Complete intergenic and flanking gene sequences from the genome of vesicular stomatitis virus

Cell, Vol. 19. 415-421,

February

1980.

Copyright

0 1980 by MIT

Complete lntergenic and Flanking Gene Sequences from the Genome of Vesicular Stomatitis Virus John K. Rose Tumor Virology Laboratory The Salk Institute P. 0. Box 85800 San Diego, California 92138

Summary Plasmids containing vesicular stomatitis virus (VSV) mRNA sequences were used to obtain sequences corresponding to the 3’ terminl of VSV mRNAs and to generate primers that were used to sequence through the genomic RNA regions joining the NS, M, G and L genes. Together with the sequence of the N-NS junction (McGeoch, 1979) these results provide the complete set of VSV intergenic and flanking gene sequences. Extensive homologies were found among the four junctions of the five VSV genes. These regions have the common structure (3’)AUACUUUUUUUNAUUGUCNNUAG(5’), in which N indicates three variable positions in the 23 nucleotide sequence. The first eleven nucleotides of this sequence are complementary to the sequence (5’). . .UAUGAAAAAAA.. 43’) which occurs at the mRNA-poly(A) junction in each mRNA. These sequences presumably signal polyadenylation of each mRNA. Dinucleotide spacers (CA or GA) whose complements do not appear in the mRNAs follow the polyadenylation signals and constitute the intergenic regions. immediately after these dinucleotides are the sequences complementary to the 5’ terminal sequences on each mRNA, (S’)AACAGNNAUC(3’). Transcription events at these junctions, and the locations of possible promoter sequences preceding them, are discussed in terms of models of VSV transcription. Important features of VSV mRNA structure, including the location of a secondary ribosome binding site at an out-of-frame AUG codon in the N mRNA and the sequences of the M and G mRNAs preceding their ribosome binding sites, are also considered. Introduction The genome of vesicular stomatitis virus (VSV) consists of a single-stranded RNA molecule containing approximately 10,000 nucleotides (Huang and Wagner, 1966). This virion RNA &RNA) is copied by a virion-associated RNA polymerase (Baltimore, Huang and Stampfer, 1970) which transcribes the five structural genes sequentially in the order 3’-N-NS-M-G-L5’ into the five monocistronic mRNAs (Abraham and Banerjee, 1976; Ball and White, 1976). Synthesis of a short leader RNA (47-48 nucleotides) encoded at the 3’ end of the genome precedes the synthesis of N

mRNA (Colonno and Banerjee, 1976). The five mRNAs are modified and have capped and methylated 5’ termini and 3’ terminal poly(A) (Banerjee, Abraham and Colonno, 1977). The discrete mRNAs and leader RNA could be generated either by cleavage of a precursor RNA or by separate initiations and sequential synthesis along the genome. The vRNA sequences at the junctions of the five structural genes must therefore contain specific signals triggering either the termination of transcription, polyadenylation and initiation, or cleavage and polyadenylation. My strategy to obtain the complete sequences of the VSV mRNA termini and the intercistronic genomic sequences involved the following procedures. -Isolation of cDNA clones containing sequences derived from the 3’ termini of VSV mRNAs. -Determination of the 3’ terminal mRNA sequences from the cloned DNAs. -Isolation from the cDNA clones of single-stranded DNA primers containing sequences derived from near the 3’ termini of each mRNA. -Extension of these primers through the intergenic regions into adjacent gene sequences on vRNA template using reverse transcriptase. -Sequencing of the extended primers, and locating the adjacent gene sequences from the known sequences of the ribosome binding sites in VSV mRNAs (Rose, 1978). McGeoch (1979) recently reported the sequence of one intergenic region between the vRNA regions complementary to the N and NS mRNAs, and Schubert et al. (1980) reported the sequence located 59 nucleotides from the 5’ end of the genome encoding the 3’ end of the L mRNA. The results reported here provide the complete intergenic sequences from the VSV genome and the flanking sequences encoding the 5’ terminal and 3’ terminal mRNA sequences. Results Sequences from the 3’ Termini of VSV M and G mRNAs Isolation and characterization of cDNA clones containing VSV mRNA sequences have been described (Rose and Iverson, 1979). Construction of these clones involved synthesis of double-stranded cDNA copies of VSV mRNAs, “tailing” of the DNA with dCMP residues and insertion at the dG-tailed Pst I site of pBR322 (Bolivar et al., 1977). By sequencing insert DNA from clones of VSV N and NS mRNAs (pN155 and pNSl73), it was possible to deduce the 3’ terminal sequences of these mRNAs (Rose and Iverson, 1979). Using procedures identical to those used to identify the N and NS clones, I have identified two additional clones, pM32 and pG65, which contain sequences derived from the 3’ termini of the VSV M and G protein

