95 °C, followed by 30 cycles at 95 °C for 30 s for denaturation, annealing 63 °C for 30 s, 72 °C for 30 s as extension and final extension at 72 °C for 4 min. The first round amplifies a 220 pb fragment from the IS6110 sequence (Khosravi et al., 2017).
disruption of the sample and DNA extraction (Vandeventer et al., 2011). This system is suitable for DNA extraction of microorganisms with complex cell wall, such as bacteria from the MTBC (Ferguson et al., 2016). In a previous study, the PureLyse® system was compared with a clinically validated method of DNA extraction from sputum samples through a single round real time PCR targeting the IS6110 sequence. In 29 TB clinical samples the PureLyse® showed a sensitivity of 91.7% (95% CI: 80–100%). However, in samples ≥1 ml of volume, the sensitivity reached as high as 100% (95% CI: 80.8–100%) (Ferguson et al., 2016). Here we present a study comparing the PureLyse® - IS6110 nested PCR with the Xpert® MTB/RIF test for MTBC detection in forty clinical samples. 2. Material and methods
2.4.2. Second round, IS6110 nested PCR The mixture of reagents from the second round of PCR was performed at the same time of the first reaction and was preserved at 4 °C to prevent contamination. The sequence primers were: forward primer, 5′ CCTGCGAGCGTAGGCGTCGG 3′ and reverse primer, 5′ CTCGTCCA GCGCCGCTTCGG 3′. The reaction volumes were: 12.5 μl of PCR Mastermix 2× (Thermo Fisher Scientific, Massachusetts, USA), 6.25 pmol of each primer and 1 μl from the first round PCR, to a final reaction of 25 μl. The unique modifications of the temperature conditions from the first round were the annealing at 68 °C and the amplification protocol was for 35 cycles, which produces a 123 bp amplicon (Khosravi et al., 2017).
2.1. Sample treatment and processing The present study was carried out by the Molecular Pathogenesis Laboratory (School of Medicine, Universidad Autónoma de Baja California) and the Department of Tuberculosis of the Baja California State Laboratory of Public Health (ISESALUD), from June 2017 to March 2018. The study was approved by the ISESALUD review board. Once the Department of Tuberculosis received the sample, decontamination and liquefaction was performed with 1:1, 4% NaOH (sodium hydroxide). Then, the sample was incubated for 15 min and centrifuged at 3500 RPM for 20 min. The supernatant was carefully discarded and the resulting pellet was re-suspended in 3 ml of saline solution (0.9% sodium chloride). One milliliter was used for Xpert® MTB/RIF test, 1 ml for the PureLyse® - IS6110 nested PCR and the last milliliter was neutralized with HCl 1 N to inoculate the Löwenstein-Jensen medium and for AFB microscopy examination.
2.4.3. Identification of the PCR products Five microliters of the PCR products, from each PCR round, were mixed with 1 μl of 100× Gelred® (Biotium, Fremont, CA, USA) in 6× loading buffer (Huang et al., 2010) and electrophoresed in a 2% molecular biology agarose gel (IBI Scientific, Dubuque, IA, USA) at 100 V for 50 min. The gel electrophoresis was visualized in a GelDoc imaging system (Biorad, Hercules, CA, USA).
2.2. Xpert® MTB/RIF processing One third of the treated sample was analyzed with the Xpert® MTB/ RIF system according to the manufacturer's instructions. Briefly, 1 ml from the re suspended pellet was mixed with 1.5 ml of the sample treatment buffer, incubated at room temperature for 15 min and transferred to the system cartridge. Finally, the result was ready in 2 h.
