- Email: [email protected]
Compatibility of Tanshinone IIA and Astragaloside IV in attenuating hypoxia-induced cardiomyocytes injury
Author’s Accepted Manuscript Combination of Tanshinone IIA and Astragaloside IV in Attenuating Hypoxia-induced Cardiomyocytes Injury: Compatible But No Significant Advantage Dawei Wang, Yuntao Liu, Guofu Zhong, Yuanyuan Wang, Tong Zhang, Zhen Zhao, Xia Yan, Qing Liu
PII: DOI: Reference:
www.elsevier.com/locate/jep
S0378-8741(16)32056-6 http://dx.doi.org/10.1016/j.jep.2017.03.053 JEP10802
To appear in: Journal of Ethnopharmacology Received date: 23 November 2016 Revised date: 24 March 2017 Accepted date: 31 March 2017 Cite this article as: Dawei Wang, Yuntao Liu, Guofu Zhong, Yuanyuan Wang, Tong Zhang, Zhen Zhao, Xia Yan and Qing Liu, Combination of Tanshinone IIA and Astragaloside IV in Attenuating Hypoxia-induced Cardiomyocytes Injury: Compatible But No Significant Advantage, Journal of Ethnopharmacology, http://dx.doi.org/10.1016/j.jep.2017.03.053 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Combination of Tanshinone IIA and Astragaloside IV in Attenuating Hypoxia-induced Cardiomyocytes Injury: Compatible But No Significant Advantage Dawei Wanga,b,c, Yuntao Liua,b,c, Guofu Zhonga, Yuanyuan Wanga, Tong Zhanga, Zhen Zhaoa, Xia Yana, and Qing Liua* a
The Second Clinical School of Medicine, Guangzhou University of Chinese Medicine,
Guangzhou b
Emergency Department, Guangdong Provincial Hospital of Chinese Medicine,
Guangzhou c
Guangdong Provincial Key Laboratory of Research on Emergency in TCM, Guangdong
Provincial Hospital of Chinese Medicine, Guangzhou 510405, China. *
Address correspondence and reprint requests to Qing Liu: The Second Clinical School
of Medicine, Guangzhou University of Chinese Medicine, Guangzhou 510405, China. [email protected]
1 / 36
Abstract Ethnopharmacological relevance Herbal medicines are widely used in Asia as therapeutic agents for cardiovascular diseases. However, the underlying mechanisms for their efficacy are still unclear, especially in their compatibilities. Aim of the study We aimed to investigate the compatibility of two herb-derived compounds, Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) in cardiomyocyte with hypoxia-induced injury. Materials and methods Cultured cardiomyocytes were stimulated in hypoxia condition, in the absence or presence of the two herbal compounds, TanIIA and AsIV. Indicators were determined by cytotoxicity assay, quantitative PCR, ELISA, flow cytometry assay, immunofluorescence staining and western blot. Results The herbal compounds inhibited hypoxia-triggered chemokine production, monocyte/ macrophage recruitment, cytokines production, and cell apoptosis induced by hypoxia rather than the overlap of hypoxia and TNF-α co-stimulation. As an anti-apoptotic factor, stress granule formation was further enhanced by the herbal compounds in hypoxia or heat shock stress, and stress-responsive MAPK pathways were inhibited while the
2 / 36
phosphorylation of Akt for cell survival was restored. Among the effects above, compatibility of these two compounds was found, but the significant advantage was hardly observed in the combination treatment of these two compounds compared to single compound treatment. Conclusions Taken together, these data suggest a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury. However, this study did not exclude more complex effects of herbal formula in treating cardiovascular diseases.
Graphic abstract
3 / 36
The herbal compounds Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) inhibited hypoxia-triggered chemokines and cytokines production, and cell apoptosis, while promoting the anti-apoptotic stress granules formation, which were associated with the inhibited stress-responsive MAPK pathways.
These data suggest a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury.
Key words Tanshinone IIA, Astragaloside IV, compatibility, hypoxia, cardiovascular disease.
4 / 36
Introduction Hypoxia-induced cardiomyocyte injury is an important process involved in myocardial ischemia and reperfusion (MIR) injury. Hypoxia is able to affect the extent of cell injury and cell death during acute and chronic myocardial ischemia and infarction, including the changes of important cell signaling mechanisms in regulation of chemokine and cytokine synthesis and production, mitochondrial function, and cell death via apoptosis and necrosis (Liu et al., 2013). It is well established that the innate immunocytes, including monocyte / macrophage, neutrophils, dendritic cells, are recruited by their corresponding chemokines and participate in the pathological process of MIR. Lymphocytes can either augment inflammatory injury responses, or participate in heart tissue remodeling, depending on the cell types and stages of injury (Linfert et al., 2009). Among them, monocyte / macrophage plays an essential role in mediating myocardial inflammatory injury in the early phase of myocardial infarction (Hofmann and Frantz, 2015). The inflammatory cytokines, e.g., tumor necrosis factor-alpha (TNF-α), are also important factors in the pathogenesis of cardiovascular injury in MIR. Synthesized cytokines can augment the inflammatory responses, either by autocrine or paracrine, and promote more inflammatory lymphocytes infiltration. Hypoxia-triggered cytokine production can also induce the cell injury via various cell signaling pathways such as mitogen-activated protein kinases (MAPK) pathway, exacerbating cell death via apoptosis or necrosis during MIR.
5 / 36
As a major adaptive defense mechanism, cytoplasmic stress granules (SG) are cytoplasmic multi-molecular aggregates of stalled translation complexes, preventing the accumulation of mis-folded proteins, and formed in response to certain types of stress including hypoxia or heat shock stress. SG assembly favors cell survival not only by suppressing translation but also by sequestering apoptosis regulatory factors, therefore SG becoming important actors in regulating cell death (Arimoto-Matsuzaki et al., 2016). The accumulation of SG can be evaluated by detecting the levels of G3BP, a marker of SG formation, in various methods (Arimoto et al., 2008; Humoud et al., 2016). Tanshinone IIA (TanIIA) is a bioactive compound isolated from the plant named Salvia miltiorrhiza Bunge (“Danshen” in Chinese), a traditional Chinese herb used for treating angina pectoris, atherosclerosis and myocardial infarction. TanIIA is reported to protect against hypoxia-induced cell apoptosis by regulating the mitochondrial apoptosis signaling pathway, and balancing anti- and pro-apoptotic proteins (Jin et al., 2013; Zhang et al., 2010). Astragaloside IV (AsIV), a bioactive compound extracted from the plant named Astragalus membranaceus (Fisch.) Bunge (“Huangqi” in Chinese), exerts antiinflammation, anti-apoptosis and anti-oxidation characteristics (Luo et al., 2004; Mei et al., 2015). Although these two herbs are main ingredients of clinical routine medicine, and they are always used together for the treatment of various diseases in animal models (Guan et al., 2015; Jian et al., 2016; Sheng et al., 2014; Xie et al., 2013), the underlying mechanisms for interpreting their protective effects are still unclear, especially why these two herbs can be used as a combination in protecting against cardiovascular disease.
6 / 36
Herein, we investigated the functional effects and the underlying mechanisms of TanIIA, AsIV and their combination to the hypoxia-induced cardiomyocytes injury. This study tried to provide a possibility for understanding the complex interactions of Chinese herbal medicines in treating cardiovascular diseases.
Materials and methods Herbal compounds, cell culture and hypoxia stimulation The two herbal compounds, Tanshinone IIA and Astragaloside IV, are both purchased as the commercial standard products. Tanshinone IIA (Dilger, Nanjing, China), Molecular formula: C19H18O3, Molecular weight: 294.34, CAS No.: 568-72-9, and the determination of content by HPLC is ≥ 98%. Astragaloside IV (King Tiger, Chengdu, China), Molecular formula: C41H68O14, Molecular weight: 784.97, CAS No.:83207-58-3, and the determination of content by HPLC is ≥ 98%.
The rat ventricular cardiomyocyte cell line, H9c2 (CRL1446, ATCC, Manassas, VA), was cultured in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen Life Technologies, Grand Island, NY) with 10% fetal bovine serum (FBS, Invitrogen) at 37 ℃ and 5% CO2. Hypoxia was induced as previously described (Liu et al., 2014). Briefly, expose cells to an incubator filled with 1% O2 / 94% N2 / 5% CO2 environment in serum-free low glucose DMEM for 16 h at most of the experiments. Primary rat peritoneal macrophage isolation and Transwell migration assay
7 / 36
Primary peritoneal macrophages were obtained from rat peritoneal cavity after 3 days stimulation of 5 ml 1% Thioglycollate. The collected cells were seeded in a 100 mm dish in 1640 with 10% FBS for 2 h and washed with PBS to remove unattached cells. The attached macrophages were then transferred to the inserts of a Transwell plate (Corning, Corning, NY) in serum-free 1640 medium, and the bottom rooms of Transwell plate were placed with supernatant from cultured H9c2 cells which had undergone hypoxia for 16 h in the absence or presence of indicated herbal compounds. Transmigration was allowed for 3 h. Then the inserts were taken out and fixed in 4% formaldehyde, followed by staining in 1 mg/mL 40,6-diamidino-2-phenylindole (DAPI) for 1 min and then for fluorescence microscopy analysis. Photos in each groups were taken and migrated cell amount in the obtained images was counted using the software Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD). Lactate dehydrogenase (LDH) assay LDH is normally retained in the cytosol until the sarcolemmal membrane is ruptured, which is free to diffuse into the surrounding medium. To determine the amount of cell injury induced by hypoxia or reoxygenation, both the culture medium and cell lysate were collected and immediately assayed for LDH activity using a LDH Cytotoxicity Detection Kit, according to the manufacturer’s instruction (Clontech, Mountain View, CA). Measurement was performed with a Spectra Max M5 Microplate Reader (Molecular Devices, Sunnyvale, CA) at Optical density (OD) 490 nm and a reference of 650 nm. Percent of cell viability was calculated as the ratio of LDH amount in the cell lysate to the total LDH amount from both the medium and cell lysate.
