Completion of the genome sequence of Lettuce necrotic yellows virus, type species of the genus Cytorhabdovirus

Virus Research 118 (2006) 16–22

Completion of the genome sequence of Lettuce necrotic yellows virus, type species of the genus Cytorhabdovirus夽 Ralf G. Dietzgen a,b,∗ , Ben Callaghan a,b , Thierry Wetzel c,d , James L. Dale c a

Department of Primary Industries and Fisheries, Queensland Agricultural Biotechnology Centre, Queensland Bioscience Precinct, The University of Queensland, 306 Carmody Rd, St. Lucia, Qld. 4072, Australia b School of Molecular and Microbial Sciences, The University of Queensland, St. Lucia, Qld. 4072, Australia c Science Research Centre, Queensland University of Technology, Faculty of Science, Brisbane, Qld 4001, Australia d RLP Agroscience, AlPlanta-Institute for Plant Research, Breitenweg 71, 67435 Neustadt a.d.W., Germany Received 7 September 2005; received in revised form 31 October 2005; accepted 31 October 2005 Available online 28 November 2005

Abstract We completed the genome sequence of Lettuce necrotic yellows virus (LNYV) by determining the nucleotide sequences of the 4a (putative phosphoprotein), 4b, M (matrix protein), G (glycoprotein) and L (polymerase) genes. The genome consists of 12,807 nucleotides and encodes six genes in the order 3 leader-N-4a(P)-4b-M-G-L-5 trailer. Sequences were derived from clones of a cDNA library from LNYV genomic RNA and from fragments amplified using reverse transcription-polymerase chain reaction. The 4a protein has a low isoelectric point characteristic for rhabdovirus phosphoproteins. The 4b protein has significant sequence similarities with the movement proteins of capillo- and trichoviruses and may be involved in cell-to-cell movement. The putative G protein sequence contains a predicted 25 amino acids signal peptide and endopeptidase cleavage site, three predicted glycosylation sites and a putative transmembrane domain. The deduced L protein sequence shows similarities with the L proteins of other plant rhabdoviruses and contains polymerase module motifs characteristic for RNA-dependent RNA polymerases of negativestrand RNA viruses. Phylogenetic analysis of this motif among rhabdoviruses placed LNYV in a group with other sequenced cytorhabdoviruses, most closely related to Strawberry crinkle virus. © 2005 Elsevier B.V. All rights reserved. Keywords: Plant rhabdovirus; LNYV; Phylogeny

1. Introduction Rhabdoviruses can infect vertebrates, invertebrates and plants and represent a large virus family of importance to agriculture and human health. They have a single-stranded, negative-sense RNA genome of ca. 12–15 kb, which encodes five functionally conserved proteins. Axillary proteins are encoded by some species. Conserved intergenic regions are located at the gene junctions and partially complementary untranslated regions, termed 3 leader and 5 trailer are located at either end of the genome. In rhabdovirus-infected cells, the viral RNA polymerase facilitates the transcription of distinct mRNA species

夽 The sequence data have been deposited in the GenBank/EMBL databanks under accession number no. AJ867584. ∗ Corresponding author. Tel.: +61 7 3346 2703; fax: +61 7 3346 2727. E-mail address: [email protected] (R.G. Dietzgen).

0168-1702/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2005.10.024

from each gene and genome replication (Tordo et al., 2005; Jackson et al., 2005). Lettuce necrotic yellows virus (LNYV) is the type species of the genus Cytorhabdovirus (Tordo et al., 2005), members of which are characterised by accumulation of enveloped virions in the cytoplasm of infected cells (Dietzgen, 1995; Jackson et al., 2005). LNYV causes a serious disease of lettuce in Australia and is transmitted in a persistent, propagative manner by the aphid Hyperomyzus lactucae (Francki et al., 1989). The LNYV genome consists of a monopartite, negative-sense, single-stranded RNA of about 13,000 nucleotides (Wetzel et al., 1994a). The physical map of the LNYV genome is 3 leaderN-P-4b-M-G-L-5 trailer, where N is the nucleocapsid gene, P is the putative phosphoprotein gene, 4b encodes a protein of unknown function, M is the matrix protein gene, G is the glycoprotein gene and L is the polymerase gene (Wetzel et al., 1994a). The sequences of the 3 leader, N gene, 5 trailer and all intergenic sequences have been reported previously (Wetzel et

