- Email: [email protected]
Complement gene expression in mouse microglia and astrocytes in culture: comparisons with mouse peritoneal macrophages
ELSEVIER
Neuroscience Letters 216 (1996) 191-194
NEUROSCIEHC[ lETTERS
Complement gene expression in mouse microglia and astrocytes in culture: comparisons with mouse peritoneal macrophages Seiichi Haga*, Takako Aizawa, Tsuyoshi Ishii, Kazuhiko Ikeda Department of Ultrastructure and Histochemistry. Tokyo Institute of Psychiatry. 2-1-8. Kamikitazawa, Setagaya-ku, ToLTo 156, Japan
Received 2 July 1996; revised version received 26 August 1996; accepted 26 August 1996
Abstract
We investigated the mRNA expression of the various complement components in cultured mouse microglia and astrocytes by the reverse transcription and polymerase chain reaction. Clq, C2, C3, and C4 mRNAs were detected in microglial cultures. C3 and C4 mRNAs were found in astrocyte cultures. Microglia showed enhanced expression of C2, C3, and C4 mRNAs when they were treated with lipopolysaccharide. Much higher expression of Clq, C2, C3, and C4 mRNAs was detected in microglia after stimulation with interferon-% Our data suggest that microglia and astrocytes may produce some of the complement components also in vivo, which can be facilitated in certain infectious and inflammatory diseases in the central nervous system. Keywords: Complement; Gene expression; Microglia; Astrocytes; Culture; Polymerase chain reaction; Lipopolysaccharide; Interferon-3,
The serum complement system consists of more than 20 glycoproteins that function as effectors of inflammatory processes, immunologic regulation, and cytotoxicity. The liver is the principal site of synthesis of serum complement proteins. However, mononuclear phagocytes provide local production of these proteins. In the central nervous system (CNS) microglia play roles as a class of mononuclear phagocytes. We have shown the production of complement C3 component by cultured microglia in the previous study [5]. Astrocytes are known to participate in immune responses, and also synthesize C3 and factor B [10]. In this study we analyzed the expression of Clq, C2, C3, C4, and C9 mRNA in mouse microglia and astrocytes in culture, compared it with the expression in cultured peritoneal macrophages using the reverse transcription-polymerase chain reaction (RT-PCR). In addition, the effects of lipopolysaccharide (LPS) and interferon-3, (IFN-,y) on the regulation of the gene expression of complement components were examined in these cultured cells. Primary cultures of mouse peritoneal macrophages, microglia, and astrocytes were established and maintained as previously described [5]. For RT-PCR analysis, 2 * Corresponding author. Tel.: +81 3 33045701; fax: +81 3 33298035.
3 x 10 6 cells for microglia and peritoneal macrophages, and 5 - 6 x 105 cells for astrocytes were plated each in a 60-mm tissue culture dish. One day after plating, LPS (1 /zg/ml; E. coli 0111, B4; Sigma) or recombinant IFN-'y (200 U/ml; Genzyme) was added into the microglia and macrophage cultures and incubated for 24 h. For astrocyte cultures, these reagents were added 2 days after plating. Total cellular RNA was extracted from cultures by the method of Lorsbach et al. [11]. The RNA extract was further treated with DNase I to remove contaminated DNA. RNA content was determined by measurement of absorption at 260 nm. The synthesis of first strand-cDNA and the cDNA amplication were carried out in a thermal cycler (Astec, Japan), following the protocol of Gene Amp RNA PCR kit (Perkin Elmer). The number of amplication cycles varied depending on the complement component to be examined. Each primer was selected by PCR Primer Design Assistance (Genetyx). The sequence of the primers, and the predicted length of PCR products are listed in Table 1. PCR products were electrophoresed on a 5% polyacrylamide gel in Tris borate-EDTA buffer (pH 8). The gel was then stained with ethidium bromide. The quality of all samples used was monitored by amplification of/3-actin mRNA. The synthesis and secretion of C3 pro-
0304-3940/96/$12.00 © 1996 Elsevier Science Ireland Ltd. All rights reserved PII S0304-3940(96) 13040-8
192
S. Haga et al. / Neuroscience Letters 216 (1996) 191-194
Table 1 DNA sequences of 5' primers and 3' primers of six target genes Gene C 1qB -chain C 1qB -chain C2 C2 C3 C3 C4 C4 C9 C9 ~-Actin /3-Actin
5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3'
primer primer primer primer primer primer primer primer primer primer primer primer
Sequence
Product (bp)
Ref.
