- Email: [email protected]
Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001
Virology 328 (2004) 301 – 310 www.elsevier.com/locate/yviro
Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001 Comparison with the South African Strain SAAR-1776 and other flaviviruses Tama´s Bakonyia,b, Ernest A. Gouldc, Jolanta Kolodziejeka, Herbert Weissenbfckd, Norbert Nowotnya,e,* a
Zoonoses and Emerging Infections Group, Clinical Virology, Clinical Department of Diagnostics, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria b Department of Microbiology and Infectious Diseases, Faculty of Veterinary Sciences, Szent Istva´n University, H-1143 Budapest, Hungary c Centre for Ecology and Hydrology, Natural Environment Research Council, Oxford, OX1 3SR, United Kingdom d Institute of Pathology and Forensic Veterinary Medicine, Department of Pathobiology, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria e Department of Medical Microbiology, Faculty of Medicine and Health Sciences, United Arab Emirates University, Al Ain, United Arab Emirates Received 4 July 2004; returned to author for revision 30 July 2004; accepted 7 August 2004 Available online 9 September 2004
Abstract Here we describe the complete genome sequences of two strains of Usutu virus (USUV), a mosquito-borne member of the genus Flavivirus in the Japanese encephalitis virus (JEV) serogroup. USUV was detected in Austria in 2001 causing a high mortality rate in blackbirds; the reference strain (SAAR-1776) was isolated in 1958 from mosquitoes in South Africa and has never been associated with avian mortality. The Austrian and South African isolates exhibited 97% nucleotide and 99% amino acid identity. Phylogenetic trees were constructed displaying the genetic relationships of USUV with other members of the genus Flavivirus. When comparing USUV with other JEV serogroup viruses, the closest lineage was Murray Valley encephalitis virus (nt: 73%, aa: 82%) followed by JEV (nt: 71%, aa: 81%) and West Nile virus (nt: 68%, aa: 75%). Comparison of the genomes showed that the conserved structural elements and putative enzyme motifs were homologous in the two USUV strains and the JEV serogroup. The factors that determine the severe clinical symptoms caused by the Austrian USUV strain in Eurasian blackbirds are discussed. We also offer a possible explanation for the origins and dispersal of USUV, JEV, and MVEV out of Africa. D 2004 Elsevier Inc. All rights reserved. Keywords: Usutu virus; Austria; Emerging mosquito-borne flavivirus; Blackbird mortality; USUV; SAAR-1776; Complete nucleotide sequences; Genome analysis and comparison; Phylogenetic analysis; Flaviviridae
Introduction
* Corresponding author. Zoonoses and Emerging Infections Group, Clinical Virology, Clinical Department of Diagnostics, University of Veterinary Medicine, Vienna, Veterin7rplatz 1, A-1210 Vienna, Austria. Fax: +43 1 25077 2790. E-mail addresses: [email protected] (T. Bakonyi)8 [email protected] (E.A. Gould)8 [email protected] (J. Kolodziejek)8 [email protected] (H. Weissenbfck)8 [email protected] (N. Nowotny). 0042-6822/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2004.08.005
An African mosquito-borne flavivirus emerged in Austria in 2001 causing extensive die-off in the wild bird populations in Vienna and its surroundings (Weissenbfck et al., 2002), resembling the beginning of the West Nile virus (WNV) epidemic in the United States (Anderson et al., 1999; Lanciotti et al., 1999). The causative agent was isolated and identified as Usutu virus (USUV), a member of the Japanese encephalitis virus (JEV) serogroup within the family
302
T. Bakonyi et al. / Virology 328 (2004) 301–310
Flaviviridae. Although the virus had been detected several times in different mosquito and bird species in Africa, it had never before been associated with fatal or even overt clinical disease in birds or mammals. Therefore, USUV was considered to be unimportant in terms of pathogenicity and has largely been ignored, despite its close relationship to WNV and other more pathogenic flaviviruses in the JEV serogroup (Burke and Monath, 2001). However, following its emergence in Europe, USUV has proven to be highly pathogenic for several species of wild birds, especially Eurasian Blackbirds (Turdus merula). Moreover, the virus is now enzootic in Austrian wild birds having been observed for three consecutive years (Weissenbfck et al., 2003) and it has also been detected in local mosquito species. Therefore, its further dispersal throughout Central Europe is considered to be highly likely and potentially of major significance for our understanding of flavivirus emergence in general. Indeed, the presence of USUV was recently reported in the United Kingdom, based on serological tests of different wild bird species although there have been no associated bird deaths in the United Kingdom (Buckley et al., 2003). Flaviviruses infect arthropods, birds, and mammals including human beings, and some, i.e., Yellow fever virus (YFV), Dengue virus (DENV), and WNV, are of major public health importance (Burke and Monath, 2001). Therefore, the introduction onto a new continent of a previously exotic flavivirus that is closely related to other pathogenic flaviviruses is potentially a serious threat for a wide range of avian and mammalian species, including humans. Flaviviruses are spherical, enveloped viruses, 40–60 nm in diameter. The virion comprises three structural proteins, the capsid (C), membrane (M), and envelope (E) proteins and an 11 kb single-stranded, positive-sense RNA genome (Rice et al., 1986). The complete nucleotide sequence of several flaviviruses has been determined (National Center for Biotechnology Information). The genomic RNA contains a 5V cap structure, but lacks a polyadenylated tail. It acts as mRNA for translation of a single open reading frame (ORF) encoding the viral proteins as a large polyprotein that is co- and posttranslationally processed by cellular and viral proteases into at least 10 separate products. The N-terminal region encodes the structural proteins C, pre-M, and E, followed by the nonstructural proteins NS1 (soluble complement-fixing antigen), NS2A and NS2B, NS3 (serine protease/RNA helicase), NS4A, NS4B, and NS5 (RNAdependent RNA polymerase/methyltransferase) (Rice et al., 1985). Based on cross-neutralization studies employing polyclonal antisera, flaviviruses have been divided into eight antigenic complexes; several viruses, however, could not be assigned to any group (Calisher et al., 1989). Recently, a comprehensive phylogenetic analysis involving 68 flaviviruses was carried out on partial nucleotide sequences of the NS5 coding- and 3V noncoding regions (Kuno et al., 1998). According to the sequence identities and phylogenetic trees, the genus Flavivirus segregated into 14 clades belonging to
three clusters. Using these data and taking into account the criteria outlined in the VIIth Report of the International Committee on Taxonomy of Viruses, USUV was classified in the Japanese encephalitis virus group of the mosquitoborne cluster, together with Cacipacore virus (CPCV), Koutango virus (KOUV), JEV, Murray Valley encephalitis virus (MVEV), Alfuy virus (ALFV), St Louis encephalitis virus (SLEV), WNV, Kunjin virus (KUNV), and Yaounde virus (YAOV) (Heinz et al., 2000). The aims of this study were to sequence and compare the complete genomes of the USUV strain that emerged in Austria in 2001 with the South African USUV reference strain SAAR-1776. It was hoped that by combining this information with that obtained previously for both USUV and its closest genetic relatives, a parsimonious explanation could be developed for the unexpected appearance of this virus in a virulent form in Vienna in 2001.
Results RT-PCR and nucleotide sequencing Following the initial amplification of viral RNA using the degenerate primers described in Materials and methods, a total of 69 primers was finally applied in specific RT-PCR and sequencing reactions to determine the sequence of the complete genome of the two strains of USUV (Table 1). The sequences of the fragments were compiled to produce 11066- and 11064-nt-long nucleotide sequences representing the complete genome of USUV strains Vienna 2001blackbird and SAAR-1776, respectively. Analysis of the sequences One large ORF was identified within the USUV genome between nt positions 97 and 10401. The putative amino acid (aa) sequence of the 3434-aa-long polyprotein precursor was translated. Based on the amino acid alignments of the polyprotein precursor sequences of the JEV group viruses, the putative mature proteins, conserved structural elements, and putative enzyme motifs were also localized: The anchored core (C) protein was located between nt positions 97 and 474; within this region, the C protein was located between nt 97 and 412. The premembrane (PreM) protein was encoded from nt 475 to nt 975, with the M protein between nt 751 and 975. The envelope (E) protein was encoded between nt positions 976 and 2475, followed by the nonstructural proteins NS1 (nt 2476–3531), NS2a (nt 3532–4212), NS2b (nt 4213– 4605), NS3 (nt 4604–6462), NS4a (nt 6463–6840), 2K protein (nt 6841–6909), NS4b (nt 6910–7683), and NS5 (nt 7684–10398), respectively. Amino acid homologies were found in the polyprotein precursor sequences of flaviviruses, i.e., residues for intramolecular bonds or enzyme motifs. Amino acid substitu-
T. Bakonyi et al. / Virology 328 (2004) 301–310
303
Table 1 Oligonucleotide primers employed for amplification and sequencing of the USUV genomes Namea
Sequence 5V to 3V
Positionb
Product length (bp)
Usu1f Usu603f Usu1714r Usu2328f Usu3145r Usu3606f Usu4759r Usu4251f Usu5392r Usu5454f Usu5790r Usu6585f Usu7357r Usu10596f Usu11014r Usu306r Usu731r Usu488f Usu1401r Usu1155f Usu1600r Usu1537f Usu2505r Usu2383f Usu3098r Usu3067f Usu3666r Usu3653f Usu5645r Usu3657f Usu5204r Usu4005f Usu4519r Usu4403f Usu5358r Usu4763f Usu5080r Usu5201f Usu5625r Usu5569f Usu6270r Usu5709f Usu7303r Usu6217f Usu6607r Usu6522f Usu6954r Usu7272f Usu9175r Usu7314f Usu8033r Usu7757f Usu8599r Usu8044f Usu9179f Usu9614r Usu9600f Usu10257r Usu10746f SAAR544f SAAR6804r
AGWMGTTYRYCTGCGTGARC TGTGAKGAYACYATCACKTA GTGGCRTGHGSYTCTTCAAA CTCTTTGGRGGRATGTCHTG GTGCADGATTTKACYTCTCC AAGAGGTGGACGGCCARRHT GTGTGCCAYAGYGTGTGGAA ATGTTYGCCATYGTWGGDGG TGGCACATSACATCMACKAT ATGGATGAAGCYCATTTCAC GGTAYTCYGTMTCATAGGAC ATGGCTCTYGARGARCTRCC TTCATKATDCCAGCVGCTGT GWAAGCCTCYCAGAACCGTCTCGGAAG AGATCCTGTGKTCTWSYYCMCCAYCAG TTGCCGTGGTCTTGTTGATG CGCTTCGAGTGTCTGGTTCT GACCATCAACGCGACTGATA CAGAGCTGGTAGAACCATGT CTAGCCACTGTCTCATATGT ATGTAGTATGCCTCGGTGTT GGTTGAACACCGAGGCATAC CTTGTCCACAGCGCAACTCT ATCGCACTGGTGATGTTAGC CAGCCGTCCCAATTATTGAG TGACTGAGACAGCTCAATAA TAAGCAGGTCAGTGTAAGTG CACTGACCTGCTTAGGTATG GCACCTCAGCTTGTATGTCT GACCTGCTTAGGTATGTTCT ATCACTGTCAGCTGCTTCTT TGGCATGAGACTGCTCTACC ATGCCGTCATACGGATGACC CAGCCAACGCCTAGATGTAA CCACTATCTCTGTGCCACTA TGGTGAAGGAAGGCTCACTC ACGATGGCACTGACATACGA AGAAGCAGCTGACAGTGATG GCACCTCAGCTTGTATGTCT CCAATGCACCAGTTACAGAC ACTTCCTGTCGGTGTACTGT TCGTCGCTAGTGTGAAGATG CCGCAGTGATCAGAGTTGTT ACTGCAGACCTGCCAGTGTG AGAGCGTCCGGCAACTCTTC TATCTGGTGGCGACAGCTGA GTTGACGTGTGCTGGAGAAT CCAAGTGTCGTTAACAACTC TTCAACACCTCCTCCAGAAT AGAACAGCGGCCGGAATCAT GACAAGGTTCCAGCCATAGC AAGAGGCCATCACTGAAGTC TTCCGTGGTAGGTCCAGGTC GCGGAGTGGACGTGTATTAT AGGAGGTGTTGAAGGACTTG CCAGGTTCTCACAGCGTATT GCTGTGAGAACCTGGCTCTT CCTGGTTAATGGCTGCGTAG CAAGCGAACAGACGGTGATG ACCAGTGCTGGATTAGAG CATGAGCAGAGCCAGCAATA
