Complete mitochondrial genome of the atlas moth, Attacus atlas (Lepidoptera: Saturniidae) and the phylogenetic relationship of Saturniidae species

Gene 545 (2014) 95–101

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Complete mitochondrial genome of the atlas moth, Attacus atlas (Lepidoptera: Saturniidae) and the phylogenetic relationship of Saturniidae species Miao-Miao Chen a,1, Yan Li a,1, Mo Chen a, Huan Wang a, Qun Li a, Run-Xi Xia a, Cai-Yun Zeng b, Yu-Ping Li a,⁎, Yan-Qun Liu a,c,⁎, Li Qin a a b c

Insect Resource Center for Engineering and Technology of Liaoning Province, Shenyang Agricultural University, Shenyang 110866, China Administration Bureau of Xishuangbanna National Nature Reserve, Yunnan, Jinghong 666100, China Key Laboratory of Wild Silkworms of Liaoning Province, Sericultural Institute of Liaoning Province, Fengcheng 118100, China

a r t i c l e

i n f o

Article history: Received 13 January 2014 Received in revised form 28 April 2014 Accepted 1 May 2014 Available online 2 May 2014 Keywords: Atlas moth Attacus atlas Nucleotide composition Genomic structure Phylogenetic relationship

a b s t r a c t Mitochondrial genome (mitogenome) can provide information for genomic structure as well as for phylogenetic analysis and evolutionary biology. In this study, we present the complete mitogenome of the atlas moth, Attacus atlas (Lepidoptera: Saturniidae), a well-known silk-producing and ornamental insect with the largest wing surface area of all moths. The mitogenome of A. atlas is a circular molecule of 15,282 bp long, and its nucleotide composition shows heavily biased towards As and Ts, accounting for 79.30%. This genome comprises 13 proteincoding genes (PCGs), two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNAs), and an A + T-rich region. It is of note that this genome exhibits a slightly positive AT skew, which is different from the other known Saturniidae species. All PCGs are initiated by ATN codons, except for COI with CGA instead. Only six PCGs use a common stop codon of TAA or TAG, whereas the remaining seven use an incomplete termination codon T or TA. All tRNAs have the typical clover-leaf structure, with an exception for tRNASer(AGN). The A. atlas A + T-rich region contains non-repetitive sequences, but harbors several features common to the Bombycoidea insects. The phylogenetic relationships based on Maximum Likelihood method provide a well-supported outline of Saturniidae, which is in accordance with the traditional morphological classification and recent molecular works. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Mitochondria, the oxygen-processing factories of eukaryotic cells, have their own genome that encodes genes involved in oxidative phosphorylation and a unique translation system of 2 ribosomal RNA genes (rRNAs) and 22 transfer RNA genes (tRNAs) used for synthesis of the 13 inclusive protein-coding genes (PCGs). In cell, the mitochondrial genome (mitogenome) forms a unit of genetic information and evolves independently from the nuclear genome (Wolstenholme, 1992). The mitochondrial DNA sequence has been widely used for phylogenetic and population genetic studies of animals, due to the characteristics of small size, maternal inheritance, lack of genetic recombination, and Abbreviations: mitogenome, mitochondrial genome; mtDNA, mitochondrial DNA; PCGs, protein-coding genes; ATP, F0 ATPase; COI-III, cytochrome oxidase subunits; CytB, cytochrome B; ND, NADH dehydrogenase; lrRNA, large subunit ribosomal RNA; srRNA, small subunit ribosomal RNA; tRNA, transfer RNA. ⁎ Corresponding authors at: Department of Sericulture, College of Bioscience and Biotechnology, Shenyang Agricultural University, No. 120 Dongling Road, Shenyang 110866, China. E-mail addresses: [email protected] (Y.-P. Li), [email protected] (Y.-Q. Liu). 1 M.-M.C. and Y.L. contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2014.05.002 0378-1119/© 2014 Elsevier B.V. All rights reserved.

relatively rapid evolutionary rate (Cameron, 2014; Kim et al., 2011; Nardi et al., 2003). In insects, the mitogenome is a circular molecule of 14–20 kb in length and contains 13 PCGs, 2 rRNAs, 22 tRNAs, and a control region, also known as the A + T-rich region (Boore, 1999; Shadel and Clayton, 1993; Wolstenholme, 1992). Thus far, the complete mitogenomes have been sequenced in more than 260 species of insects (http://www.ncbi.nlm.nih.gov). Of these mitogenomes, only about 50 are from Lepidoptera species, although it is one of the four megadiverse insect orders. In the superfamily Bombycoidea of Lepidoptera, Saturniids have been important not only as sources of wild silk and/or human food in a number of cultures, but also as models for comparative studies of genetics, development, physiology, and ecology (Regier et al., 2008a). Saturniidae has been estimated to contain over 1860 species worldwide (Lemaire and Minet, 1998); however, the mitogenome information available is very limited. To date, only seven mitogenomes from Saturniidae species are available in GenBank, including Samia cynthia (KC812618; Sima et al., 2013), Samia ricini (JN215366; Kim et al., 2012), Antheraea pernyi (HQ264055 and AY242996; Liu et al., 2008, 2012a), Antheraea yamamai (EU726630; Kim et al., 2009), Caligula boisduvalii (EF622227; Hong et al., 2008), Saturnia pyretorum