AAGCATCACAGAACACCAG ATAGTrCTCGTTCGCG'Iq'G TGGATGTCTCTAAGCTCAC TGCATAGGAACTGGTCTGT CACCGCCAAGAATCGCTAC GATCAGGTG'ITI'CAGCCGC TGGAGGACAAGGACGGCI'A GGCCCTAACCCTGAGCTGA AGTAGCGGAAGAATCAGAGC TTTGAGGTACTTCGGTGGGT GTGGGCCGCTCTAGGCACCAA CTCTFTGATGTCACGCACGATI~C
507
[19]
645
[8]
385
[4]
464
[6]
311
[14]
540
[2]
tein by cultured cells were determined by metabolic labeling of [35S]methionine and immunoprecipitation as previously described [5]. All of the length of the PCR products examined in this study correlated with the theoretical length derived from the sequence date./3-Actin mRNA expression for all RNA samples used were shown in Fig. 1, indicating that cDNA synthesis was in the same efficiency in every reaction mixture. C3 and C4 mRNA expression was observed in mouse cultured microglia as in peritoneal macrophages. Moreover, higher expression of the C3 and C4 genes was detected in cultured astrocytes, which was comparable to that of the mouse liver tissue. Clq and C2 mRNAs were detected at the low amount in microglia, but neither was found in astrocytes. In our study Clq product in peritoneal macrophages was only faintly observed on the electrophoresis gel. In microglia LPS increased the synthesis of C3 and C4 mRNAs slightly and C2 mRNA conspicuously. On the
Mz 1 2 3 1
Clq C4
C2 C3
Mic 231
Ast 23
M r Liv
"=
t''
'~
- - - . - =m a = t B ~
----
....!
,---m
C9 Bactin
Fig. 1. RT-PCR analysis of Clq, C4, C2, C3, C9, and/3-actin. Mouse cultured cells (M4, peritoneal macrophages; Mic, microglia; Ast, astrocytes) were treated without (1), or with LPS (2) or IFN-',/ (3). Liver sample (Liv) served as control. Mr, DNA marker.
contrary, LPS markedly decreased the C4 mRNA expression in peritoneal macrophages. Recombinant IFN-q/ induced substantial upregulation of Clq, C2, C3, and C4 mRNAs in microglia and peritoneal macrophages. In cultured astrocytes, C2 mRNA was only detected after IFN-q/ treatment. There was no significant effect of LPS or IFN-3, on the expression of C3 and C4 mRNAs in astrocytes. None of the C9 mRNA expression was detected in any primary cultures examined, while it was observed in a liver sample. To investigate whether C3 protein is synthesized by the cultured cells that express C3 mRNA, the cells were metabolically labeled, and the immunoprecipitated C3 product from cultured medium was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and fluorography. The bands of 125 and 75 kDa, corresponding to C3 o~- and/3-chains, were detected in every cultured medium (Fig. 2.). Higher production of C3 was observed in astrocytes in agreement with the results of RTPCR analysis. The secretory pro-C3 (195 kDa) and additional unknown bands were observed in cultured astrocytes. Since pro-C3 is usually cell-associated in other cell types, it remains to be determined whether there is an altered processing of pro-C3 in astrocytes culture. LPS increased synthesis of C3 in both microglia and peritoneal macrophages, and to less degree in astrocytes. IFNhad a significant effect on the synthesis of C3 in microglia or peritoneal macrophages, while it had no effect in astrocytes. The marked increase of C3 synthesis in microglia or peritoneal macrophages that was brought about by the LPS or IFN-',/ treatment was not in parallel to the results of the minor increase of C3 mRNA expression in these cells. Possibly the PCR analysis is less quantitative compared to the immunoprecipitation analysis. Much attention has been focused on the roles of complement components in the CNS. In Alzheimer's disease brains complement components have been detected in senile plaques [3,7,12], and neurofibrillary tangles [52] by immunohistochemical studies. Recently, using in situ
A.A. Author / Neuroscience Letters 000 (1996) 191-194
Mo 2
Mic
Ast
3 1 2 3 1 2 3 M ~,~
kD
Urn" -125
Fig. 2. SDS-PAGE analysis under reducing conditions of immuoprecipitates from cultured cells (M~b,peritoneal macrophage; Mic, microglia; Ast, astrocytes) metabolically labeled with [35S]methionine. Non-treated (1) or treated with LPS (2) or IFN-3, (3). Longer exposure to the film revealed the bands for macrophages under basal condition (not shown).