1–20 607–626 1699–1718 2329–2348 3127–3146 3607–3626 4741–4760 4252–4271 5374–5393 5455–5474 5772–5791 6586–6605 7339–7358 10646–10672 11038–11064 309–328 721–740 510–529 1404–1423 1159–1178 1564–1583 1555–1578 2508–2527 2413–2432 3018–3037 3006–3025 3678–3697 3684–3703 5607–5626 3688–3707 5161–5180 4011–4030 4506–4525 4425–4444 5361–5380 4785–4804 5083–5102 5162–5181 5607–5626 5591–5610 6273–6292 5690–5709 7242–7261 6223–6242 6595–6614 6544–6563 6957–6976 7230–7249 9194–9213 7336–7355 8036–8055 7769–7788 8592–8611 8066–8085 9201–9220 9617–9636 9622–9641 10287–10306 10795–10804 569–586 6785–6804
740c 1112 818 1152 1142 337 773 419 328d 740e 914 425 973 625 692 1943 1493 515 656 318 465 702 1572 392 433 1984 720 843 546f 436 685 270g 855h 477i (continued on next page)
304
T. Bakonyi et al. / Virology 328 (2004) 301–310
Table 1 (continued) Namea
Sequence 5V to 3V
Positionb
SAAR9532f SAAR10124r WNV9031f WNV10091r WNV10090f WNV10807r WNV10460f WNV10889r
AACATTGCCGTCCAGCTCAT TCCACACTTGTCCACACTTC TACAACATGATGGGVAARAGAGAGA AGCATGTCTTCYGTBGTCATCCAYT GARTGGATGACVACRGAAGACATGCT GGGGTCTCCTCTAACCTCTAGTCCTT GCCACCGGAAGTTGAGTAGA GCTGGTTGTGCAGAGCAGAA
9532–9551 10129–10148 9043–9067 10103–10127 10102–10127 10829–10854 10564–10583 10986–11005
Product length (bp) 617 1085 753 442
a
Italics: degenerated JEV group specific primers. SAAR: primers applied to sequence genomic segments of strain SAAR-1776; WNV: WNV-specific primers published earlier (Weissenbo¨ck et al., 2002). Numbers refer to the approximate locations based on the consensus sequence of MVV, JEV, and WNV alignments. f: forward primer; r: reverse primer. b Positions refer to the genome of USUV strain SAAR-1776 (GenBank accession number AY453412). c With primer Usu731r. d Sequencing primer of PCR product Usu1f–Usu731r. e With primer Usu1f. f Sequencing primer of amplicon Usu7757f–Usu8599r. g Sequencing primer of amplification product Usu10596f–Usu11014r. h Sequencing primer of PCR product Usu488f–Usu1401r. i Sequencing primer of amplicon Usu5709f–Usu7303r.
tions and conserved motifs are presented in Table 2 and Fig. 1. In the envelope protein region, the 12 Cys residues (in positions 3, 30, 60, 74, 92, 105, 116, 121, 190, 287, 304, and 335) involved in intramolecular disulfide bonds (Nowak and Wengler, 1987) aligned with those in all other flaviviruses analyzed. This was also the case for the putative integrin binding motif (Arg387–Gly388–Asp389), which is a suspected
pathogenicity determinant of flaviviruses (Lee et al., 2000). The Glu306 and Asp389 residues, which are involved in a receptor-binding domain for viral attachment to sulfated proteoglycans (Lee and Lobigs, 2002; Lindenbach and Rice, 2001; Mandl et al., 2000), also aligned with those in the JEVgroup viruses. In the NS1 protein region, another 12 Cys residues (in positions 4, 15, 55, 143, 179, 223, 280, 291, 312, 313, 316, and 329) that form intramolecular disulfide bonds
Table 2 Amino acid substitutions and conserved regions within the precursor polyprotein of USUV strains
Aa positions refer to the complete precursor polyprotein sequence of the USUV Vienna strain. Relative aa positions refer to the protease cleavage sites. Substitutions in homologous positions of the MVEV, JEV, and WNV polyprotein precursors are also indicated. Conserved structural elements of the JEV serogroup viruses are demonstrated in the bottom panel. The receptor-binding domain for viral attachment to sulfated proteoglycans is indicated with n. The catalytic triad of the trypsin-like protease is indicated with *.
T. Bakonyi et al. / Virology 328 (2004) 301–310
305
Fig. 1. Amino acid substitutions and conserved regions within the precursor polyprotein of USUV strains.
were found in homologous positions in USUV and in the other JEV serogroup viruses (Mason, 1989). In the N-terminal third of the NS3 protein, the proposed catalytic triad (His47, Asp75, and Ser135) and substrate binding pocket (Gly133, Ser135, Gly136, Gly148, Leu149, and Gly153) of the trypsin-like serine protease (Valle and Falgout, 1998) was also found conserved in USUV, as well as the RNA helicase motif Asp285–Glu286– Ala287–His288 at the C-terminal third of the protein (Gorbalenya et al., 1989). Similar to other flaviviruses, the homologous Gly667–Asp668–Asp669 motif common to RNA-dependent RNA polymerase enzymes (Rice et al., 1985) was found in the C-terminal third of the NS5 protein. Comparing the nucleotide sequences of the two USUV isolates, the nucleotide substitutions were distributed fairly evenly over the entire genome. Within the 96-nt-long 5V untranslated region (UTR), three mutations were found at nt positions 31, 32, and 38. In total, 306 nt substitutions were found in the ORF resulting in 25 aa changes in the putative polyprotein precursor sequence (Table 2). The 3V UTR contained 21 nucleotide changes comprising two A insertions in a polyA region between nt positions 10945 and 10951 of the USUV Vienna strain (Table 3). This particular region is also highly variable in other flaviviruses. Flaviviruses share common secondary structural elements of the 5V and 3V UTRs forming terminal stem-loop sequences necessary for the translation and replication of the genome (Shi et al.,
1996). Mutations engineered in these regions led to limited host-range phenotypes (usually in mosquitoes), suggesting that these regions may interact with host-specific factors (Zeng et al., 1998). The recognized conserved sequence motifs of the 3V stem loop within the JEV serogroup viruses were also conserved in the USUV viruses (motifs CS2, RCS2, and TL2; Proutski et al., 1997) at nt positions 10908– 10929, 10830–10851, and 10886–10894, respectively). The amino acid sequences of the two USUV strains were identical in the C, preM, M, NS2b, and 2K protein regions. A particularly high level of sequence divergence was found in the anchored part of the C protein in the different JEV serogroup viruses, but the two USUV isolates differed from each other only in one aa in this region (Val/Ala16). In the E protein region, five aa substitutions were detected between the USUV strains. Regarding these changes, in positions Gly320, Thr423, and Asn457, USUV Vienna was identical with MVEV, JEV, and WNV; while in position Gly276, USUV SAAR was identical with the JEV serogroup viruses. In position Met126, each of the five viruses differed from each other. In regions NS1, NS2a, and NS4b, eight aa substitutions were found between the two USUV strains, and most of these differed from the other JEV serogroup viruses. However, in the NS3 and NS4a regions, where the USUV strains differed from each other (by seven amino acids), they were identical with at least one of the following JEV serogroup viruses:
Table 3 Nucleotide substitutions of the 3VUTR region in USUV strains Vienna and SAAR-1776, aligned to JEV serogroup viruses
(A) Nucleotide positions refer to the complete genome sequence of USUV Vienna. (B) Alignment of a partial region of the 3VURT containing nucleotide insertions/deletions in the USUV strains.
306
T. Bakonyi et al. / Virology 328 (2004) 301–310
Table 4 Analysis of the amino acid and nucleotide substitutions within the USUV strains Vienna and SAAR-1776 compared to the homologous positions in MVEV, JEV, and WNV sequences Identical substitutions
MVEV aaa
ntb
Total ntc
JEV aaa
ntb
Total ntc
WNV aaa
ntb
Total ntc
USUV Vienna USUV SAAR
11/25 5/25
19/29 7/29
115/330 104/330
11/25 7/25
14/29 9/29
107/330 121/330
10/25 5/25
14/29 12/29
113/330 107/330
a
Number of identical amino acids between the USUV strain and the related JEV group flaviviruses within the 25 aa substitutions of the two USUV strains. Number of identical nucleotides between the USUV strain and the related JEV group flaviviruses within the 29 nt substitutions of the two USUV strains responsible for aa changes. c Number of identical nucleotides between USUV and the related JEV group flaviviruses within the 330 nt substitutions of the two USUV strains. b
MVEV, JEV, or WNV (Table 2). A high level of sequence variation was found in the N-terminal region of the NS4b protein of the JEV serogroup viruses, the two USUV strains differed in two amino acids in this section. The NS5 protein exhibited the lowest level of sequence divergence, with only five aa substitutions in the 905-aa-long peptide. Table 5 Complete flavivirus genomic nucleotide sequences and complete polyprotein precursor amino acid sequences used for the phylogenetic analyses Virus name
Abbreviation
ALKV APOIV CFAV
Nucleotide accession number NC_004355 NC_003676 NC_001564
Protein accession number NP_722551.1 NP_620045.1 NP_041725.1
Alkhurma virus Apoi virus Cell Fusing Agent virus Deer Tick virus Dengue virus 2 Dengue virus 4 Japanese Encephalitis Virus Kamiti River virus Langat virus Louping Ill virus Modoc virus Montana myotis leukoencephalitis virus Murray Valley Encephalitis Virus Omsk Hemorrhagic Fever virus Powassan virus Rio Bravo virus Tamana Bat virus Tick Borne Encephalitis virus Europe Tick Borne Encephalitis virus Siberia Usutu virus strain SAAR-1776 Usutu virus strain Vienna 2001blackbird West Nile Virus Yellow Fever virus Yokose virus
DTV DENV2 DENV4 JEV
NC_003218 M19197 M14931 NC_001437
NP_476520.1 AAA42962.1 AAA42964.1 NP_059434.1
KRV LGTV LIV MODV MMLV
NC_005064 NC_003690 NC_001809 NC_003635 NC_004119
NP_891560.1 NP_620108.1 NP_044677.1 NP_619758.1 NP_689391.1
MVEV
NC_000943
NP_051124.1
OHFV
NC_005062
NP_878909.1
POWV RBV TABV TBEE
NC_003687 NC_003675 NC_003996 NC_001672
NP_620099.1 NP_620044.1 NP_658908.1 NP_043135.1
TBES
L40361
AAF82240.2
USUV SAAR USUV VIENNA
AY453412
WNV YFV YOKV
NC_001563 NC_002031 NC_005039
AY453411
NP_041724.1 NP_041726.1 NP_872627.1
The detailed analysis of the 25 aa positions, in which the USUV strains differ from each other revealed that USUV Vienna, rather than the USUV SAAR strain, was more frequently identical with MVEV, JEV, and WNV (Tables 2 and 4). When nucleotide changes responsible for the aa substitutions were analyzed, a similar result was observed (Table 4). Interestingly, when analyzing all nucleic acid mutations (including silent mutations) of the two USUV strains, the above-mentioned phenomenon was not observed. The nucleotide and amino acid sequences of the USUV strains were aligned to all complete flavivirus sequences available in the GenBank database (Table 5). The USUV strains showed 97% nucleotide and 99% amino acid identity to each other. When comparing USUV with other flaviviruses, the highest nucleotide sequence identity was found
Fig. 2. Phylogenetic tree illustrating the genetic relationship between flaviviruses based on their complete genome sequences. (Abbreviations and accession numbers are listed in Table 5. The JEV group viruses are marked with grey underlay. Bar on the left demonstrates the genetic distance. The bootstrap values were in all cases 1000 with the only exception of the MVEV-USUV junction, where it was 970.)