8 / 36
Quantitative polymerase chain reaction (qPCR) analysis Total RNA from cells was extracted and purified using TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Then reverse transcription for cDNA was generated with a prime script RT Master Mix (TaKaRa Bio Inc., Otsu, Japan). qPCR analysis was carried out using SYBR Green Gene Expression kit (Applied Biosystems, Foster City, CA) on Applied Biosystems 7500 (Thermo Fisher Scientific, Waltham, MA). The primers sequences (Life technology/Thermo Fisher Scientific, Rockford, IL) used in qPCR are listed in Table 1. Samples were amplified using the following program, 95 ℃ for 30 s followed by 45 cycles of 95 ℃ for 5 s, 60 ℃ for 34 s, then a melting curve analysis from 60 to 95 ℃ gradually. The abundance of each gene product was calculated by relative quantification, with values for the target genes normalized with the internal control 18S RNA. Enzyme linked immunosorbent assay (ELISA) Supernatant from cell culture was collected and determined by corresponding ELISA kits (TNF-α, RayBio tech, Atlanta, GA; CCL2 and IL-6, Sigma-Aldrich, St.Louis, MO), while the cell lysate was centrifuged to pellet cell debris before measurement. According to the manufacturer’s instructions, samples after reactions in 96-well micro-plates were read using an Infinite M200 pro Microplate Reader (Life Technologies, Grand Island, NY) at OD 450 nm, and the reference OD 570 nm. Western blot After quantitation of protein concentration by BCA assay (Pierce/Thermo Fisher 9 / 36
Scientific, Rockford, IL), equal total protein was loaded onto 10% Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels for electrophoresis. The size-separated proteins were then transferred to PVDF membranes. After block, primary antibodies against G3BP, Bax (Abcam, Cambridge, MA) and p-/t-ERK1/2, p-/t-p38, p-/tJNK, p-/t-Akt, GAPDH (Cell Signaling Technology, Beverly, MA) (1:2000) were incubated, followed by corresponding Horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling Technology, Beverly, MA). Signal of target proteins was detected with an ECL kit (Pierce/Thermo Fisher Scientific, Rockford, IL). The gray density of bands in the obtained images was quantified by the software Image-Pro Plus 6.0 for statistical analysis of the ratio of phosphorylated amount of molecule to the total amount, and the ratio of the control group was then normalized to 1 for comparison. Apoptosis staining and flow cytometry analysis FITC-labeled Annexin V and PE-labeled PI kit (RayBio tech, Atlanta, GA) for apoptosis and necrosis double staining were performed on the cultured cells, according to the manufacturer’s instructions. After staining, percent of the positive cells were analyzed on a CyAn machine (Beckman Coulter,Fullerton, CA), and the data analysis was performed using FlowJo software (Tree star, Ashland, OR). Immunofluorescence staining and confocal fluorescence microscopy analysis Cells were collected and fixed in 4% paraformaldehyde (PFA). After block, primary antibodies against G3BP (Abcam, Cambridge, MA) were incubated, followed by staining with corresponding secondary antibody (Life technology/Thermo Fisher Scientific,
10 / 36
Rockford, IL) and DAPI. Then series of photos were taken from each sample under a fluorescence microscopy, and quantified with the software Image-pro plus 6.0. Statistical analysis GraphPad Prism 5 software (GraphPad Software, SanDiego, CA) was used to carry out all statistical analysis. One-way ANOVA analysis of variance was used for multiple groups comparisons. If the data followed a Gaussian distribution, then Bonferroni’s multiple comparisons were used as a posttest. Otherwise, the nonparametric KruskalWallis test multiple comparison posttest was used to analyze the data. Regarding to two groups comparison, Student’s t-test was performed. A P value of less than 0.05 was considered as statistically significant.
11 / 36
Results Cytotoxicity of TanIIA and AsIV to cardiomyocytes in hypoxia Before investigating the roles of TanIIA, AsIV and the combination of these two herbal compounds in the pathological process of hypoxia injury, we detected the cytotoxicity of the herbal compounds to H9c2 cardiomyocytes in hypoxia, in order to find a suitable dose and treatment duration. Concentration course showed that single treatment with either TanIIA or AsIV did not significantly decrease the cell viability of cardiomyocytes in hypoxia (Figure 1A), while a marked decline was observed in the concentrations more than 10 µM TanIIA combined with 50 µM AsIV (Figure 1B). Time course detection showed that only when treatment for 32 h did the herbal compounds dramatically decrease cell viability (Figure 1C). Therefore, 10 µM TanIIA and 50 µM AsIV in 16 h of treatment was used in the following experiments. For an overview of the role of the herbal compounds to cardiomyocytes in hypoxia, LDH-indicated cell injury was determined. As hypoxia induced significant LDH release from the injured cardiomyocytes, AsIV or the combination of TanIIA and AsIV both showed a statistical effect in attenuating LDH release (Figure 1E). However, single TanIIA treatment did not show significant attenuation, and there was no significant difference between single AsIV treatment and the combined treatment of these two compounds (Figure 1E). TanIIA and AsIV inhibited hypoxia-induced chemokines production
12 / 36
Recruitment of numerous inflammatory cells infiltration to the injured heart tissues is a typical phenomenon in hypoxia indicated ischemic myocardial injury (Sager et al., 2016). To test whether the herbal compounds could reduce inflammatory infiltrates, critical chemokines in the hypoxia-induced myocardial injury were detected by qPCR. As hypoxia upregulated most of the chemokines, including the monocyte / macrophage chemokines CCL2 and CCL5, the neutrophils chemokines CXCL2 but not CXCL1, and the dendritic cells chemokines CCL19 but not CCL21, either single TanIIA or the combination of TanIIA and AsIV obviously downregulated these pro-inflammatory chemokines. However, single AsIV treatment did not show significant inhibition, and there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 2A). Among these chemokines, CCL2, the major one for monocytic lineage was extremely downregulated in mRNA levels, which evoked a further investigation on the changes of its protein levels. ELISA result showed a similar attenuation of these herbal compounds to hypoxia-provoked CCL2 accumulation (Figure 2B). With the supernatant of cell culture from Figure 2B and a classical Transwell assay, in which primary peritoneal macrophages were added in the inserts of Transwell plate, the transmigrated macrophages were significantly increased in hypoxia model group, and this increase was clearly reversed in the groups added TanIIA and the combined two compounds. However, there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 2C-D). TanIIA and AsIV inhibited hypoxia-induced cytokine production
13 / 36
Besides of recruiting inflammatory infiltrates to the injured tissue area, hypoxia also triggers cytokines release from cardiomyocytes, which will further aggravate the local inflammation and produce a vicious cycle for infiltrates recruitment. Hence we detected whether the herbal compounds could inhibit cytokines production from hypoxiastimulated cardiomyocytes. qPCR results showed that TNF-α, IL-6 but not IL-1β, major cytokines involved in myocardial ischemia injury, were both significantly increased after 16h stimulation of hypoxia, followed by distinct decrease with the single TanIIA treatment and the combined two compounds treatment. However, there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 3A). Based on the obvious suppression on TNF-α, the effects of the herbal compounds were further detected by ELISA in the protein levels. Distinct from the unchanged levels in cell lysates, TNF-α in the supernatant of cell culture was dramatically elevated and then being partially decreased in the herbal compounds treatment, same as the mRNA changes (Figure 3B). As TNF-α was reported to enhance inflammation and promote cell death in ischemia, the inhibition to TNF-α production by the herbal compounds enabled us to detect their overall protective effect to hypoxia-injured cardiomyocytes. From the LDH assay, TNF-α exacerbated hypoxia-induced LDH release from cardiomyocytes. Nevertheless, only the treatment with single TanIIA clearly attenuated LDH release, while the single AsIV treatment and the combined herbal compounds did not appear significant effect (Figure 3C). TanIIA and AsIV inhibited hypoxia- rather than TNF-induced cell apoptosis
14 / 36
As one of the endpoints of hypoxia-injured cardiomyocytes is cell death, including apoptosis and necrosis, so we tried to test whether the herbal compounds could also exert a direct protective effect on hypoxia-induced cell death of cardiomyocytes. With the Annexin V-PI double staining assay, we found an evident accumulation of Annexin V+ apoptotic cells in hypoxia, while this increase was attenuated in the single AsIV treatment and the combined two compounds. However, this attenuation was not observed in single TanIIA treatment, and no significant effect appeared in affecting the PI+ necrotic cells (Figure 4A-B). TNF-α was previously reported to induce cell apoptosis of cardiomyocytes, and we found the herbal compounds could inhibit TNF-α production. Thus we speculated that the herbal compounds may also suppress TNF-α-exacerbated cell apoptosis in hypoxia condition. Subsequently, concentration course of TNF-α was detected overlap the hypoxia condition, and 20 ng/ml TNF-α exhibited a statistical exacerbation for apoptosis induction (Supplemental Figure A). Unexpectedly, the suppression of herbal compounds to hypoxia and TNF-a co-stimulated cell apoptosis was not statistically significant, while single TanIIA treatment showed a marked suppression on hypoxia and TNF-a costimulated cell necrosis (Supplemental Figure B). These data above suggested that the herbal compounds may mainly suppress hypoxia-induced apoptosis, but there was no significant advantage of the combined treatment of these two compounds compared to the single AsIV treatment. Further investigation on the apoptosis associated genes expression revealed that Bax was upregulated by hypoxia and Bcl-2 was downregulated, while the herbal compounds could
15 / 36
significantly restore these changes in Bax but not in each group of Bcl-2 (Figure 4C). Changes of the ratio of Bax/Bcl-2 confirmed the anti-apoptotic effect of the herbal compounds in hypoxia condition (Figure 4C). Consistently, change of protein levels of Bax was shown in Western blot assay, which was similar to the trend of mRNA changes (Figure 4D). TanIIA and AsIV enhanced hypoxia-induced stress granules formation Formation of stress granules (SG) is reported to inhibit hypoxia-induced apoptosis (Arimoto et al., 2008), which suggests a possible explanation to why the herbal compounds could attenuate hypoxia-induced cardiomyocyte apoptosis. With the fluorescence staining of a stress granule component named G3BP, it was found that hypoxia-induced SG assembly was further enhanced in the presence of single AsIV treatment and the combined two compounds. However, there was no significant advantage of the combined treatment of these two compounds compared to the single AsIV treatment (Figure 5A-B). To validate these confocal images results, we examined the protein levels of G3BP in hypoxia-stimulated cardiomyocytes without or with indicated herbal compounds by Western blot. Data showed that AsIV further enhanced hypoxia-induced G3BP expression most significantly, which is consistent with the fluorescent image results (Figure 5C). To confirm the enhancement of the herbal compounds to SG formation, another stress model, the heat shock stress was performed later. Time course test showed heat shock stress-induced stress granules formation in H9c2 cells peaked around 1 h (Data not shown). As shown in the statistical results of SG assembly in fluorescence staining, heat 16 / 36
shock stress obviously induced SG formation, which was also further enhanced by the single AsIV treatment and the combined two compounds (Figure 5D), and western blot of the G3BP expression showed consistent changes, in which the combination of these herbal compounds showed better effect (Figure 5E). TanIIA and AsIV downregulated stress-responsive MAPK pathways Stress-responsive MAPK pathways, especially p38 and JNK, were known to be inhibited in stress granules formation and hypoxia-induced inflammatory process (Arimoto et al., 2008), and Akt was involved in the regulation of cell growth and cell death. Hence these cell signaling pathways were detected by Western blot, and we can find the phosphorylation levels of ERK1/2, p38 and JNK were all induced by hypoxia. However, only p-ERK1/2 was then being significantly inhibited by either the single herbal compound treatment or the combined treatments, compared to its total protein levels (Figure 6A-B). For p-p38, single TanIIA did not show significant inhibition, and for pJNK, the combined compounds did not show advantage compared to either of the single compound treatment (Figure 6A-B). In contrast, phosphorylation of Akt was just mildly suppressed by hypoxia and then restored by the herbal compounds (Figure 6A-B).
