Complex chromosome 4, 9, and 22 rearrangement in a patient presenting with AML-FAB M2

ELSEVIER

Complex Chromosome 4, 9, and 22 Rearrangement in a Patient Presenting with AML-FAB M2 E.S. Martin, A. Joseph, M.A. Ahmad, D.S. Borgaonkar, and S.E. Martin

ABSTRACT: Fluorescence in situ hybridization (FISH) and the reverse transcription-polymerase chain

reaction (RT-PCR) were used to examine a patient presenting with acute myelogenous leukemia (AML) FAB M2, and a complex t(4;9;22)(p14;q34;q11.2). The patient's clinical course was characterized by an aggressive leukemia, resistant to intensive therapy including allogeneic bone marrow transplantation. FISH analysis, using two chromosome painting probes and a BCR/ABL specific probe, confirmed the cytogenetic observation of a 22ql 1.2-e4p14 and a 4p14-~9q34 exchange, and revealed the presence of a 9q34-~22qi 1.2, respectively. In addition, RT-PCR demonstrated the presence of a BCR/ABL transcript derived from the major breakpoint cluster region (M-bcr) of the BCR gene. This transcript has been shown to generate an active 210 kDa tyrosine kinase protein more commonly observed in chronic myelogenous leukemia. Because the presentation of AML with this ABL-~BCR fusion product is a rare event, it would seem likely that the additional complex chromosomal rearrangement involving chromosomes 4, 9, and 22 played a role h7 the aggressive presentation and clinical behavior of this patient's leukemia. © Elsevier Science Inc., 1997

INTRODUCTION

The Philadelphia (Ph) chromosome results from a reciprocal translocation involving the long arms of chromosomes 9 and 22, t(9;22)(q34;q11.2) [1, 2]. This leukemic marker can be demonstrated in more than 95% of the cases of chronic myelogenous leukemia (CML), in approximately 25% of adult and 3-5% of childhood cases of acute lymphoblastic leukemia (ALL), and in some rare cases of acute myelogenous leukemia (AML) [1-4]. At the molecular level, this translocation causes a fusion of a variable number of 5' exons of the BCR gene located on chromosome 22 with the c-ABL gene normally found on chromosome 9 [5-9]. The novel gene is transcribed into a hybrid BCR/ABL transcript where exon 1 of the c-ABL gene has been replaced by 5' BCR exons. The resulting fusion protein, either a 210 kDa or 190 kDa species, is an activated form of the c-ABL tyrosine kinase with a significant role in the pathogenesis of CML and Ph-positive acute leukemias [lO-12]. Other chromosome anomalies have been observed in conjunction with the Ph chromosome [13-16]. These additional changes may mask the t(9;22) or play a role in the

From the Departments of Pathology and Laboratory Medicine (E. S. M., A. J., M. A. A., D. S. B., S. E. M.), and the Bone Marrow Transplantation Program (S. E. M.), Medical Center of Delaware, P.O. Box 6001, Newark, Delaware, U.S.A. Address reprint requests to: Dr. S. Eric Martin, Cytogenetics Laboratory, Department of Pathology and Laboratory Medicine, Medical Center of Delaware, P.O. Box 6001, Newark DE 19718-0001. Received April 25, i996; accepted June 15, 1996. Cancer Genet Cytogenet 93:119-124 (1997) @ Elsevier Science Inc., 1997 655 Avenue of the Americas, New York, NY 10010

clinical behavior of disease, such as correlating with the appearance of blast crisis in CML [17-19]. This communication reports on a patient presenting as AML-FAB M2 with a complex t(4;9;22)(p14;q34;q11.2), in whom the BCR/ ABL transcript and the additional chromosomal rearrangements were analyzed, respectively, by the reverse transcription polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH). CASE REPORT

A 44-year-old male without significant past medical history presented for the evaluation of persistent "flu-like" illness. The physical exam was unremarkable, without evidence of hepatosplenomegaly or lymphadenopathy. A complete blood count revealed a white blood cell (WBC) count of 197 x 109/L, with 27% blasts, a platelet count of 33 x 1 0 9 / L , and a hematocrit of 36%. Chemistries revealed significantly elevated serum LDH and leukocyte alkaline phosphatase. A bone marrow aspirate showed more than 70% of the marrow replaced with sheets of myeloblasts with maturation and with the presence of auer rods (FAB-M2). Histochemical stains were also consistent with myeloid leukemia. Flow cytometry analysis of the blast population revealed a myeloid origin with two immunophenotypically different populations present. The more prevalent population expressed CD13, CD33, weak CD15, and no CD34, the lesser population expressed CD13, CD33, weak CD7 and CD34. Heterogeneous expression of CD19 was observed, but could not be assigned to either population. Cytogenetic analysis demon-