96

M.-M. Chen et al. / Gene 545 (2014) 95–101

(FJ685653; Jiang et al., 2009), and Actias selene (NC_018133; Liu et al., 2012b). Mitogenomes from Bombycidae (AB070264 for Bombyx mori, AY301620 for Bombyx mandarina China, NC_003395 for B. mandarina Japan) and Sphingidae (EU286785 and KC470083 for Manduca sexta and Sphinx morio, respectively) are also available in GenBank (Cameron and Whiting, 2008; Kim et al., 2013; Pan et al., 2008; Yukuhiro et al., 2002). The atlas moth, Attacus atlas (Lepidoptera; Saturniidae), is a famous insect species with its silk-producing and ornamental value. This moth has the largest wing surface area of all moths, with a maximum recorded wing span of 300 mm. The atlas moths are named after the Titan of Greek mythology. This species is found only in Southeast Asia, including China, particularly in tropical rainforest habitats at altitudes between sea level and about 1500 m. The larvae feed on a variety of plants including Annona (Annonaceae), Citrus (Rutaceae), Nephelium (Sapindaceae), Cinnamomum (Lauraceae), and Psidium (Myrtaceae). They often move from one plant species to another in the course of their development. The cocoons produced by atlas silkworm are used to make a durable silk called Fagara silk (Jolly et al., 1979); in Taiwan, their cocoons are made into pocket purses. Based on the genetic databases from GenBank, only 13 nucleotide sequences from seven genes are available for this species; as a result, the available gene knowledge on this species is very limited. In the present work, we presented the complete mitogenome sequence of this important agricultural insect and compared it with other Bombycoidea species. What is more, we performed the phylogenetic analysis based on the available complete mitogenome sequences to provide insight into the phylogenetic relationship of Saturniidae. Our work provides the reference sequence of mitogenome for this species that may be utilized for the determination of population genetic studies in the future. 2. Materials and methods 2.1. Sample and total DNA extraction The A. atlas larvae were reared at the Administration Bureau of Xishuangbanna National Nature Reserve, Jinghong, Yunnan Province, China. The species identification was conducted based on the adult morphology. One fresh pupa was used to extract total DNA using the TIANamp Genomic DNA Kit (TIANGEN, Beijing, China), a silica-based DNA purification in convenient spin-column format. The procedure was consistent with the manufacturer instruction. 2.2. PCR amplification and sequencing In this study, four pairs of primer were used for PCR amplification of the A. atlas mitogenome in four overlapping fragments (Table 1; Fig. 1). Four primers (F1-F, F1-R, F3-F, and F3-R) were the previously published conserved primers, while other four specific primers (F2-F, F2-R, F4-F, and F4-R) were designed on the basis of the information from the

Table 1 Primers used for PCR amplification. Primer

Sequence (5′–3′)

Target gene

Reference

F1-F

CTACCTTTGCACRGTCAAGATACYGCGGC

lrRNA

F1-R F2-F F2-R F3-F F3-R

GGCTGAGATATAAGCGATAAATTG ATTTTTTTTCTTTAGTCTCCATTTC ATTTTTCTCGGTCTTTTATTGATTT GAAGCAGCTGCATGATATTGACA TTATCGAYAAAAAAGWTTGCGACCTCGATGTT

tRNATyr ND2 ND3 COIII lrRNA

F4-F F4-R

AGATAGAAACCAACCTGGCTTACAC TATAAATAAGAAATATGAAGAAATTATGAT

lrRNA lrRNA

Hwang et al. (2001) Sima et al. (2013) This study This study Hong et al. (2009) Hwang et al. (2001) This study This study

determined fragments. PCR reaction was performed in a 50 μl volume with 1 U of LA Taq (TaKaRa Co., Dalian, China), 1 μl (about 20 ng) of DNA, 5 μl 10 × LA Taq buffer (Mg2 + plus), 200 μM dNTPs, and 10 pmol each primer. PCR amplification was performed under the following procedure: 94 °C for 2 min, followed by 35 cycles of 1 min at 94 °C and 1–7 min at 65 °C, with a subsequent 10 min final extension at 72 °C. The PCR products were resolved by electrophoresis in 1.0% agarose gel. After purification with TIANgel Midi Purification Kit (TIANGEN, Beijing, China), the PCR fragments were sent to Beijing Huada Gene Research Center (Beijing, China), and directly sequenced by primer walking on an ABI 3730 Genetic Analyzer (Applied Biosystems). 2.3. Sequence annotation and genomic analysis The A. atlas mitogenome was completed through assembly of four overlapping sequences via the alignment of neighboring fragments using Clustal X (Thompson et al., 1997). The PCGs was determined by sequence comparison with the known Lepidoptera mitogenome sequences available in GenBank. The 5′ ends of PCGs were assumed to be at the first legitimate in-frame start codon (ATN, GTG, TTG, GTT) in an open reading frame (ORF) that was not located within an upstream gene encoded on the same strand, and the 3′ ends were inferred to be at the first in-frame stop codon encountered downstream of the start codon. A truncated stop codon (T or TA) adjacent to the beginning of the downstream gene was designated as the termination codon (Wolstenholme, 1992). Both the tRNAscan-SE search server and MITOS web server were used to identify the tRNA genes and their secondary structures with default parameters (Bernt et al., 2013; Lowe and Eddy, 1997). The combination of these two methods could identify all of the tRNAs. The lrRNA gene was annotated to extend to the boundaries of the flanking tRNALeu(CUN) and tRNAVal. The 3′ end of the srRNA gene was annotated to be adjacent to the start of tRNAVal, while the 5′ end was determined via comparing with orthologous sequences of other known Lepidoptera mitogenomes. The entire A + T-rich region was subjected to a search for the tandem repeats using Tandem Repeats Finder program (Benson, 1999). Composition skew analysis was carried out according to formulas AT skew = [A − T] / [A + T] and GC skew = [G − C] / [G + C] (Perna and Kocher, 1995). The overlapping regions and intergenic spacers between genes were counted manually. 2.4. Phylogenetic analysis A total of 13 Bombycoidea mitogenomes including nine Saturniidae, three Bombycidae and one Sphingidae were used to reconstruct the phylogenetic relationships. Besides, mitogenomes of dipteran Drosophila melanogaster (NC_001709; de Bruijn, 1983), and lepidopteran Thitarodes renzhiensis (HM744694; Cao et al., 2012) were used as outgroups. For phylogenetic analyses, two datasets were used: (1) amino acid sequences of 13 PCGs, (2) nucleotide sequences of 13 PCGs plus 2 rRNAs. The test for these two datasets on the resolution and relationships within the Lepidoptera has demonstrated that the majority of analyses did not substantially alter the relevant topology and node support (Kim et al., 2011). Nucleotide sequences of each of the 13 PCGs were translated into amino acid sequences then aligned with default setting, and these resultant alignments were retranslated into nucleotide alignments by MEGA 5.05 (Tamura et al., 2011). The alignment of the nucleotide sequences of 2 rRNAs was aligned with Clustal X using default settings (Thompson et al., 1997). The sequences of the 13 PCGs and 2 rRNAs were concatenated together, which may result in a more complete analysis (Hassanin, 2006). The analytical approach, Maximum Likelihood (ML), was used to infer phylogenetic trees with 1000 bootstrap replicates. Substitution model selection was also conducted based on the lowest BIC scores (Bayesian Information Criterion) using MEGA 5.05. The mtREV24 + G + F model and GTR + G + I model were the appropriate models for the amino acid sequence dataset and the nucleotide sequence dataset, respectively.