hybridization technique, increased expression of Clq mRNA was reported in the cells that were immunoreactive for microglia marker (OX-42) in adult rats, following experimental lesions [13]. Further, Clq and C3 immunepositive microglia was shown in rat hippocampal lesions induced by kainic acid [1]. In the present study we demonstrated Clq, C2, C3, and C4 mRNA expression in mouse cultured microglia. These results suggest that microglia may be potential cells that produce complement components, especially in various types of CNS injury. IFN- 7 is a well-characterized lymphokine known to regulate many functions of mononuclear phagocytes. Increased expression of C2, C4, and factor B mRNAs has been reported in human monocytes and macrophages [16,17]. Our results, for the first time, showed that IFN-'y has significant effects on the synthesis of C3 protein and the expression of Clq, C2, C3, and C4 mRNAs in mouse cultured microgtia. LPS is a potent activator of humoral and cellular immunity. LPS stimulates mononuclear phagocytes to produce various substances including superoxide anion, prostaglandin E2, C3, and factor B [15]. Kulics reported that LPS decreased human monocytes C4 mRNA expression in a concentration dependent manner [9]. We also observed the downregulation of C4 expression in LPStreated mouse peritoneal macrophages. The reason for the suppression of C4 mRNA expression is uncertain, but macrophage adherence accompanied with the elicitation by mineral oil, casein, or endotoxine may provide a regulatory signal to decrease C4 expression. However, LPS slightly increased the C4 expression in our cultured microglia. The origin of microglia has currently been ascribed to bone marrow-derived monocytes. Microglia share characteristics with monocytes and macrophages in respect of immunohistochemical markers and functional properties. However, morphological, immunophenotypical and functional differences among mononuclear phagocytes have been well known. Our results support the notion that microglia comprise a functionally distinct subpopulation of mononuclear phagocytes.
193
Very recently Walker et al. showed expression of Clq and C3 mRNAs in human cultured microglia derived from postmortem brains [18]. In contrast to our results, IFN-3' had no effect on the gene expression of Clq and C3 mRNAs. Further, C4 mRNA expression was only detected after stimulation with IFN-3,. These results might be explained by the difference in species and/or maturation of cultured microglia used for analysis. Much higher gene expression of C3 and C4 mRNAs was detected in cultured astrocytes compared to those in microglia under the basal condition. C3 synthesis and secretion from astrocytes were observed as well. Astrocytes might participate in the production of complement proteins together with microglia, but the synthesis in situ remains to be determined. In response to brain lesions the complement synthesis may be enhanced in microglia and possibly in astrocytes. Complement may play key roles in the initiation of local inflammation. The complement degradation product such as C3b facilitates phagocytosis by opsonization. The terminal event in complement pathway results in the formation of membrane attack complex (C5b-9), which may cause lysis of target cells. These events could be effective on the removal of locally lesioned tissue in the CNS. On the other hand they may afflict the nerve cells, and thus finally could lead to the cell death or cell degeneration. Further clarification of complement system in the CNS is required.