3. Results A total of 40 samples were processed through the Xpert® MTB/RIF test, the PureLyse®- IS6110 nested PCR and for L-J media cultivation. Thirty-six samples were sputum and the remaining samples were: (1) pleural effusion, (1) bronchial secretion, (1) bone biopsy and (1) gastric juice. The only sample that required an overnight digestion with Proteinase K at 55 °C before the PureLyse® DNA extraction was the bone biopsy. For Xpert® MTB/RIF test, fourteen samples were negative and 26 samples were positive. Based on this test, positive samples present different bacillary concentrations, from “High” to “Very Low”. Among the 26 positive samples, 9 samples were “High”, 5 samples were “Medium”, 6 samples were “Low” and the last 6 samples presented “Very Low” bacillary concentrations (Supplementary Table 1). Additionally, the rifampicin resistance was observed in 5 samples. Regarding the PureLyse - IS6110 nested PCR, we considered a positive sample for MTBC if one of the PCR amplicons (220 bp and 123 bp) were visualized in the gel electrophoresis. Notably, the positives samples observed in Xpert® MTB/RIF test were also positive in the PureLyse IS6110 nested PCR (Table 1). Particularly, positive samples with “high”, “medium” or “low” bacillary concentration, presented the 220 bp and 123 bp PCR products from the first and second round, respectively. For “very low” concentration samples, only the 123 bp from the second round was observed. On the other hand, we observed 14 positive samples, 12 negative and four contaminated based on the L-J media cultivation. Due to financial sources, L-J medium was not accessible in all samples analyzed. AFB examination was evaluated in 38 samples (19 positive and 19 negative). Five of the 19 negative samples for AFB examination resulted positive for both NAATs performed. These negative samples for AFB examination had very low or low concentrations
2.3. Mycobacterial cultivation and AFB microscopy examination The sample was cultured in Lowenstein-Jensen medium at 37 °C and inspected daily for bacteria growth for 8 weeks. The isolates were analyzed using biochemical tests as nitrate reduction, catalase inhibition and niacin production (Palomino et al., 2008). AFB microscopy examination was performed throught Ziehl-Neelsen staining. 2.4. PureLyse® DNA extraction According with the manufacturer's recommendations for sputum DNA extraction, the sample was mixed with equal's volume (1 ml) of 4× binding buffer and incubated for 10 min. Next, with a 3 cc. syringe the liquid was collected and connected into the Purelyse® chamber. The liquid was passed through the chamber with the 6 V battery turned on, resulting in the cell disruption and DNA binding to the beads. After, 1 ml of wash buffer, made from 1× binding buffer and 0.025% of Tween 80, Biotech grade (BioBasic, Buffalo, NY, USA) was passed through the chamber. Next the chamber was purged by drawing air into the syringe and passing it through the chamber twice. The elution of the DNA was performed with 100 μl of elution buffer drawing the buffer into the chamber, displacing the air and with the battery on for 30 s. Finally, the chamber was purged with air to ensure that the entire elution buffer with the DNA was in the 1.5 ml microtube. The DNA samples were stored at 4 °C until their analysis by the IS6110 nested PCR. 49
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
TB coinfection. The selection of these samples could bias the current frequency of samples resistant to rifampin. Subsequent studies, where the criteria of the evaluated samples are extended, could give a more accurate answer about the frequency of rifampin resistance in TB patients. Identification of rifampin resistance could be evaluated with a nested-multiplex PCR proposed by Mokrousov et al. (2003). This method identifies the three main mutations in codons 516, 526, and 531of the rpoB gene, associated with the 70–95% of rifampin resistance, that could be included in the IS6110 nested PCR to obtain both results at the same time. Finally, AFB examination showed 5 of 19 negative samples positive for MTBC for both molecular methods evaluated. The sensitivity of these tests on pulmonary smear-negative samples has been reported from 60 to 40% (Miller et al., 2011). However it is important to perform future studies comparing the PureLyse® IS6110 nested PCR with the Xpert® MTB/RIF test in smear-negative samples. In conclusion, to our knowledge, the present study is the first that compares the PureLyse® system followed by an IS6110 nested PCR with the Xpert® MTB/RIF test, in clinical samples. One of our limitations was the low number of samples processed through both molecular methods, however, further studies are required to evaluate the PureLyse® in larger cohorts and coupled with other variants such as nested real time PCR that would make it faster to get a result and evaluate the impact of this method in high burden TB countries.
Table 1 Comparison of PureLyse® – IS6110 nested PCR with the Xpert MTB/RIF® test. b
All samples (No. 40)
PureLyse® - IS6110 nested PCRa
Pos Neg
Xpert MTB/RIF® test
40 26 14
Pos
Neg
26 26 0
14 0 14
a PCR conditions for IS6110 nested PCR were described by Khosravi et al., 2017. A Sample was considered positive if one of the two amplicons were visualized after the gel electrophoresis. b The Xpert MTB/RIF® test was performed according to the manufacturer's instructions.