T. Bakonyi et al. / Virology 328 (2004) 301–310
Fig. 3. Phylogenetic tree illustrating the genetic relationship between flaviviruses based on the putative amino acid sequences of the polyprotein precursor. (Abbreviations and accession numbers are listed in Table 5. The JEV group viruses are marked with grey underlay. Bar on the left demonstrates the genetic distance. Internal labels represent the bootstrap values of 1000 replicates, where they were lower than 1000.)
with representatives of the JEV group: MVEV (73%), JEV (71%), and WNV (68%). Representatives of other less closely related members of the Flavivirus genus exhibited between 56% (DENV2–4) and 43% (Tamana bat virus; TABV, a tentative species in the genus) nucleotide identity to USUV. Phylogenetic trees, based on the entire genome sequences, were constructed to investigate the evolutionary relationships between USUV and other flaviviruses. Trees based on either nucleotides (Fig. 2) or amino acids (Fig. 3) confirmed the closer relationship of USUV to MVEV, JEV, and WNV, in that order, than with members of other flavivirus serogroups.
Discussion In some ways, the circumstances surrounding the emergence of USUV in Vienna, Austria, during 2001 (Weissenbo¨ck et al., 2002), resemble the appearance of WNV in New York in 1999. In both situations, the virus was observed for the first time on a new continent, and in both cases it was associated with significantly increased virulence for birds compared with the recognized African parent virus. However, following its introduction through New York, WNV had dispersed very widely over North America within 3 years whereas the Austrian USUV appeared to have remained relatively localized in Vienna and the neighboring federal state of Lower Austria (Weissenbo¨ck et al., 2003), spreading so far only around 50 km per season. Before this study, genetic information
307
was available only for a very small (approximately 1 kb) fragment of USUV. Therefore, to attempt to explain the apparent differences in virulence and the emergence and subsequent limited dispersion relating to USUV, we felt it was justified to determine and compare the entire genomic sequences of the Austrian and the South African reference strain of USUV, and also to compare these with other closely related bird associated flaviviruses, particularly MVEV, JEV, and WNV. Comparison of the sequences of the South African and Austrian USUV strains revealed that they are closely related and share the common conserved structural motifs and known pathogenicity determinants present in other related flaviviruses. However, significant amino acid substitutions were distributed throughout the open reading frame of the Austrian strain, which may not only influence the apparent differences in virulence for birds of the two strains of USUV but which may also reflect on the evolutionary origins and dispersal of USUV, MVEV, JEV, and WNV. Although limited information is available on the distribution and pathogenicity of USUV in Africa, it is apparently nonpathogenic for local bird populations, either because it is a naturally nonvirulent virus or possibly because of immunity and/or genetic resistance arising in the bird population as the result of exposure to USUV and other antigenically related flaviviruses over a long period of time. Although the virus has never been associated with disease in birds in Africa, it must be borne in mind that enzootics in wild bird populations are not easy to detect. On the other hand, Austrian dead birds were mainly found in urban areas, in gardens or parks, rather than in the natural environment, where the corpses quickly disappear. In Austria, before the appearance of pathogenic USUV, there were no identified flavivirus pathogens of birds. Although tick-borne encephalitis virus is widespread in Austria, it has never been associated with disease in birds. Moreover, WNV was isolated from mosquitoes at the Czech– Austrian border, 70 km from Vienna (Hubalek et al., 1998), but it has never been associated with outbreaks in the local birds or in other vertebrates. Although the two strains of USUV shared N99% amino acid identity, and the phylogenetic trees based on the complete nucleic acid and amino acid sequences demonstrated a close relationship between the Austrian and the South African USUV strain (Figs. 2 and 3), there was sufficient difference in specific amino acid substitutions to conclude that these viruses have evolved independently. In other words, the Austrian strain seems not to be simply the South African strain introduced in the year 2000 by migrant birds (Weissenbo¨ck et al., 2002). Indeed, comparative analysis of the amino acid substitutions of the two USUV strains and the other JEV group viruses suggests that the Austrian strain may be genetically even closer than the South African strain to other flaviviruses that have emerged into Eurasia and Australia. Thus, based on the amino acid signature analysis, the Austrian USUV lineage might
308
T. Bakonyi et al. / Virology 328 (2004) 301–310
represent a genetic link between Australian MVEV and ALFV, Asian JEV, and the related viruses in Africa such as WNV. Therefore, by analogy with current thinking on WNV dispersal out of Africa, which has dispersed across Asia to appear as Kunjin virus in Australia (Buckley et al., 2003; Gould et al., 2003), the USUV lineage could represent an equivalent exodus of an African virus eventually leading to the emergence of JEV in south east Asia and MVEV/ALFV in Australasia and Australia. While this explanation may be viewed as too far-reaching at this stage of our knowledge, we believe it should not be ignored because of the potentially serious implications of emerging pathogens in Europe. In Africa, USUV has been isolated more than once in geographic regions thousands of kilometers apart (i.e., in South Africa and in the Central African Republic). Such geographic separation provides the opportunity for the evolution of distinct lineages either one of which could represent the Austrian strain. Similar badaptive evolutionQ has been identified in North America for two closely related tick-borne flaviviruses, Powassan virus (POWV) and Deer tick virus (DTV), representing an equivalent divergence in which the two separate combinations of ticks and their vertebrate hosts were sufficiently geographically separated to allow the viruses (the same virus originally) to evolve distinctly (Ebel et al., 2001). Alternatively, the Austrian strain may have evolved independently of the African strain after being introduced into Vienna. However, this latter possibility appears less likely because there has been little evidence of genetic change during the 3 years since its isolation in Austria. These results support the view that the avian pathogenic USUV strain is not being annually reintroduced into the Vienna region of Austria from Africa, but has been introduced only once and has established an efficient transmission cycle between local bird and mosquito species, as we have demonstrated recently (unpublished observations). The Austrian USUV became a resident pathogen in the eastern part of Austria, and is slowly radiating to neighboring federal states and countries. On the other hand, USUV is not only present in Africa and in the eastern part of Austria. In the United Kingdom, seropositivity was found against USUV in blackbirds, magpies, carrion crows, and turkeys, which are not migratory birds, implying that they have become infected within the United Kingdom (Buckley et al., 2003). It is possible that lowvirulence USUV strains are widespread over Europe, but because they do not cause overt disease, they have not yet been detected, and because they cross-react with WNV in routine serological tests, they may have been identified as WNV. On the other hand, there is a specific, although laborious, serological test for USUV available [plaque reduction neutralization test (PRNT)], which can differentiate between antibodies induced by USUV, WNV, and other flaviviruses; only when the hosts have been infected with both USUV and WNV, or multiple times with the same virus, cross-reactivity may be observed also in PRNT. Circulating low-virulence strains of USUV in Europe might
be expected to induce protective immunity against virulent infections in a range of bird species. Taking all of these factors into account, at least two theories could explain the emergence of USUV in Austria. A possible scenario is that a virulent strain was introduced to Vienna, either via importation of infected birds to the Vienna Zoo from Africa, or by migratory birds. However, importation of wild birds from exotic countries is monitored closely and the animals are quarantined for a long time. Moreover, no such imports were registered during the years 2000 and 2001. The presumed newly introduced virus may have been particularly pathogenic for blackbirds because they are nonmigratory and therefore will not have preexisting immunity because they have not been exposed to the virus in Africa. The fact that WNV does not appear to be a bird pathogen in Austria also means that cross-protective antibodies are unlikely to be present in the blackbirds. Another possibility is that blackbirds are more genetically susceptible to the Austrian USUV than other Austrian local (nonmigratory) bird species that have been affected far less. A third and perhaps less likely possibility is that the putative widespread and less virulent South African strain was introduced into Austria, adapted to blackbirds and became more virulent for this species. Evidence as to whether such changes occurred awaits more extensive molecular and especially serological analysis of African and Austrian as well as U.K. and possibly other European isolates of USUV. Whatever the explanation for the appearance and unusual virulence and dispersal characteristics of USUV, it is intriguing that within a short period of time, USUV and WNV first emerged in large western cities, Vienna and New York, with airports and several other possibilities of introduction of exotic viruses. Whether or not other equivalent bird-associated arboviruses such as JEV will follow this pattern remains to be seen.