[1] Akiyama, H., Tooyama, I., Kondo, H., Ikeda, K., Kimura, H., McGeer, E.G. and McGeer, P.L., Early response of brain resident microglia to kainic acid-induced hippocampal lesions, Brain Res., 635 (1994) 257-268. [2] Alonso, S., Minty, A., Bourlet, Y. and Buckingham, M., Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm-blooded vertebrates, J, Mol. Evol., 23 (1986) 11-22. [3] Eikenlenboom, P. and Stam, F.C., Immunoglobulins and complement factors in senile plaques, Acta Neuropathol. (Berlin), 57 (1982) 239-242. [4] Fey, G.H., Lundwall, A., Wetsel, R,A., Tack, B.F., de Bruijn, M.H.L. and Domdey, H., Nucleotide sequence of complementary DNA and derived amino acid sequence of murine complement protein C3, Philos. Trans, R. Soc. London, Ser. B., Biol. Sci., 306 (1984) 333-344. [5] Haga, S., Ikeda, K., Sato, M. and Ishii, T., Synthetic Alzheimer amyloid /3/A4 peptides enhance production of complement C3 component by cultured microglial cells, Brain Res., 601 (1993) 88-94. [6] Hemenway, C., Kalff, M., Stavenhagen, J., Walthall, D. and Robins, D., Sequence comparison of alleles of the fourth component of complement (C4) and sex-limited protein (Slp), Nucleic Acids Res., 14 (1986) 2539-2554. [7] Ishii, T. and Haga, S., Immuno-electron-microscopic localization of complements in amyloid fibrils of senile plaques, Acta Neuropathol. (Berlin), 63 (1984) 296-300. [8] Ishikawa, N., Nonaka, M., Wetsel, R.A. and Colten, H.R., Murine complement C2 and factor B gemonic and cDNA clonig reveals different mechanisms for multiple transcripts of C2 and B, J. Biol. Chem., 265 (1990) 19040-19046. [9] Kulics, J., Colten, H.R. and Perlmutter, D.H., Counterregulatory
194
[10]
[11]
[12]
[13]
[14]
S. Haga et al. / Neuroscience Letters 216 (1996) 191-194
effects of interferon-.), and endotoxin on expression of the human C4 genes, J. Clin. Invest., 85 (1990) 943-949. L6vi-Strauss, M. and Mallat, M., Primary cultures of mufine astrocytes produce C3 and factor B, two components of the alternative pathway of complement activation, J. Immunol., 139 (1987) 23612366. Lorsbach, R.B., Murphy, W.J., Lowenstein, C.J., Snyder, S.H. and Russell, S.W., Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing, J. Biol. Chem., 268 (1993) 1908-1913. McGeer, P.L., Akiyama, H., Itagaki, S. and McGeer, E.G., Activation of the classical complement pathway in the brain tissue of Alzheimer patients, Neurosci. Lett., 107 (1989) 341-346. Pasinett~, G.M., Johnson, S.A., Rozovsky, I., Lampert-Etchells, M., Morgan, D.G., Gordon, M.N., Morgan, T.E., Willoughby, D. and Finch, C.E., Complement ClqB and C4 mRNAs responses to lesioning in rat brain, Exp. Neurol., 118 (1992) 117-125. Stanley, K.K. and Herz, J., Topological mapping of complement component C9 by recombinant DNA techniques suggests a novel mechanism for its insertion into target membranes, EMBO J., 6 (1987) 1951-1957.
[15] Strunk, R.C., Whitehead, A.S. and Cole, F.S., Pretranslational regulation of the synthesis of the third component of complement in human mononuclear phagocytes by the lipid A portion of lipopolysaccharide, J. Clin. Invest., 76 (1985) 985-990. [16] Strunk, R.C., Cole, F.S., Perlmutter, D.H. and Colten, H.R., 3,_ Interferon increases expression of class III complement genes C2 and factor B in human monocytes and in murine fibroblasts transfected with human C2 and factor B genes, J. Biol. Chem., 260 (1985) 15280-15285. [17] Vincent, F., De La Salle, H., Bohbot, A., Bergerat, J.P., Hauptmann, G. and Oberling, F., Synthesis and regulation of complement components by human monocytes/macrophages and by acute monocytic leukemia, DNA Cell Biol., 12 (1993) 415-423. [18] Walker, D.G., Kim, S.U. and McGeer, P.L., Complement and cytokine gene expression in cultured microglia derived from postmortem human brains, J. Neurosci. Res., 40 (1995) 478-493. [19] Wood, L., Pulaski, S. and Vogeli, G., cDNA clones coding for the complete murine B chain of complement Clq: nucleotide and derived amino acid sequences, Immunol. Lett., 17 (1988) 59-62.