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

al., 1994a,b). In this paper, we present the completed nucleotide sequence of LNYV and compare it to the genomes of other plant rhabdoviruses. 2. Materials and methods 2.1. Virus propagation, purification and isolation of viral RNAs The previously described garlic isolate (Sward, 1990) was used throughout. LNYV was propagated in Nicotiana glutinosa and leaves were collected 10–12 days post inoculation (dpi). Virus was purified and the genomic RNA extracted as described previously (Francki et al., 1989; Dietzgen et al., 1989). Total RNA from LNYV-infected N. glutinosa was extracted as described by Rezaian et al. (1983) or Higgins and Dietzgen (2000), or using RNeasy® Plant Mini kits (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Poly(A)+ RNA was fractionated on oligo(dT)-cellulose using a mRNA purification kit (Pharmacia Biotech, Freiburg, Germany). 2.2. Oligonucleotide primers Oligonucleotide primers for determination of the P, 4b and M gene sequences were synthesized using a PCR-MATE DNA synthesizer (Applied Biosystems). Primers for amplification and sequencing of the G and L genes were synthesized by Bresatec Pty Ltd. (Adelaide, South Australia) and Sigma-Genosys (Melbourne, Australia). Primer names and sequences are listed in Table 1.

17

2.3. PCR amplification and RACE Poly(A)+ RNA preparations from LNYV-infected N. glutinosa, and purified LNYV genomic RNA were used for cDNA synthesis and PCR amplification as described previously (Wetzel et al., 1994a). For the P, 4b and M genes, the reverse transcription mixture was denatured for 5 min at 94 ◦ C prior to PCR amplification for 40 cycles of 94 ◦ C for 20 s, 42 ◦ C for 20 s and 72 ◦ C for 30 s. For amplification of the G and L genes, primers G1 and G3, respectively were heat-denatured prior to cDNA synthesis and Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) was used for PCR. Primers G1 and G2 were used to amplify the complete G gene between the G-M and the G-L intergenic regions (PCR1; Fig. 1) using 30 cycles of 94 ◦ C for 1 min, 50 ◦ C for 1 min, and 72 ◦ C for 2 min. Primers L11 and L12 were used in PCR for 30 cycles of 94 ◦ C for 30 s, 50 ◦ C for 30 s and 72 ◦ C for 6 min to amplify the majority of the L gene (PCR-3; Fig. 1). L gene cDNA was also used to amplify additional DNA fragments, which overlapped each of the two internal EcoRI sites of the PCR-3 DNA fragment (L4/L5 and L6/L7) or linked PCR-3 to the G gene (G3/L3), yielding clones PCR-4, PCR-5 and PCR-2, respectively (Fig. 1). For 3 RACE (rapid amplification of cDNA ends), an oligo(dT)12–18 primer was used for cDNA synthesis. The subsequent PCR amplification was done with oligo(dT)12–18 and the LNYV-specific primers m4a, m4b1 or m4b2, and mM (Table 1) for 3 RACE of the LNYV 4a, 4b, and M mRNAs, respectively. For 5 RACE, cDNA was synthesized, purified, tailed with dCTP or dGTP and PCR-amplified using the 5 RACE system (Life Technologies), according to protocols provided by the supplier. For dG-tailing, an oligo-dC15 primer was used in

Table 1 LNYV-specific oligonucleotide primers used in this study Primer name

Nucleotide sequence 5 → 3

Remark

g4a m4a g4b m4b1 m4b2 gM mM gG

TAGAGCTATCATCAGAAGTTTTAGG GATTGTTGACTTCCTTGTCC CGCTCTTCATAGCATCCAGATCCTC GAGGGATGATTGCGTGATCACGTTG AGTGCTGACATTGATGAGTTAGGGG ACGGAAACAAGAACTCACATCG TGTTTCCGTCTGAAGTGTTC ACCTTGTTGCATCTAGTCAC

5 3 5 3 3 5 3 5

PCR-1

G1 G2

GGTCTAGAGATTCACATATAGACGAGTTATATCCG CGGAATTCTTTTCTTAAATCACACATGCCACTTGG

XbaI EcoRI

PCR-2

G3 L3

GTCAAGCGACATGGATCTGA TATCATAGAGAGATTGAAGG

PCR-3

L11 L12

GCGAATTCTTGGAGGTTGTTGAGATTTGAC GCGAATTCTTGGTTCTAATTGCATACACC

PCR-4

L4 L5

CTTTAACTTGTATGGACTC CTCTTCATCACTCATCAACC

PCR-5

L6 L7

CGATATGCCAAAGGAGCCC GCTTCCGTGGTTGGTGTC

Clone

RACE RACE RACE RACE RACE RACE RACE RACE

EcoRI EcoRI

“g” corresponds to the genomic sense, “m” to the messenger RNA sense and “4a”, “4b”, “M”, “G” and “L” correspond to the respective genes; non-viral sequences are underlined.