Materials and methods Virus strains The USUV reference strain SAAR-1776 was originally isolated by Dr. B.M. McIntosh from Culex neavei collected in Ndumu, Natal, South Africa, on January 30, 1959. It was passaged seven times in mice by Dr. J. Casals (Yale Arbovirus Research Unit, New Haven) and once by Dr. J. Porterfield (National Institute for Medical Research, Mill Hill, London) in 1968. Recently, the strain was passaged again in suckling mice and stored freeze-dried. The Austrian strain 939/01, designated USUV Vienna 2001-blackbird, was isolated in Vero cell culture, following inoculation with a brain homogenate of a blackbird found dead in Perchtoldsdorf (Mfdling) near Vienna on September 4, 2001. Usutu virus-specific RNA and antigen had been identified in several organs of the bird by RT-PCR,
T. Bakonyi et al. / Virology 328 (2004) 301–310
immunohistochemistry, and in situ hybridization. The virus isolate was passaged two times in Vero cells and then stored frozen at 808C. RT-PCR Viral RNA was extracted from 140-Al virus suspension using the QIAamp viral RNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. For the amplification of the complete USUV genome, universal JEV group oligonucleotide primers were designed: Multiple alignment was performed on the genomic sequences of MVEV, JEV, and WNV (GenBank accession numbers NC_000943, NC_001437, and NC_001563, respectively), and the most conserved regions were identified. A total of 34 20-nt-long genomic stretches were selected, where the number of nucleotide mismatches in the consensus sequence was lower than six, and the sequences met the standard criteria of oligonucleotide primer molecules. Degenerate primer pairs were designed in these regions containing a mixture of the probable nucleotide variations. RT-PCR assays involving the selected primers were applied to the extracted RNA, and when specific products of the expected size were detected, the amplicons were sequenced. Based on these specific sequences, further primer pairs were designed to produce overlapping RT-PCR products covering the entire genome of USUV. In cases where the amplicons were too long to be sequenced in one step, additional sequencing primers were applied. The oligonucleotide primer sequences, locations (referring to nt positions of USUV strain SAAR-1776, accession number AY453412) and product sizes are shown in Table 1. The oligonucleotides were designed with the help of the Primer Designer 4 for Windows 95 program (Scientific and Educational Software, version 4.10, serial number 563-097-7776), and were synthesized by GibcoBRL Life Technologies, Ltd. (Paisley, Scotland, UK). Reverse transcription and amplification were performed with a continuous RT-PCR method using the QIAGEN OneStep RT-PCR Kit (Qiagen). Each 25-Al reaction mixture contained 5 Al of 5 buffer (final MgCl2 concentration 2.5 mM), 0.4 mM of each deoxynucleoside triphosphate (dNTP), 10 U RNasink RNase Inhibitor (Promega, USA), 20 pmol of the appropriate forward and reverse primers, 1 Al of enzyme mix (containing Omniscriptk and Sensiscriptk Reverse Transcriptases and HotStarTaqk DNA polymerase) and 2.5 Al of template RNA. Reverse transcription was carried out at 508C for 30 min, followed by a denaturation step at 958C for 15 min. Thereafter, the cDNA was amplified in 40 cycles (heat denaturation at 948C for 40 s, primer annealing at 578C for 50 s, and DNA extension at 728C for 1 min), and the reaction was completed by a final extension for 7 min at 728C. The samples were kept at 48C until electrophoresis was carried out. The reactions were performed in a Perkin Elmer GeneAmp PCR System 2400 thermocycler. Following RT-
309
PCR, 10 Al of the amplicons were electrophoresed in a 1.2% Tris acetate–EDTA–agarose gel at 5 V/cm for 80 min. The gel was stained with ethidium bromide; bands were visualized by UV transillumination at 312 nm using a TFX 35M UV transilluminator (Life Technologies) and photographed with a Kodak DS Electrophoresis Documentation and Analysis System using the Kodak Digital Science 1D software program. Product sizes were determined with reference to a 100-bp DNA Ladder (Promega). Nucleotide sequencing and computer analyses Seven degenerate and 26 USUV-specific primer–pair combinations generated clear PCR products corresponding to the previously estimated size. The amplicons were electrophoresed in agarose gel (as described above), the fragments were excised from the gel, and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. To control the extraction efficiency and for estimation of the DNA content, 3 Al of the extracts were electrophoresed in agarose gel. Fluorescence-based direct sequencing was performed in both directions on the PCR products. The sequencing PCR was carried out using the ABI Prism Big Dye Terminator cycle sequencing ready reaction kit (Perkin Elmer) with AmpliTaq DNA polymerase. The reaction mixture contained 5 Al of Big Dye Terminator Reaction Mix (comprising the necessary components in an appropriate buffer solution), 4 pmol of oligonucleotides (see Table 1), 10–15 ng of template DNA (5–10 Al) and distilled water to a final volume of 20 Al. Sequencing PCR was performed in 30 amplification cycles of 968C for 30 s (denaturation), 508C for 10 s (primer annealing), and 608C for 4 min (DNA extension). Thereafter, the products were precipitated with 70% ethanol containing 0.5 mM MgCl2 by incubation at room temperature for 10 min followed by centrifugation at 20,000 g for 25 min. Each pellet was resuspended in 30 Al of ABI Prism template suppression reagent denaturing buffer (Perkin Elmer), and shortly before sequencing the samples were heated to 1008C for 2 min and quickly cooled on ice. The products were sequenced using an ABI Prism 310 genetic analyzer (Perkin Elmer) automated sequencing system. The nucleotide sequences were identified by BLAST search against gene bank databases. The amplicons showed 69–77% identity with the corresponding sequences of the JEV group viruses; thus, they were regarded as USUVspecific sequences. Thereafter, sequences were compiled and aligned with the help of the Align Plus 4 for Windows 95 (Scientific and Educational Software, version 4.00, serial number 465-054-2141) and ClustalX Multiple Sequence Alignment (version 1.81) programs. Deduced amino acid sequences were also analyzed. Phylogenetic analysis was performed on the available complete flavivirus genome sequences (Table 5) using the Phylogeny Inference Program Package (PHYLIP) version 3.57c. Bootstrap resampling
310
T. Bakonyi et al. / Virology 328 (2004) 301–310
analysis of 1000 replicates was generated with the SEQBOOT program to prove the stability of the trees. Distance matrices were generated by the Fitch program, using a translation/transversion ratio of 2.0. Phylogenetic trees were delineated using the TreeView (Win32) program version 1.6.6. Nucleotide sequence accession numbers The complete genomic sequences of the USUV strains Vienna 2001-blackbird and SAAR-1776 were submitted to the GenBank database under accession numbers AY453411 and AY453412, respectively. Acknowledgment This study was funded by a grant of the Austrian Federal Ministry for Health and Women’s Issues. References Anderson, J.F., Andreadis, T.G., Vossbrinck, C.R., Tirrel, S., Wakem, E.M., French, R.A., Garmendia, A.E., Van Kruiningen, H.J., 1999. Isolation of West Nile Virus from mosquitoes, crows, and a Cooper’s hawk in Connecticut. Science 286, 2331 – 2333. Buckley, A., Dawson, A., Moss, S.R., Hinsley, S.A., Bellamy, P.E., Gould, E.A., 2003. Serological evidence of West Nile virus, Usutu virus and Sindbis virus infection of birds in the UK. J. Gen. Virol. 84, 2807 – 2817. Burke, D.S., Monath, T.P., 2001. Flaviviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, vol. 1. Lippincott Williams and Wilkins, Philadelphia, pp. 1055 – 1109. Calisher, C.H., Karabatos, N., Dalrymple, J.M., Shope, R.E., Porterfield, J.S., Westerway, E.G., Brandt, W.E., 1989. Antigenic relationships between flaviviruses as determined by cross-neutralisation tests with polyclonal antisera. J. Gen. Virol. 70, 37 – 43. Ebel, G.D., Spielman, A., Telford III, S.R., 2001. Phylogeny of North American Powassan virus. J. Gen. Virol. 82, 1657 – 1665. Gorbalenya, A.E., Koonin, E.V., Donchenko, A.P., Blinov, V.M., 1989. Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17, 4713 – 4729. Gould, E.A., de Lamballerie, X., de A Zanotto, P.M., Holmes, E.C., 2003. Origins, evolution, and vector/host coadaptations within the genus flavivirus. Adv. Virus Res. 59, 277 – 314. Heinz, F.X., Collett, M.S., Purcell, R.H., Gould, E.A., Howard, C.R., Houghton, M., Moormann, R.J., Rice, C.M., Thiel, H.J., 2000. Family Flaviviridae. In: van Regenmortel, M.H.V., Faquet, C.M., Bishop, D.H.L. (Eds.), Virus Taxonomy, Seventh International Committee for the Taxonomy of Viruses. Academic Press, San Diego, pp. 859 – 878.
Hubalek, Z., Halouzka, J., Juricova, Z., Sebesta, O., 1998. First isolation of mosquito-borne West Nile virus in the Czech Republic. Acta Virol. 42, 119 – 120. Kuno, G., Chang, G.J., Tsuchiya, K.R., Karabatsos, N., Cropp, C.B., 1998. Phylogeny of the genus Flavivirus. J. Virol. 72, 73 – 83. Lanciotti, R.S., Roehrig, J.T., Deubel, V., Smith, J., Parker, M., Steele, K., Crise, B., Volpe, K.E., Crabtree, M.B., Scherret, J.H., Hall, R.A., MacKenzie, J.S., Cropp, C.B., Panigrahy, B., Ostlund, E., Schmitt, B., Malkinson, M., Banet, C., Weissman, J., Komar, N., Savage, H.M., Stone, W., McNamara, T., Gubler, D.J., 1999. Origin of the West Nile Virus responsible for an outbreak of encephalitis in the northeastern United States. Science 286, 2333 – 2337. Lee, E., Lobigs, M., 2002. Mechanism of virulence attenuation of glycosaminoglycan-binding variants of Japanese encephalitis virus and Murray Valley encephalitis virus. J. Virol. 76, 4901 – 4911. Lee, E., Stocks, C.E., Amberg, S.M., Rice, C.M., Lobigs, M., 2000. Mutagenesis of the signal sequence of yellow fever virus prM protein: enhancement of signalase cleavage in vitro is lethal for virus production. J. Virol. 74, 24 – 32. Lindenbach, B.D., Rice, C.M., 2001. Flaviviridae: the viruses and their replication. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, vol. 1. Lippincott Williams and Wilkins, Philadelphia, pp. 997 – 1002. Mandl, C.W., Allison, S.L., Holzmann, H., Meixner, T., Heinz, F.X., 2000. Attenuation of tick-borne encephalitis virus by structure-based site-specific mutagenesis of a putative flavivirus receptor binding site. J. Virol. 74, 9601 – 9609. Mason, P.W., 1989. Maturation of Japanese encephalitis virus glycoproteins produced by infected mammalian and mosquito cells. Virology 169, 354 – 364. National Center for Biotechnology Information [Online] http:// www.ncbi.nlm.nih.gov. Nowak, T., Wengler, G., 1987. Analysis of disulfides present in the membrane proteins of the West Nile flavivirus. Virology 156, 127 – 137. Proutski, V., Gould, E.A., Holmes, E.C., 1997. Secondary structure of the 3V untranslated region of flaviviruses: similarities and differences. Nucleic Acids Res. 25, 1194 – 1202. Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., Strauss, J.H., 1985. Nucleotide sequence of yellow fever virus: Implications for flavivirus gene expression and evolution. Science 229, 726 – 733. Rice, C.M., Strauss, E.G., Strauss, J.H., 1986. Structure of the flavivirus genome. In: Schlesinger, S., Schlesinger, M.J. (Eds.), The Togaviridae and Flaviviridae. Plenum, New York, pp. 279 – 326. Shi, P.Y., Li, W., Brinton, M.A., 1996. Cell proteins bind specifically to West Nile virus minus-strand 3V stem-loop RNA. J. Virol. 70, 6278 – 6287. Valle, R.P., Falgout, B., 1998. Mutagenesis of the NS3 protease of dengue virus type 2. J. Virol. 72, 624 – 632. Weissenbfck, H., Kolodziejek, J., Url, A., Lussy, H., Rebel-Bauder, B., Nowotny, N., 2002. Emergence of Usutu virus, an African mosquitoborne flavivirus of the Japanese encephalitis virus group, central Europe. Emerging Infect. Dis. 8, 652 – 656. Weissenbfck, H., Kolodziejek, J., Fragner, K., Kuhn, R., Pfeffer, M., Nowotny, N., 2003. Usutu virus activity in Austria, 2001–2002. Microbes Infect. 5, 1132 – 1136. Zeng, L., Falgout, B., Markoff, L., 1998. Identification of specific nucleotide sequences within the conserved 3V-SL in the dengue type 2 virus genome required for replication. J. Virol. 72, 7510 – 7522.