Cell 416

mRNAs (Figure 1). The location of the 3’ terminal mRNA sequences in the insert DNAs from pM32 and pG65 was determined by sequencing both ends of each insert DNA, using the procedure of Maxam and Gilbert (1977). The regions of each insert that were sequenced on both DNA strands are indicated by double arrows in Figure 1. The sequences of the DNA strands complementary to the 3’ terminal 100 nucleotides of the M and G mRNAs are shown in Figure 2, with the deduced mRNA sequences. The termination codon for G protein synthesis occurs at positions 101-103 (J. Rose, manuscript in preparation), and the M protein termination codon has not yet been identified.

duce full-length transcripts of VSV mRNAs with a yield greater than 90% (J. Rose, unpublished results). This early termination prevented use of the chain terminator sequencing method (Sanger, Nicklen and Coulson, 1977). To obtain the intergenic sequences, I therefore chose the procedure of purifying that fraction of 5’labeled primer which was extended more than 200300 nucleotides, followed by sequencing using the procedure of Maxam and Gilbert (1977). Sequences of the vRNA Regions Separating the NS, M, G and L Genes Examples of sequencing gels for each of the extended primers are shown in Figure 4. The complete primer sequence and some additional nucleotides were run off of the gels. The sequences near the bottom of each gel correspond to the sequences near the 3’ ends of each mRNA. In each case, the sequence copied from the vRNA agrees exactly with the sequence at the 3’ end of the mRNA (Figure 2; Rose and Iverson, 19791, including the common poly(A) proximal tetranucleotide TATG and seven A residues corresponding to the first seven As in the poly(A) sequence (Figure 4). This common undecamer is followed in each case by a dinucleotide, either GT (Figure 4, NS-M) or CT (Figure 4, M-G and G-L). These “spacer” dinucleotide sequences do not appear in VSV mRNA sequences and are followed immediately by the sequence (WAACAG, the common 5’ terminal (capped) sequence on VSV mRNAs (Rhodes and Banerjee, 1976; Rose, 1978). In the case of the G-L junction, the AACAG sequence begins the known sequence in the L mRNA ribosome binding site (Rose, 1978). The extended 5’ terminal sequences on M and G mRNAs were not known previously and are discussed below. The complete intergenic regions are illustrated in Figure 5 with the corresponding mRNA

Primer Isolation and Extension on vRNA To obtain primers suitable for extension through the intergenic regions, the sequences of plasmid inserts near the 3’ ends of the NS, M and G mRNAs were scanned to locate short restriction fragments. The fragments chosen were 33, 49 and 52 nucleotides long and are indicated with arrows in Figure 1. These specific fragments were chosen because they were expected to have DNA strands of unequal length, thus facilitating subsequent strand separation and priming. The three single-stranded, 5’ 32P-labeled primers were isolated as described in Experimental Procedures, hybridized to an excess of vRNA and extended by reverse transcription in the presence of four unlabeled dNTPs. Separation of the extended pM32 primer fragments on a 20% acrylamide gel is shown in Figure 3, with sizes of the fragments indicated. Although more than 60% of the primer molecules were extended, fewer than 20% were extended more than 200 nucleotides. This relatively short extension was found with all three primers and was unexpected because these conditions of reverse transcription propNS 173

t1.

t

t

_= t 4

t

2

1

3

4

5

6

1

E w

14

NS mRNA C

-

PoIY(A)