18

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

Fig. 1. Organisation of the LNYV genome and location of clones that were used for sequence analysis. The location and relative size of the LNYV genes are shown. Clone ␤ and the multigenic clones A, B, C, D and X were identified previously (Dietzgen et al., 1989; Wetzel et al., 1994a). PCR clones 1–5 covering the G and L genes were generated using the primer pairs listed in Table 1.

place of the AAP primer. The LNYV-specific primers g4a, g4b, gM and gG (Table 1) were used for 5 RACE of LNYV 4a, 4b, M and G mRNAs, respectively. At least two clones from independent PCR reactions were sequenced for each 5 RACE experiment. 2.4. Cloning of PCR products PCR products of the P, 4b and M mRNA sequences were ligated into pCR II (TA cloning kit, Invitrogen), or into dTTP-tailed pBluescript (Stratagene) and used to transform INVaF’ (Invitrogen) or DH5aF’ E. coli cells. The G gene PCR product was digested with EcoRI and XbaI, gel-purified and ligated into similarly digested pGEM-3Z (Promega, Madison, WI). The PCR-3 product of the L gene was digested with EcoRI, the 3 fragments were isolated using QIAEX II gel extraction kit (Qiagen), ligated into EcoRI-digested, shrimp alkaline phosphatase-treated pBluescript SK, and transformed into E. coli (JM109 strain) (Promega, Madison, WI). Plasmid miniprep extractions were done by alkaline lysis (Sambrook and Russell, 2001) or using a QIAprep® Spin Miniprep Kit (Qiagen). The order and orientation of the L gene EcoRI fragments was determined by restriction enzyme analysis. Additional overlapping PCR products were Atailed with Taq DNA polymerase, ligated into pCR2.1-TOPO and transformed into TOP10 cells (Invitrogen). 2.5. Sequencing of cDNA clones and PCR products Some plasmid DNA was sequenced manually using the Sequenase kit (USB) and thio-[a-35 S]dATP (Dupont). For the previously obtained LNYV cDNA clones (Dietzgen et al., 1989), addition of 0.5 mg of T4 gene 32 protein (Pharmacia) was sometimes required during the labelling reaction to read through long G- or C-tails. Gel-purified PCR products were sequenced directly following the protocol described by Casanova et al. (1990), except that 10% DMSO was added to the annealing buffer. Automatic sequencing of plasmid DNA or PCR products (at least 3 clones on both strands) was done using the PrismTM Ready Reaction DyeDeoxy Termination Cycle sequencing kit or Big Dye Terminator Ready Reaction Mix versions 2.0 or 3.1 (PE Applied Biosystems, Foster City, CA). Sequences were edited and aligned using the IBI Sequence Analysis, MacVector (Oxford Molecular Ltd.) or Sequencher 3.0 (Gene Codes Corp., Ann Arbor, MI) software packages.

2.6. Sequence analysis and phylogeny The putative G and L gene mRNA sequences were identified based on the published sequence data from multigenic clones (Wetzel et al., 1994a). Open reading frame (ORF) analysis and hydropathy plots were carried out using MacVector. Pair-wise (“GAP”) and multiple sequence (“CLUSTALW”) alignments and phylogenetic analysis utilizing the “Phylip” and GCG software packages were facilitated through the Australian National Genome Information Service (Sydney, Australia). ORF sizes were calculated excluding the stop codon. ORFs were translated into amino acid sequences using “TRANSLATE” and queried against the Swiss-Prot database using “BLAST P”. Predicted protein molecular weight, isoelectric point and charge were determined using “PEPSTATS”. Some putative protein motifs and secondary structure elements were identified using programs on the Predict Protein website (http://www.emblheidelberg.de/predictprotein/predictprotein.html). 3. Results 3.1. The complete nucleotide sequence of LNYV We have completed the genome sequence of LNYV from overlapping clones derived from a cDNA library from LNYV virion RNA generated previously (Wetzel et al., 1994a,b) and from fragments of the G and L genes amplified by RT-PCR (Fig. 1). Recently PCR-amplified sequences of the N and P genes differed from the previously determined sequences by 1 (Callaghan and Dietzgen, 2005) and 7 nucleotides (data not shown), respectively. Clones of the P, 4b and M mRNAs and 5 and 3 RACE confirmed the transcribed sequences of these genes. The complete LNYV genome sequence comprised of 12,807 nucleotides has been deposited in GenBank/EMBL databases with the accession number AJ867584. 3.2. The phosphoprotein gene The 4a gene (AF209035), thought to represent the phosphoprotein (P) gene, based on its location in the genome, was sequenced from both genomic RNA and mRNA. 5 RACE and dG-tailing of the cDNA identified the start of the mRNA as 5 GGAAACC-3 , indicating the presence of an additional guanosine (G cap). The P gene was 1082 nucleotides in length and