0165-4608/97/$17.00 PII S0165-4608(96)00187-2

120

E.S. Martin et al.

strated a complex exchange between chromosomes 4, 9, and 22 (Table 1, at diagnosis). The patient underwent induction chemotherapy with dannorubicin and cytosine arabinoside requiring two cycles of chemotherapy to induce marrow aplasia and eventual trilineage recovery with less than 5% blasts, but with residual karyotypic abnormalities (Table 1, post induction). The patient was scheduled to undergo allogeneic bone marrow transplantation and immediately prior to transplant his bone marrow showed 20% blasts with the same abnormal karyotype. He received total body irradiation and cyclophosphamide followed by allogeneic bone marrow transplantation using an unmanipulated HLAmatched male sibling donor. Cyclosporine and methotrexate were used as graft-versus-host disease (GVHD) prophylaxis. No signs of GVHD were evident, and the patient relapsed 121 days post-transplantation. High dose cytosine arabinoside was given and marrow aplasia was achieved. G-CSF mobilized allogeneic peripheral blood stem cells (PBSC), using the same donor, were infused during the period of aplasia, followed by donor neutrophil recovery within 23 days post infusion and with no histologic evidence of leukemia. Cytogenetic analysis at this point showed a normal karyotype in 17 of 20 metaphases and an abnormal karyotype in the remaining 3 (Table 1, postallogeneic PBSC rescue). Thirty-two days following allogeneic PBSC, evidence of grade II GVHD involving the skin and liver was seen and treated with corticosteriods. Within 60 days after allogeneic PBSC infusion, the patient developed pseudomonas aeruginosa sepsis with multiorgan failure and died. At postmortem examination, in addition to bronchopneumonia, cytopathic changes of cytomegalovirus disease were found involving the liver and the gastrointestinal tract, with bone marrow histology still demonstrating hematologic reconstitution without morphologically overt leukemia.

MATERIALS AND METHODS Cytogenetic Analysis Cytogenetic analysis was performed with standard GTL (G-Banding/Trypsin-Leischman) techniques on bone marrow cells from an aspirate and peripheral blood cells obtained at the time of the diagnosis. Metaphase cells from short-term (24 hours) unstimulated cultures were examined and chromosomal abnormalities were described according to the

International System for Human Cytogenetic Nomenclature, 1995 (ISCN).

cDNA Analysis RNA was extracted from peripheral blood and bone marrow buffy coat using an RNA Isolation Kit (Oncor, Gaithersburg, MD). Primers were designed to detect BCR/ABL transcripts containing BCR breakpoints localized to the major breakpoint cluster region (M-bcr, exons bl-b5) (Primers A, D, and E, [20]). All primers were synthesized using a PCRMate DNA synthesizer (Applied Biosystems, Foster City, CA). Reverse transcription (RT) was performed with 2 p~l (0.5 ~g/pJ) denatured RNA (incubated for 5 min at 99°C), 30 pmol of Primer A, 5 mM MgC12, 1 × reverse transcription buffer (10 mM Tris-HC1 pH 8.8, 50 mM KCL, and 0.1% Triton X-100), 1 mM each of dNTP, and 1.0 ~1 RNAse (Promega, Madison, WI) in a final volume of 20 ~1. The mixtures were incubated for 30 min at 42°C, 5 min at 99°C, and 4°C indefinitely until ready for use. Following incubation, 20jxl of RT product was added to a mixture consisting of 25 pmol of Primer E, 25 pmol of Primer D, and 1 × PCR buffer (50raM Tris-HCL pH 9.0, 5OmM NaC1, 0.01% Triton X-100, and 0.2 mM each of dNTP) in a final volume of 49.5 Ixl, and designated translocation junction product. As a control, a second RT reaction product, derived from the same RNA template, was added separately to a mixture designated normal cDNA consisting of 25 pmol of Primer D, 25 pmol of the ABL-4 primer (5'-~3', TCTGACTTTGAGCCTCAGGGTCTGA), and 1 × PCR buffer in a final volume of 49.5 ~1. This primer set amplifies a region in the c-abl transcript that exists in both Ph-positive and Ph-negative samples. After an initial denaturation at 95°C for 2 rain and the addition of 1U of Taq DNA Polymerase (Fisher Biotech, Pittsburgh, PA), amplification of cDNA was carried out for 35 cycles with denaturation at 94°C for 45 seconds, annealing at 65°C for 20 seconds, with an extension at 72°C for 45 seconds, followed by a final extension at 72°C for 7 rain. All PCR reactions were performed on a GeneAmp 2400 thermalcycler (Perkin-Elmer, Foster City, CA). All cDNA products were electrophoresed on a 4% NuSieve 3:1 agarose gel (FMC, Rockland, ME) with the BioMarker T M Low sizing marker (Bio Ventures, Murfreesboro, TN) and visualized by ethidium bromide staining and ultraviolet illumination. For detection of rearrange-