Neuroscience Letters 216 (1996) 191-194
NEUROSCIEHC[ lETTERS
Complement gene expression in mouse microglia and astrocytes in culture: comparisons with mouse peritoneal macrophages Seiichi Haga*, Takako Aizawa, Tsuyoshi Ishii, Kazuhiko Ikeda Department of Ultrastructure and Histochemistry. Tokyo Institute of Psychiatry. 2-1-8. Kamikitazawa, Setagaya-ku, ToLTo 156, Japan
Received 2 July 1996; revised version received 26 August 1996; accepted 26 August 1996
Abstract
We investigated the mRNA expression of the various complement components in cultured mouse microglia and astrocytes by the reverse transcription and polymerase chain reaction. Clq, C2, C3, and C4 mRNAs were detected in microglial cultures. C3 and C4 mRNAs were found in astrocyte cultures. Microglia showed enhanced expression of C2, C3, and C4 mRNAs when they were treated with lipopolysaccharide. Much higher expression of Clq, C2, C3, and C4 mRNAs was detected in microglia after stimulation with interferon-% Our data suggest that microglia and astrocytes may produce some of the complement components also in vivo, which can be facilitated in certain infectious and inflammatory diseases in the central nervous system. Keywords: Complement; Gene expression; Microglia; Astrocytes; Culture; Polymerase chain reaction; Lipopolysaccharide; Interferon-3,
The serum complement system consists of more than 20 glycoproteins that function as effectors of inflammatory processes, immunologic regulation, and cytotoxicity. The liver is the principal site of synthesis of serum complement proteins. However, mononuclear phagocytes provide local production of these proteins. In the central nervous system (CNS) microglia play roles as a class of mononuclear phagocytes. We have shown the production of complement C3 component by cultured microglia in the previous study [5]. Astrocytes are known to participate in immune responses, and also synthesize C3 and factor B [10]. In this study we analyzed the expression of Clq, C2, C3, C4, and C9 mRNA in mouse microglia and astrocytes in culture, compared it with the expression in cultured peritoneal macrophages using the reverse transcription-polymerase chain reaction (RT-PCR). In addition, the effects of lipopolysaccharide (LPS) and interferon-3, (IFN-,y) on the regulation of the gene expression of complement components were examined in these cultured cells. Primary cultures of mouse peritoneal macrophages, microglia, and astrocytes were established and maintained as previously described [5]. For RT-PCR analysis, 2 * Corresponding author. Tel.: +81 3 33045701; fax: +81 3 33298035.
3 x 10 6 cells for microglia and peritoneal macrophages, and 5 - 6 x 105 cells for astrocytes were plated each in a 60-mm tissue culture dish. One day after plating, LPS (1 /zg/ml; E. coli 0111, B4; Sigma) or recombinant IFN-'y (200 U/ml; Genzyme) was added into the microglia and macrophage cultures and incubated for 24 h. For astrocyte cultures, these reagents were added 2 days after plating. Total cellular RNA was extracted from cultures by the method of Lorsbach et al. [11]. The RNA extract was further treated with DNase I to remove contaminated DNA. RNA content was determined by measurement of absorption at 260 nm. The synthesis of first strand-cDNA and the cDNA amplication were carried out in a thermal cycler (Astec, Japan), following the protocol of Gene Amp RNA PCR kit (Perkin Elmer). The number of amplication cycles varied depending on the complement component to be examined. Each primer was selected by PCR Primer Design Assistance (Genetyx). The sequence of the primers, and the predicted length of PCR products are listed in Table 1. PCR products were electrophoresed on a 5% polyacrylamide gel in Tris borate-EDTA buffer (pH 8). The gel was then stained with ethidium bromide. The quality of all samples used was monitored by amplification of/3-actin mRNA. The synthesis and secretion of C3 pro-
0304-3940/96/$12.00 © 1996 Elsevier Science Ireland Ltd. All rights reserved PII S0304-3940(96) 13040-8
192
S. Haga et al. / Neuroscience Letters 216 (1996) 191-194
Table 1 DNA sequences of 5' primers and 3' primers of six target genes Gene C 1qB -chain C 1qB -chain C2 C2 C3 C3 C4 C4 C9 C9 ~-Actin /3-Actin
5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3'
primer primer primer primer primer primer primer primer primer primer primer primer
Sequence
Product (bp)
Ref.