M.-M. Chen et al. / Gene 545 (2014) 95–101

97

Fig. 1. Circular map of the mitogenome of Attacus atlas. tRNA genes are denoted as one-letter symbols according to the IUPAC-IUB single-letter amino acid codes. The one-letter symbols L, L*, S and S* denote tRNALeu(CUN), tRNALeu(UUR), tRNASer(AGN), and tRNASer(UCN), respectively. Gene names underlined indicate a counter-clockwise transcriptional direction, whereas those not underlined indicate a clockwise direction. Overlapping arcs (F1–F4) within the circle indicate the PCR amplified fragments.

3. Results and discussion

analyzed Bombycoidea mitogenomes, it is of note that the GC skew of A. atlas exhibits the highest skew value (−0.241).

3.1. Genome organization, composition and skewness 3.2. Intergenic spacer regions and overlapping sequences The complete mitogenome of A. atlas (GenBank accession: KF006326) is a closed-circular molecule of 15,282 bp in length (Fig. 1), which is well within the range observed in the completely sequenced Saturniidae insects with the size ranging from 15,236 bp in A. selene to 15,566 bp in A. pernyi. It presents the typical set of 37 genes observed in metazoan mitogenomes, including 13 PCGs, 22 tRNA genes, 2 rRNAs (Table 2). The gene order and orientation of this genome are identical to the completely sequenced ditrysian species of Lepidoptera including Saturniidae, with the gene order tRNAMet-tRNAIle-tRNAGln. However, this arrangement is different from the ancestral gene order tRNAIle-tRNAGln-tRNAMet in the non-ditrysian lineage Hepialoidea of Lepidoptera (Cao et al., 2012). The nucleotide composition in the forward strand of A. atlas is heavily biased towards As and Ts, accounting for 79.30%: A 39.80%, G 7.86%, T 39.50% and C 12.84%. This bias value is well within the range observed for the sequenced Saturniidae species, from 78.91% in A. selene to 80.82% in S. pyretorum (Table 3). As for the A + T-rich region, the A + T content is 90.25%, which is also well within the range observed in the completely sequenced Bombycoidea species, with the value from 87.91% in A. selene to 95.55% in B. mori. The AT skew in the forward strand of A. atlas exhibits slightly positive (0.004), indicating the occurrence of more As than Ts. It differs from those found in previously sequenced Saturniidae species, with the value ranging from − 0.006 in S. ricini to − 0.031 in S. pyretotum. In contrast, the slightly positive AT skew is found in previously sequenced Bombycidae species varying from 0.55 for B. mandarina Japan to 0.59 for B. mori. Although the GC skew values are negative in all

The A. atlas mitogenome harbors a total of 129 bp intergenic spacer sequences, which is made up of 12 regions in the range from 1 to 48 bp. There are two major intergenic spacer regions at least 30 bp in length. The largest intergenic spacer sequence of 48 bp is located between tRNAGln and ND2, with A + T content of 87.50%. Although this region is common in lepidopteran species, it displays limited sequence conservation even within Saturniidae (Fig. 2A), supporting that it would imply no functional significance or might not serve as another origin of replication (Cameron and Whiting, 2008). The second largest spacer region is 33 bp long between tRNASer(AGN) and ND1, and it also contains the ATACTAA motif (Cameron and Whiting, 2008), which is conserved across Lepidoptera species (Fig. 2B). This special 7 bp motif has been proposed to be a recognition site by mtTERM protein, the transcription termination peptide (Taanman, 1999). In addition, this mitogenome has a total of 20 bp overlapping sequences in five regions. The longest overlap is 8 bp long, located between tRNATrp and tRNACys. Similarly sized overlaps are also observed in sequenced lepidopteran species (Kim et al., 2009). The ATP8 and ATP6 have a 7 bp overlap, which is common in the sequenced lepidopteran mitogenomes (Boore, 1999). 3.3. Protein-coding genes The initial codons for 13 protein-coding genes of A. atlas are the canonical putative start codons ATN (ATG for COII, ATP6, COIII, ND4, ND4L, ND1; ATT for ND2, ND3, ND5; ATA for ND6, CytB; ATC for ATP8),

98

M.-M. Chen et al. / Gene 545 (2014) 95–101

Table 2 Annotation and gene organization of the A. atlas mitogenome. Gene

Direction

Nucleotide no.