17 / 36
Discussion Myocardial ischemia occurs when blood flow to heart is pathologically reduced, preventing the heart from receiving enough oxygen and nutrition. In this study, we investigated the roles and mechanisms of two herbal medicine in modulating hypoxiainduced injury to cardiomyocytes, and concluded that either TanIIA or AsIV, or their combination could inhibit hypoxia-induced chemokine and cytokine production, cell apoptosis and promote the stress granules formation, and the hypoxia-associated stressresponsive MAPK pathways. However, the significant advantage of the combination treatment of TanIIA and AsIV was hardly observed in protecting cardiomyocyte against hypoxia-induced injury. To distinguish the cytotoxicity and efficacy effects of the herbal compounds, a suitable dose and time point was screened based on the cardiomyocte viability in hypoxia condition. LDH release, which reflects the cell injury, was then tested and found an overview protective role of the herbal compounds. At the initiation phase of ischemia, chemokines have already been triggered to be released from the stimulated cardiomyocytes and other tissue resident cells of heart, which results in the subsequent influx of inflammatory lymphocytes infiltration (Xia and Frangogiannis, 2007). We found that the herbal compounds could attenuate the chemokines responsible for recruiting monocyte / macrophages, neutrophils and dendritic cells, which was further confirmed by the transmigration assay.
18 / 36
For the roles on cytokine production, both TNF-α and IL-6 were found to be suppressed by the herbal compounds, although IL-1β did not show a statistical significance. TNF-α is a well-known inflammatory cytokine, which is important in mediating the pathogenesis of cardiovascular injury, and previous studies have shown that TNF-α production was elevated after exposure to hypoxia in H9c2 cardiomyocytes and in the plasma of patients with acute myocardial infarction (AMI) (Wu et al., 2013). Based on the obvious inhibition on TNF-α expression and production, and previous report that TNF-α could also induce cell death including via apoptosis (Zhao et al., 2015), subsequent LDH assay and apoptosis analysis were performed to further investigate the effect of herbal compounds on hypoxia-injured cardiomyocytes. As the flow cytometry analysis shows, hypoxia-induced apoptosis was suppressed by herbal compounds, however, when TNF-α was co-stimulated with hypoxia to cardiomyocytes, the protective effect of these herbal compounds did not appear on cell apoptosis. These data suggest that the protective role of herbal compounds depends on the extent of stimulation, during which severe stress may overload the protective efficacy of herbal compounds. In response to stress such as hypoxia, cells can stall translation by storing mRNAs in cellular compartments and formed stress granules (SG), working as a defense mechanism to benefit cell survival and inhibit stress-induced cell apoptosis (Humoud et al., 2016). As we speculated whether the mechanism for herbal compounds to inhibit apoptosis was via promoting SG assembly, the following experiment showed that the herbal compounds enhanced hypoxia-triggered SG assembly, especially AsIV. This result is consistent with another plant-derived compound, Vinca alkaloids, on promoting SG formation (Szaflarski et al., 2016). To validate this phenomenon, another common stress for 19 / 36
inducing SG formation was also tested, expectedly, the herbal compounds can also enhance heat shock stress-induced SG assembly, which suggest that the promoted SG formation may be partially benefits the myocardial protective effect of herbal compounds. As the MAPK pathway, including ERK, JNK and p38, is classically involved in myocardial ischemia and reperfusion injury (Zhang et al., 2015), meanwhile, it is reported that stress-responsive MAPK could be inhibited by SG formation (Arimoto et al., 2008), we next tested the changes of MAPK in hypoxia-stimulated cardiomyocytes with the treatment of herbal compounds. Our results showed that MAPK pathways were suppressed while the phosphorylation of Akt, which benefits cell survival in stress, was just mildly restored by the herbal compounds. Taken these data together, in this work, the herbal compounds TanIIA and AsIV were found to be partially effective in protecting cardiomyocytes against hypoxia-induced cell injury, and the combination of these two compounds showed a compatibility. However, the advantage of the combined two compounds was hardly observed, which indicates a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury. Nevertheless, this study did not exclude more complex effects of herbal formula in treating cardiovascular diseases, and in vivo studies need to be performed for further investigation, especially for the herbal formula treatment.
20 / 36
Author contributions Q.L., D.W. and X.Y. designed this study, D.W., Y.W., T.Z., G.Z., Z.Z. performed experimental detection, Y.L. collected data and finished statistical analysis, Q.L. wrote the manuscript, and all authors have read and revised the manuscript critically.
Conflict of interest The authors declared no conflict of interest.
Acknowledgements This work is supported by Natural Science Foundation of Guangdong Province (No. 2015A030313368 to D.W.) and Guangzhou Municipal Science and Technology Program (No. 201607010337, to X.Y.).
21 / 36
References Arimoto-Matsuzaki, K., Saito, H., Takekawa, M., 2016. TIA1 oxidation inhibits stress granule assembly and sensitizes cells to stress-induced apoptosis. Nature communications 7, 10252. Arimoto, K., Fukuda, H., Imajoh-Ohmi, S., Saito, H., Takekawa, M., 2008. Formation of stress granules inhibits apoptosis by suppressing stress-responsive MAPK pathways. Nature cell biology 10, 1324-1332. Guan, F.Y., Yang, S.J., Liu, J., Yang, S.R., 2015. Effect of astragaloside IV against rat myocardial cell apoptosis induced by oxidative stress via mitochondrial ATP-sensitive potassium channels. Molecular medicine reports 12, 371-376. Hofmann, U., Frantz, S., 2015. Role of lymphocytes in myocardial injury, healing, and remodeling after myocardial infarction. Circulation research 116, 354-367. Humoud, M.N., Doyle, N., Royall, E., Willcocks, M.M., Sorgeloos, F., van Kuppeveld, F., Roberts, L.O., Goodfellow, I.G., Langereis, M.A., Locker, N., 2016. Feline Calicivirus Infection Disrupts Assembly of Cytoplasmic Stress Granules and Induces G3BP1 Cleavage. Journal of virology 90, 6489-6501. Jian, W., Yu, S., Tang, M., Duan, H., Huang, J., 2016. A combination of the main constituents of Fufang Xueshuantong Capsules shows protective effects against streptozotocin-induced retinal lesions in rats. Journal of ethnopharmacology 182, 50-56. Jin, H.J., Xie, X.L., Ye, J.M., Li, C.G., 2013. TanshinoneIIA and cryptotanshinone protect against hypoxia-induced mitochondrial apoptosis in H9c2 cells. PloS one 8, e51720. Linfert, D., Chowdhry, T., Rabb, H., 2009. Lymphocytes and ischemia-reperfusion injury. Transplantation reviews 23, 1-10. Liu, B., Che, W., Xue, J., Zheng, C., Tang, K., Zhang, J., Wen, J., Xu, Y., 2013. SIRT4 prevents hypoxia-induced apoptosis in H9c2 cardiomyoblast cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 32, 655-662. Liu, Q., Wang, J., Liang, Q., Wang, D., Luo, Y., Li, J., Janicki, J.S., Fan, D., 2014. Sparstolonin B attenuates hypoxia-reoxygenation-induced cardiomyocyte inflammation. Experimental biology and medicine 239, 376-384. Luo, Y., Qin, Z., Hong, Z., Zhang, X., Ding, D., Fu, J.H., Zhang, W.D., Chen, J., 2004. Astragaloside IV protects against ischemic brain injury in a murine model of transient focal ischemia. Neuroscience letters 363, 218-223. 22 / 36
Mei, M., Tang, F., Lu, M., He, X., Wang, H., Hou, X., Hu, J., Xu, C., Han, R., 2015. Astragaloside IV attenuates apoptosis of hypertrophic cardiomyocyte through inhibiting oxidative stress and calpain-1 activation. Environmental toxicology and pharmacology 40, 764-773. Sager, H.B., Hulsmans, M., Lavine, K.J., Beltrami Moreira, M.B., Heidt, T., Courties, G., Sun, Y., Iwamoto, Y., Tricot, B., Khan, O.F., Dahlman, J.E., Borodovsky, A., Fitzgerald, K., Anderson, D.G., Weissleder, R., Libby, P., Swirski, F.K., Nahrendorf, M., 2016. Proliferation and Recruitment Contribute to Myocardial Macrophage Expansion in Chronic Heart Failure. Circulation research. Sheng, S., Wang, J., Wang, L., Liu, H., Li, P., Liu, M., Long, C., Xie, C., Xie, X., Su, W., 2014. Network pharmacology analyses of the antithrombotic pharmacological mechanism of Fufang Xueshuantong Capsule with experimental support using disseminated intravascular coagulation rats. Journal of ethnopharmacology 154, 735-744. Szaflarski, W., Fay, M.M., Kedersha, N., Zabel, M., Anderson, P., Ivanov, P., 2016. Vinca alkaloid drugs promote stress-induced translational repression and stress granule formation. Oncotarget. Wu, W.Y., Wang, W.Y., Ma, Y.L., Yan, H., Wang, X.B., Qin, Y.L., Su, M., Chen, T., Wang, Y.P., 2013. Sodium tanshinone IIA silate inhibits oxygen-glucose deprivation/recoveryinduced cardiomyocyte apoptosis via suppression of the NF-kappaB/TNF-alpha pathway. British journal of pharmacology 169, 1058-1071. Xia, Y., Frangogiannis, N.G., 2007. MCP-1/CCL2 as a therapeutic target in myocardial infarction and ischemic cardiomyopathy. Inflammation & allergy drug targets 6, 101-107. Xie, J., Wang, H., Song, T., Wang, Z., Li, F., Ma, J., Chen, J., Nan, Y., Yi, H., Wang, W., 2013. Tanshinone IIA and astragaloside IV promote the migration of mesenchymal stem cells by up-regulation of CXCR4. Protoplasma 250, 521-530. Zhang, Y., Liao, H., Zhong, S., Gao, F., Chen, Y., Huang, Z., Lu, S., Sun, T., Wang, B., Li, W., Xu, H., Zheng, F., Shi, G., 2015. Effect of N-n-butyl haloperidol iodide on ROS/JNK/Egr-1 signaling in H9c2 cells after hypoxia/reoxygenation. Scientific reports 5, 11809. Zhang, Y., Wei, L., Sun, D., Cao, F., Gao, H., Zhao, L., Du, J., Li, Y., Wang, H., 2010. Tanshinone IIA pretreatment protects myocardium against ischaemia/reperfusion injury through the phosphatidylinositol 3-kinase/Akt-dependent pathway in diabetic rats. Diabetes, obesity & metabolism 12, 316-322. Zhao, M., Yang, Y., Bi, X., Yu, X., Jia, H., Fang, H., Zang, W., 2015. Acetylcholine Attenuated TNF-alpha-Induced Apoptosis in H9c2 Cells: Role of Calpain and the p38-
23 / 36
MAPK Pathway. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 36, 1877-1889.