Complete genome analysis and molecular characterization of Usutu virus that emerged in Austria in 2001 Comparison with the South African Strain SAAR-1776 and other flaviviruses Tama´s Bakonyia,b, Ernest A. Gouldc, Jolanta Kolodziejeka, Herbert Weissenbfckd, Norbert Nowotnya,e,* a
Zoonoses and Emerging Infections Group, Clinical Virology, Clinical Department of Diagnostics, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria b Department of Microbiology and Infectious Diseases, Faculty of Veterinary Sciences, Szent Istva´n University, H-1143 Budapest, Hungary c Centre for Ecology and Hydrology, Natural Environment Research Council, Oxford, OX1 3SR, United Kingdom d Institute of Pathology and Forensic Veterinary Medicine, Department of Pathobiology, University of Veterinary Medicine, Vienna, A-1210 Vienna, Austria e Department of Medical Microbiology, Faculty of Medicine and Health Sciences, United Arab Emirates University, Al Ain, United Arab Emirates Received 4 July 2004; returned to author for revision 30 July 2004; accepted 7 August 2004 Available online 9 September 2004
Abstract Here we describe the complete genome sequences of two strains of Usutu virus (USUV), a mosquito-borne member of the genus Flavivirus in the Japanese encephalitis virus (JEV) serogroup. USUV was detected in Austria in 2001 causing a high mortality rate in blackbirds; the reference strain (SAAR-1776) was isolated in 1958 from mosquitoes in South Africa and has never been associated with avian mortality. The Austrian and South African isolates exhibited 97% nucleotide and 99% amino acid identity. Phylogenetic trees were constructed displaying the genetic relationships of USUV with other members of the genus Flavivirus. When comparing USUV with other JEV serogroup viruses, the closest lineage was Murray Valley encephalitis virus (nt: 73%, aa: 82%) followed by JEV (nt: 71%, aa: 81%) and West Nile virus (nt: 68%, aa: 75%). Comparison of the genomes showed that the conserved structural elements and putative enzyme motifs were homologous in the two USUV strains and the JEV serogroup. The factors that determine the severe clinical symptoms caused by the Austrian USUV strain in Eurasian blackbirds are discussed. We also offer a possible explanation for the origins and dispersal of USUV, JEV, and MVEV out of Africa. D 2004 Elsevier Inc. All rights reserved. Keywords: Usutu virus; Austria; Emerging mosquito-borne flavivirus; Blackbird mortality; USUV; SAAR-1776; Complete nucleotide sequences; Genome analysis and comparison; Phylogenetic analysis; Flaviviridae
Introduction
* Corresponding author. Zoonoses and Emerging Infections Group, Clinical Virology, Clinical Department of Diagnostics, University of Veterinary Medicine, Vienna, Veterin7rplatz 1, A-1210 Vienna, Austria. Fax: +43 1 25077 2790. E-mail addresses: [email protected] (T. Bakonyi)8 [email protected] (E.A. Gould)8 [email protected] (J. Kolodziejek)8 [email protected] (H. Weissenbfck)8 [email protected] (N. Nowotny). 0042-6822/$ - see front matter D 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.virol.2004.08.005
An African mosquito-borne flavivirus emerged in Austria in 2001 causing extensive die-off in the wild bird populations in Vienna and its surroundings (Weissenbfck et al., 2002), resembling the beginning of the West Nile virus (WNV) epidemic in the United States (Anderson et al., 1999; Lanciotti et al., 1999). The causative agent was isolated and identified as Usutu virus (USUV), a member of the Japanese encephalitis virus (JEV) serogroup within the family
302
T. Bakonyi et al. / Virology 328 (2004) 301–310
Flaviviridae. Although the virus had been detected several times in different mosquito and bird species in Africa, it had never before been associated with fatal or even overt clinical disease in birds or mammals. Therefore, USUV was considered to be unimportant in terms of pathogenicity and has largely been ignored, despite its close relationship to WNV and other more pathogenic flaviviruses in the JEV serogroup (Burke and Monath, 2001). However, following its emergence in Europe, USUV has proven to be highly pathogenic for several species of wild birds, especially Eurasian Blackbirds (Turdus merula). Moreover, the virus is now enzootic in Austrian wild birds having been observed for three consecutive years (Weissenbfck et al., 2003) and it has also been detected in local mosquito species. Therefore, its further dispersal throughout Central Europe is considered to be highly likely and potentially of major significance for our understanding of flavivirus emergence in general. Indeed, the presence of USUV was recently reported in the United Kingdom, based on serological tests of different wild bird species although there have been no associated bird deaths in the United Kingdom (Buckley et al., 2003). Flaviviruses infect arthropods, birds, and mammals including human beings, and some, i.e., Yellow fever virus (YFV), Dengue virus (DENV), and WNV, are of major public health importance (Burke and Monath, 2001). Therefore, the introduction onto a new continent of a previously exotic flavivirus that is closely related to other pathogenic flaviviruses is potentially a serious threat for a wide range of avian and mammalian species, including humans. Flaviviruses are spherical, enveloped viruses, 40–60 nm in diameter. The virion comprises three structural proteins, the capsid (C), membrane (M), and envelope (E) proteins and an 11 kb single-stranded, positive-sense RNA genome (Rice et al., 1986). The complete nucleotide sequence of several flaviviruses has been determined (National Center for Biotechnology Information). The genomic RNA contains a 5V cap structure, but lacks a polyadenylated tail. It acts as mRNA for translation of a single open reading frame (ORF) encoding the viral proteins as a large polyprotein that is co- and posttranslationally processed by cellular and viral proteases into at least 10 separate products. The N-terminal region encodes the structural proteins C, pre-M, and E, followed by the nonstructural proteins NS1 (soluble complement-fixing antigen), NS2A and NS2B, NS3 (serine protease/RNA helicase), NS4A, NS4B, and NS5 (RNAdependent RNA polymerase/methyltransferase) (Rice et al., 1985). Based on cross-neutralization studies employing polyclonal antisera, flaviviruses have been divided into eight antigenic complexes; several viruses, however, could not be assigned to any group (Calisher et al., 1989). Recently, a comprehensive phylogenetic analysis involving 68 flaviviruses was carried out on partial nucleotide sequences of the NS5 coding- and 3V noncoding regions (Kuno et al., 1998). According to the sequence identities and phylogenetic trees, the genus Flavivirus segregated into 14 clades belonging to
three clusters. Using these data and taking into account the criteria outlined in the VIIth Report of the International Committee on Taxonomy of Viruses, USUV was classified in the Japanese encephalitis virus group of the mosquitoborne cluster, together with Cacipacore virus (CPCV), Koutango virus (KOUV), JEV, Murray Valley encephalitis virus (MVEV), Alfuy virus (ALFV), St Louis encephalitis virus (SLEV), WNV, Kunjin virus (KUNV), and Yaounde virus (YAOV) (Heinz et al., 2000). The aims of this study were to sequence and compare the complete genomes of the USUV strain that emerged in Austria in 2001 with the South African USUV reference strain SAAR-1776. It was hoped that by combining this information with that obtained previously for both USUV and its closest genetic relatives, a parsimonious explanation could be developed for the unexpected appearance of this virus in a virulent form in Vienna in 2001.
Results RT-PCR and nucleotide sequencing Following the initial amplification of viral RNA using the degenerate primers described in Materials and methods, a total of 69 primers was finally applied in specific RT-PCR and sequencing reactions to determine the sequence of the complete genome of the two strains of USUV (Table 1). The sequences of the fragments were compiled to produce 11066- and 11064-nt-long nucleotide sequences representing the complete genome of USUV strains Vienna 2001blackbird and SAAR-1776, respectively. Analysis of the sequences One large ORF was identified within the USUV genome between nt positions 97 and 10401. The putative amino acid (aa) sequence of the 3434-aa-long polyprotein precursor was translated. Based on the amino acid alignments of the polyprotein precursor sequences of the JEV group viruses, the putative mature proteins, conserved structural elements, and putative enzyme motifs were also localized: The anchored core (C) protein was located between nt positions 97 and 474; within this region, the C protein was located between nt 97 and 412. The premembrane (PreM) protein was encoded from nt 475 to nt 975, with the M protein between nt 751 and 975. The envelope (E) protein was encoded between nt positions 976 and 2475, followed by the nonstructural proteins NS1 (nt 2476–3531), NS2a (nt 3532–4212), NS2b (nt 4213– 4605), NS3 (nt 4604–6462), NS4a (nt 6463–6840), 2K protein (nt 6841–6909), NS4b (nt 6910–7683), and NS5 (nt 7684–10398), respectively. Amino acid homologies were found in the polyprotein precursor sequences of flaviviruses, i.e., residues for intramolecular bonds or enzyme motifs. Amino acid substitu-
T. Bakonyi et al. / Virology 328 (2004) 301–310
303
Table 1 Oligonucleotide primers employed for amplification and sequencing of the USUV genomes Namea
Sequence 5V to 3V
Positionb
Product length (bp)
Usu1f Usu603f Usu1714r Usu2328f Usu3145r Usu3606f Usu4759r Usu4251f Usu5392r Usu5454f Usu5790r Usu6585f Usu7357r Usu10596f Usu11014r Usu306r Usu731r Usu488f Usu1401r Usu1155f Usu1600r Usu1537f Usu2505r Usu2383f Usu3098r Usu3067f Usu3666r Usu3653f Usu5645r Usu3657f Usu5204r Usu4005f Usu4519r Usu4403f Usu5358r Usu4763f Usu5080r Usu5201f Usu5625r Usu5569f Usu6270r Usu5709f Usu7303r Usu6217f Usu6607r Usu6522f Usu6954r Usu7272f Usu9175r Usu7314f Usu8033r Usu7757f Usu8599r Usu8044f Usu9179f Usu9614r Usu9600f Usu10257r Usu10746f SAAR544f SAAR6804r
AGWMGTTYRYCTGCGTGARC TGTGAKGAYACYATCACKTA GTGGCRTGHGSYTCTTCAAA CTCTTTGGRGGRATGTCHTG GTGCADGATTTKACYTCTCC AAGAGGTGGACGGCCARRHT GTGTGCCAYAGYGTGTGGAA ATGTTYGCCATYGTWGGDGG TGGCACATSACATCMACKAT ATGGATGAAGCYCATTTCAC GGTAYTCYGTMTCATAGGAC ATGGCTCTYGARGARCTRCC TTCATKATDCCAGCVGCTGT GWAAGCCTCYCAGAACCGTCTCGGAAG AGATCCTGTGKTCTWSYYCMCCAYCAG TTGCCGTGGTCTTGTTGATG CGCTTCGAGTGTCTGGTTCT GACCATCAACGCGACTGATA CAGAGCTGGTAGAACCATGT CTAGCCACTGTCTCATATGT ATGTAGTATGCCTCGGTGTT GGTTGAACACCGAGGCATAC CTTGTCCACAGCGCAACTCT ATCGCACTGGTGATGTTAGC CAGCCGTCCCAATTATTGAG TGACTGAGACAGCTCAATAA TAAGCAGGTCAGTGTAAGTG CACTGACCTGCTTAGGTATG GCACCTCAGCTTGTATGTCT GACCTGCTTAGGTATGTTCT ATCACTGTCAGCTGCTTCTT TGGCATGAGACTGCTCTACC ATGCCGTCATACGGATGACC CAGCCAACGCCTAGATGTAA CCACTATCTCTGTGCCACTA TGGTGAAGGAAGGCTCACTC ACGATGGCACTGACATACGA AGAAGCAGCTGACAGTGATG GCACCTCAGCTTGTATGTCT CCAATGCACCAGTTACAGAC ACTTCCTGTCGGTGTACTGT TCGTCGCTAGTGTGAAGATG CCGCAGTGATCAGAGTTGTT ACTGCAGACCTGCCAGTGTG AGAGCGTCCGGCAACTCTTC TATCTGGTGGCGACAGCTGA GTTGACGTGTGCTGGAGAAT CCAAGTGTCGTTAACAACTC TTCAACACCTCCTCCAGAAT AGAACAGCGGCCGGAATCAT GACAAGGTTCCAGCCATAGC AAGAGGCCATCACTGAAGTC TTCCGTGGTAGGTCCAGGTC GCGGAGTGGACGTGTATTAT AGGAGGTGTTGAAGGACTTG CCAGGTTCTCACAGCGTATT GCTGTGAGAACCTGGCTCTT CCTGGTTAATGGCTGCGTAG CAAGCGAACAGACGGTGATG ACCAGTGCTGGATTAGAG CATGAGCAGAGCCAGCAATA