8

~M32

M mRNA C

1

2

3

4

5

7

6

*

c

‘h

G mRNA 2

4

6

8

10

12

14

P+(A)

a

16

,b

b wlv(A)

Figure

1. Restriction

Maps of Plasmid

Inserts

Single lines represent the VSV NS. M and G mRNAs with lengths given in hundreds of nucleotides. Double lines represent the region of each mRNA sequence present as inserts in the indicated plasmids. Each insert has dG. dC “tails” 0 at one end, and dT.dA sequences [derived from the oligo(dT) primer] linked to dG.dC “tails” till at the other end. Double arrows represent the regions of each plasmid where sequences were determined on both DNA strands. Single arrows show locations of fragments used to generate single stranded DNA primers: lengths given are for the (+I strand. The wavy lines represent pBR322 sequences: distances to the indicated restriction sites are in base pairs (Sutcliffe, 1976).

VW 417

lntergenic

r-4

100 50 . . ..GCUAGUCUAA CUUCUAGCW CUGAACAAUC CCCGGUWAC UCAGUCUCUC CUAAWCCAG CCUCUCGAAC AACUAAUAUC CUGUCUUUUC UAUCCCUAUG-poly(A) G . . ..CGATCAGATT GAAGATCGAA GACPKXTAG GGGCCAAATG AGTCAGAGAG GATTAAGGTC GGAGAGCTTG TTGA'PTATAG GACAGAAAAG ATAGGGATAC-T 22 14

G Figure

Sequences

100 50 . . ..CUCAAAUCCU GCACAACAGA UUCWCAUGU WGGACCAAA UCAACWGUG AUACCAUGCU CAAAGAGGCC UCAAUUAUAU WGAGWWU . . ..GAG'FiTAGGA OX'GTTGTCT AAGAAGTACA AACCTGGTIT AGTTGAACAC TATGGTACGA GTTTCTCCGG AGTTAATATA AACTCAAMA 2. Poly(A)

Proximal

Sequences

of VW

AAWUWAUG-ply(A) TTAAAAATAC-T G 10 18

M and G mRNAs

The sequences of 100 nucleotides extending from the poly(A) in each mRNA are shown. These sequences were deduced from both DNA strands of the insert in pM32 and pG65; the sequence of one DNA strand is given in each case. The oligo(dT) sequences are derived from the oligo(dT) used to prime first strand cDNA synthesis (Rose and Iverson, 1979).

sequences. The sequence between the N and NS genes is from McGeoch (1979) and the sequence at the end of the L gene is from Schubert et al. (1980). Extended Primers Yield 5’ Terminal Sequences from M and G mRNAs No sequences other than cap-AACAG were known previously for the immediate 5’ ends of the M and G mRNAs (Rhodes and Banerjee, 1978). At the NS-M and M-G intercistronic boundaries, as at the N-NS and G-L boundaries, AACAG sequences follow sequences corresponding to the 3’ ends of the preceding mRNAs after dinucleotide spacers (Figures 4 and 5). These AACAG sequences clearly correspond to the beginning of the M and G mRNAs because the exact ribosome binding site sequences (Rose, 1978) occur at positions 23-59 (MI and 17-51 (G), following the AACAG (Figures 4 and 6). These results complete and in some cases extend the 5’ terminal sequences for all the VSV mRNAs, and position each of the translation initiation codons relative to the 5’ ends of the mRNA (Figure 6). Discussion In this paper I describe the use of cDNA clones of VSV mRNAs to obtain the sequences of the 3’ ends of VSV mRNAs and to generate primers that were used to sequence through the intergenic regions on vRNA into the adjacent genes. Together with the sequence of one intergenic region reported recently (McGeoch, 1979), the three intergenic sequences reported here provide the complete set and directly confirm the gene order (B’)N-NS-M-G-L(5’) suggested initially from indirect transcription mapping experiments (Abraham and Banerjee, 1976; Ball and White, 1976). The results presented also locate the ribosome binding sites in M and G mRNAs relative to the 5’ ends and confirm their sequences. There are only 70 nucleotides of genomic RNA whose complements do not appear in mRNA and leader RNA transcripts. These are eight nucleotides in the intergenic regions, three nucleotides at the junction of vRNA sequences encoding the leader RNA and N mRNA (McGeoch and Dolan, 1979) and 59

nucleotides al., 1980).