according with the Xpert® MTB/RIF test. AFB results were not available in two samples (Supplementary Table 1). 4. Discussion One of the biggest challenges in our country against TB, is its laboratory diagnosis. The majority of our health centers perform microscopic examination for acid-fast bacilli observation, which most of the time is, the only method available for TB patients. Actually, molecular methods based on PCR, have a great potential to identify MTBC directly from clinical samples, obtaining results the same day (Choi et al., 2014). Although, the Xpert® MTB/RIF system is one of the most used tests for molecular detection of TB, it is difficult to be accessible in patients with low resources (Ferguson et al., 2016). Particularly, the cost of the Xpert®MTB/RIF cartridge in our country is about 90$ and the GeneXpert machine is around 17,000$, compared to the PureLyse® cartridge that costs around 13$ giving a final cost of 20$ when the material and reagents for PCR were included. The Xpert®MTB/RIF has been compared with other in-house PCR assays obtaining different results. Armand et al. (2011), compared the Xpert® MTB/RIF test with an IS6110 real time PCR in 117 clinical specimens. For smear-positive specimens, a sensitivity of 100% was reported in both methods, while in smear-negative specimens the Xpert® MTB/RIF test showed 48% compared to 69% from the IS6110 real time PCR assay. On the other hand, Miller et al. (2011), observed a concordance of 100% between the Xpert® MTB/RIF test and IS6110 Real-time PCR in smear-culture positive specimens. However, in smear-culture negative specimens the sensitivity was 60% and 75% for pulmonary and extrapulmonary specimens for Xpert® MTB/RIF test and for the IS6110 Real Time PCR showed 40% and 0% for both types of specimens. The present study identified 26 positive and 14 negative samples for MTBC identification through two molecular methods. The different bacillary concentrations observed by Xpert® MTB/RIF test, allowed us to evaluate the PureLyse® IS6110 nested PCR in pauci-bacillary samples, that is, one of the biggest challenges in the TB patients (Sharma et al., 2018). A previous study compared the PureLyse® system with a clinically validated DNA extraction protocol, through the amplification of the insertion IS6110 by real time PCR. Among the twenty-nine samples evaluated, 24 were positive by the clinically validated method and 22 as well for the PureLyse® system (91.66%). However, in samples ≥1 ml, both methods were concordant (Ferguson et al., 2016). Unlike our study, we performed a nested PCR to increase the sensitivity of the assay that allowed us to identify pauci-bacillary samples. On the other hand, the rifampin resistance was observed in five samples (12.5%) from the forty samples according to the Xpert® MTB/ RIF. This frequency was high compared with Halse et al. (2010), where 3 rifampin resistant samples (2.1%) were reported in a cohort of 140 samples. In Mexico's Public Health Laboratories, the Xpert® MTB/RIF method is used in patients that have first line drug failure or with HIV/
Funding The present work was supported by the 2a Convocatoria Especial de Apoyo a Proyectos de Investigación, (U.A.B.C.), Grant no.: 1985. Supplementary data to this article can be found online at https:// doi.org/10.1016/j.mimet.2018.07.002. Acknowledgements The authors thank to Vinh-Bao Nguyen, MBS, Research Associate, Claremont Biosolutions, LLC for technical assistance about sputum sample processing. Specially thanks to Esperanza Flores-Romo and Claudia Serrano-Flores from the Baja California State Laboratory of Public Health for the assistance provided. Declaration of interest None. References Aldous, W.K., Pounder, J.I., Cloud, J.L., Woods, G.L., 2005. Comparison of six methods of extracting Mycobacterium tuberculosis DNA from processed sputum for testing by quantitative real-time PCR. J. Clin. Microbiol. 43 (5), 2471–2473. https://doi.org/10. 1128/JCM.43.5.2471-2473.2005. Armand, S., Vanhuls, P., Delcroix, G., Courcol, R., Lemaitre, N., 2011. Comparison of the Xpert MTB/RIF Test with an IS6110-TaqMan real-time PCR assay for direct detection of Mycobacterium tuberculosis in respiratory and nonrespiratory specimens. J. Clin. Microbiol. 49 (5), 1772–1776. https://doi.org/10.1128/JCM.02157-10. Choi, Y., Jeon, B.Y., Shim, T.S., Jin, H., Cho, S.N., Lee, H., 2014. Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis. Diagn. Microbiol. Infect. Dis. 80 (4), 299–303. https://doi.org/10.1016/j. diagmicrobio.2014.08.009. Drobniewski, F.A., Caws, M., Gibson, A., Young, D., 2003. Modern laboratory diagnosis of tuberculosis. Lancet Infect. Dis. 3 (3), 141–147. https://doi.org/10.1016/S14733099(03)00544-9. Farzam, B., Imani Fooladi, A.A., Izadi, M., Hossaini, H.M., Feizabadi, M.M., 2015. Comparison of cyp141 and IS6110 for detection of Mycobacterium tuberculosis from clinical specimens by PCR. J. Infect. Public Health 8 (1), 32–36. https://doi.org/10. 1016/j.jiph.2014.08.005. Ferguson, T.M., Weigel, K.M., Lakey Becker, A., Ontengco, D., Narita, M., Tolstorukov, I., Doebler, R., Cangelosi, G., Niemz, A., 2016. Pilot study of a rapid and minimally instrumented sputum sample preparation method for molecular diagnosis of tuberculosis. Sci. Rep. 6 (1). https://doi.org/10.1038/srep19541. Halse, T.A., Edwards, J., Cunningham, P.L., Wolfgang, W.J., Dumas, N.B., Escuyer, V.E., Musser, K.A., 2010. Combined real-time PCR and rpoB gene pyrosequencing for rapid
50
Journal of Microbiological Methods 152 (2018) 48–51
C.G. Lemus-Minor et al.