AAGCATCACAGAACACCAG ATAGTrCTCGTTCGCG'Iq'G TGGATGTCTCTAAGCTCAC TGCATAGGAACTGGTCTGT CACCGCCAAGAATCGCTAC GATCAGGTG'ITI'CAGCCGC TGGAGGACAAGGACGGCI'A GGCCCTAACCCTGAGCTGA AGTAGCGGAAGAATCAGAGC TTTGAGGTACTTCGGTGGGT GTGGGCCGCTCTAGGCACCAA CTCTFTGATGTCACGCACGATI~C
507
[19]
645
[8]
385
[4]
464
[6]
311
[14]
540
[2]
tein by cultured cells were determined by metabolic labeling of [35S]methionine and immunoprecipitation as previously described [5]. All of the length of the PCR products examined in this study correlated with the theoretical length derived from the sequence date./3-Actin mRNA expression for all RNA samples used were shown in Fig. 1, indicating that cDNA synthesis was in the same efficiency in every reaction mixture. C3 and C4 mRNA expression was observed in mouse cultured microglia as in peritoneal macrophages. Moreover, higher expression of the C3 and C4 genes was detected in cultured astrocytes, which was comparable to that of the mouse liver tissue. Clq and C2 mRNAs were detected at the low amount in microglia, but neither was found in astrocytes. In our study Clq product in peritoneal macrophages was only faintly observed on the electrophoresis gel. In microglia LPS increased the synthesis of C3 and C4 mRNAs slightly and C2 mRNA conspicuously. On the
Mz 1 2 3 1
Clq C4
C2 C3
Mic 231
Ast 23
M r Liv
"=
t''
'~
- - - . - =m a = t B ~
----
....!
,---m
C9 Bactin
Fig. 1. RT-PCR analysis of Clq, C4, C2, C3, C9, and/3-actin. Mouse cultured cells (M4, peritoneal macrophages; Mic, microglia; Ast, astrocytes) were treated without (1), or with LPS (2) or IFN-',/ (3). Liver sample (Liv) served as control. Mr, DNA marker.
contrary, LPS markedly decreased the C4 mRNA expression in peritoneal macrophages. Recombinant IFN-q/ induced substantial upregulation of Clq, C2, C3, and C4 mRNAs in microglia and peritoneal macrophages. In cultured astrocytes, C2 mRNA was only detected after IFN-q/ treatment. There was no significant effect of LPS or IFN-3, on the expression of C3 and C4 mRNAs in astrocytes. None of the C9 mRNA expression was detected in any primary cultures examined, while it was observed in a liver sample. To investigate whether C3 protein is synthesized by the cultured cells that express C3 mRNA, the cells were metabolically labeled, and the immunoprecipitated C3 product from cultured medium was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and fluorography. The bands of 125 and 75 kDa, corresponding to C3 o~- and/3-chains, were detected in every cultured medium (Fig. 2.). Higher production of C3 was observed in astrocytes in agreement with the results of RTPCR analysis. The secretory pro-C3 (195 kDa) and additional unknown bands were observed in cultured astrocytes. Since pro-C3 is usually cell-associated in other cell types, it remains to be determined whether there is an altered processing of pro-C3 in astrocytes culture. LPS increased synthesis of C3 in both microglia and peritoneal macrophages, and to less degree in astrocytes. IFNhad a significant effect on the synthesis of C3 in microglia or peritoneal macrophages, while it had no effect in astrocytes. The marked increase of C3 synthesis in microglia or peritoneal macrophages that was brought about by the LPS or IFN-',/ treatment was not in parallel to the results of the minor increase of C3 mRNA expression in these cells. Possibly the PCR analysis is less quantitative compared to the immunoprecipitation analysis. Much attention has been focused on the roles of complement components in the CNS. In Alzheimer's disease brains complement components have been detected in senile plaques [3,7,12], and neurofibrillary tangles [52] by immunohistochemical studies. Recently, using in situ
A.A. Author / Neuroscience Letters 000 (1996) 191-194
Mo 2
Mic
Ast
3 1 2 3 1 2 3 M ~,~
kD
Urn" -125
Fig. 2. SDS-PAGE analysis under reducing conditions of immuoprecipitates from cultured cells (M~b,peritoneal macrophage; Mic, microglia; Ast, astrocytes) metabolically labeled with [35S]methionine. Non-treated (1) or treated with LPS (2) or IFN-3, (3). Longer exposure to the film revealed the bands for macrophages under basal condition (not shown).