at the 5’ end of the genome

(Schubert

et

General Features of the lntergenic Regions The extent of sequence homology is the most striking feature of the four vRNA regions which encode the boundaries of the five structural genes. The general structure can be represented as (3’)AUACUUUUUUUNAUUGUCNNUAG(5’), with N representing positions at which the sequence varies (see Figure 5). The first eleven nucleotides of this sequence probably signal polyadenylation because they are complementary to the common mRNA sequence (SYJAUGAAAAAAA, which occurs at the mRNA-poly(A) junctions. The eleven nucleotide sequence is followed by a dinucleotide (underlined) and then immediately by the sequence complementary to the 5’ terminal mRNA sequence (5’)AACAGNNAUC(3’) beginning the next gene. Thus the dinucleotides are the only vRNA sequences from these junctions that are not represented in the mRNA sequences. The intergenic dinucleotide is always GA, except between the NS and M genes, where it is CA (Figure 5). The GA sequence also follows an identical polyadenylation signal for L mRNA (Schubert et al., 1980; Figure 51, suggesting that it may be an important part of the signal. Corresponding with this one sequence difference is the finding that anomalous polyadenylation is especially prevalent at the NS-M junction, generating NS mRNA linked to M mRNA by long poly(A) (Herman et al., 1978). One interesting feature of the vRNA sequence in each gene which precedes another gene (but not in L) is the occurrence of the related sequences (S’)UAUAA(S’), (3’)lJAUAG(5’) and (3’)UAAUA(S’), which begin 28-36 nucleotides before the start of the next gene (Figure 5). These sequences resemble the putative eucaryotic “promoter” sequence (5’)TATAAA(3’) that has been found 27 nucleotides before presumed polymerase II initiation sites on eucaryotic DNA (Ziff and Evans, 1978). The sequence (3’YJAAUA(S’) also occurs twice in the vRNA sequence encoding the leader RNA (McGeoch and DoIan, 1979) at positions 29 and 32 nucleotides from the start of the N gene. The occurrence of these

Cell 418

tain. Regions of dyad symmetry are found centered around the junction of the NS and M genes and at the 3’ ends of the G mRNA (Figure 5) but these also are not general features of the intergenic boundaries. Such features could be related to the process of attenuation which results in unequal transcription rates for the VSV genes (Villarreal, Breindl and Holland, 1976). Local secondary structure does not appear to be an important feature of these intergenic boundaries, although several structures can be drawn for the N-NS and G-L boundaries. These would involve almost exclusively AU base pairs and would be only marginally stable (Tinoco et al., 1973).

-0RIGlN

33 x

Figure 3. Gel Autoradiogram Showing the Fragments Obtained Extension of the Primer Derived from pNS173 on vRNA

after

The 5’ “P-labeled primer was extended on vRNA template and the products were separated by electrophoresis on a 20% acrylamide. 0.5% bisacrylamide gel containing 7 M urea. The positions of the xylene cyanol dye (XC), the 33 nucleotide primer and the lengths of extended primers are indicated.

sequences preceding each VSV mRNA start site would thus be consistent with a role in promoting transcription initiation. The vRNA regions encoding the last 40 nucleotides at the 3’ ends of the N and G mRNAs are extremely AU-rich (75%), but this is not a general feature of the 3’ ends of VSV mRNAs, so its significance is uncer-