1–20 607–626 1699–1718 2329–2348 3127–3146 3607–3626 4741–4760 4252–4271 5374–5393 5455–5474 5772–5791 6586–6605 7339–7358 10646–10672 11038–11064 309–328 721–740 510–529 1404–1423 1159–1178 1564–1583 1555–1578 2508–2527 2413–2432 3018–3037 3006–3025 3678–3697 3684–3703 5607–5626 3688–3707 5161–5180 4011–4030 4506–4525 4425–4444 5361–5380 4785–4804 5083–5102 5162–5181 5607–5626 5591–5610 6273–6292 5690–5709 7242–7261 6223–6242 6595–6614 6544–6563 6957–6976 7230–7249 9194–9213 7336–7355 8036–8055 7769–7788 8592–8611 8066–8085 9201–9220 9617–9636 9622–9641 10287–10306 10795–10804 569–586 6785–6804
740c 1112 818 1152 1142 337 773 419 328d 740e 914 425 973 625 692 1943 1493 515 656 318 465 702 1572 392 433 1984 720 843 546f 436 685 270g 855h 477i (continued on next page)
304
T. Bakonyi et al. / Virology 328 (2004) 301–310
Table 1 (continued) Namea
Sequence 5V to 3V
Positionb
SAAR9532f SAAR10124r WNV9031f WNV10091r WNV10090f WNV10807r WNV10460f WNV10889r
AACATTGCCGTCCAGCTCAT TCCACACTTGTCCACACTTC TACAACATGATGGGVAARAGAGAGA AGCATGTCTTCYGTBGTCATCCAYT GARTGGATGACVACRGAAGACATGCT GGGGTCTCCTCTAACCTCTAGTCCTT GCCACCGGAAGTTGAGTAGA GCTGGTTGTGCAGAGCAGAA
9532–9551 10129–10148 9043–9067 10103–10127 10102–10127 10829–10854 10564–10583 10986–11005
Product length (bp) 617 1085 753 442
a
Italics: degenerated JEV group specific primers. SAAR: primers applied to sequence genomic segments of strain SAAR-1776; WNV: WNV-specific primers published earlier (Weissenbo¨ck et al., 2002). Numbers refer to the approximate locations based on the consensus sequence of MVV, JEV, and WNV alignments. f: forward primer; r: reverse primer. b Positions refer to the genome of USUV strain SAAR-1776 (GenBank accession number AY453412). c With primer Usu731r. d Sequencing primer of PCR product Usu1f–Usu731r. e With primer Usu1f. f Sequencing primer of amplicon Usu7757f–Usu8599r. g Sequencing primer of amplification product Usu10596f–Usu11014r. h Sequencing primer of PCR product Usu488f–Usu1401r. i Sequencing primer of amplicon Usu5709f–Usu7303r.
tions and conserved motifs are presented in Table 2 and Fig. 1. In the envelope protein region, the 12 Cys residues (in positions 3, 30, 60, 74, 92, 105, 116, 121, 190, 287, 304, and 335) involved in intramolecular disulfide bonds (Nowak and Wengler, 1987) aligned with those in all other flaviviruses analyzed. This was also the case for the putative integrin binding motif (Arg387–Gly388–Asp389), which is a suspected
pathogenicity determinant of flaviviruses (Lee et al., 2000). The Glu306 and Asp389 residues, which are involved in a receptor-binding domain for viral attachment to sulfated proteoglycans (Lee and Lobigs, 2002; Lindenbach and Rice, 2001; Mandl et al., 2000), also aligned with those in the JEVgroup viruses. In the NS1 protein region, another 12 Cys residues (in positions 4, 15, 55, 143, 179, 223, 280, 291, 312, 313, 316, and 329) that form intramolecular disulfide bonds
Table 2 Amino acid substitutions and conserved regions within the precursor polyprotein of USUV strains
Aa positions refer to the complete precursor polyprotein sequence of the USUV Vienna strain. Relative aa positions refer to the protease cleavage sites. Substitutions in homologous positions of the MVEV, JEV, and WNV polyprotein precursors are also indicated. Conserved structural elements of the JEV serogroup viruses are demonstrated in the bottom panel. The receptor-binding domain for viral attachment to sulfated proteoglycans is indicated with n. The catalytic triad of the trypsin-like protease is indicated with *.
T. Bakonyi et al. / Virology 328 (2004) 301–310
305
Fig. 1. Amino acid substitutions and conserved regions within the precursor polyprotein of USUV strains.
were found in homologous positions in USUV and in the other JEV serogroup viruses (Mason, 1989). In the N-terminal third of the NS3 protein, the proposed catalytic triad (His47, Asp75, and Ser135) and substrate binding pocket (Gly133, Ser135, Gly136, Gly148, Leu149, and Gly153) of the trypsin-like serine protease (Valle and Falgout, 1998) was also found conserved in USUV, as well as the RNA helicase motif Asp285–Glu286– Ala287–His288 at the C-terminal third of the protein (Gorbalenya et al., 1989). Similar to other flaviviruses, the homologous Gly667–Asp668–Asp669 motif common to RNA-dependent RNA polymerase enzymes (Rice et al., 1985) was found in the C-terminal third of the NS5 protein. Comparing the nucleotide sequences of the two USUV isolates, the nucleotide substitutions were distributed fairly evenly over the entire genome. Within the 96-nt-long 5V untranslated region (UTR), three mutations were found at nt positions 31, 32, and 38. In total, 306 nt substitutions were found in the ORF resulting in 25 aa changes in the putative polyprotein precursor sequence (Table 2). The 3V UTR contained 21 nucleotide changes comprising two A insertions in a polyA region between nt positions 10945 and 10951 of the USUV Vienna strain (Table 3). This particular region is also highly variable in other flaviviruses. Flaviviruses share common secondary structural elements of the 5V and 3V UTRs forming terminal stem-loop sequences necessary for the translation and replication of the genome (Shi et al.,
1996). Mutations engineered in these regions led to limited host-range phenotypes (usually in mosquitoes), suggesting that these regions may interact with host-specific factors (Zeng et al., 1998). The recognized conserved sequence motifs of the 3V stem loop within the JEV serogroup viruses were also conserved in the USUV viruses (motifs CS2, RCS2, and TL2; Proutski et al., 1997) at nt positions 10908– 10929, 10830–10851, and 10886–10894, respectively). The amino acid sequences of the two USUV strains were identical in the C, preM, M, NS2b, and 2K protein regions. A particularly high level of sequence divergence was found in the anchored part of the C protein in the different JEV serogroup viruses, but the two USUV isolates differed from each other only in one aa in this region (Val/Ala16). In the E protein region, five aa substitutions were detected between the USUV strains. Regarding these changes, in positions Gly320, Thr423, and Asn457, USUV Vienna was identical with MVEV, JEV, and WNV; while in position Gly276, USUV SAAR was identical with the JEV serogroup viruses. In position Met126, each of the five viruses differed from each other. In regions NS1, NS2a, and NS4b, eight aa substitutions were found between the two USUV strains, and most of these differed from the other JEV serogroup viruses. However, in the NS3 and NS4a regions, where the USUV strains differed from each other (by seven amino acids), they were identical with at least one of the following JEV serogroup viruses:
Table 3 Nucleotide substitutions of the 3VUTR region in USUV strains Vienna and SAAR-1776, aligned to JEV serogroup viruses
(A) Nucleotide positions refer to the complete genome sequence of USUV Vienna. (B) Alignment of a partial region of the 3VURT containing nucleotide insertions/deletions in the USUV strains.
306
T. Bakonyi et al. / Virology 328 (2004) 301–310
Table 4 Analysis of the amino acid and nucleotide substitutions within the USUV strains Vienna and SAAR-1776 compared to the homologous positions in MVEV, JEV, and WNV sequences Identical substitutions
MVEV aaa
ntb
Total ntc
JEV aaa
ntb
Total ntc
WNV aaa
ntb
Total ntc
USUV Vienna USUV SAAR
11/25 5/25
19/29 7/29
115/330 104/330
11/25 7/25
14/29 9/29
107/330 121/330
10/25 5/25
14/29 12/29
113/330 107/330
a
Number of identical amino acids between the USUV strain and the related JEV group flaviviruses within the 25 aa substitutions of the two USUV strains. Number of identical nucleotides between the USUV strain and the related JEV group flaviviruses within the 29 nt substitutions of the two USUV strains responsible for aa changes. c Number of identical nucleotides between USUV and the related JEV group flaviviruses within the 330 nt substitutions of the two USUV strains. b
MVEV, JEV, or WNV (Table 2). A high level of sequence variation was found in the N-terminal region of the NS4b protein of the JEV serogroup viruses, the two USUV strains differed in two amino acids in this section. The NS5 protein exhibited the lowest level of sequence divergence, with only five aa substitutions in the 905-aa-long peptide. Table 5 Complete flavivirus genomic nucleotide sequences and complete polyprotein precursor amino acid sequences used for the phylogenetic analyses Virus name
Abbreviation
ALKV APOIV CFAV
Nucleotide accession number NC_004355 NC_003676 NC_001564
Protein accession number NP_722551.1 NP_620045.1 NP_041725.1
Alkhurma virus Apoi virus Cell Fusing Agent virus Deer Tick virus Dengue virus 2 Dengue virus 4 Japanese Encephalitis Virus Kamiti River virus Langat virus Louping Ill virus Modoc virus Montana myotis leukoencephalitis virus Murray Valley Encephalitis Virus Omsk Hemorrhagic Fever virus Powassan virus Rio Bravo virus Tamana Bat virus Tick Borne Encephalitis virus Europe Tick Borne Encephalitis virus Siberia Usutu virus strain SAAR-1776 Usutu virus strain Vienna 2001blackbird West Nile Virus Yellow Fever virus Yokose virus
DTV DENV2 DENV4 JEV
NC_003218 M19197 M14931 NC_001437
NP_476520.1 AAA42962.1 AAA42964.1 NP_059434.1
KRV LGTV LIV MODV MMLV
NC_005064 NC_003690 NC_001809 NC_003635 NC_004119
NP_891560.1 NP_620108.1 NP_044677.1 NP_619758.1 NP_689391.1
MVEV
NC_000943
NP_051124.1
OHFV
NC_005062
NP_878909.1
POWV RBV TABV TBEE
NC_003687 NC_003675 NC_003996 NC_001672
NP_620099.1 NP_620044.1 NP_658908.1 NP_043135.1
TBES
L40361
AAF82240.2
USUV SAAR USUV VIENNA
AY453412
WNV YFV YOKV
NC_001563 NC_002031 NC_005039
AY453411
NP_041724.1 NP_041726.1 NP_872627.1
The detailed analysis of the 25 aa positions, in which the USUV strains differ from each other revealed that USUV Vienna, rather than the USUV SAAR strain, was more frequently identical with MVEV, JEV, and WNV (Tables 2 and 4). When nucleotide changes responsible for the aa substitutions were analyzed, a similar result was observed (Table 4). Interestingly, when analyzing all nucleic acid mutations (including silent mutations) of the two USUV strains, the above-mentioned phenomenon was not observed. The nucleotide and amino acid sequences of the USUV strains were aligned to all complete flavivirus sequences available in the GenBank database (Table 5). The USUV strains showed 97% nucleotide and 99% amino acid identity to each other. When comparing USUV with other flaviviruses, the highest nucleotide sequence identity was found
Fig. 2. Phylogenetic tree illustrating the genetic relationship between flaviviruses based on their complete genome sequences. (Abbreviations and accession numbers are listed in Table 5. The JEV group viruses are marked with grey underlay. Bar on the left demonstrates the genetic distance. The bootstrap values were in all cases 1000 with the only exception of the MVEV-USUV junction, where it was 970.)