24 / 36
Table 1. Primers used in qPCR assay.
Primers Forward (5’--3’)
Reverse (3’--5’)
(rat)
18S
TGAGGCCATGATTAAGAGGG
AGTCGGCATCGTTTATGGTC
CCAATGAGTCGGCTGGAGAAC CCL2
AGTGCTTGAGGTGGTTGTGGAA T
CCL5
GGAGATGAGCTAGAATAGAGG
CATAGGAGAGGACACAGTTAT
CXCL1
GTGTGAGAGGCTATGTTGT
CGAGAAGGAGCATTGGTTA
CXCL2
TGTTCAATGTGTTCAGTCAG
GGAGGTGGTGTAGTCAGT
CCL19
CTCTCAGGCTCATTCATTCT
CAGTCTTCCGCATCGTTA
CCL21
CTTGGTCCTGGTTCTCTG
CGGTTCTTGCTTCCTGTA
TNF-α
TGGCGTGTTCATCCGTTCTC
ACTACTTCAGCGTCTCGTGTG
IL-6
CGGAGAGGAGACTTCACA
GCATCATCGCTGTTCATAC
25 / 36
IL-1β
GACAGAACATAAGCCAACAA
ACACAGGACAGGTATAGATTC
Bax
GACGCATCCACCAAGAAG
TCTGTATCCACATCAGCAATC
Bcl-2
CCTGGCATCTTCTCCTTC
GCTGACTGGACATCTCTG
26 / 36
Figure 1 Cytotoxicity of Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) to cardiomyocytes in hypoxia. Cytotoxicity of TanIIA or AsIV (A.), and the combination of these two herbal compounds (B.) at indicated concentrations, was detected on H9c2 cells in normoxia control or hypoxia (1% O2) treatment for 24h by LDH assay. C. Time course (0 to 32 h) of the cytotoxicity of TanIIA or AsIV, and the combination of these two herbal compounds to H9c2 cells in normoxia control or hypoxia. D. Effect of TanIIA or AsIV, and the combination of these two herbal compounds, to attenuate hypoxiainduced cell injury was detected in the supernatant of cell culture by LDH assay. Data above are presented as mean ± SEM, n=3, *P<0.05 vs normoxia group, #P<0.05 vs hypoxia without compound group. Figure 2 TanIIA and AsIV inhibited hypoxia-induced chemokines production. A. qPCR results of the changes of chemokines mRNA levels, detected in H9c2 induced by hypoxia in the absence or presence of indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h. The ratio of target genes expression to 18S RNA expression in normoxia was normalized as 1. B. H9c2 was treated by indicated herbal compounds in hypoxia for 16h, and the protein levels of CCL2 in the supernatant of cell culture were determined by ELISA. C. Supernatant from each group in (B.) was collected and added into the bottom rooms of Transwell plate, peritoneal macrophages from rat was collected and added into the inserts of Transwell plate equally. Cells were allowed for migration for 3 h, and the representative images were obtained (C., scale bar indicated 100 μm) and for statistical analysis (D). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups.
27 / 36
Figure 3. TanIIA and AsIV inhibited hypoxia-induced cytokines production. A. qPCR results of the changes of cytokines mRNA levels, detected in H9c2 induced by hypoxia in the absence or presence of indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h. The ratio of target genes expression to 18S RNA expression in normoxia was normalized as 1. B. Supernatant and cell lysate treated the same as (A.) was collected, and the protein levels of TNF-α were determined by ELISA. C. H9c2 cells stimulated in hypoxia with or without TNF-α (20 ng/ml), were simultaneously treated with the indicated herbal compounds for 16 h. Cell injury was measured by LDH assay. Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 4. TanIIA and AsIV inhibited hypoxia- rather than TNF-induced cell apoptosis. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h. Cell apoptosis was examined by FITC-labeled Annexin V and PE-labeled PI staining (A.), then percent of apoptotic cells and necrotic cells were calculated (B.). C. qPCR results of the changes of Bax, Bcl-2 mRNA levels in the same condition as (A.), and the ratio of Bax to Bcl-2 was calculated. D. Western blot result of Bax changes in the same condition as (A.). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 5. TanIIA and AsIV enhanced hypoxia-induced stress granules formation. A. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h, then fixed and stained with G3BP (indicates stress granules formation) and DAPI (indicates nuclei) for confocal fluorescent microscopy analysis. Representative images were shown and the scale bar indicated 50 μm. The percent of
28 / 36
G3BP positive cells were calculated for statistical analysis (B.). Cell lysate in the same condition as (A.) were collected, and the protein levels of G3BP and GAPDH were examined by Western blot. D. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h, and then stimulated with heat shock stress (42 ⁰C) for another 1h. Cells were stained with G3BP and DAPI for calculating the percent of stress granules positive cells. E. Western blot showed the changes of protein levels of G3BP and GAPDH in the condition of (D.). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 6. TanIIA and AsIV downregulated stress-responsive MAPK pathways. A. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h, then both of the phosphorylation levels and total levels of ERK1/2, p38, JNK and Akt in cell lysate were examined by Western blot. Representative images were shown in (A.) and the corresponding statistical analysis data were given in (B.). Data are presented as mean ± SEM, n=3, *P<0.05 between indicated groups.
29 / 36
30 / 36
Figure 2 CXCL1
CCL2
**
8
**
**
10
**
6 4 2 0 Normoxia Medium TanIIA
*
8 6 4 2 0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
3
1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
3 2 1
AsIV Tan+As
Hypoxia
B
CCL21
*
2.5
2
1
0 Normoxia Medium TanIIA
2.0 1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
C
D
***
*
Transwell 160
*** Migrated cell number (per 10X photo)
Concentration (pg/ml)
15000
***
AsIV Tan+As
Hypoxia
CCL2 20000
AsIV Tan+As
Hypoxia
Folds of change
*
4
0 Normoxia Medium TanIIA
1.5
CXCL2
*
*
Folds of change
Folds of change
*
**
*
2.0
Hypoxia
CCL5 5
CCL19 2.5
* Folds of change
Folds of change
10
Folds of change
A
10000 5000 0 Normoxia Medium TanIIA
**
*
***
120 80 40 0 Normoxia Medium TanIIA
AsIV Tan+As
AsIV Tan+As
Hypoxia
Hypoxia
31 / 36
Figure 3 A IL-6
TNF-
2 1
1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
1.0 0.5
C
AsIV Tan+As
Hypoxia
600 400 200
***
4
**
*
3 2 1 0
0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
TN TN F FTa nI IA TN FA sI TN V FTa nA s
0
5
ox ia
50
LDH
800
ed iu m
100
AsIV Tan+As
Hypoxia
Relative LDH release
Concentration in cell lysate (pg/ml)
Concentration in supernatant (pg/ml)
** ***
Normoxia Medium TanIIA
1.5
0.0 Normoxia Medium TanIIA
AsIV Tan+As
TNF-
TNF- 200
***
2.0
Hypoxia
Hypoxia
150
*
*
M
0 Normoxia Medium TanIIA
1.5
Folds of change
*
3
B
2.5
or m
**
IL-1
2.0
*
N
*
Folds of change
Folds of change
4
Hypoxia + TNF- + Tan IIA / As IV (M)
32 / 36
Figure 4
2.16%
Annexin V+ apoptotic cells
B
Hypoxia
Percentage in Total cells (%)
A
Normoxia
4.18%
7.94%
14.5%
25
**
20
* *
15 10 5 0
PI
Normoxia Medium TanIIA
Hypoxia-TanIIA
Hypoxia-AsIV
AsIV Tan+As
Hypoxia
Hypoxia-Tan-As
PI+ necrotic cells 3.78%
12.2%
4.58%
9.16%
Percentage in Total cells (% )
4.88%
8.22%
Annexin V
8 6 4 2 0 Normoxia Medium TanIIA
AsIV
Tan+As
Hypoxia
C Bax
**
*
1
0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
2.0
6
*
*
*
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
D
Bax/Bcl-2
Bcl-2 2.5
*
Ratio of Bax/Bcl-2
2
*
Folds of change
Folds of change
3
4
***
*** *** ***
20 kD
2
37 kD
0 AsIV
Tan+As
Normoxia Medium TanIIA
Hypoxia
AsIV Tan+As
Hypoxia
33 / 36
34 / 36
35 / 36
Figure 6 B 44 kD 42 kD
2.5
p-ERK/t-ERK
A
**
**
***
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
44 kD 42 kD
2.5
p-p38/t-p38
*
***
*
1.5 1.0 0.5
40 kD
0.0 Normoxia Medium TanIIA
54 kD 2.5 2.0
p-JNK/t-JNK
46 kD
AsIV Tan+As
Hypoxia
46 kD 54 kD
AsIV Tan+As
Hypoxia
2.0
43 kD
*
2.0
*
*
*
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
60 kD
AsIV Tan+As
Hypoxia 1.5
37 kD
p-Akt/t-Akt
60 kD 1.0
0.5
0.0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
36 / 36
PII: DOI: Reference:
www.elsevier.com/locate/jep
S0378-8741(16)32056-6 http://dx.doi.org/10.1016/j.jep.2017.03.053 JEP10802
To appear in: Journal of Ethnopharmacology Received date: 23 November 2016 Revised date: 24 March 2017 Accepted date: 31 March 2017 Cite this article as: Dawei Wang, Yuntao Liu, Guofu Zhong, Yuanyuan Wang, Tong Zhang, Zhen Zhao, Xia Yan and Qing Liu, Combination of Tanshinone IIA and Astragaloside IV in Attenuating Hypoxia-induced Cardiomyocytes Injury: Compatible But No Significant Advantage, Journal of Ethnopharmacology, http://dx.doi.org/10.1016/j.jep.2017.03.053 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Combination of Tanshinone IIA and Astragaloside IV in Attenuating Hypoxia-induced Cardiomyocytes Injury: Compatible But No Significant Advantage Dawei Wanga,b,c, Yuntao Liua,b,c, Guofu Zhonga, Yuanyuan Wanga, Tong Zhanga, Zhen Zhaoa, Xia Yana, and Qing Liua* a
The Second Clinical School of Medicine, Guangzhou University of Chinese Medicine,
Guangzhou b
Emergency Department, Guangdong Provincial Hospital of Chinese Medicine,
Guangzhou c
Guangdong Provincial Key Laboratory of Research on Emergency in TCM, Guangdong
Provincial Hospital of Chinese Medicine, Guangzhou 510405, China. *
Address correspondence and reprint requests to Qing Liu: The Second Clinical School
of Medicine, Guangzhou University of Chinese Medicine, Guangzhou 510405, China. [email protected]
1 / 36
Abstract Ethnopharmacological relevance Herbal medicines are widely used in Asia as therapeutic agents for cardiovascular diseases. However, the underlying mechanisms for their efficacy are still unclear, especially in their compatibilities. Aim of the study We aimed to investigate the compatibility of two herb-derived compounds, Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) in cardiomyocyte with hypoxia-induced injury. Materials and methods Cultured cardiomyocytes were stimulated in hypoxia condition, in the absence or presence of the two herbal compounds, TanIIA and AsIV. Indicators were determined by cytotoxicity assay, quantitative PCR, ELISA, flow cytometry assay, immunofluorescence staining and western blot. Results The herbal compounds inhibited hypoxia-triggered chemokine production, monocyte/ macrophage recruitment, cytokines production, and cell apoptosis induced by hypoxia rather than the overlap of hypoxia and TNF-α co-stimulation. As an anti-apoptotic factor, stress granule formation was further enhanced by the herbal compounds in hypoxia or heat shock stress, and stress-responsive MAPK pathways were inhibited while the
2 / 36
phosphorylation of Akt for cell survival was restored. Among the effects above, compatibility of these two compounds was found, but the significant advantage was hardly observed in the combination treatment of these two compounds compared to single compound treatment. Conclusions Taken together, these data suggest a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury. However, this study did not exclude more complex effects of herbal formula in treating cardiovascular diseases.