Transcriptive Events at the lntergenic Boundaries The two general models that explain the sequential nature of VSV transcription involve either cleavage of a precursor (see review by Banerjee et al., 1977) or multiple, sequential transcription initiations. In the cleavage model, the polymerase would transcribe through the intergenic regions. Two subsequent cleavage events would then be required to remove the intergenic dinucleotide, followed by capping and methylation of the 5’ terminus. Poly(A) tails could be added by an enzyme that recognizes. . .UAUGAAAAAAA(3’) at the 3’ end of the cleaved transcript. Alternatively, poly(A) could be added before cleavage if the polymerase copied the oligo(U) sequence repetitively before proceeding. In the multiple initiation model, the polymerase would terminate in the oligo(U) sequence, perhaps after repetitive copying. Synthesis of the next mRNA species would then require a separate initiation event. The possible promoter sequence located in the 3’ end of the preceding gene might be part of a signal for this initiation. Internal initiation of transcription can occur on the VSV genome, as shown by Roy and Bishop (1973), who found a y-32P-ATP-labeled, 5’ terminal sequence pppAAPyNG on RNA synthesized in vitro. This sequence is different from the 5’ terminal leader RNA sequence (Colonno and Banerjee, 1976) and could be a precursor of the common 5’ terminal mRNA sequence m’GpppAACAG (Rhodes and Banerjee, 1976; Rose, 1976). Primary and Secondary Ribosome Sites The sequences of the M and G mRNAs preceding their ribosome binding sites (Rose, 1978) were not known previously and were deduced from the sequences of primers extended from within the ends of the adjacent NS and M genes (Figure 4 and 6). These sequences show that the initiator AUG codons occur at positions 30-32 (G mRNA) and 42-44 (M mRNA). Consistent with the general view of eucaryotic translation (Kozak, 1978), the major initiation complexes were formed only at the first AUG in each VSV mRNA.

VW 419

lntergenic

Sequences

NS-M GACCT

G-L GACc’r

M-G GACCT A

*t-

-c

30 w

c-

Figure 4. Autoradiograms G, and G and L Genes

of Portions

of Sequencing

Gels Showing

-4

the Sequences

Derived

from Primers

Extended

between

the NS and M. M and

Sequences corresponding to the 3’ end of each mRNA are indicated at the bottom of each gel. Numbers of every tenth nucleotide starting below the Ar sequence correspond to those in Figure 5. Sequences corresponding to the 5’ end of each mRNA are indicated in the top portion of each gel. Numbering of every tenth nucleotide starting from the 5’ end sequence of each mRNA corresponds to numbers given in Figure 6. Electrophoresis was on 6% polyacrylamide gels (65 cm X 16 cm x 0.35 mm). Sequences from the bottom half of each gel are shown.

and the GUG codon preceding the initiator AUG in M mRNA was not recognized. The sequence of N mRNA extending beyond the major ribosome binding site (Rose, 1978) is shown in Figure 6. This sequence was determined from fulllength cDNA copied from N mRNA (J. Rose, unpublished data) and from a cDNA clone (L. lverson and J. Rose, unpublished data). The sequence agrees with and extends the sequence reported by McGeoch and Dolan (1979). The underlined sequence centered around the second AUG codon is a minor ribosome binding site in N mRNA that was partially sequenced (spot 8; Rose, 1978) but not located relative to the major site at the 5’ end. The partial sequences of each of the Tl oligonucleotides in the site were in exact agreement with those predicted from the underlined site. If protein synthesis initiated at this site, the protein synthesized would be read in a different frame from the product initiated at the first AUG codon, and would

code for a 30 residue peptide terminating at positions 165-l 67. Although this second initiation site may be an in vitro artifact, it should be noted that such a short peptide would probably have gone undetected in the past. M Protein Structure Extensive homology was noted previously for the VSV M mRNA ribosome binding site and the alfalfa mosaic virus (AIMV) coat mRNA ribosome binding site (KoperZwarthoff et al., 1977; Rose, 1978). This homology, as well as the nearly identical sizes of the mRNAs and proteins, suggested evolutionary relatedness. The predicted NH2 terminal sequence for the first 40 amino acids of M protein is given in Figure 6. Additional similarities are apparent from this sequence and the sequence of the AIMV coat protein (Van Beynum et al., 1977). The amino terminal portions of both proteins are highly basic and the spacing of the basic