assays for detection of rifampin-resistant Mycobacterium tuberculosis in sputum smears. Antimicrob. Agents Chemother. 47 (7), 2231–2235. Palomino, J.C., Martin, A., Von Groll, A., Portaels, F., 2008. Rapid culture-based methods for drug-resistance detection in Mycobacterium tuberculosis. J. Microbiol. Methods 75 (2), 161–166. https://doi.org/10.1016/j.mimet.2008.06.015. Ravansalar, H., Tadayon, K., Ghazvini, K., 2016. Molecular typing methods used in studies of Mycobacterium tuberculosis in Iran: a systematic review. Iran J. Microbiol. 8 (5), 338–346. Reed, J.L., Walker, Z.J., Basu, D., Allen, V., Nicol, M.P., Kelso, D.M., McFall, S.M., 2016. Highly sensitive sequence specific QPCR detection of Mycobacterium tuberculosis complex in respiratory specimens. Tuberculosis (Edinb) 101, 114–124. https://doi. org/10.1016/j.tube.2016.09.002. Sharma, S., Dahiya, B., Sreenivas, V., Singh, N., Raj, A., Sheoran, A., Yadav, A., Gupta, K.B., Mehta, P.K., 2018. Comparative evaluation of GeneXpert MTB/RIF and multiplex PCR targeting mpb64 and IS6110 for the diagnosis of pleural TB. Future Microbiol 13, 407–413. https://doi.org/10.2217/fmb-2017-0147. Vandeventer, P.E., Weigel, K.M., Salazar, J., Erwin, B., Irvine, B., Doebler, R., Nadim, A., Cangelosi, G.A., Niemz, A., 2011. Mechanical disruption of lysis-resistant bacterial cells by use of a miniature, low-power, disposable device. J. Clin. Microbiol. 49 (7), 2533–2539. https://doi.org/10.1128/JCM.02171-10. Walzl, G., McNerney, R., du Plessis, N., Bates, M., McHugh, T.D., Chegou, N.N., Zumla, A., 2018. Tuberculosis: advances and challenges in development of new diagnostics and biomarkers. Lancet Infect. Dis. https://doi.org/10.1016/S1473-3099(18)30111-7. pii: S1473-3099(18)30111-7. World Heatlh Organization, 2018. Global Tuberculosis Report 2017. http://www.who. int/tb/publications/global_report/en/, Accessed date: 16 April 2018.
identification of Mycobacterium tuberculosis and determination of rifampin resistance directly in clinical specimens. J. Clin. Microbiol. 48 (4), 1182–1188. https:// doi.org/10.1128/JCM.02149-09. Helb, D., Jones, M., Story, E., Boehme, C., Wallace, E., Ho, K., Kop, J., Owens, M.R., Rodgers, R., Banada, P., Safi, H., Blakemore, R., Lan, N.T., Jones-López, E.C., Levi, M., Burday, M., Ayakaka, I., Mugerwa, R.D., McMillan, B., Winn-Deen, E., Christel, L., Dailey, P., Perkins, M.D., Persing, D.H., Alland, D., 2010. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J. Clin. Microbiol. 48 (1), 229–237. https://doi.org/10.1128/JCM. 01463-09. Huang, Q., Baum, L., Fu, W.L., 2010. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis. Clin. Lab. 56 (3–4), 149–152. Khosravi, A.D., Alami, A., Meghdadi, H., Hosseini, A.A., 2017. Identification of Mycobacterium tuberculosis in clinical specimens of patients suspected of having extrapulmonary tuberculosis by application of nested PCR on five different genes. Front. Cell. Infect. Microbiol. 7, 3. Lawn, S.D., Mwaba, P., Bates, M., Piatek, A., Alexander, H., Marais, B.J., Cuevas, L.E., McHugh, T.D., Zijenah, L., Kapata, N., Abubakar, I., McNerney, R., Hoelscher, M., Memish, Z.A., Migliori, G.B., Kim, P., Maeurer, M., Schito, M., Zumla, A., 2013. Advances in tuberculosis diagnostics: the Xpert MTB/RIF assay and future prospects for a point-of-care test. Lancet Infect. Dis. 13 (4), 349–361. https://doi.org/10.1016/ S1473-3099(13)70008-2. Miller, M.B., Popowitch, E.B., Backlund, M.G., Ager, E.P., 2011. Performance of Xpert MTB/RIF RUO assay and IS6110 real-time PCR for Mycobacterium tuberculosis detection in clinical samples. J. Clin. Microbiol. 49 (10), 3458–3462. https://doi.org/ 10.1128/JCM.05212-11. Mokrousov, I., Otten, T., Vyshnevskiy, B., Narvskaya, O., 2003. Allele-specific rpoB PCR
51