Size (bp)

Anticodon

tRNAMet tRNAIle tRNAGln ND2 tRNATrp tRNACys tRNATyr COI tRNALeu(UUR) COII tRNALys tRNAAsp ATP8 ATP6 COIII tRNAGly ND3 tRNAAla tRNAArg tRNAAsn tRNASer(AGN) tRNAGlu tRNAPhe ND5 tRNAHis ND4 ND4L tRNAThr tRNAPro ND6 CytB tRNASer(UCN) ND1 tRNALeu(CUN) lrRNA tRNAVal srRNA A + T-rich region

F F R F F R R F F F F F F F F F F F F F F F R R R R R F R F F F R R R R R

1–68 70–133 131–199 248–1261 1265–1331 1324–1390 1394–1457 1462–2992 2993–3059 3060–3741 3742–3812 3833–3898 3899–4060 4054–4730 4731–5519 5523–5588 5589–5940 5941–6009 6009–6073 6074–6140 6140–6205 6206–6271 6272–6336 6337–8080 8081–8146 8147–9487 9488–9777 9786–9849 9850–9914 9917–10,453 10,457–11,606 11,607–11,672 11,706–12,644 12,646–12,712 12,713–14,080 14,081–14,146 14,147–14,923 14,924–15,282

68 64 69 1014 67 67 64 1531 67 682 71 66 162 677 789 66 352 69 65 67 66 66 65 1744 66 1341 290 64 65 537 1150 66 939 67 1368 66 777 359

CAT GAT TTG

Non

OL

Start codon

Stop codon

ATT

TAG

CGA

T-tRNA

ATG

T-tRNA

ATC ATG ATG

TAA TA-COIII TAA

ATT

T-tRNA

ATT

T-tRNA

ATG ATG

TAA TA-ND4

ATA ATA

TAA T-tRNA

ATG

TAA

1 3 48 3

TCA GCA GTA

8 3 4

TAA CTT GTC

20 7 3

TCC TGC TCG GTT GCT TTC GAA

1 1

GTG 8 TGT TGG

2 3

TGA

33 1

TAG TAC

F, forward; R, reverse; Non, non-coding region; OL, overlapping region.

with the exception of COI. The start codon for COI remains uncertain, although its open reading frame starts at a CGA codon for arginine as found in all Bombycoidea insects (Fig. 3). Four atypical and longer initiators have been proposed for COI in Bombycoidea, such as TTAG for A. selene, A. pernyi, A. yamamai, B. mori, and B. mandarina; TTG for C. boisduvalii; CGA for S. pyretorum, S. cynthia, and M. sexta; even a typical start codon ATT for S. ricini. Recently, a study based on expressed

sequence tag data from Maruca vitrata (Lepidoptera: Crambidae) have shown that COI may start with the CGA (Margam et al., 2011). Therefore, the present study tentatively designates the CGA as the start codon of COI of A. atlas. Among 13 PCGs, only six share the complete termination codon TAA or TAG, and the remaining possess the incomplete termination codons (T for COI, COII, ND3, ND5, CytB, and TA for ATP6, ND4L). The non-

Table 3 Composition and skewness in the forward strand of the complete mitogenome of superfamily Bombycoidea. Family/species

Size (bp)

A%

G%

T%

C%

A+T%

AT skew

GC skew

Saturniidae A. atlas S. cynthia S. ricini A. selene A. pernyi wild A. pernyi domestic A. yamamai C. boisduvalii S. pyretorum

15,282 15,345 15,384 15,236 15,537 15,566 15,338 15,360 15,327

39.80 39.60 39.65 38.54 39.38 39.22 39.26 39.34 39.17

7.86 7.83 7.81 8.05 7.38 7.77 7.69 7.58 7.63

39.50 40.25 40.13 40.37 40.73 40.94 41.04 41.28 41.65

12.84 12.31 12.41 13.03 12.20 12.06 12.02 11.79 11.55

79.30 79.86 79.78 78.91 80.11 80.16 80.29 80.62 80.82

0.004 −0.008 −0.006 −0.023 −0.017 −0.021 −0.022 −0.024 −0.030

−0.241 −0.222 −0.227 −0.236 −0.227 −0.216 −0.219 −0.217 −0.204

Bombycidae B. mori B. mandarina China B. mandarina Japan

15,656 15,682 15,928

43.06 43.11 43.08

7.31 7.40 7.21

38.30 38.48 38.60

11.33 11.01 11.11

81.36 81.59 81.68

0.059 0.057 0.055

−0.216 −0.196 −0.213

Sphingidae M. sexta Sphinx morio

15,516 15,299

40.67 40.64

7.46 7.58

41.11 40.53

10.76 11.26

81.79 81.17

−0.005 0.001

−0.181 −0.195

M.-M. Chen et al. / Gene 545 (2014) 95–101

99

A A.atlas S.cynthia S.ricini A.pernyi domestic A.pernyi wild A.yamamai S.pyretorum C.boisduvalii A.selene

--CTCTATAGAG-AAAGAATTTAAAATTCTT--TTAA--TAAAT--TAA--TATTTTAA -ATTCTCTAGAATAAAGAACTTATAATTCTC--CCTATTTAAATAATAA--TATTTTAA -ATTCTCTAGAATAAAGAACTTATAATTCTC--CTTATTTAAATAATAA--TATTTTAA -ATTTTTCTTAATAAAGAATTGATAATTCTT-AAAAATTTATTTAATAA-TTATTTTTA ATTTTCTCTTAATAAAGAATTGATAATTCTT-AAAAATTTATTTAATAA-TTATTTTTA ---ATTTTTTAATAAAGAATTGATAATTCTT-AGAAATTTATTTA-TAA-TTATTTTTG ----ATTTTCTATAAAGAATTTATAATTCTT-TCAAATTTATTCATTAAATTATTTTAA ----ATTTTAAATAGAGAATTTCAAATTCTT-TTTAATTTATT-ATTAAATTATTTTAA --ATTTTTATAATAATGAATTTAAAATACTTATTTAAATCAAATTTTAT----TTTTA--* *** * *** ** * * ** ****