Cell 420

IIlRNAS VRNA

N

=P

NS

G

NS

I P ..!A"AA""C"CA:A"CACC"A"uA"A"A""A"&"ACA~.po,y(A) pAACAGAUAUC?: , ..%JAUUAAGAGUCUAGUGGA ~~CGAUGUAUAC~UUUUUUUUGAUUGUCUA~~

M

pP

IM2NA.s

..5;;UA~nnUcAG~~wrGAGU~UA~~U~~UAGA~~.pp,"(~)

WNA

..~AUGUUAGUCCGCUCUCAGUU~GAGACAUCUGAUA~UUUU""U~AUUGUCUAUAG~~ ---I-=

pAACAGAUAUC?.:

G

mP.NAs

M 30 10 ..&JCUCGAACbJAAUAUCCUGUCUU"UCtiAUCCCU~-pol~A~

VFNA

..?GG?tGAGC""G"UGA~ACAGAAAAGAUAGGGAUACUUuuuuuHJuGUCUCL&

G pP

'AACAGAGAUC?:

Figure 5. Nucleotide vRNA at the Junctions Genes and at the End sponding to the 3’ End

Sequences of VSV of the Five Structural of the L Gene Correof the mRNA

The vRNA sequences at the junctions of the NS, M, G and L genes were determined from the gels shown in Figure 4 and from other experiments. The mRNA sequences encoded are shown above the vRNA sequences. The 3’ terminal N. NS, M and G mRNA sequences are from Rose and lverson (1979) and this paper. Underlined sequences are identical at each junction. Possible promoter sequences are bracketed, and arrows indicate regions of dyad symmetry.

G L =P 30 10 ..!CAA~GAGGCC~CI\AVVAUAU~UGAGUIIUU~~~U~-~~I~~) pp~~cc~uc!~ I ..!GU"UCUCCGGAGU~~CUCAAAA?HJ"AAAAAlJACWUUU"lJC1A"UGUCGU"AGf. -,L 30 'P UCAUGAGGAGACUCCAAACUUUAAG~~ot~~A~

IllFNA

..!~Gxrmwd

vRNA

,.?UCUAAUULIUU~JAGUACUCCUCUGAGGUUUGAAAU~C?IUACLJ~~~LJ~~GAMNXAGGA...~

N

‘! ___ m'CpppAmACAC"AA"CAAA~UCU GUU ACA GOC AAG AGA A"C A"" Met Ser Val Thr Val LyS Rrq Ile Ile

GAC AAC ACA %C AUA GUU CCA AAA C"U CCU GCA nA=AG ASP Asn Thr Val Ile Val Pro Lys Le" Pro Ala Asn Glu

GAU CCA ASP Pro

150 100 GUG GAA "AC CCG GCli GAU UAC "UC AGA AAA UCA RAG GAG AW CCU CUU "AC AUC AA" AC" ACA ti AGU UUG UCA GAU CSGA Val Glu Tyr Pro Ala ASP Tyr Phe Ax-q Lys Ser Lys Glu Ile Pro Leu Tyr Ile Asn Thr Thr Lys Ser Leu Ser ASP LezArq

-

_

‘!

NS

m'GP&nACAGAUAUC~GAU AAU CUC ACA AAA GUU CGU GAG "A" Met ASP Am Leu Thr LyS Val AX-q Glu Tyr

M

m'GPPPAmACAGAUAUCACGA"C"AAGUG""AUCCCAAUCCA"UCAUC

--

C"C AAG UCU Leu LyS Ser

42 50 AUG AGU WCC WA AAG AAG AIJU CUC GGU CUG AAG GGG AM Met Ser Ser Le" Lys Lys Ile Leu Gly Leu LyS Gly Lys

GGU AAG ARA Gly Lys Lys

IS0 ,qo UCU AAG AAA U"A GGG AUC GCA CCA CCC CCU UAU GAA GAG GAC ACU AGC AUG GAG UAU GCU kCG AGC GCU CCA A"" Ser Lys Lys Leu Gly Ile Ala Pro Pro Pro Tyr Glu Glu ASP Thr Ser Met Glu Tyr Ala Pro Ser Ala Pro Ile