Table 1 Summary of cytogenetic analysis Treatment Status

Karyotypte

No. of Metaphase Cells Analyzed

At diagnosis

46,XY,t(4;9;22)(p14;q34;q11.2)[20]

20

Post induction chemotherapy

46,XY,t(4;9;22)(p14;q34;q11.2)[9] 46,XY[12]

21

Post allogeneic PBSC rescue

46,XY [17] 46,XY,t(4;9;22)(p14;q34;ql 1.2),der(2)t(2;?)(p15;?), del(2)(pl 3),- 17,- 20,+ 2mar[l] 46,XY,add(1)(p22),t(4;9;22)(p14;q34;q11.2), 10,+mar[I] 45,XY,add(1)(p22),t(4;9;22)(p14;q34;q11.2),del(2)(p13), - 5,- 6,- 10,del(11)(q23),- 12,add(13)(q34),- 14, del(16)(q22),+4mar[1]

20

Complex Chromosome 4, 9, and 22 Rearrangement

4

121

9

22

Figure 1 A representative composite of the complex chromosomal translocation, t(4;9;22)(p14;q34;q11.2), observed in the cytogenetic analysis of the patient's cells. Arrows indicate translocated chromosome regions of the der(4) containing 4pter~4p14::22q11-~22qter, the der(9) containing 9pter-~9q34::4p14-~4pter, and the der(22) containing 2pter-~22qll::9q34->9qter, whereas those metaphase chromosomes on the left possess normal intact segments.

ments involving the minor breakpoint cluster region of the BCR gene (m-bcr) that result in an ela 2 junction and the p190 BCR/ABL protein (10), primer BCR-4 (5'-GTCCTTCGACAGCAGCAGTCCC-3') was used in place of primer E.

FISH The biotinylated Coatasome 9 (P5211-BIO, Oncor) and Coatasome 22 (P5204-BIO, Oncor) chromosome-specific painting probes were combined to perform a dual-single color FISH. FISH confirmation of the Ph chromosome as well as the BCR/ABL fusion was done using the bcr/abl translocation DNA probe (P5109, Oncor). All probes were hybridized to metaphases and interphases on prepared slides and detected by immunochemical methods as directed by the manufacturer (Oncor). Slides were stained with 4',6diamidino-2-phenylindole dihydrochloride (DAPI) for visualization on a fluorescence microscope equipped with a triple-bandpass filter (Olympus, Lake Success, NY). FISH images were viewed and digitized using MacProbe v3.2.1 (Perceptive Scientific Instruments, Houston, TX). RESULTS

Cytogenetic Analysis Cytogenetic analysis revealed the complex translocation t(4;9;22)(p14;q34;q11.2)(Fig. 1). The appearance of chromosome 22 was that of the Ph chromosome, however, the additional translocation of 22q-~4p as well as 4p-~9q concealed any evidence for a direct ABL-~BCR coupling. Evidence of the cytogenetically abnormal cells persisted throughout the post diagnosis and treatment periods, although during times of hematologic reconstitution (post induction chemotherapy and post allogeneic transplant/ allogeneic PBSC rescue) cells with a normal karyotype predominated (Table 1). Following allogeneic PBSC reconstitution, cytogenetic abnormalities in addition to the t(4;9;22) were seen (Table 1).

FISH Analysis FISH was performed on material obtained at presentation of the disease. Analysis using two single-color painting probes specific for chromosome 9 and 22 showed signals on chromosomes 4, 9, and 22 (Fig. 2). A positive signal on the telomeric region of the short arm of the derivative

chromosome 4 confirmed the cytogenetic translocation of 22-~4p (Fig. 2, white arrow). Secondly, the absence of a telomeric signal on the painted chromosome 9 demonstrated the existence of an unpainted 4p14-~pter segment resulting from the cytogenetically observed translocation of 4p-~9q (Fig. 2, yellow arrow). Finally, to investigate the possible existence of a translocation of 9q-~22q, FISH analysis using the bcr/abl translocation DNA probe was performed (Fig. 3). A signal positive for the BCR/ABL fusion was detected on the derivative chromosome 22 in all cells analyzed (Fig. 3C).