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

19

Table 2 Comparison of the sizes of genes encoded by LNYV, NCMV, and SYNV Regions

Viruses

Encoded genes N

5

UTR

LNYV NCMV SYNV

78 46 56

81 64 50

ORF (amino acids)a

LNYV NCMV SYNV

459 431 475

300 286 345

3 UTRb

LNYV NCMV SYNV

75 65 70

101 63 53

a b c

Xc

P

M

38 7, 7, 7, 7 43

G

L

55 16 71

33 38 34

78 17 44

302 172, 136, 125, 122 324

177 174 286

551 483 632

2067 2046 2116

102 9, 13, 28, 136 181

45 95 142

150 9 115

53 36 9

Excluding the stop codon. Including the stop codon. Site containing the putative movement protein genes and unknown genes (NCMV).

located between 1631 and 2712 nucleotides from the 3 end of the viral genome (Fig. 1). A 5 untranslated region (UTR) of 81 nucleotides was followed by an ORF (nucleotides 1712 to 2611) and a 3 UTR (Table 2). This ORF encoded a 32.5 kDa protein (300 amino acids) with a calculated isoelectric point (pI) of 4.4. An additional overlapping ORF in a +1 reading frame was located between nucleotides 1647 and 1952 that could potentially encode an 11.8 kDa protein.

identified the nucleotide(s) “G” (1 clone) or “GGA” (3 clones) at the 5 end preceding the intergenic consensus sequence 5 GAAU-3 . The M gene was 631 nucleotides in length and located between nucleotides 3773 and 4403 from the 3 end of the viral genome (Fig. 1). 5 and 3 UTRs of 55 and 45 nucleotides, respectively flanked a 531 nucleotide ORF (Table 2). The ORF encodes a 19.54 kDa protein (177 amino acids) with a pI of 8.17.

3.3. The 4b protein gene

3.5. The glycoprotein gene

The 4b gene (AF209034) was also sequenced from both genomic and mRNAs. 5 RACE and dG-tailing identified the start of the 4b gene mRNA as 5 -GGAAUA-3 , indicating the presence of a G cap. The gene was 1046 nucleotides in length and located between nucleotides 2720 and 3765 from the 3 end of the viral genome (Fig. 1). 5 and 3 UTRs of 38 and 102 nucleotides, respectively flanked a 906 nucleotide ORF. The ORF encoded a 33.7 kDa protein (302 amino acids) with a pI of 9.94. A database search using BlastP revealed significant E value similarities of the 4b protein with the movement proteins of capillo- and trichoviruses, family Flexiviridae (Table 3). The longest region of sequence identity between the 4b protein and these movement proteins was four consecutive amino acids at one or two locations in the alignments.

The G gene (AJ251533) was 1836 nucleotides in length and located between nucleotides 4412 and 6247 from the 3 end of the viral genome (Fig. 1). 5 RACE and dG-tailing of the G gene mRNA identified the nucleotides “G” (3 clones) or “GGA” (2 clones) at the 5 end preceding the intergenic consensus sequence 5 -GAUU-3 . The largest ORF in the anti-genome sense was 1656 nucleotides long (including the stop codon). There were no other ORFs larger than 250 nucleotides in either orientation. The ORF encoded a 62.3 kDa protein (551 amino acids) with a pI of 6.3. The putative G protein sequence was 23.2% identical to the analogous sequence of Northern cereal mosaic virus (NCMV), the only other cytorhabdovirus G protein sequence available, and less to that of other rhabdoviruses. The LNYV G protein contained an amino-terminal 25 amino acids hydrophobic region including the predicted peptidase recognition sequence “VQG↓V” (the arrow indicates the predicted cleavage site), which probably represents a signal peptide for localisation to the endoplasmic reticulum. The mature G protein had three predicted glycosylation sites (Asn-X-Ser/Thr), a