Graphic abstract
3 / 36
The herbal compounds Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) inhibited hypoxia-triggered chemokines and cytokines production, and cell apoptosis, while promoting the anti-apoptotic stress granules formation, which were associated with the inhibited stress-responsive MAPK pathways.
These data suggest a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury.
Key words Tanshinone IIA, Astragaloside IV, compatibility, hypoxia, cardiovascular disease.
4 / 36
Introduction Hypoxia-induced cardiomyocyte injury is an important process involved in myocardial ischemia and reperfusion (MIR) injury. Hypoxia is able to affect the extent of cell injury and cell death during acute and chronic myocardial ischemia and infarction, including the changes of important cell signaling mechanisms in regulation of chemokine and cytokine synthesis and production, mitochondrial function, and cell death via apoptosis and necrosis (Liu et al., 2013). It is well established that the innate immunocytes, including monocyte / macrophage, neutrophils, dendritic cells, are recruited by their corresponding chemokines and participate in the pathological process of MIR. Lymphocytes can either augment inflammatory injury responses, or participate in heart tissue remodeling, depending on the cell types and stages of injury (Linfert et al., 2009). Among them, monocyte / macrophage plays an essential role in mediating myocardial inflammatory injury in the early phase of myocardial infarction (Hofmann and Frantz, 2015). The inflammatory cytokines, e.g., tumor necrosis factor-alpha (TNF-α), are also important factors in the pathogenesis of cardiovascular injury in MIR. Synthesized cytokines can augment the inflammatory responses, either by autocrine or paracrine, and promote more inflammatory lymphocytes infiltration. Hypoxia-triggered cytokine production can also induce the cell injury via various cell signaling pathways such as mitogen-activated protein kinases (MAPK) pathway, exacerbating cell death via apoptosis or necrosis during MIR.
5 / 36
As a major adaptive defense mechanism, cytoplasmic stress granules (SG) are cytoplasmic multi-molecular aggregates of stalled translation complexes, preventing the accumulation of mis-folded proteins, and formed in response to certain types of stress including hypoxia or heat shock stress. SG assembly favors cell survival not only by suppressing translation but also by sequestering apoptosis regulatory factors, therefore SG becoming important actors in regulating cell death (Arimoto-Matsuzaki et al., 2016). The accumulation of SG can be evaluated by detecting the levels of G3BP, a marker of SG formation, in various methods (Arimoto et al., 2008; Humoud et al., 2016). Tanshinone IIA (TanIIA) is a bioactive compound isolated from the plant named Salvia miltiorrhiza Bunge (“Danshen” in Chinese), a traditional Chinese herb used for treating angina pectoris, atherosclerosis and myocardial infarction. TanIIA is reported to protect against hypoxia-induced cell apoptosis by regulating the mitochondrial apoptosis signaling pathway, and balancing anti- and pro-apoptotic proteins (Jin et al., 2013; Zhang et al., 2010). Astragaloside IV (AsIV), a bioactive compound extracted from the plant named Astragalus membranaceus (Fisch.) Bunge (“Huangqi” in Chinese), exerts antiinflammation, anti-apoptosis and anti-oxidation characteristics (Luo et al., 2004; Mei et al., 2015). Although these two herbs are main ingredients of clinical routine medicine, and they are always used together for the treatment of various diseases in animal models (Guan et al., 2015; Jian et al., 2016; Sheng et al., 2014; Xie et al., 2013), the underlying mechanisms for interpreting their protective effects are still unclear, especially why these two herbs can be used as a combination in protecting against cardiovascular disease.
6 / 36
Herein, we investigated the functional effects and the underlying mechanisms of TanIIA, AsIV and their combination to the hypoxia-induced cardiomyocytes injury. This study tried to provide a possibility for understanding the complex interactions of Chinese herbal medicines in treating cardiovascular diseases.
Materials and methods Herbal compounds, cell culture and hypoxia stimulation The two herbal compounds, Tanshinone IIA and Astragaloside IV, are both purchased as the commercial standard products. Tanshinone IIA (Dilger, Nanjing, China), Molecular formula: C19H18O3, Molecular weight: 294.34, CAS No.: 568-72-9, and the determination of content by HPLC is ≥ 98%. Astragaloside IV (King Tiger, Chengdu, China), Molecular formula: C41H68O14, Molecular weight: 784.97, CAS No.:83207-58-3, and the determination of content by HPLC is ≥ 98%.
The rat ventricular cardiomyocyte cell line, H9c2 (CRL1446, ATCC, Manassas, VA), was cultured in Dulbecco’s Modified Eagle Medium (DMEM, Invitrogen Life Technologies, Grand Island, NY) with 10% fetal bovine serum (FBS, Invitrogen) at 37 ℃ and 5% CO2. Hypoxia was induced as previously described (Liu et al., 2014). Briefly, expose cells to an incubator filled with 1% O2 / 94% N2 / 5% CO2 environment in serum-free low glucose DMEM for 16 h at most of the experiments. Primary rat peritoneal macrophage isolation and Transwell migration assay
7 / 36
Primary peritoneal macrophages were obtained from rat peritoneal cavity after 3 days stimulation of 5 ml 1% Thioglycollate. The collected cells were seeded in a 100 mm dish in 1640 with 10% FBS for 2 h and washed with PBS to remove unattached cells. The attached macrophages were then transferred to the inserts of a Transwell plate (Corning, Corning, NY) in serum-free 1640 medium, and the bottom rooms of Transwell plate were placed with supernatant from cultured H9c2 cells which had undergone hypoxia for 16 h in the absence or presence of indicated herbal compounds. Transmigration was allowed for 3 h. Then the inserts were taken out and fixed in 4% formaldehyde, followed by staining in 1 mg/mL 40,6-diamidino-2-phenylindole (DAPI) for 1 min and then for fluorescence microscopy analysis. Photos in each groups were taken and migrated cell amount in the obtained images was counted using the software Image-Pro Plus 6.0 (Media Cybernetics, Rockville, MD). Lactate dehydrogenase (LDH) assay LDH is normally retained in the cytosol until the sarcolemmal membrane is ruptured, which is free to diffuse into the surrounding medium. To determine the amount of cell injury induced by hypoxia or reoxygenation, both the culture medium and cell lysate were collected and immediately assayed for LDH activity using a LDH Cytotoxicity Detection Kit, according to the manufacturer’s instruction (Clontech, Mountain View, CA). Measurement was performed with a Spectra Max M5 Microplate Reader (Molecular Devices, Sunnyvale, CA) at Optical density (OD) 490 nm and a reference of 650 nm. Percent of cell viability was calculated as the ratio of LDH amount in the cell lysate to the total LDH amount from both the medium and cell lysate.