G

L Figure

30

--

m'G@mACAGAGAUCGA"C"GU"UCCU"GACA~

GAC AAA Asp Lys

50

AAG UGC CUU UUG UAC UUA G Met Lys Cys Leu Le" Tyr Leu

‘!

m'G~~~~A;nACAGCAA"C~GAA GUC CAC GA" U"" GAG ACC GAC GAG WC AA Met Glu Val His Asp Phe Glu Thr Asp Glu Phe 6. Complete

5’ Terminal

Sequences

from VSV mRNAs

The sequences of the ribosome binding sites (underlined) were reported previously (Rose. 19761, and are in complete agreement with the sequences reported here except at one position. The sequence AUUUUG at the 3’ end of the L mRNA site was previously found to be AUUUG. The RNA sequence error presumably resulted from inaccurate quantitation of nearest neighbor transfer. Lines above the sequences indicate regions of homology in all VW mRNAs. The presumptive translation initiation codons are boxed. The initiation codon in the secondary ribosome binding site (N mRNA) and the termination codon in the same frame are bracketed.

residues (mostly lysines) is similar in the first 20 positions of both proteins. Further sequencing will presumably reveal other similarities between these proteins and other proteins of apparently unrelated viruses.

Experimental

Procedures

Cloning of VSV mRNA Sequences Synthesis of single- and double-stranded DNA copies of VSV mRNAs and insertion of these DNAs at the Pst I site of pBR322 (Bolivar et al., 1977) has been described (Rose and Iverson. 1979) and will be

VSV lntergenic 421

Sequences

reported in greater detail elsewhere (J. Rose and L. Iverson. manuscript in preparation). All work was performed in accordance with the NIH Guidelines under EKl /Pl conditions. DNA Sequencing Restriction fragments of plasmid DNA were fractionated by polyacrylamide gel electrophoresis. recovered by electroelution and labeled with Y-~*P-ATP and polynucleotide kinase as described previously (Rose and Iverson, 1979). Chemical sequencing reactions on electroeluted DNA fragments were as described (Maxam and Gilbert, 1977). Thin gels (Sanger and Coulson, 1978) of either 20% acrylamide (40 cm x 18 cm x 0.35 mm) or 8% acrylamide (85 cm x 18 cm x 0.35 mm) were used to fractionate the reaction products. Isolation of Primers for vRNA Sequencing Isolation of the primers illustrated in Figure 1 from pNSl73, pM32 and pG85 was performed as follows: -pNSl73 DNA was digested with Hae Ill and the 235 bp Hae Ill-8 fragment (145 bp of pBR322 linked to 90 bp of insert DNA) was purified by gel electrophoresis followed by electroelution. Following labeling with Y-~‘P-ATP and polynucleotide kinasa, the fragment was digested with Hint I and the products were separated on a 40 cm x 18 cm x 0.35 mm sequencing gel. The 33 nucleotide, single-stranded primer fragment was located by autoradiography and eluted by soaking at 37’C for 5 hr in 0.5 ml 0.4 M sodium acetate. -pM32 DNA was digested with Hinf I and the 401 bp Hinf l-4 fragment (250 bp of pBR322 DNA and 151 bp of insert DNA) was purified and labeled as above. Secondary Hpa II digestion generated the 52 nucleotide primer which was purified as above. -pG65 DNA was digested with Hinf I and the 359 nucleotide Hinf I5 fragment (250 bp of pBR322 DNA and 109 bp of insert DNA) was labeled and purified as described above. Secondary Hae Ill digestion generated the 49 nucleotide primer that was purified as described above.

Ball, L. A. and White, 442-448.

Acknowledgments I thank Linda Iverson. Bart Sefton, lnder Verma and other members of the Tumor Virology Laboratory for their helpful comments and suggestions. I am grateful to Patricia Kelley for excellent technical and artistic assistance and to Carolyn Goller for typing this manuscript. I thank Robert Lazzarini for communicating the results from his laboratory (Schubert et al., 1980) on the 3’ terminal L mRNA sequence prior to publication. This work was supported by grants from the National Institute of Allergy and Infectious Diseases and the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received

October

29. 1979

References Abraham, G. and Banerjee. 73. 1504-l 508.