B A.atlas ATACTAAaaataattcatttacttctaactaac S.cynthia aaaattATACTAAaaataattcat S.ricini aaaattATACTAAaaataattcat A.pernyi ATACTAAaaataattcaat A.yamamai ATACTAAaaataattcaatttata A.selene tataaatattctattaatttATACTAAaa-ta-ttca S.pyretorum ATACTAAaaataattcaa C.boisduvalii aattATACTAAaaataattcaa B.mori tttattaATACTAAaaata-ttcaa B.mandarina China ttattcaATACTAAaaata-ttacaa B.mandarina Japan ttattcaATACTAAaaata-ttaca Fig. 2. Alignment of the intergenic spacer regions between tRNAGln and ND2 (A), and between tRNASer(UCN) and ND1 (B) of Bombycoidea species. The sign * shows the conserved position. Limited sequence conservation is observed between tRNAGln and ND2, although this region is common within Saturniidae. The ATACTAA motif located between tRNASer(UCN) and ND1 (Cameron and Whiting, 2008) is conserved across the Bombycoidea.

canonical stop codon will be corrected via posttranscriptional polyadenylation (Ojala et al., 1981). The slight excess of A content is also exhibited in PCGs of A. atlas mitogenome (Table 4), which appears to suggest that it might exhibit a difference in the codon usage pattern in PCGs from the other Saturniidae species. We then compared the codon usage pattern between A. atlas and S. cynthia mitogenomes, which are closely relatives but show a different AT skew. Our analyses showed an almost identical codon usage pattern between the two species (data not shown). Like the S. cynthia mitogenome, the A. atlas mitogenome also demonstrates more preference towards T-ended codons in PCGs encoded by the forward strand as well as T-ended codons in those encoded by the reverse strand. The result suggests that the slight excess of A content in the A. atlas mitogenome is not caused by the codon usage pattern. 3.4. rRNA and tRNA genes Two rRNA genes (lrRNA and srRNA) are also present in the mitogenome of A. atlas, which are located between tRNALeu(CUN) and tRNAVal, and between tRNAVal and the A + T-rich region, respectively. The lrRNA and srRNA genes are 1368 and 777 bp, respectively, well within the range observed in the completely sequenced lepidopteran insects. The set of 22 tRNA genes was identified in the mitogenome of A. atlas. These tRNA genes are scattered throughout the mitogenome,

A.atlas S.cynthia S.ricini A.pernyi A.yamamai A.selene C.boisduvalii S.pyretorum B.mori B.mandarina China B.mandarina Japan M.sexta M.vitrata

and vary from 64 bp for tRNAIle, tRNATyr, tRNAThr to 71 bp for tRNALys. Their anticodons are identical to those observed in other Bombycoidea species. With the exception of tRNASer(AGN) that lacks a stable stemloop structure in the DHU arm, all tRNA genes have the typical cloverleaf secondary structures (Supp. Fig. 1). These features are common in most animal mitogenomes (Wolstenholme, 1992). A total of 31 mismatched base pairs and G–U wobble pairs were observed in 17 of 22 tRNA genes. Of these 31 unmatched base pairs in tRNAs, there are 25 G–U wobble pairs that forms a weak bond. The unmatched base pairs in tRNAs can be corrected through RNAediting mechanisms (Lavrov et al., 2000). 3.5. The A + T-rich region The A. atlas A + T-rich region spans 359 bp, with the highest A + T content (90.25%) in the mitogenome. The presence of the repetitive sequences in the A + T-rich region has been observed in some Bombycoidea species, such as a 38 bp repeat element in A. pernyi and A. roylei (Arunkumar et al., 2006; Liu et al., 2008), and a 126 bp repeat element in B. mori and B. mandarina (Pan et al., 2008; Yukuhiro et al., 2002). Although the A. atlas A + T-rich region contains non-repetitive sequences, it harbors several features as typically found in Bombycoidea (Cameron and Whiting, 2008), including the motif ATAGA followed by an 19 bp poly-T stretch, a microsatellite-like (AT)7 element preceded

tRNATyr ATCGCTTATAACTCAGCCATTTTATTT TTG CTTATCCTTCAGCCATTTTATTATTTT CAG CTTACCCCTCAGCCATTTTATTATTTTTCAG GCTTTAAACCTCAGCCATTTTATTAAT TAG CTTATTAACCTCAGCCATTTTATTAAT TAG CTCAGCCATTTTATTATTTATTTTATT TAG ACTCAGCCATTTTATTAATTATTTAAT TTG TAACTCAGCCATTTTATTAAAATTATA TAG TTCAGCCATTTTATTTTTTTTCTTTTT TAG CAGCCATTTTATTTACTTACTTTTATT TAG CAGCCATTTTATTTACTTACTTTTATT TAG ATCGCTTAAAACTCAGCCATTTTATTT TTG CGCTTATAACGTCAGCCATTTTATTAA TAG

COI CGAAAATGACTT RKWL CGAAAATGACTT RKWL CGAAAATGACTT MFQRKWL CGAAAATGACTT RKWL CGAAAATGACTT RKWL CGAAAATGACTT RKWL CGAAAATGACTT MRKWL CGAAAATGACTT RKWL CGAAAATGAATT RKWI CGAAAATGAATT RKWI CGAAAATGAATT RKWI CGAAAATGACTT RKWL CGAAAATGAATT RKWI

Fig. 3. Alignment of the initiation context for COI of Bombycoidea species. The translation initiation codon from lepidopteran Maruca vitrata has been determined by analysis of the transcript information. The amino acid sequences of the first four to seven codons are shown on the right-hand side. Boxed nucleotides are the presumed translation initiators in each species. Underlined nucleotides indicate the partial adjacent sequence of tRNATyr. Arrows indicate the direction of transcription.