8 / 36
Quantitative polymerase chain reaction (qPCR) analysis Total RNA from cells was extracted and purified using TRIzol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Then reverse transcription for cDNA was generated with a prime script RT Master Mix (TaKaRa Bio Inc., Otsu, Japan). qPCR analysis was carried out using SYBR Green Gene Expression kit (Applied Biosystems, Foster City, CA) on Applied Biosystems 7500 (Thermo Fisher Scientific, Waltham, MA). The primers sequences (Life technology/Thermo Fisher Scientific, Rockford, IL) used in qPCR are listed in Table 1. Samples were amplified using the following program, 95 ℃ for 30 s followed by 45 cycles of 95 ℃ for 5 s, 60 ℃ for 34 s, then a melting curve analysis from 60 to 95 ℃ gradually. The abundance of each gene product was calculated by relative quantification, with values for the target genes normalized with the internal control 18S RNA. Enzyme linked immunosorbent assay (ELISA) Supernatant from cell culture was collected and determined by corresponding ELISA kits (TNF-α, RayBio tech, Atlanta, GA; CCL2 and IL-6, Sigma-Aldrich, St.Louis, MO), while the cell lysate was centrifuged to pellet cell debris before measurement. According to the manufacturer’s instructions, samples after reactions in 96-well micro-plates were read using an Infinite M200 pro Microplate Reader (Life Technologies, Grand Island, NY) at OD 450 nm, and the reference OD 570 nm. Western blot After quantitation of protein concentration by BCA assay (Pierce/Thermo Fisher 9 / 36
Scientific, Rockford, IL), equal total protein was loaded onto 10% Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels for electrophoresis. The size-separated proteins were then transferred to PVDF membranes. After block, primary antibodies against G3BP, Bax (Abcam, Cambridge, MA) and p-/t-ERK1/2, p-/t-p38, p-/tJNK, p-/t-Akt, GAPDH (Cell Signaling Technology, Beverly, MA) (1:2000) were incubated, followed by corresponding Horseradish peroxidase (HRP)-conjugated secondary antibodies (Cell Signaling Technology, Beverly, MA). Signal of target proteins was detected with an ECL kit (Pierce/Thermo Fisher Scientific, Rockford, IL). The gray density of bands in the obtained images was quantified by the software Image-Pro Plus 6.0 for statistical analysis of the ratio of phosphorylated amount of molecule to the total amount, and the ratio of the control group was then normalized to 1 for comparison. Apoptosis staining and flow cytometry analysis FITC-labeled Annexin V and PE-labeled PI kit (RayBio tech, Atlanta, GA) for apoptosis and necrosis double staining were performed on the cultured cells, according to the manufacturer’s instructions. After staining, percent of the positive cells were analyzed on a CyAn machine (Beckman Coulter,Fullerton, CA), and the data analysis was performed using FlowJo software (Tree star, Ashland, OR). Immunofluorescence staining and confocal fluorescence microscopy analysis Cells were collected and fixed in 4% paraformaldehyde (PFA). After block, primary antibodies against G3BP (Abcam, Cambridge, MA) were incubated, followed by staining with corresponding secondary antibody (Life technology/Thermo Fisher Scientific,
10 / 36
Rockford, IL) and DAPI. Then series of photos were taken from each sample under a fluorescence microscopy, and quantified with the software Image-pro plus 6.0. Statistical analysis GraphPad Prism 5 software (GraphPad Software, SanDiego, CA) was used to carry out all statistical analysis. One-way ANOVA analysis of variance was used for multiple groups comparisons. If the data followed a Gaussian distribution, then Bonferroni’s multiple comparisons were used as a posttest. Otherwise, the nonparametric KruskalWallis test multiple comparison posttest was used to analyze the data. Regarding to two groups comparison, Student’s t-test was performed. A P value of less than 0.05 was considered as statistically significant.
11 / 36
Results Cytotoxicity of TanIIA and AsIV to cardiomyocytes in hypoxia Before investigating the roles of TanIIA, AsIV and the combination of these two herbal compounds in the pathological process of hypoxia injury, we detected the cytotoxicity of the herbal compounds to H9c2 cardiomyocytes in hypoxia, in order to find a suitable dose and treatment duration. Concentration course showed that single treatment with either TanIIA or AsIV did not significantly decrease the cell viability of cardiomyocytes in hypoxia (Figure 1A), while a marked decline was observed in the concentrations more than 10 µM TanIIA combined with 50 µM AsIV (Figure 1B). Time course detection showed that only when treatment for 32 h did the herbal compounds dramatically decrease cell viability (Figure 1C). Therefore, 10 µM TanIIA and 50 µM AsIV in 16 h of treatment was used in the following experiments. For an overview of the role of the herbal compounds to cardiomyocytes in hypoxia, LDH-indicated cell injury was determined. As hypoxia induced significant LDH release from the injured cardiomyocytes, AsIV or the combination of TanIIA and AsIV both showed a statistical effect in attenuating LDH release (Figure 1E). However, single TanIIA treatment did not show significant attenuation, and there was no significant difference between single AsIV treatment and the combined treatment of these two compounds (Figure 1E). TanIIA and AsIV inhibited hypoxia-induced chemokines production
12 / 36
Recruitment of numerous inflammatory cells infiltration to the injured heart tissues is a typical phenomenon in hypoxia indicated ischemic myocardial injury (Sager et al., 2016). To test whether the herbal compounds could reduce inflammatory infiltrates, critical chemokines in the hypoxia-induced myocardial injury were detected by qPCR. As hypoxia upregulated most of the chemokines, including the monocyte / macrophage chemokines CCL2 and CCL5, the neutrophils chemokines CXCL2 but not CXCL1, and the dendritic cells chemokines CCL19 but not CCL21, either single TanIIA or the combination of TanIIA and AsIV obviously downregulated these pro-inflammatory chemokines. However, single AsIV treatment did not show significant inhibition, and there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 2A). Among these chemokines, CCL2, the major one for monocytic lineage was extremely downregulated in mRNA levels, which evoked a further investigation on the changes of its protein levels. ELISA result showed a similar attenuation of these herbal compounds to hypoxia-provoked CCL2 accumulation (Figure 2B). With the supernatant of cell culture from Figure 2B and a classical Transwell assay, in which primary peritoneal macrophages were added in the inserts of Transwell plate, the transmigrated macrophages were significantly increased in hypoxia model group, and this increase was clearly reversed in the groups added TanIIA and the combined two compounds. However, there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 2C-D). TanIIA and AsIV inhibited hypoxia-induced cytokine production
13 / 36
Besides of recruiting inflammatory infiltrates to the injured tissue area, hypoxia also triggers cytokines release from cardiomyocytes, which will further aggravate the local inflammation and produce a vicious cycle for infiltrates recruitment. Hence we detected whether the herbal compounds could inhibit cytokines production from hypoxiastimulated cardiomyocytes. qPCR results showed that TNF-α, IL-6 but not IL-1β, major cytokines involved in myocardial ischemia injury, were both significantly increased after 16h stimulation of hypoxia, followed by distinct decrease with the single TanIIA treatment and the combined two compounds treatment. However, there was no significant difference between single TanIIA treatment and the combined treatment of these two compounds (Figure 3A). Based on the obvious suppression on TNF-α, the effects of the herbal compounds were further detected by ELISA in the protein levels. Distinct from the unchanged levels in cell lysates, TNF-α in the supernatant of cell culture was dramatically elevated and then being partially decreased in the herbal compounds treatment, same as the mRNA changes (Figure 3B). As TNF-α was reported to enhance inflammation and promote cell death in ischemia, the inhibition to TNF-α production by the herbal compounds enabled us to detect their overall protective effect to hypoxia-injured cardiomyocytes. From the LDH assay, TNF-α exacerbated hypoxia-induced LDH release from cardiomyocytes. Nevertheless, only the treatment with single TanIIA clearly attenuated LDH release, while the single AsIV treatment and the combined herbal compounds did not appear significant effect (Figure 3C). TanIIA and AsIV inhibited hypoxia- rather than TNF-induced cell apoptosis
14 / 36
As one of the endpoints of hypoxia-injured cardiomyocytes is cell death, including apoptosis and necrosis, so we tried to test whether the herbal compounds could also exert a direct protective effect on hypoxia-induced cell death of cardiomyocytes. With the Annexin V-PI double staining assay, we found an evident accumulation of Annexin V+ apoptotic cells in hypoxia, while this increase was attenuated in the single AsIV treatment and the combined two compounds. However, this attenuation was not observed in single TanIIA treatment, and no significant effect appeared in affecting the PI+ necrotic cells (Figure 4A-B). TNF-α was previously reported to induce cell apoptosis of cardiomyocytes, and we found the herbal compounds could inhibit TNF-α production. Thus we speculated that the herbal compounds may also suppress TNF-α-exacerbated cell apoptosis in hypoxia condition. Subsequently, concentration course of TNF-α was detected overlap the hypoxia condition, and 20 ng/ml TNF-α exhibited a statistical exacerbation for apoptosis induction (Supplemental Figure A). Unexpectedly, the suppression of herbal compounds to hypoxia and TNF-a co-stimulated cell apoptosis was not statistically significant, while single TanIIA treatment showed a marked suppression on hypoxia and TNF-a costimulated cell necrosis (Supplemental Figure B). These data above suggested that the herbal compounds may mainly suppress hypoxia-induced apoptosis, but there was no significant advantage of the combined treatment of these two compounds compared to the single AsIV treatment. Further investigation on the apoptosis associated genes expression revealed that Bax was upregulated by hypoxia and Bcl-2 was downregulated, while the herbal compounds could
15 / 36
significantly restore these changes in Bax but not in each group of Bcl-2 (Figure 4C). Changes of the ratio of Bax/Bcl-2 confirmed the anti-apoptotic effect of the herbal compounds in hypoxia condition (Figure 4C). Consistently, change of protein levels of Bax was shown in Western blot assay, which was similar to the trend of mRNA changes (Figure 4D). TanIIA and AsIV enhanced hypoxia-induced stress granules formation Formation of stress granules (SG) is reported to inhibit hypoxia-induced apoptosis (Arimoto et al., 2008), which suggests a possible explanation to why the herbal compounds could attenuate hypoxia-induced cardiomyocyte apoptosis. With the fluorescence staining of a stress granule component named G3BP, it was found that hypoxia-induced SG assembly was further enhanced in the presence of single AsIV treatment and the combined two compounds. However, there was no significant advantage of the combined treatment of these two compounds compared to the single AsIV treatment (Figure 5A-B). To validate these confocal images results, we examined the protein levels of G3BP in hypoxia-stimulated cardiomyocytes without or with indicated herbal compounds by Western blot. Data showed that AsIV further enhanced hypoxia-induced G3BP expression most significantly, which is consistent with the fluorescent image results (Figure 5C). To confirm the enhancement of the herbal compounds to SG formation, another stress model, the heat shock stress was performed later. Time course test showed heat shock stress-induced stress granules formation in H9c2 cells peaked around 1 h (Data not shown). As shown in the statistical results of SG assembly in fluorescence staining, heat 16 / 36
shock stress obviously induced SG formation, which was also further enhanced by the single AsIV treatment and the combined two compounds (Figure 5D), and western blot of the G3BP expression showed consistent changes, in which the combination of these herbal compounds showed better effect (Figure 5E). TanIIA and AsIV downregulated stress-responsive MAPK pathways Stress-responsive MAPK pathways, especially p38 and JNK, were known to be inhibited in stress granules formation and hypoxia-induced inflammatory process (Arimoto et al., 2008), and Akt was involved in the regulation of cell growth and cell death. Hence these cell signaling pathways were detected by Western blot, and we can find the phosphorylation levels of ERK1/2, p38 and JNK were all induced by hypoxia. However, only p-ERK1/2 was then being significantly inhibited by either the single herbal compound treatment or the combined treatments, compared to its total protein levels (Figure 6A-B). For p-p38, single TanIIA did not show significant inhibition, and for pJNK, the combined compounds did not show advantage compared to either of the single compound treatment (Figure 6A-B). In contrast, phosphorylation of Akt was just mildly suppressed by hypoxia and then restored by the herbal compounds (Figure 6A-B).