A. K. (1976).

Proc.

Nat. Acad.

Sci. USA

Proc.

Nat. Acad.

Sci. USA

Baltimore. D., Huang, A. S. and Stampfer, Acad. Sci. USA 66, 572-576.

M. (1970).

Banerjee. A. K.. Abraham. Viral. 34, l-8.

R. J. (1977).

Bolivar, F.. Rodriguez, Gene 2, 95-112. Colonno,

G. and Colonno,

R. L.. Betlach.

R. J. and Banerjee.

M. C. and Boyer,

A. K. (1976).

Huang,

A. S. and Wagner,

R. R. (1966).

Proc.

73, Nat.

J. Gen.

H. W. (1977).

Cell 8, 197-204.

Herman, R. C., Adler, S.. Lazzarini. R. A., Colonno. A. K. and Westphal. H. (1978). Cell 15, 587-598.

R. J., Banerjee.

J. Mol. Biol. 22, 381-384.

Koper-Zwarthoff, E. C., Lockard. R. E.. deweerd, B. A.. RajBhandary, U. L. and Bol, J. F. (1977). Proc. Nat. Acad. Sci. USA 74, 55045508. Kozak.

M. (I 978).

Cell 7 5. 1109-l

McGeoch.

D. J. (1979).

McGeoch. 3211.

D. J. and Dolan.

Maxam, 560-564. Rhodes,

A. (1979). W. (1977).

D. P. and Banerjee,

Rose,

J. K. (1978).

Rose,

J. K. and Iverson.

Nucl. Proc.

A. K. (1978).

Acids

Res. 6, 3199-

Nat. Acad.

Sci. USA 74,

J. Viral. 5, 559-567.

Cell 14, 345-353.

Roy, P. and Bishop, Sanger.

123.

Cell 17, 873-681.

A. M. and Gilbert,

L. (1979).

J. Virol. 32, 404-411.

D. H. L. (1973).

F. and Coulson,

J. Viral.

A. R. (1978).

Schubert, M., Keene, J. Virol., in press.

J. D., Herman,

J. G. (1978).

Nucl.

Acids

72, 969-983.

FEBS Letters

Sanger. F., Nicklen. S. and Coulson. Sci. USA 74, 5463-5487.

Sutcliffe, Primer Extension and Sequencing An amount of 5’ “P-labeled, single-stranded primer derived from 20 Fg of plasmid DNA (approximately IO’ dpm) was combined with 15 Pg of VSV vRNA and precipitated with ethanol. The pellet was washed with ethanol, dried and resuspended in 10 ~1 of 4X reverse transcrip tion buffer containing 200 mM Tris-HCI (pH 8.4). 40 mM MgCb. 120 mM &mercaptoethanol. 440 mM KCI. and each of the four dNTPs at 2 mM. This mixture was incubated for 10 min at 42’C. followed by addition of 20 PI of Hz0 and 300 units of reverse transcriptase in 10 ~1. Incubation was for 2 hr at 42°C. followed by phenol extraction and ethanol precipitation. The extended primers were purified by polyacrylamide gel electrophoresis under denaturing conditions, followed by sequencing using the method of Maxam and Gilbert (I 977).

C. N. (1976).

87, 107-l

A. R. (1977).

Proc.

R. C. and Laxxarini.

10.

Nat. Acad. R. A. (1980).

Res. 5, 2721-2728.

Tinoco. I.. Jr., Borer, P. N.. Dengler, B., Levine, M. D., Uhlenbeck. 0. C.. Crothers. D. M. and Gralla, J. (1973). Nature New Biol. 248, 4041. Van Beynum, G.. DeGraaf, J.. Castel. (1977). Eur. J. Biochem. 72, 63-78. Villarreal, L. P.. Breindl, 15, 1663-l 667. Ziff, E. B. and Evans,

M. and Holland,

R. M. (1978).

M.. Kraal,

B. and Bosch,

J. J. (1976).

Cell 15, 1463-1475.

Biochemistry

L.