100

M.-M. Chen et al. / Gene 545 (2014) 95–101

Table 4 Comparison of AT skewness of mitogenome regions between A. atlas and S. cynthia. Species/regions A. atlas tRNAs rRNAs Intergenic spacer A + T-rich PCGs 3rd codon in forward strand PCGs 3rd codon in reverse strand PCGs S. cynthia tRNAs rRNAs Intergenic spacer A + T-rich PCGs 3rd codon in forward strand PCGs 3rd codon in reverse strand PCGs

size (bp)

A%

T%

A+T%

AT skew

1448 2145 129 359 11,201

41.09 41.72 44.19 41.50 39.17 40.94 40.25

40.06 42.47 40.31 48.75 38.55 48.69 50.73

81.15 84.20 84.50 90.25 77.72 89.62 90.98

0.013 −0.008 0.046 −0.080 0.008 −0.086 −0.115

1450 2137 196 359 11,203

40.62 41.04 41.84 44.29 39.01 40.91 41.05

40.21 43.14 46.94 46.80 39.38 50.20 52.03

80.83 84.18 88.78 91.09 78.39 91.11 93.08

0.005 −0.025 −0.057 −0.028 −0.005 −0.102 −0.118

by the ATTTA motif, and a 19 bp poly-A element immediately upstream tRNAMet and intermittently interrupted by T and G nucleotides (Supp. Fig. 2). The motif ATAGA followed by a long poly-T stretch has been suggested to be ON site, the origin of reverse or light strand replication (Saito et al., 2005). The poly-A element upstream tRNAMet may be involved in the control of transcription and/or replication initiation or have some other unknown functional role (Zhang et al., 1995). 3.6. Phylogenetic relationships The taxonomic classification of Saturniids has long been a challenge (Regier et al., 2008a). The placement of Saturniidae into the Bombycoidea has been confirmed by a recent molecular work of bombycoid relationships (Regier et al., 2008b). Although the genetic relationships within Saturniidae have been performed (Friedlander et al., 1998; Hwang et al., 1999; Mahendran et al., 2006; Regier et al., 2002, 2008b; Wu et al., 2009), information on phylogenetic relationships of these silk-producing species is yet limited. Our analyses are based on two sequence datasets (amino acid sequences of 13 PCGs, and nucleotide sequences of 13 PCGs plus 2 rRNAs) with Maximum Likelihood method, a model-based evolutionary method (Fig. 4). The optimal cladograms inferred by these two datasets are identical, which indicate the presence of two distinct groups: Saturniidae and Bombycidae, consistent with the morphological analysis and the previous works

(Arunkumar et al., 2006; Hwang et al., 1999; Kim et al., 2011; Mahendran et al., 2006). It is clear that A. atlas shares a close ancestry with Samia species (Peigler, 1989), with very strong support by ML analyses. Within Saturniidae, our study support the sister group relationship between Saturniini (A. pernyi, A. yamamai, C. boisduvalii, S. pyretorum, and A. selene) and Attacini (A. atlas, S. cynthia, and S. ricini), with strong support (100% of bootstrap value), which agree with the traditional morphological classification and recent molecular works (Friedlander et al., 1998; Mahendran et al., 2006; Peigler, 1989; Regier et al., 2002, 2008a; Wu et al., 2009), but with a much higher support.

4. Conclusion The complete mitogenome of A. atlas (Lepidoptera: Saturniidae) is 15,282 bp in length, and contains 13 PCGs, 22 tRNA genes, two rRNA genes, and a non-coding A + T-rich region, with a typical gene arrangement for sequenced Bombycoidea species. The nucleotide composition of this genome is highly A + T biased (79.30%), but with a slightly positive AT skew, which differs from those found in the previously sequenced Saturniidae species. All PCGs are initiated by ATN codons, except for COI, which are proposed by CGA. Seven PCGs harbor the incomplete termination codons. All tRNA genes show a typical cloverleaf structure of mitochondrial tRNA, except for tRNASer(AGN). The A. atlas A + T-rich region contains non-repetitive sequences, but harbors several features common to the Bombycoidea insects. The phylogenetic analyses confirm that Saturniini and Attacini belong to the sister group relationship within Saturniidae, and supports the current morphology-based hypothesis that A. atlas belongs to the tribe Attacini.

Conflict of interest The authors have declared that no potential conflicts of interest exist.

Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (No. 30800803), the China Agriculture Research System (No. CARS-22), the Program for Liaoning Excellent Talents in University (2012060), the Projects for Tianzhushan Scholar (2011) and Innovation Foundation for Postgraduate (20112285) of SAU.

Antheraea pernyi domestic Antheraea pernyi wild 92/99 Antheraea yamamai 98/99 Actias selene Saturnia pyretorum 100 100 Caligula boisduvalii Attacus atlas 99 Samia cynthia 98/100 100 Samia ricini 100 Manduca sexta Bombyx mandarina Japan Bombyx mori 52/67 Bombyx mandarina China 100

100

Saturniini Saturniidae Attacini

Bombycidae

Thitarodes renzhiensis Drosophila melanogaster 0.05 Fig. 4. Phylogeny of Bombycoidea species based on Maximum Likelihood analysis. The dipteran D. melanogaster, and lepidopteran T. renzhiensis were used as outgroups. Numbers at each node specify bootstrap percentages of 1000 replicates inferred from amino acid dataset and nucleotide dataset, respectively. The scale bar indicates the number of substitution per site.