17 / 36
Discussion Myocardial ischemia occurs when blood flow to heart is pathologically reduced, preventing the heart from receiving enough oxygen and nutrition. In this study, we investigated the roles and mechanisms of two herbal medicine in modulating hypoxiainduced injury to cardiomyocytes, and concluded that either TanIIA or AsIV, or their combination could inhibit hypoxia-induced chemokine and cytokine production, cell apoptosis and promote the stress granules formation, and the hypoxia-associated stressresponsive MAPK pathways. However, the significant advantage of the combination treatment of TanIIA and AsIV was hardly observed in protecting cardiomyocyte against hypoxia-induced injury. To distinguish the cytotoxicity and efficacy effects of the herbal compounds, a suitable dose and time point was screened based on the cardiomyocte viability in hypoxia condition. LDH release, which reflects the cell injury, was then tested and found an overview protective role of the herbal compounds. At the initiation phase of ischemia, chemokines have already been triggered to be released from the stimulated cardiomyocytes and other tissue resident cells of heart, which results in the subsequent influx of inflammatory lymphocytes infiltration (Xia and Frangogiannis, 2007). We found that the herbal compounds could attenuate the chemokines responsible for recruiting monocyte / macrophages, neutrophils and dendritic cells, which was further confirmed by the transmigration assay.
18 / 36
For the roles on cytokine production, both TNF-α and IL-6 were found to be suppressed by the herbal compounds, although IL-1β did not show a statistical significance. TNF-α is a well-known inflammatory cytokine, which is important in mediating the pathogenesis of cardiovascular injury, and previous studies have shown that TNF-α production was elevated after exposure to hypoxia in H9c2 cardiomyocytes and in the plasma of patients with acute myocardial infarction (AMI) (Wu et al., 2013). Based on the obvious inhibition on TNF-α expression and production, and previous report that TNF-α could also induce cell death including via apoptosis (Zhao et al., 2015), subsequent LDH assay and apoptosis analysis were performed to further investigate the effect of herbal compounds on hypoxia-injured cardiomyocytes. As the flow cytometry analysis shows, hypoxia-induced apoptosis was suppressed by herbal compounds, however, when TNF-α was co-stimulated with hypoxia to cardiomyocytes, the protective effect of these herbal compounds did not appear on cell apoptosis. These data suggest that the protective role of herbal compounds depends on the extent of stimulation, during which severe stress may overload the protective efficacy of herbal compounds. In response to stress such as hypoxia, cells can stall translation by storing mRNAs in cellular compartments and formed stress granules (SG), working as a defense mechanism to benefit cell survival and inhibit stress-induced cell apoptosis (Humoud et al., 2016). As we speculated whether the mechanism for herbal compounds to inhibit apoptosis was via promoting SG assembly, the following experiment showed that the herbal compounds enhanced hypoxia-triggered SG assembly, especially AsIV. This result is consistent with another plant-derived compound, Vinca alkaloids, on promoting SG formation (Szaflarski et al., 2016). To validate this phenomenon, another common stress for 19 / 36
inducing SG formation was also tested, expectedly, the herbal compounds can also enhance heat shock stress-induced SG assembly, which suggest that the promoted SG formation may be partially benefits the myocardial protective effect of herbal compounds. As the MAPK pathway, including ERK, JNK and p38, is classically involved in myocardial ischemia and reperfusion injury (Zhang et al., 2015), meanwhile, it is reported that stress-responsive MAPK could be inhibited by SG formation (Arimoto et al., 2008), we next tested the changes of MAPK in hypoxia-stimulated cardiomyocytes with the treatment of herbal compounds. Our results showed that MAPK pathways were suppressed while the phosphorylation of Akt, which benefits cell survival in stress, was just mildly restored by the herbal compounds. Taken these data together, in this work, the herbal compounds TanIIA and AsIV were found to be partially effective in protecting cardiomyocytes against hypoxia-induced cell injury, and the combination of these two compounds showed a compatibility. However, the advantage of the combined two compounds was hardly observed, which indicates a compatible characteristic but no significant advantage of the combination treatment of TanIIA and AsIV in protecting cardiomyocyte against hypoxia-induced injury. Nevertheless, this study did not exclude more complex effects of herbal formula in treating cardiovascular diseases, and in vivo studies need to be performed for further investigation, especially for the herbal formula treatment.
20 / 36
Author contributions Q.L., D.W. and X.Y. designed this study, D.W., Y.W., T.Z., G.Z., Z.Z. performed experimental detection, Y.L. collected data and finished statistical analysis, Q.L. wrote the manuscript, and all authors have read and revised the manuscript critically.
Conflict of interest The authors declared no conflict of interest.
Acknowledgements This work is supported by Natural Science Foundation of Guangdong Province (No. 2015A030313368 to D.W.) and Guangzhou Municipal Science and Technology Program (No. 201607010337, to X.Y.).
21 / 36
References Arimoto-Matsuzaki, K., Saito, H., Takekawa, M., 2016. TIA1 oxidation inhibits stress granule assembly and sensitizes cells to stress-induced apoptosis. Nature communications 7, 10252. Arimoto, K., Fukuda, H., Imajoh-Ohmi, S., Saito, H., Takekawa, M., 2008. Formation of stress granules inhibits apoptosis by suppressing stress-responsive MAPK pathways. Nature cell biology 10, 1324-1332. Guan, F.Y., Yang, S.J., Liu, J., Yang, S.R., 2015. Effect of astragaloside IV against rat myocardial cell apoptosis induced by oxidative stress via mitochondrial ATP-sensitive potassium channels. Molecular medicine reports 12, 371-376. Hofmann, U., Frantz, S., 2015. Role of lymphocytes in myocardial injury, healing, and remodeling after myocardial infarction. Circulation research 116, 354-367. Humoud, M.N., Doyle, N., Royall, E., Willcocks, M.M., Sorgeloos, F., van Kuppeveld, F., Roberts, L.O., Goodfellow, I.G., Langereis, M.A., Locker, N., 2016. Feline Calicivirus Infection Disrupts Assembly of Cytoplasmic Stress Granules and Induces G3BP1 Cleavage. Journal of virology 90, 6489-6501. Jian, W., Yu, S., Tang, M., Duan, H., Huang, J., 2016. A combination of the main constituents of Fufang Xueshuantong Capsules shows protective effects against streptozotocin-induced retinal lesions in rats. Journal of ethnopharmacology 182, 50-56. Jin, H.J., Xie, X.L., Ye, J.M., Li, C.G., 2013. TanshinoneIIA and cryptotanshinone protect against hypoxia-induced mitochondrial apoptosis in H9c2 cells. PloS one 8, e51720. Linfert, D., Chowdhry, T., Rabb, H., 2009. Lymphocytes and ischemia-reperfusion injury. Transplantation reviews 23, 1-10. Liu, B., Che, W., Xue, J., Zheng, C., Tang, K., Zhang, J., Wen, J., Xu, Y., 2013. SIRT4 prevents hypoxia-induced apoptosis in H9c2 cardiomyoblast cells. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 32, 655-662. Liu, Q., Wang, J., Liang, Q., Wang, D., Luo, Y., Li, J., Janicki, J.S., Fan, D., 2014. Sparstolonin B attenuates hypoxia-reoxygenation-induced cardiomyocyte inflammation. Experimental biology and medicine 239, 376-384. Luo, Y., Qin, Z., Hong, Z., Zhang, X., Ding, D., Fu, J.H., Zhang, W.D., Chen, J., 2004. Astragaloside IV protects against ischemic brain injury in a murine model of transient focal ischemia. Neuroscience letters 363, 218-223. 22 / 36
Mei, M., Tang, F., Lu, M., He, X., Wang, H., Hou, X., Hu, J., Xu, C., Han, R., 2015. Astragaloside IV attenuates apoptosis of hypertrophic cardiomyocyte through inhibiting oxidative stress and calpain-1 activation. Environmental toxicology and pharmacology 40, 764-773. Sager, H.B., Hulsmans, M., Lavine, K.J., Beltrami Moreira, M.B., Heidt, T., Courties, G., Sun, Y., Iwamoto, Y., Tricot, B., Khan, O.F., Dahlman, J.E., Borodovsky, A., Fitzgerald, K., Anderson, D.G., Weissleder, R., Libby, P., Swirski, F.K., Nahrendorf, M., 2016. Proliferation and Recruitment Contribute to Myocardial Macrophage Expansion in Chronic Heart Failure. Circulation research. Sheng, S., Wang, J., Wang, L., Liu, H., Li, P., Liu, M., Long, C., Xie, C., Xie, X., Su, W., 2014. Network pharmacology analyses of the antithrombotic pharmacological mechanism of Fufang Xueshuantong Capsule with experimental support using disseminated intravascular coagulation rats. Journal of ethnopharmacology 154, 735-744. Szaflarski, W., Fay, M.M., Kedersha, N., Zabel, M., Anderson, P., Ivanov, P., 2016. Vinca alkaloid drugs promote stress-induced translational repression and stress granule formation. Oncotarget. Wu, W.Y., Wang, W.Y., Ma, Y.L., Yan, H., Wang, X.B., Qin, Y.L., Su, M., Chen, T., Wang, Y.P., 2013. Sodium tanshinone IIA silate inhibits oxygen-glucose deprivation/recoveryinduced cardiomyocyte apoptosis via suppression of the NF-kappaB/TNF-alpha pathway. British journal of pharmacology 169, 1058-1071. Xia, Y., Frangogiannis, N.G., 2007. MCP-1/CCL2 as a therapeutic target in myocardial infarction and ischemic cardiomyopathy. Inflammation & allergy drug targets 6, 101-107. Xie, J., Wang, H., Song, T., Wang, Z., Li, F., Ma, J., Chen, J., Nan, Y., Yi, H., Wang, W., 2013. Tanshinone IIA and astragaloside IV promote the migration of mesenchymal stem cells by up-regulation of CXCR4. Protoplasma 250, 521-530. Zhang, Y., Liao, H., Zhong, S., Gao, F., Chen, Y., Huang, Z., Lu, S., Sun, T., Wang, B., Li, W., Xu, H., Zheng, F., Shi, G., 2015. Effect of N-n-butyl haloperidol iodide on ROS/JNK/Egr-1 signaling in H9c2 cells after hypoxia/reoxygenation. Scientific reports 5, 11809. Zhang, Y., Wei, L., Sun, D., Cao, F., Gao, H., Zhao, L., Du, J., Li, Y., Wang, H., 2010. Tanshinone IIA pretreatment protects myocardium against ischaemia/reperfusion injury through the phosphatidylinositol 3-kinase/Akt-dependent pathway in diabetic rats. Diabetes, obesity & metabolism 12, 316-322. Zhao, M., Yang, Y., Bi, X., Yu, X., Jia, H., Fang, H., Zang, W., 2015. Acetylcholine Attenuated TNF-alpha-Induced Apoptosis in H9c2 Cells: Role of Calpain and the p38-
23 / 36
MAPK Pathway. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 36, 1877-1889.