3.4. The matrix protein gene The M gene (AF209033) was sequenced from both genomic and mRNAs. 5 RACE and dG-tailing of the M gene mRNA

Table 3 Viral movement proteins with highest score sequence similarity to the 4b protein of LNYV identified using Blast P searches SwissProt accession

Virus

Genus

Identity (%)

Similarity (%)

E value

Q85215 Q9LQY3 Q9YPIL Q787R3

Potato virus T Grapevine berry inner necrosis virus Citrus tatter leaf virus Apple stem grooving virus

Trichovirus Trichovirus Capillovirus Capillovirus

22 25 22 22

41 44 42 42

3e-11 4e-10 3e-09 3e-09

20

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

putative carboxy-terminal transmembrane domain and 18 cysteine residues, which could potentially be involved in the formation of disulfide bridges (data not shown). 3.6. The polymerase (L) gene The L gene (AJ746199) was 6335 nucleotides in length and located between nucleotides 6278 and 12,613 from the 3 end of the viral genome (Fig. 1). There was a single large ORF of 6204 nucleotides (including the stop codon) commencing from the first AUG. No other ORFs larger than 250 nucleotides were identified. The ORF encoded a protein of 236.4 kDa (2067 amino acids), which had a sequence similarity at the nucleotide level of 44.5% with NCMV and of 42.3% with either Sonchus yellow net virus (SYNV) or Rice yellow stunt virus (RYSV). The L protein sequence contained polymerase module motifs characteristic for RNA-dependent RNA polymerases of negative-strand RNA viruses, including the conserved “GDN” motif, which is thought to represent the catalytic centre (data not shown). 3.7. Phylogeny of plant rhabdoviruses based on the L gene Phylogenetic analysis of the conserved polymerase module (block III) of the L gene comprising motifs pre-A to E (Poch

Fig. 2. Phylogenetic tree constructed from alignment of the deduced amino acid sequences of the conserved rhabdovirus L protein polymerase module (pre-A to E domains of box III). The tree was generated using the maximum parsimony method. Bootstrap values of 100 tree replicas are shown at each branch node. The rhabdoviruses and GenBank sequence accession numbers used in this analysis are bovine ephemeral fever virus (BEFV; AF234533), infectious hemopoietic necrosis virus (IHNV; X89213), Hirame rhabdovirus (HIRRV; AF104985), Snakehead rhabdovirus (SHRV; AF147498), viral hemorrhagic septicemia virus (VHSV; Y18203), maize mosaic virus (MMV; AY618418), taro vein chlorosis virus (TaVCV; AY674964), rice yellow stunt virus (RYSV; AB011257), sonchus yellow net virus (SYNV; L32603), maize fine streak virus (MFSV; AY618417), northern cereal mosaic virus (NCMV; AB030277), strawberry crinkle virus (SCV; AY005146), rabies virus (RABV; M31046), and vesicular stomatitis New Jersey virus (VSNJV; M29788).