hybridization technique, increased expression of Clq mRNA was reported in the cells that were immunoreactive for microglia marker (OX-42) in adult rats, following experimental lesions [13]. Further, Clq and C3 immunepositive microglia was shown in rat hippocampal lesions induced by kainic acid [1]. In the present study we demonstrated Clq, C2, C3, and C4 mRNA expression in mouse cultured microglia. These results suggest that microglia may be potential cells that produce complement components, especially in various types of CNS injury. IFN- 7 is a well-characterized lymphokine known to regulate many functions of mononuclear phagocytes. Increased expression of C2, C4, and factor B mRNAs has been reported in human monocytes and macrophages [16,17]. Our results, for the first time, showed that IFN-'y has significant effects on the synthesis of C3 protein and the expression of Clq, C2, C3, and C4 mRNAs in mouse cultured microgtia. LPS is a potent activator of humoral and cellular immunity. LPS stimulates mononuclear phagocytes to produce various substances including superoxide anion, prostaglandin E2, C3, and factor B [15]. Kulics reported that LPS decreased human monocytes C4 mRNA expression in a concentration dependent manner [9]. We also observed the downregulation of C4 expression in LPStreated mouse peritoneal macrophages. The reason for the suppression of C4 mRNA expression is uncertain, but macrophage adherence accompanied with the elicitation by mineral oil, casein, or endotoxine may provide a regulatory signal to decrease C4 expression. However, LPS slightly increased the C4 expression in our cultured microglia. The origin of microglia has currently been ascribed to bone marrow-derived monocytes. Microglia share characteristics with monocytes and macrophages in respect of immunohistochemical markers and functional properties. However, morphological, immunophenotypical and functional differences among mononuclear phagocytes have been well known. Our results support the notion that microglia comprise a functionally distinct subpopulation of mononuclear phagocytes.
193
Very recently Walker et al. showed expression of Clq and C3 mRNAs in human cultured microglia derived from postmortem brains [18]. In contrast to our results, IFN-3' had no effect on the gene expression of Clq and C3 mRNAs. Further, C4 mRNA expression was only detected after stimulation with IFN-3,. These results might be explained by the difference in species and/or maturation of cultured microglia used for analysis. Much higher gene expression of C3 and C4 mRNAs was detected in cultured astrocytes compared to those in microglia under the basal condition. C3 synthesis and secretion from astrocytes were observed as well. Astrocytes might participate in the production of complement proteins together with microglia, but the synthesis in situ remains to be determined. In response to brain lesions the complement synthesis may be enhanced in microglia and possibly in astrocytes. Complement may play key roles in the initiation of local inflammation. The complement degradation product such as C3b facilitates phagocytosis by opsonization. The terminal event in complement pathway results in the formation of membrane attack complex (C5b-9), which may cause lysis of target cells. These events could be effective on the removal of locally lesioned tissue in the CNS. On the other hand they may afflict the nerve cells, and thus finally could lead to the cell death or cell degeneration. Further clarification of complement system in the CNS is required.