T. Bakonyi et al. / Virology 328 (2004) 301–310
Fig. 3. Phylogenetic tree illustrating the genetic relationship between flaviviruses based on the putative amino acid sequences of the polyprotein precursor. (Abbreviations and accession numbers are listed in Table 5. The JEV group viruses are marked with grey underlay. Bar on the left demonstrates the genetic distance. Internal labels represent the bootstrap values of 1000 replicates, where they were lower than 1000.)
with representatives of the JEV group: MVEV (73%), JEV (71%), and WNV (68%). Representatives of other less closely related members of the Flavivirus genus exhibited between 56% (DENV2–4) and 43% (Tamana bat virus; TABV, a tentative species in the genus) nucleotide identity to USUV. Phylogenetic trees, based on the entire genome sequences, were constructed to investigate the evolutionary relationships between USUV and other flaviviruses. Trees based on either nucleotides (Fig. 2) or amino acids (Fig. 3) confirmed the closer relationship of USUV to MVEV, JEV, and WNV, in that order, than with members of other flavivirus serogroups.
Discussion In some ways, the circumstances surrounding the emergence of USUV in Vienna, Austria, during 2001 (Weissenbo¨ck et al., 2002), resemble the appearance of WNV in New York in 1999. In both situations, the virus was observed for the first time on a new continent, and in both cases it was associated with significantly increased virulence for birds compared with the recognized African parent virus. However, following its introduction through New York, WNV had dispersed very widely over North America within 3 years whereas the Austrian USUV appeared to have remained relatively localized in Vienna and the neighboring federal state of Lower Austria (Weissenbo¨ck et al., 2003), spreading so far only around 50 km per season. Before this study, genetic information
307
was available only for a very small (approximately 1 kb) fragment of USUV. Therefore, to attempt to explain the apparent differences in virulence and the emergence and subsequent limited dispersion relating to USUV, we felt it was justified to determine and compare the entire genomic sequences of the Austrian and the South African reference strain of USUV, and also to compare these with other closely related bird associated flaviviruses, particularly MVEV, JEV, and WNV. Comparison of the sequences of the South African and Austrian USUV strains revealed that they are closely related and share the common conserved structural motifs and known pathogenicity determinants present in other related flaviviruses. However, significant amino acid substitutions were distributed throughout the open reading frame of the Austrian strain, which may not only influence the apparent differences in virulence for birds of the two strains of USUV but which may also reflect on the evolutionary origins and dispersal of USUV, MVEV, JEV, and WNV. Although limited information is available on the distribution and pathogenicity of USUV in Africa, it is apparently nonpathogenic for local bird populations, either because it is a naturally nonvirulent virus or possibly because of immunity and/or genetic resistance arising in the bird population as the result of exposure to USUV and other antigenically related flaviviruses over a long period of time. Although the virus has never been associated with disease in birds in Africa, it must be borne in mind that enzootics in wild bird populations are not easy to detect. On the other hand, Austrian dead birds were mainly found in urban areas, in gardens or parks, rather than in the natural environment, where the corpses quickly disappear. In Austria, before the appearance of pathogenic USUV, there were no identified flavivirus pathogens of birds. Although tick-borne encephalitis virus is widespread in Austria, it has never been associated with disease in birds. Moreover, WNV was isolated from mosquitoes at the Czech– Austrian border, 70 km from Vienna (Hubalek et al., 1998), but it has never been associated with outbreaks in the local birds or in other vertebrates. Although the two strains of USUV shared N99% amino acid identity, and the phylogenetic trees based on the complete nucleic acid and amino acid sequences demonstrated a close relationship between the Austrian and the South African USUV strain (Figs. 2 and 3), there was sufficient difference in specific amino acid substitutions to conclude that these viruses have evolved independently. In other words, the Austrian strain seems not to be simply the South African strain introduced in the year 2000 by migrant birds (Weissenbo¨ck et al., 2002). Indeed, comparative analysis of the amino acid substitutions of the two USUV strains and the other JEV group viruses suggests that the Austrian strain may be genetically even closer than the South African strain to other flaviviruses that have emerged into Eurasia and Australia. Thus, based on the amino acid signature analysis, the Austrian USUV lineage might
308
T. Bakonyi et al. / Virology 328 (2004) 301–310
represent a genetic link between Australian MVEV and ALFV, Asian JEV, and the related viruses in Africa such as WNV. Therefore, by analogy with current thinking on WNV dispersal out of Africa, which has dispersed across Asia to appear as Kunjin virus in Australia (Buckley et al., 2003; Gould et al., 2003), the USUV lineage could represent an equivalent exodus of an African virus eventually leading to the emergence of JEV in south east Asia and MVEV/ALFV in Australasia and Australia. While this explanation may be viewed as too far-reaching at this stage of our knowledge, we believe it should not be ignored because of the potentially serious implications of emerging pathogens in Europe. In Africa, USUV has been isolated more than once in geographic regions thousands of kilometers apart (i.e., in South Africa and in the Central African Republic). Such geographic separation provides the opportunity for the evolution of distinct lineages either one of which could represent the Austrian strain. Similar badaptive evolutionQ has been identified in North America for two closely related tick-borne flaviviruses, Powassan virus (POWV) and Deer tick virus (DTV), representing an equivalent divergence in which the two separate combinations of ticks and their vertebrate hosts were sufficiently geographically separated to allow the viruses (the same virus originally) to evolve distinctly (Ebel et al., 2001). Alternatively, the Austrian strain may have evolved independently of the African strain after being introduced into Vienna. However, this latter possibility appears less likely because there has been little evidence of genetic change during the 3 years since its isolation in Austria. These results support the view that the avian pathogenic USUV strain is not being annually reintroduced into the Vienna region of Austria from Africa, but has been introduced only once and has established an efficient transmission cycle between local bird and mosquito species, as we have demonstrated recently (unpublished observations). The Austrian USUV became a resident pathogen in the eastern part of Austria, and is slowly radiating to neighboring federal states and countries. On the other hand, USUV is not only present in Africa and in the eastern part of Austria. In the United Kingdom, seropositivity was found against USUV in blackbirds, magpies, carrion crows, and turkeys, which are not migratory birds, implying that they have become infected within the United Kingdom (Buckley et al., 2003). It is possible that lowvirulence USUV strains are widespread over Europe, but because they do not cause overt disease, they have not yet been detected, and because they cross-react with WNV in routine serological tests, they may have been identified as WNV. On the other hand, there is a specific, although laborious, serological test for USUV available [plaque reduction neutralization test (PRNT)], which can differentiate between antibodies induced by USUV, WNV, and other flaviviruses; only when the hosts have been infected with both USUV and WNV, or multiple times with the same virus, cross-reactivity may be observed also in PRNT. Circulating low-virulence strains of USUV in Europe might
be expected to induce protective immunity against virulent infections in a range of bird species. Taking all of these factors into account, at least two theories could explain the emergence of USUV in Austria. A possible scenario is that a virulent strain was introduced to Vienna, either via importation of infected birds to the Vienna Zoo from Africa, or by migratory birds. However, importation of wild birds from exotic countries is monitored closely and the animals are quarantined for a long time. Moreover, no such imports were registered during the years 2000 and 2001. The presumed newly introduced virus may have been particularly pathogenic for blackbirds because they are nonmigratory and therefore will not have preexisting immunity because they have not been exposed to the virus in Africa. The fact that WNV does not appear to be a bird pathogen in Austria also means that cross-protective antibodies are unlikely to be present in the blackbirds. Another possibility is that blackbirds are more genetically susceptible to the Austrian USUV than other Austrian local (nonmigratory) bird species that have been affected far less. A third and perhaps less likely possibility is that the putative widespread and less virulent South African strain was introduced into Austria, adapted to blackbirds and became more virulent for this species. Evidence as to whether such changes occurred awaits more extensive molecular and especially serological analysis of African and Austrian as well as U.K. and possibly other European isolates of USUV. Whatever the explanation for the appearance and unusual virulence and dispersal characteristics of USUV, it is intriguing that within a short period of time, USUV and WNV first emerged in large western cities, Vienna and New York, with airports and several other possibilities of introduction of exotic viruses. Whether or not other equivalent bird-associated arboviruses such as JEV will follow this pattern remains to be seen.