et al., 1989; M¨uller et al., 1994; Callaghan, 2005) placed the plant rhabdoviruses into two distinct clades, which correspond to the cyto- and nucleorhabdovirus genera, respectively (Fig. 2). According to this analysis, the plant rhabdoviruses appear to be more closely related to the novirhabdoviruses than to the other animal rhabdoviruses. LNYV clustered with the other two sequenced cytorhabdoviruses, but appears to be evolutionarily more closely related to Strawberry crinkle virus (SCV) than to NCMV. The five nucleorhabdoviruses fell into two distinct sister clades with Maize mosaic virus (MMV) and taro vein chlorosis virus (TaVCV) forming one sub-clade and SYNV and maize fine streak virus (MFSV) another. The association of RYSV with either sister clade varied depending on whether maximum parsimony or neighbour-joining methods were used. 4. Discussion LNYV isolates can be divided into two subgroups based on N gene sequence variability—the isolate we sequenced belongs to subgroup I (Callaghan and Dietzgen, 2005). The order of the genes on the LNYV genome 3 -N-P-4b-M-G-L-5 and the nucleotide sequences of all intergenic regions, nucleocapsid protein gene, 3 leader and 5 trailer have been reported previously (Wetzel et al., 1994a,b). The N gene sequence did not show genetic drift from the previously reported sequence since it only differed by a single nucleotide (Callaghan and Dietzgen, 2005). All six LNYV transcripts have been detected by northern blot analysis (Wetzel et al., 1994a). We have completed the genome sequence by determining the nucleotide sequences of the remaining genes, namely P, 4b, M, G and L. The genome size of 12,807 nucleotides is within the range of 12 to 14.5 kb reported for other sequenced plant rhabdoviruses (Choi et al., 1994; Tanno et al., 2000; Huang et al., 2003; Revill et al., 2005; Tsai et al., 2005; C.D. Schoen, personal communication), but there is considerable variability in the number of ORFs among and between cyto- and nucleorhabdoviruses. The LNYV genome organisation is most similar to that of the nucleorhabdoviruses SYNV and TaVCV, but differs considerably from that of the other cytorhabdoviruses in that LNYV has six ORFs in the antigenome sense, while SCV has seven and NCMV has nine ORFs (Tanno et al., 2000). The LNYV and SCV genomes have one ORF located between the P and M genes, whereas NCMV carries four ORFs in this position which we termed “X” (Table 2). Among the sequenced cytorhabdoviruses, SCV and NCMV, appear to have an additional small putative ORF between the G and L genes (C.D. Schoen, pers. communication; Tanno et al., 2000), while no ORF was evident in this location in the LNYV genome. The start sites for the transcription of all LNYV genes, except the L gene mRNA have been experimentally determined by 5 RACE. The 5 terminus of each LNYV mRNA sequence commenced with a guanine residue, which probably represents a 5 cap structure (Wetzel et al., 1994b), similar to that suggested for SYNV mRNAs (Scholthof et al., 1994). Some of the dG-tailed 5 RACE clones of the M and G mRNAs had the 5 sequence “GGA” instead of “G”. The additional nucleotides “GA” had previously also been identified in one of the dG-tailed clones of

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

the N mRNA (Wetzel et al., 1994a). They may be due to polymerase slippage resulting in transcription of the two nucleotides immediately prior to the predicted mRNA start at the 5 end (viral sense) of the conserved intergenic region. Polymerase slippage at Vesicular stomatitis virus (VSV) gene junctions has been reported (Barr and Wertz, 2001). It is possible, but seems less likely that the additional nucleotides are of non-viral origin as has been suggested for the 5 termini of the RYSV M, G and L genes (Luo and Fang, 1998). The deduced amino acid sequences of the P, 4b, M, G and L proteins shared a number of features with analogous rhabdovirus genes. The putative P gene, previously referred to as “4a”, contained a second ORF which could potentially encode a small highly basic protein in an overlapping +1 reading frame, similar to the overlapping P gene ORF conserved among the vesiculoviruses (Spiropoulou and Nichol, 1993; Kretzschmar et al., 1996). This additional protein is expressed during VSV infection in tissue culture, but it appears to be dispensable for virus replication and a role in viral pathogenesis or vector transmission has been proposed (Kretzschmar et al., 1996). It is unknown if this internal P gene ORF is expressed in plant or insect hosts during LNYV infection. Overlapping +1 ORFs have also been identified in NCMV, MFSV and MMV, but appear to be absent from the P genes of SYNV and RYSV (Callaghan, 2005). Genes located between the P and M genes are found in all plant rhabdoviruses analysed to date, but not in vertebrateinfecting rhabdoviruses. In the LNYV genome the 4b gene was located in this position, as were the genes that encode the sc4 and P3 proteins in the SYNV and RYSV genomes, respectively (Scholthof et al., 1994; Huang et al., 2003). Evidence from our database searches and refined secondary structure predictions (http://opbs.okstate.edu/Virevol/web/Rhabdo.html) suggest that the 4b protein belongs to the 30 kDa superfamily of plant viral movement proteins (Melcher, 2000), most similar to the movement proteins of capillo- and trichoviruses. Secondary structure predictions for the SYNV sc4 protein and RYSV P3 also show some similarities to the 30 kDa superfamily, but distinct from that of the LNYV 4b protein (Melcher, personal communication; Huang et al., 2005). The membrane and cell wall associations of SYNV sc4 protein also suggest a role in cell-to-cell movement (Scholthof et al., 1994; Goodin et al., 2002) and recent experimental evidence suggests that RYSV P3 has some properties typical for viral movement proteins (Huang et al., 2005). It therefore appears likely that the 4b protein has a role in LNYV cell-to-cell movement. The LNYV G gene encoded a protein with features typical of rhabdoviral glycoproteins, including three glycosylation sites, a hydrophobic, N-terminal signal peptide for membrane targeting and putative C-terminal transmembrane domain. The G protein has previously been shown to be glycosylated in N. glutinosa with a complex network of oligosaccharides containing ␤-Nacetylchitobiose N-linked to asparagine residues (Dietzgen and Francki, 1988). The assumption that some of the 18 cysteine residues in the G protein sequence may form disulphide bonds is supported by previously observed differences in the migration rate of the G protein from purified LNYV particles under