24 / 36
Table 1. Primers used in qPCR assay.
Primers Forward (5’--3’)
Reverse (3’--5’)
(rat)
18S
TGAGGCCATGATTAAGAGGG
AGTCGGCATCGTTTATGGTC
CCAATGAGTCGGCTGGAGAAC CCL2
AGTGCTTGAGGTGGTTGTGGAA T
CCL5
GGAGATGAGCTAGAATAGAGG
CATAGGAGAGGACACAGTTAT
CXCL1
GTGTGAGAGGCTATGTTGT
CGAGAAGGAGCATTGGTTA
CXCL2
TGTTCAATGTGTTCAGTCAG
GGAGGTGGTGTAGTCAGT
CCL19
CTCTCAGGCTCATTCATTCT
CAGTCTTCCGCATCGTTA
CCL21
CTTGGTCCTGGTTCTCTG
CGGTTCTTGCTTCCTGTA
TNF-α
TGGCGTGTTCATCCGTTCTC
ACTACTTCAGCGTCTCGTGTG
IL-6
CGGAGAGGAGACTTCACA
GCATCATCGCTGTTCATAC
25 / 36
IL-1β
GACAGAACATAAGCCAACAA
ACACAGGACAGGTATAGATTC
Bax
GACGCATCCACCAAGAAG
TCTGTATCCACATCAGCAATC
Bcl-2
CCTGGCATCTTCTCCTTC
GCTGACTGGACATCTCTG
26 / 36
Figure 1 Cytotoxicity of Tanshinone IIA (TanIIA) and Astragaloside IV (AsIV) to cardiomyocytes in hypoxia. Cytotoxicity of TanIIA or AsIV (A.), and the combination of these two herbal compounds (B.) at indicated concentrations, was detected on H9c2 cells in normoxia control or hypoxia (1% O2) treatment for 24h by LDH assay. C. Time course (0 to 32 h) of the cytotoxicity of TanIIA or AsIV, and the combination of these two herbal compounds to H9c2 cells in normoxia control or hypoxia. D. Effect of TanIIA or AsIV, and the combination of these two herbal compounds, to attenuate hypoxiainduced cell injury was detected in the supernatant of cell culture by LDH assay. Data above are presented as mean ± SEM, n=3, *P<0.05 vs normoxia group, #P<0.05 vs hypoxia without compound group. Figure 2 TanIIA and AsIV inhibited hypoxia-induced chemokines production. A. qPCR results of the changes of chemokines mRNA levels, detected in H9c2 induced by hypoxia in the absence or presence of indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h. The ratio of target genes expression to 18S RNA expression in normoxia was normalized as 1. B. H9c2 was treated by indicated herbal compounds in hypoxia for 16h, and the protein levels of CCL2 in the supernatant of cell culture were determined by ELISA. C. Supernatant from each group in (B.) was collected and added into the bottom rooms of Transwell plate, peritoneal macrophages from rat was collected and added into the inserts of Transwell plate equally. Cells were allowed for migration for 3 h, and the representative images were obtained (C., scale bar indicated 100 μm) and for statistical analysis (D). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups.
27 / 36
Figure 3. TanIIA and AsIV inhibited hypoxia-induced cytokines production. A. qPCR results of the changes of cytokines mRNA levels, detected in H9c2 induced by hypoxia in the absence or presence of indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h. The ratio of target genes expression to 18S RNA expression in normoxia was normalized as 1. B. Supernatant and cell lysate treated the same as (A.) was collected, and the protein levels of TNF-α were determined by ELISA. C. H9c2 cells stimulated in hypoxia with or without TNF-α (20 ng/ml), were simultaneously treated with the indicated herbal compounds for 16 h. Cell injury was measured by LDH assay. Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 4. TanIIA and AsIV inhibited hypoxia- rather than TNF-induced cell apoptosis. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h. Cell apoptosis was examined by FITC-labeled Annexin V and PE-labeled PI staining (A.), then percent of apoptotic cells and necrotic cells were calculated (B.). C. qPCR results of the changes of Bax, Bcl-2 mRNA levels in the same condition as (A.), and the ratio of Bax to Bcl-2 was calculated. D. Western blot result of Bax changes in the same condition as (A.). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 5. TanIIA and AsIV enhanced hypoxia-induced stress granules formation. A. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h, then fixed and stained with G3BP (indicates stress granules formation) and DAPI (indicates nuclei) for confocal fluorescent microscopy analysis. Representative images were shown and the scale bar indicated 50 μm. The percent of
28 / 36
G3BP positive cells were calculated for statistical analysis (B.). Cell lysate in the same condition as (A.) were collected, and the protein levels of G3BP and GAPDH were examined by Western blot. D. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) for 16 h, and then stimulated with heat shock stress (42 ⁰C) for another 1h. Cells were stained with G3BP and DAPI for calculating the percent of stress granules positive cells. E. Western blot showed the changes of protein levels of G3BP and GAPDH in the condition of (D.). Data above are presented as mean ± SEM, n=3, *P<0.05 between indicated groups. Figure 6. TanIIA and AsIV downregulated stress-responsive MAPK pathways. A. H9c2 cells were treated by indicated herbal compounds (TanIIA at 10 µM, AsIV at 50 µM) in hypoxia for 16 h, then both of the phosphorylation levels and total levels of ERK1/2, p38, JNK and Akt in cell lysate were examined by Western blot. Representative images were shown in (A.) and the corresponding statistical analysis data were given in (B.). Data are presented as mean ± SEM, n=3, *P<0.05 between indicated groups.
29 / 36
30 / 36
Figure 2 CXCL1
CCL2
**
8
**
**
10
**
6 4 2 0 Normoxia Medium TanIIA
*
8 6 4 2 0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
3
1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
3 2 1
AsIV Tan+As
Hypoxia
B
CCL21
*
2.5
2
1
0 Normoxia Medium TanIIA
2.0 1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
C
D
***
*
Transwell 160
*** Migrated cell number (per 10X photo)
Concentration (pg/ml)
15000
***
AsIV Tan+As
Hypoxia
CCL2 20000
AsIV Tan+As
Hypoxia
Folds of change
*
4
0 Normoxia Medium TanIIA
1.5
CXCL2
*
*
Folds of change
Folds of change
*
**
*
2.0
Hypoxia
CCL5 5
CCL19 2.5
* Folds of change
Folds of change
10
Folds of change
A
10000 5000 0 Normoxia Medium TanIIA
**
*
***
120 80 40 0 Normoxia Medium TanIIA
AsIV Tan+As
AsIV Tan+As
Hypoxia
Hypoxia
31 / 36
Figure 3 A IL-6
TNF-
2 1
1.0 0.5 0.0 Normoxia Medium TanIIA
AsIV Tan+As
1.0 0.5
C
AsIV Tan+As
Hypoxia
600 400 200
***
4
**
*
3 2 1 0
0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
TN TN F FTa nI IA TN FA sI TN V FTa nA s
0
5
ox ia
50
LDH
800
ed iu m
100
AsIV Tan+As
Hypoxia
Relative LDH release
Concentration in cell lysate (pg/ml)
Concentration in supernatant (pg/ml)
** ***
Normoxia Medium TanIIA
1.5
0.0 Normoxia Medium TanIIA
AsIV Tan+As
TNF-
TNF- 200
***
2.0
Hypoxia
Hypoxia
150
*
*
M
0 Normoxia Medium TanIIA
1.5
Folds of change
*
3
B
2.5
or m
**
IL-1
2.0
*
N
*
Folds of change
Folds of change
4
Hypoxia + TNF- + Tan IIA / As IV (M)
32 / 36
Figure 4
2.16%
Annexin V+ apoptotic cells
B
Hypoxia
Percentage in Total cells (%)
A
Normoxia
4.18%
7.94%
14.5%
25
**
20
* *
15 10 5 0
PI
Normoxia Medium TanIIA
Hypoxia-TanIIA
Hypoxia-AsIV
AsIV Tan+As
Hypoxia
Hypoxia-Tan-As
PI+ necrotic cells 3.78%
12.2%
4.58%
9.16%
Percentage in Total cells (% )
4.88%
8.22%
Annexin V
8 6 4 2 0 Normoxia Medium TanIIA
AsIV
Tan+As
Hypoxia
C Bax
**
*
1
0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
2.0
6
*
*
*
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
D
Bax/Bcl-2
Bcl-2 2.5
*
Ratio of Bax/Bcl-2
2
*
Folds of change
Folds of change
3
4
***
*** *** ***
20 kD
2
37 kD
0 AsIV
Tan+As
Normoxia Medium TanIIA
Hypoxia
AsIV Tan+As
Hypoxia
33 / 36
34 / 36
35 / 36
Figure 6 B 44 kD 42 kD
2.5
p-ERK/t-ERK
A
**
**
***
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
44 kD 42 kD
2.5
p-p38/t-p38
*
***
*
1.5 1.0 0.5
40 kD
0.0 Normoxia Medium TanIIA
54 kD 2.5 2.0
p-JNK/t-JNK
46 kD
AsIV Tan+As
Hypoxia
46 kD 54 kD
AsIV Tan+As
Hypoxia
2.0
43 kD
*
2.0
*
*
*
1.5 1.0 0.5 0.0 Normoxia Medium TanIIA
60 kD
AsIV Tan+As
Hypoxia 1.5
37 kD
p-Akt/t-Akt
60 kD 1.0
0.5
0.0 Normoxia Medium TanIIA
AsIV Tan+As
Hypoxia
36 / 36