M.-M. Chen et al. / Gene 545 (2014) 95–101

Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2014.05.002.

References Arunkumar, K.P., Metta, M., Nagaraju, J., 2006. Molecular phylogeny of silkmoths reveals the origin of domesticated silkmoth, Bombyx mori from Chinese Bombyx mandarina and paternal inheritance of Antheraea proylei mitochondrial DNA. Molecular Phylogenetics and Evolution 40, 419–427. Benson, G., 1999. Tandem Repeats Finder: a program to analyze DNA sequences. Nucleic Acids Research 27, 573–580. Bernt, M., Donath, A., Jühling, F., Externbrink, F., Florentz, C., Fritzsch, G., Pütz, J., Middendorf, M., Stadler, P.F., 2013. MITOS: improved de novo metazoan mitochondrial genome annotation. Molecular Phylogenetics and Evolution 69, 313–319. Boore, J.L., 1999. Animal mitochondrial genomes. Nucleic Acids Research 27, 1767–1780. Cameron, S.L., 2014. Insect mitochondrial genomics: implications for evolution and phylogeny. Annual Review of Entomology 59, 95–117. Cameron, S.L., Whiting, M.F., 2008. The complete mitochondrial genome of the tobacco hornworm, Manduca sexta (Insecta: Lepidoptera: Sphingidae), and an examination of mitochondrial gene variability within butterflies and moths. Gene 408, 112–113. Cao, Y.Q., Ma, C., Chen, J.Y., Yang, D.R., 2012. The complete mitochondrial genomes of two ghost moths, Thitarodes renzhiensis and Thitarodes yunnanensis: the ancestral gene arrangement in Lepidoptera. BMC Genomics 13, 276. de Bruijn, M.H.L., 1983. Drosophila melanogaster mitochondrial DNA: a novel organisation and genetic code. Nature 304, 234–241. Friedlander, T.P., Horst, K.R., Regier, J.C., Mitter, C., Peigler, R.S., Fang, Q.Q., 1998. Two nuclear genes yield concordant relationships within Attacini (Lepidoptera: Saturniidae). Molecular Phylogenetics and Evolution 9, 131–140. Hassanin, A., 2006. Phylogeny of Arthropoda inferred from mitochondrial sequences: strategies for limiting the misleading effects of multiple changes in pattern and rates of substitution. Molecular Phylogenetics and Evolution 38, 100–116. Hong, M.Y., Lee, E.M., Jo, Y.H., Park, H.C., Kim, S.R., Hwang, J.S., Jin, B.R., Kang, P.D., Kim, K.G., Han, Y.S., Kim, I., 2008. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects. Gene 413, 49–57. Hong, G.Y., Jiang, S.T., Yu, M., Yang, Y., Li, F., Xue, F., Wei, Z., 2009. The complete nucleotide sequence of the mitochondrial genome of the cabbage butterfly, Artogeia melete (Lepidoptera: Pieridae). Acta Biochimica et Biophysica Sinica 41, 446–455. Hwang, J.S., Lee, J.S., Goo, T.W., Yun, E.Y., Sohn, H.R., Kim, H.R., Kwon, O.Y., 1999. Molecular genetic relationships between Bombycidae and Saturniidae based on the mitochondria DNA encoding of large and small rRNA. Genetic Analysis 15, 223–228. Hwang, U.W., Park, C.J., Yong, T.S., Kim, W., 2001. One-step PCR amplification of complete arthropod mitochondrial genomes. Molecular Phylogenetics and Evolution 19, 345–352. Jiang, S.T., Hong, G.Y., Yu, M., Li, N., Yang, Y., Liu, Y.Q., Wei, Z.J., 2009. Characterization of the complete mitochondrial genome of the giant silkworm moth, Eriogyna pyretorum (Lepidoptera: Saturniidae). International Journal of Biological Sciences 5, 351–365. Jolly, M.S., Sen, S.K., Sonwalkar, T.N., Prasad, G.S., 1979. Non-mulberry silks. Food & Agriculture Organisation. United Nations, Serv. Bull., 29, p. 178 (Rome). Kim, S.R., Kim, M., Hong, M.Y., Kim, K.Y., Kang, P.D., Hwang, J.S., Han, Y.S., Jin, B.R., Kim, I., 2009. The complete mitogenome sequence of the Japanese oak silkmoth, Antheraea yamamai (Lepidoptera: Saturniidae). Molecular Biology Reports 36, 1871–1880. Kim, M.J., Kang, A.R., Jeong, H.C., Kim, K.G., Kim, I., 2011. Reconstructing intraordinal relationships in Lepidoptera using mitochondrial genome data with the description of two newly sequenced lycaenids, Spindasis takanonis and Protantigius superans (Lepidoptera: Lycaenidae). Molecular Phylogenetics and Evolution 61, 436–445. Kim, J.S., Park, J.S., Kim, M.J., Kang, P.D., Kim, S.G., Jin, B.R., Han, Y.S., Kim, I., 2012. Complete nucleotide sequence and organization of the mitochondrial genome of eri-silkworm, Samia cynthia ricini (Lepidoptera: Saturniidae). Journal of Asia Pacific Entomology 15, 162–173. Kim, M.J., Choi, S.W., Kim, I., 2013. Complete mitochondrial genome of the larch hawk moth, Sphinx morio (Lepidoptera: Sphingidae). Mitochondrial DNA. http://dx.doi. org/10.3109/19401736.2013.772155. Lavrov, D.V., Brown, W.M., Boore, J.L., 2000. A novel type of RNA editing occurs in the mitochondrial tRNAs of the centipede Lithobius forficatus. Proceedings of the National Academy of Sciences of the United States of America 97, 13738–13742.