21

reducing and non-reducing condition (Dietzgen and Francki, 1988) and a detailed examination of the amino acid sequence (Callaghan, 2005). The phylogeny of rhabdovirus L proteins suggests a monophyletic origin (Hogenhout et al., 2003). Based on phylogenetic analysis of the conserved L gene polymerase module, plant rhabdoviruses appear to be evolutionarily closely related, but with a clear differentiation into two sister clades. This grouping confirms the current two genera of plant rhabdoviruses, which is based on the site of virus replication and maturation. Future availability of additional plant rhabdovirus sequences as well as knowledge of sequence variability between isolates (Callaghan and Dietzgen, 2005; Klerks et al., 2004; Revill et al., 2005) can be expected to lead to a better understanding of the evolution of this important group of viruses. Acknowledgements We thank Margaret Bernard for technical assistance and Peter Revill for provision of TaVCV sequence data prior to publication. This work was supported by the Australian Research Council, Horticulture Australia Limited and the Department of Primary Industries and Fisheries, Queensland. References Barr, J.N., Wertz, G.W., 2001. Polymerase slippage at vesicular stomatitis virus gene junctions to generate poly (A) is regulated by the upstream 3 AUAC05 tetranucleotide: implications for the mechanism of transcription termination. J. Virol. 75, 6901–6913. Callaghan, B., 2005. Sequence analysis and variability study of Lettuce necrotic yellows virus. Ph.D thesis. The University of Queensland, Brisbane, Australia. Callaghan, B., Dietzgen, R.G., 2005. Nucleocapsid gene variability reveals two subgroups of Lettuce necrotic yellows virus. Arch. Virol. 150, 1661–1667. Casanova, J.L., Pannetier, C., Jaulin, C., Kourilsky, P., 1990. Optimal conditions for directly sequencing double-stranded PCR products with Sequenase. Nucleic Acids Res. 18, 4028. Choi, T.J., Wagner, J.D., Jackson, A.O., 1994. Sequence analysis of the trailer region of sonchus yellow net virus genomic RNA. Virology 185, 32–38. Dietzgen, R.G., 1995. Rhabdoviridae. In: Kohmoto, K., Singh, RP., Singh, US., Zeigler, R. (Eds.), Pathogenesis and Host–Parasite Specificity in Plant Diseases: Histopathological, Biochemical, Genetic and Molecular Basis, vol. 3. Pergamon Press, Oxford, pp. 177–197. Dietzgen, R.G., Francki, R.I.B., 1988. Analysis of lettuce necrotic yellows virus structural proteins with monoclonal antibodies and concanavalin A. Virology 166, 486–494. Dietzgen, R.G., Hunter, B.G., Francki, R.I.B., Jackson, A.O., 1989. Cloning of lettuce necrotic yellows virus RNA and identification of virus-specific polyadenylated RNAs in infected Nicotiana glutinosa leaves. J. Gen. Virol. 70, 2299–2307. Francki, R.I.B., Randles, J.W., Dietzgen, R.G., 1989. Lettuce necrotic yellows virus. In “AAB Descriptions of Plant Viruses” No. 343. Higgins, C.M., Dietzgen, R.G., 2000. Genetic transformation, regeneration and analysis of transgenic peanut. ACIAR Technical Report no. 48, 86 pp. Hogenhout, S.A., Redinbaugh, M.G., Ammar, E.D., 2003. Plant and animal rhabdovirus host range: a bug’s view. Trends Microbiol. 11, 264–271. Huang, Y., Zhao, H., Luo, Z., Chen, X., Fang, R.-X., 2003. Novel structure of the genome of Rice yellow stunt virus: identification of the gene 6encoded virion protein. J. Gen. Virol. 84, 2259–2264.