Materials and methods Virus strains The USUV reference strain SAAR-1776 was originally isolated by Dr. B.M. McIntosh from Culex neavei collected in Ndumu, Natal, South Africa, on January 30, 1959. It was passaged seven times in mice by Dr. J. Casals (Yale Arbovirus Research Unit, New Haven) and once by Dr. J. Porterfield (National Institute for Medical Research, Mill Hill, London) in 1968. Recently, the strain was passaged again in suckling mice and stored freeze-dried. The Austrian strain 939/01, designated USUV Vienna 2001-blackbird, was isolated in Vero cell culture, following inoculation with a brain homogenate of a blackbird found dead in Perchtoldsdorf (Mfdling) near Vienna on September 4, 2001. Usutu virus-specific RNA and antigen had been identified in several organs of the bird by RT-PCR,
T. Bakonyi et al. / Virology 328 (2004) 301–310
immunohistochemistry, and in situ hybridization. The virus isolate was passaged two times in Vero cells and then stored frozen at 808C. RT-PCR Viral RNA was extracted from 140-Al virus suspension using the QIAamp viral RNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. For the amplification of the complete USUV genome, universal JEV group oligonucleotide primers were designed: Multiple alignment was performed on the genomic sequences of MVEV, JEV, and WNV (GenBank accession numbers NC_000943, NC_001437, and NC_001563, respectively), and the most conserved regions were identified. A total of 34 20-nt-long genomic stretches were selected, where the number of nucleotide mismatches in the consensus sequence was lower than six, and the sequences met the standard criteria of oligonucleotide primer molecules. Degenerate primer pairs were designed in these regions containing a mixture of the probable nucleotide variations. RT-PCR assays involving the selected primers were applied to the extracted RNA, and when specific products of the expected size were detected, the amplicons were sequenced. Based on these specific sequences, further primer pairs were designed to produce overlapping RT-PCR products covering the entire genome of USUV. In cases where the amplicons were too long to be sequenced in one step, additional sequencing primers were applied. The oligonucleotide primer sequences, locations (referring to nt positions of USUV strain SAAR-1776, accession number AY453412) and product sizes are shown in Table 1. The oligonucleotides were designed with the help of the Primer Designer 4 for Windows 95 program (Scientific and Educational Software, version 4.10, serial number 563-097-7776), and were synthesized by GibcoBRL Life Technologies, Ltd. (Paisley, Scotland, UK). Reverse transcription and amplification were performed with a continuous RT-PCR method using the QIAGEN OneStep RT-PCR Kit (Qiagen). Each 25-Al reaction mixture contained 5 Al of 5 buffer (final MgCl2 concentration 2.5 mM), 0.4 mM of each deoxynucleoside triphosphate (dNTP), 10 U RNasink RNase Inhibitor (Promega, USA), 20 pmol of the appropriate forward and reverse primers, 1 Al of enzyme mix (containing Omniscriptk and Sensiscriptk Reverse Transcriptases and HotStarTaqk DNA polymerase) and 2.5 Al of template RNA. Reverse transcription was carried out at 508C for 30 min, followed by a denaturation step at 958C for 15 min. Thereafter, the cDNA was amplified in 40 cycles (heat denaturation at 948C for 40 s, primer annealing at 578C for 50 s, and DNA extension at 728C for 1 min), and the reaction was completed by a final extension for 7 min at 728C. The samples were kept at 48C until electrophoresis was carried out. The reactions were performed in a Perkin Elmer GeneAmp PCR System 2400 thermocycler. Following RT-
309
PCR, 10 Al of the amplicons were electrophoresed in a 1.2% Tris acetate–EDTA–agarose gel at 5 V/cm for 80 min. The gel was stained with ethidium bromide; bands were visualized by UV transillumination at 312 nm using a TFX 35M UV transilluminator (Life Technologies) and photographed with a Kodak DS Electrophoresis Documentation and Analysis System using the Kodak Digital Science 1D software program. Product sizes were determined with reference to a 100-bp DNA Ladder (Promega). Nucleotide sequencing and computer analyses Seven degenerate and 26 USUV-specific primer–pair combinations generated clear PCR products corresponding to the previously estimated size. The amplicons were electrophoresed in agarose gel (as described above), the fragments were excised from the gel, and DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. To control the extraction efficiency and for estimation of the DNA content, 3 Al of the extracts were electrophoresed in agarose gel. Fluorescence-based direct sequencing was performed in both directions on the PCR products. The sequencing PCR was carried out using the ABI Prism Big Dye Terminator cycle sequencing ready reaction kit (Perkin Elmer) with AmpliTaq DNA polymerase. The reaction mixture contained 5 Al of Big Dye Terminator Reaction Mix (comprising the necessary components in an appropriate buffer solution), 4 pmol of oligonucleotides (see Table 1), 10–15 ng of template DNA (5–10 Al) and distilled water to a final volume of 20 Al. Sequencing PCR was performed in 30 amplification cycles of 968C for 30 s (denaturation), 508C for 10 s (primer annealing), and 608C for 4 min (DNA extension). Thereafter, the products were precipitated with 70% ethanol containing 0.5 mM MgCl2 by incubation at room temperature for 10 min followed by centrifugation at 20,000 g for 25 min. Each pellet was resuspended in 30 Al of ABI Prism template suppression reagent denaturing buffer (Perkin Elmer), and shortly before sequencing the samples were heated to 1008C for 2 min and quickly cooled on ice. The products were sequenced using an ABI Prism 310 genetic analyzer (Perkin Elmer) automated sequencing system. The nucleotide sequences were identified by BLAST search against gene bank databases. The amplicons showed 69–77% identity with the corresponding sequences of the JEV group viruses; thus, they were regarded as USUVspecific sequences. Thereafter, sequences were compiled and aligned with the help of the Align Plus 4 for Windows 95 (Scientific and Educational Software, version 4.00, serial number 465-054-2141) and ClustalX Multiple Sequence Alignment (version 1.81) programs. Deduced amino acid sequences were also analyzed. Phylogenetic analysis was performed on the available complete flavivirus genome sequences (Table 5) using the Phylogeny Inference Program Package (PHYLIP) version 3.57c. Bootstrap resampling
310
T. Bakonyi et al. / Virology 328 (2004) 301–310
analysis of 1000 replicates was generated with the SEQBOOT program to prove the stability of the trees. Distance matrices were generated by the Fitch program, using a translation/transversion ratio of 2.0. Phylogenetic trees were delineated using the TreeView (Win32) program version 1.6.6. Nucleotide sequence accession numbers The complete genomic sequences of the USUV strains Vienna 2001-blackbird and SAAR-1776 were submitted to the GenBank database under accession numbers AY453411 and AY453412, respectively. Acknowledgment This study was funded by a grant of the Austrian Federal Ministry for Health and Women’s Issues. References Anderson, J.F., Andreadis, T.G., Vossbrinck, C.R., Tirrel, S., Wakem, E.M., French, R.A., Garmendia, A.E., Van Kruiningen, H.J., 1999. Isolation of West Nile Virus from mosquitoes, crows, and a Cooper’s hawk in Connecticut. Science 286, 2331 – 2333. Buckley, A., Dawson, A., Moss, S.R., Hinsley, S.A., Bellamy, P.E., Gould, E.A., 2003. Serological evidence of West Nile virus, Usutu virus and Sindbis virus infection of birds in the UK. J. Gen. Virol. 84, 2807 – 2817. Burke, D.S., Monath, T.P., 2001. Flaviviruses. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, vol. 1. Lippincott Williams and Wilkins, Philadelphia, pp. 1055 – 1109. Calisher, C.H., Karabatos, N., Dalrymple, J.M., Shope, R.E., Porterfield, J.S., Westerway, E.G., Brandt, W.E., 1989. Antigenic relationships between flaviviruses as determined by cross-neutralisation tests with polyclonal antisera. J. Gen. Virol. 70, 37 – 43. Ebel, G.D., Spielman, A., Telford III, S.R., 2001. Phylogeny of North American Powassan virus. J. Gen. Virol. 82, 1657 – 1665. Gorbalenya, A.E., Koonin, E.V., Donchenko, A.P., Blinov, V.M., 1989. Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res. 17, 4713 – 4729. Gould, E.A., de Lamballerie, X., de A Zanotto, P.M., Holmes, E.C., 2003. Origins, evolution, and vector/host coadaptations within the genus flavivirus. Adv. Virus Res. 59, 277 – 314. Heinz, F.X., Collett, M.S., Purcell, R.H., Gould, E.A., Howard, C.R., Houghton, M., Moormann, R.J., Rice, C.M., Thiel, H.J., 2000. Family Flaviviridae. In: van Regenmortel, M.H.V., Faquet, C.M., Bishop, D.H.L. (Eds.), Virus Taxonomy, Seventh International Committee for the Taxonomy of Viruses. Academic Press, San Diego, pp. 859 – 878.
Hubalek, Z., Halouzka, J., Juricova, Z., Sebesta, O., 1998. First isolation of mosquito-borne West Nile virus in the Czech Republic. Acta Virol. 42, 119 – 120. Kuno, G., Chang, G.J., Tsuchiya, K.R., Karabatsos, N., Cropp, C.B., 1998. Phylogeny of the genus Flavivirus. J. Virol. 72, 73 – 83. Lanciotti, R.S., Roehrig, J.T., Deubel, V., Smith, J., Parker, M., Steele, K., Crise, B., Volpe, K.E., Crabtree, M.B., Scherret, J.H., Hall, R.A., MacKenzie, J.S., Cropp, C.B., Panigrahy, B., Ostlund, E., Schmitt, B., Malkinson, M., Banet, C., Weissman, J., Komar, N., Savage, H.M., Stone, W., McNamara, T., Gubler, D.J., 1999. Origin of the West Nile Virus responsible for an outbreak of encephalitis in the northeastern United States. Science 286, 2333 – 2337. Lee, E., Lobigs, M., 2002. Mechanism of virulence attenuation of glycosaminoglycan-binding variants of Japanese encephalitis virus and Murray Valley encephalitis virus. J. Virol. 76, 4901 – 4911. Lee, E., Stocks, C.E., Amberg, S.M., Rice, C.M., Lobigs, M., 2000. Mutagenesis of the signal sequence of yellow fever virus prM protein: enhancement of signalase cleavage in vitro is lethal for virus production. J. Virol. 74, 24 – 32. Lindenbach, B.D., Rice, C.M., 2001. Flaviviridae: the viruses and their replication. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Lamb, R.A., Martin, M.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology, vol. 1. Lippincott Williams and Wilkins, Philadelphia, pp. 997 – 1002. Mandl, C.W., Allison, S.L., Holzmann, H., Meixner, T., Heinz, F.X., 2000. Attenuation of tick-borne encephalitis virus by structure-based site-specific mutagenesis of a putative flavivirus receptor binding site. J. Virol. 74, 9601 – 9609. Mason, P.W., 1989. Maturation of Japanese encephalitis virus glycoproteins produced by infected mammalian and mosquito cells. Virology 169, 354 – 364. National Center for Biotechnology Information [Online] http:// www.ncbi.nlm.nih.gov. Nowak, T., Wengler, G., 1987. Analysis of disulfides present in the membrane proteins of the West Nile flavivirus. Virology 156, 127 – 137. Proutski, V., Gould, E.A., Holmes, E.C., 1997. Secondary structure of the 3V untranslated region of flaviviruses: similarities and differences. Nucleic Acids Res. 25, 1194 – 1202. Rice, C.M., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L., Strauss, J.H., 1985. Nucleotide sequence of yellow fever virus: Implications for flavivirus gene expression and evolution. Science 229, 726 – 733. Rice, C.M., Strauss, E.G., Strauss, J.H., 1986. Structure of the flavivirus genome. In: Schlesinger, S., Schlesinger, M.J. (Eds.), The Togaviridae and Flaviviridae. Plenum, New York, pp. 279 – 326. Shi, P.Y., Li, W., Brinton, M.A., 1996. Cell proteins bind specifically to West Nile virus minus-strand 3V stem-loop RNA. J. Virol. 70, 6278 – 6287. Valle, R.P., Falgout, B., 1998. Mutagenesis of the NS3 protease of dengue virus type 2. J. Virol. 72, 624 – 632. Weissenbfck, H., Kolodziejek, J., Url, A., Lussy, H., Rebel-Bauder, B., Nowotny, N., 2002. Emergence of Usutu virus, an African mosquitoborne flavivirus of the Japanese encephalitis virus group, central Europe. Emerging Infect. Dis. 8, 652 – 656. Weissenbfck, H., Kolodziejek, J., Fragner, K., Kuhn, R., Pfeffer, M., Nowotny, N., 2003. Usutu virus activity in Austria, 2001–2002. Microbes Infect. 5, 1132 – 1136. Zeng, L., Falgout, B., Markoff, L., 1998. Identification of specific nucleotide sequences within the conserved 3V-SL in the dengue type 2 virus genome required for replication. J. Virol. 72, 7510 – 7522.