101

Lemaire, C., Minet, J., 1998. The Bombycoidea and their relatives. In: Kristensen, N.P. (Ed.), Lepidoptera, Moths and Butterflies, 1: Evolution, Systematics, and Biogeography. Walter de Gruyter, Inc., Hawthorne, pp. 321–353. Liu, Y.Q., Li, Y.P., Pan, M.H., Dai, F.Y., Zhu, X.W., Lu, C., Xiang, Z.H., 2008. The complete mitochondrial genome of the Chinese oak silkmoth, Antheraea pernyi (Lepidoptera: Saturniidae). Acta Biochimica et Biophysica Sinica 40, 693–703. Liu, Q.N., Zhu, B.J., Dai, L.S., Wei, G.Q., Liu, C.L., 2012a. The complete mitochondrial genome of the wild silkworm moth, Actias selene. Gene 505, 291–299. Liu, Y.Q., Li, Y.P., Wang, H., Xia, R.X., Chai, C.L., Pan, M.H., Lu, C., Xiang, Z.H., 2012b. The complete mitochondrial genome of the wild type of Antheraea pernyi (Lepidoptera: Saturniidae). Annals of the Entomological Society of America 105, 498–505. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25, 955–964. Mahendran, B., Ghosh, S.K., Kundu, S.C., 2006. Molecular phylogeny of silk producing insects based on internal transcribed spacer DNA1. Journal of Biochemistry and Molecular Biology 39, 522–529. Margam, V.M., Coates, B.S., Hellmich, R.L., Agunbiade, T., Seufferheld, M.J., Sun, W.L., Ba, M.N., Sanon, A., Binso-Dabire, C.L., Baoua, I., Ishiyaku, M.F., Covas, F.G., Srinivasan, R., Armstrong, J., Murdock, L.L., Pittendrigh, B.R., 2011. Mitochondrial genome sequence and expression profiling for the legume pod borer Maruca vitrata (Lepidoptera: Crambidae). PLoS One 6, e16444. Nardi, F., Spinsanti, G., Boore, J.L., 2003. Hexapod origins: monophyletic or paraphyletic? Science 299, 1887–1889. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Pan, M.H., Yu, Q.Y., Xia, Y.L., Dai, F., Liu, Y., Lu, C., Zhang, Z., Xiang, Z., 2008. Characterization of mitochondrial genome of Chinese wild mulberry silkworm Bomyx mandarina (Lepidoptera Bombycidae). Science in China. Series C, Life Sciences 51, 693–701. Peigler, R.S., 1989. A Revision of the Indo-Australian Genus Attacus. Lepid. Res. Found, Beverly Hills, p. 167. Perna, N.T., Kocher, T.D., 1995. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. Journal of Molecular Evolution 41, 353–358. Regier, J.C., Mitter, C., Peigler, R.S., Friedlander, T.P., 2002. Phylogenetic relationships in Saturniinae (Lepidoptera: Saturniidae): evidence from two nuclear genes. Insect Systematics & Evolution 33, 9–21. Regier, J.C., Cook, C.P., Mitter, C., Hussey, A., 2008a. A phylogenetic study of the “bombycoid complex” (Lepidoptera) using five protein-coding genes, with comments on the problem of macrolepidopteran phylogeny. Systematic Entomology 33, 175–189. Regier, J.C., Grant, M.C., Mitter, C., Cook, C.P., Peigler, R.S., Rougerie, R., 2008b. Phylogenetic relationships of wild silkmoths (Lepidoptera: Saturniidae) inferred from four protein-coding nuclear genes. Systematic Entomology 33, 219–228. Saito, S., Tamura, K., Aotsuka, T., 2005. Replication origin of mitochondrial DNA in insects. Genetics 171, 1695–1705. Shadel, G.S., Clayton, D.A., 1993. Mitochondrial transcription initiation: variation and conservation. Journal of Biological Chemistry 268, 16083–16086. Sima, Y.H., Chen, M., Yao, R., Li, Y.P., Liu, T., Jin, X., Wang, L.P., Su, J.F., Li, X.S., Liu, Y.Q., 2013. The complete mitochondrial genome of the Ailanthus silkmoth, Samia cynthia cynthia (Lepidoptera: Saturniidae). Gene 526, 309–317. Taanman, J.W., 1999. The mitochondrial genome: structure, transcription, translation and replication. Biochimica et Biophysica Acta 1410, 103–123. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. Wolstenholme, D.R., 1992. Animal mitochondrial DNA: structure and evolution. International Review of Cytology 141, 173–216. Wu, S., Li, Y.P., Xia, R.X., Wang, H., Shi, S.L., Li, X.S., Wang, Z.D., Liu, Y.Q., 2009. Barcodes of cynthia silkworms, Philosamia cynthia cynthia and Philosamia cynthia ricini, and phylogenetic analysis with other Saturnidae insects. Can Ye Ke Xue 35, 533–538. Yukuhiro, K., Sezutsu, H., Itoh, M., Shimizu, K., Banno, Y., 2002. Significant levels of sequence divergence and gene rearrangements have occurred between the mitochondrial genomes of the wild mulberry silkmoth, Bombyx mandarina, and its close relative, the domesticated silkmoth, Bombyx mori. Molecular Biology and Evolution 19, 1385–1389. Zhang, D.X., Szymura, J.M., Hewitt, G.M., 1995. Evolution and structural conservation of the control region of insect mitochondrial DNA. Journal of Molecular Evolution 40, 382–391.