22

R.G. Dietzgen et al. / Virus Research 118 (2006) 16–22

Huang, Y.-W., Geng, Y.-F., Ying, X.-B., Chen, X.-Y., Fang, R.-X., 2005. Identification of a movement protein of rice yellow stunt rhabdovirus. J. Virol. 79, 2108–2114. Goodin, M.M., Dietzgen, R.G., Schichnes, D., Ruzin, S., Jackson, A.O., 2002. pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J. 31, 375–383. Jackson, A.O., Dietzgen, R.G., Goodin, M.M., Bragg, J.N., Deng, M., 2005. Biology of plant rhabdoviruses. Annu. Rev. Phytopathol. 43, 623–660. Klerks, M.M., Lindner, J.L., Vaskova, D., Spak, J., Thompson, J.R., Jelkmann, W., Schoen, C.D., 2004. Detection and tentative grouping of Strawberry crinkle virus isolates. Eur. J. Plant Pathol. 110, 45–52. Kretzschmar, E., Peluso, R., Schnell, M.J., Whitt, M.A., Rose, J.K., 1996. Normal replication of vesicular stomatitis virus without C proteins. Virology 216, 309–316. Luo, Z.L., Fang, R.-X., 1998. Structure analysis of the rice yellow stunt rhabdovirus glycoprotein gene and its mRNA. Arch. Virol. 143, 2453–2459. Melcher, U., 2000. The ‘30K’ superfamily of viral movement proteins. J. Gen. Virol. 81, 257–266. M¨uller, R., Poch, O., Delarue, M., Bishop, D.H., Bouloy, M., 1994. Rift Valley fever virus L segment: correction of the sequence and possible functional role of newly identified regions conserved in RNA-dependent polymerases. J. Gen. Virol. 75, 1345–1352. Poch, O., Sauvaget, I., Delarue, M., Tordo, N., 1989. Identification of four conserved motifs among the RNA-dependent polymerase encoding elements. EMBO J. 8, 3867–3874. Revill, P., Trinh, X., Dale, J., Harding, R., 2005. Taro vein chlorosis virus: characterization and variability of a new nucleorhabdovirus. J. Gen. Virol. 86, 491–499.

Rezaian, M.A., Heaton, L.A., Pederson, K., Milner, J.J., Jackson, A.O., 1983. Size and complexity of polyadenylated RNAs induced in tobacco infected with sonchus yellow net virus. Virology 131, 221–229. Sambrook, J., Russell, D.W., 2001. Molecular cloning: a laboratory manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Scholthof, K.-B.G., Hillman, B.I., Modrell, B., Heaton, L.A., Jackson, A.O., 1994. Characterization and detection of sc4: a sixth gene encoded by sonchus yellow net virus. Virology 204, 279–288. Spiropoulou, C.F., Nichol, S.T., 1993. A small highly basic protein is encoded in overlapping frame within the P gene of vesicular stomatitis virus. J. Virol. 67, 3103–3110. Sward, R.J., 1990. Lettuce necrotic yellows rhabdovirus and other viruses infecting garlic. Australas. Plant Path. 19, 46–51. Tanno, F., Nakatsu, A., Toriyama, S., Kojima, M., 2000. Complete nucleotide sequence of northern cereal mosaic virus and its genome organization. Arch. Virol. 145, 1373–1384. Tordo, N., Benmansour, A., Calisher, C., Dietzgen, R.G., Fang, R.-X., Jackson, A.O., Kurath, G., Nadin-Davies, S., Tesh, R.B., Walker, P.J., 2005. Family Rhabdoviridae Virus Taxonomy, Classification and Nomenclature of Viruses. Academic Press, San Diego. Tsai, C.-W., Redinbaugh, M.G., Willie, K.J., Reed, S., Goodin, M., Hogenhout, S.A., 2005. Complete genome sequence and in planta subcellular localization of maize fine streak virus proteins. J. Virol. 79, 5304– 5314. Wetzel, T., Dietzgen, R.G., Dale, J.L., 1994a. Genomic organization of lettuce necrotic yellows rhabdovirus. Virology 200, 401–412. Wetzel, T., Dietzgen, R.G., Geering, A.D.W., Dale, J.L., 1994b. Analysis of the nucleocapsid gene of lettuce necrotic yellows rhabdovirus. Virology 202, 1054–1057.