[1] Akiyama, H., Tooyama, I., Kondo, H., Ikeda, K., Kimura, H., McGeer, E.G. and McGeer, P.L., Early response of brain resident microglia to kainic acid-induced hippocampal lesions, Brain Res., 635 (1994) 257-268. [2] Alonso, S., Minty, A., Bourlet, Y. and Buckingham, M., Comparison of three actin-coding sequences in the mouse; evolutionary relationships between the actin genes of warm-blooded vertebrates, J, Mol. Evol., 23 (1986) 11-22. [3] Eikenlenboom, P. and Stam, F.C., Immunoglobulins and complement factors in senile plaques, Acta Neuropathol. (Berlin), 57 (1982) 239-242. [4] Fey, G.H., Lundwall, A., Wetsel, R,A., Tack, B.F., de Bruijn, M.H.L. and Domdey, H., Nucleotide sequence of complementary DNA and derived amino acid sequence of murine complement protein C3, Philos. Trans, R. Soc. London, Ser. B., Biol. Sci., 306 (1984) 333-344. [5] Haga, S., Ikeda, K., Sato, M. and Ishii, T., Synthetic Alzheimer amyloid /3/A4 peptides enhance production of complement C3 component by cultured microglial cells, Brain Res., 601 (1993) 88-94. [6] Hemenway, C., Kalff, M., Stavenhagen, J., Walthall, D. and Robins, D., Sequence comparison of alleles of the fourth component of complement (C4) and sex-limited protein (Slp), Nucleic Acids Res., 14 (1986) 2539-2554. [7] Ishii, T. and Haga, S., Immuno-electron-microscopic localization of complements in amyloid fibrils of senile plaques, Acta Neuropathol. (Berlin), 63 (1984) 296-300. [8] Ishikawa, N., Nonaka, M., Wetsel, R.A. and Colten, H.R., Murine complement C2 and factor B gemonic and cDNA clonig reveals different mechanisms for multiple transcripts of C2 and B, J. Biol. Chem., 265 (1990) 19040-19046. [9] Kulics, J., Colten, H.R. and Perlmutter, D.H., Counterregulatory
194
[10]
[11]
[12]
[13]
[14]
S. Haga et al. / Neuroscience Letters 216 (1996) 191-194
effects of interferon-.), and endotoxin on expression of the human C4 genes, J. Clin. Invest., 85 (1990) 943-949. L6vi-Strauss, M. and Mallat, M., Primary cultures of mufine astrocytes produce C3 and factor B, two components of the alternative pathway of complement activation, J. Immunol., 139 (1987) 23612366. Lorsbach, R.B., Murphy, W.J., Lowenstein, C.J., Snyder, S.H. and Russell, S.W., Expression of the nitric oxide synthase gene in mouse macrophages activated for tumor cell killing, J. Biol. Chem., 268 (1993) 1908-1913. McGeer, P.L., Akiyama, H., Itagaki, S. and McGeer, E.G., Activation of the classical complement pathway in the brain tissue of Alzheimer patients, Neurosci. Lett., 107 (1989) 341-346. Pasinett~, G.M., Johnson, S.A., Rozovsky, I., Lampert-Etchells, M., Morgan, D.G., Gordon, M.N., Morgan, T.E., Willoughby, D. and Finch, C.E., Complement ClqB and C4 mRNAs responses to lesioning in rat brain, Exp. Neurol., 118 (1992) 117-125. Stanley, K.K. and Herz, J., Topological mapping of complement component C9 by recombinant DNA techniques suggests a novel mechanism for its insertion into target membranes, EMBO J., 6 (1987) 1951-1957.
[15] Strunk, R.C., Whitehead, A.S. and Cole, F.S., Pretranslational regulation of the synthesis of the third component of complement in human mononuclear phagocytes by the lipid A portion of lipopolysaccharide, J. Clin. Invest., 76 (1985) 985-990. [16] Strunk, R.C., Cole, F.S., Perlmutter, D.H. and Colten, H.R., 3,_ Interferon increases expression of class III complement genes C2 and factor B in human monocytes and in murine fibroblasts transfected with human C2 and factor B genes, J. Biol. Chem., 260 (1985) 15280-15285. [17] Vincent, F., De La Salle, H., Bohbot, A., Bergerat, J.P., Hauptmann, G. and Oberling, F., Synthesis and regulation of complement components by human monocytes/macrophages and by acute monocytic leukemia, DNA Cell Biol., 12 (1993) 415-423. [18] Walker, D.G., Kim, S.U. and McGeer, P.L., Complement and cytokine gene expression in cultured microglia derived from postmortem human brains, J. Neurosci. Res., 40 (1995) 478-493. [19] Wood, L., Pulaski, S. and Vogeli, G., cDNA clones coding for the complete murine B chain of complement Clq: nucleotide and derived amino acid sequences, Immunol. Lett., 17 (1988) 59-62.