Molecular Analysis RT-PCR analysis of the presentation and relapse bone marrows revealed the presence of a BCR/ABL, b2a2, fusion product (Fig. 4, lane P1), compatible with a chromosomal exchange involving the M-bcr cluster region that would result in a 210 kDa protein product [10, 20]. No evidence

Figure 2 Representative metaphase observed in the FISH analysis using two biotinylated painting probes for chromosomes 9 and 22. Signals were detected on chromosomes 4, 9, and 22. The white arrow indicates the fluoresceinated portion of chromosome 22 that has translocated to the unpainted chromosome 4. The green arrow demonstrates the smaller derivative painted chromosome 22, whereas the yellow arrow shows the unlabeled portion of chromosome 4 on the long arm of the painted derivative chromosome 9.

12 2

E.S. Martin et al.

AB

C

D

M

1

P

2

I~

Figure 3 FISH analysis using the bcr/abl translocation DNA probe. Due to the 9q-~22q, single green signal (A) is detected for 9q34, a single red signal (B) is detected for 22q11, and a fusion signal (C) is detected for the Ph chromosome. In a normal metaphase control cell (not shown) a green set of signals and a red set of signals is observed at the 9q34 and 22qll regions for both homologous chromosomes.

of an ela 2 junction product that would result in a 190 kDa protein product [10] was seen using primers for the m-bcr region (data not shown).

DISCUSSION

The identification of non-random chromosomal abnormalities in patients with leukemia has helped to define distinct clinical and pathological subgroups [21]. The detection of such aberrations has aided in establishing both diagnostic and prognostic information, including the clinical response to antileukemic therapy [22]. In addition, these translocations have provided clues and the starting material for the biochemical characterization of gene products that participate in the molecular pathways of leukemogenesis [10-12, 21,23]. The patient reported here presented with a leukemic process that clinically mimicked AML-M2 while possessing a complex chromosomal translocation with a ABL-~BCR exchange. The BCR/ABL fusion transcript detected by RTPCR confirmed the FISH analysis, as well as its potential role in this leukemic state. Although the fusion transcript b2a 2 involving the M-bcr region is more characteristic of CML, the clinical presentation, the absence of splenomegaly, and the presence of an elevated leukocyte alkaline phosphatase were suggestive of a de novo myeloid blast crisis without a chronic phase of the disease. In addition to its aggressive presentation, the leukemic behavior was markedly resistant to intensive antileukemic therapy. The infectious complications that led to the patient's demise did not allow

JABL

Figure 4 RT-PCR results. The expected sizes for Ph-positive CML RNA for the b2a2 and b3a2 junctions involving the M-bcr are 304 bp and 374 bp, respectively. Lane P1 is the patient cDNA and corresponds to the b2a2 bcr/abl fusion transcript. Lane A represents the b3a 2 product of a positive control (Ph-positive cDNA) and lane C demonstrates and absence of a fusion product in a negative control (Ph-negative cDNA). The 170-bp product in lanes B, D, and P2 represent the positive control, negative control, and the patient, respectively, and is indictive of the normal abl allele (interna] control). Lane M is the BioMarker TM Low standard; sizes are 1000 bp, 700 bp, 500 bp, 400 bp, 30O bp, 200 bp, 100 bp, and 50 bp.

us to determine whether additional antileukemic activity would have been generated by a graft versus leukemia effect induced by the allogeneic PBSC rescue [24]. Although other complex translocations involving chromosomes 4, 9, and 22 have been reported in the literature [13-16, 25-26], they have been seen in the chronic phase of CML and have not involved 4p-~9q and 22q-~4p. The presentation of AML with a Ph chromosome is a rare event [4]. In the majority of patients described, biphenotypic myeloid/lymphoid markers are expressed on the surface of the leukemia cells [4, 27-30], and indeed this patient's blasts, in addition to myeloid markers, showed heterogeneous expression of CD19 and weak expression of CD7. In contrast to the M-bcr BCR/ABL message observed in patients with CML, which generates a 210 kDa hybrid protein, in most Ph positive AML the breakpoints in BCR are distributed in the second breakpoint cluster region (m-bcr), which result in the formation of a chimeric message that encodes the 190 kDa hybrid [4, 27]. Some experimental evidence suggests a difference in the leukemogenic effect between the two products generated, with the 190kDa hybrid possibly accelerating leukemogenesis at a more significant rate [1112, 31]. In this patient, who possessed the 210 kDa related transcript but presented with acute leukemic behavior, we could speculate that the concomitant transfer of 4p-~9q or 22q-~4p played a role in the nature of the disease similar to the additional cytogenetic abnormalities observed in the transformation from chronic phase to blast crisis as in other CML patients [17-19]. Indeed, isolated breakpoints

Complex Chromosome 4, 9, and 22 Rearrangement

of 22q11, without evidence of BCR/ABL rearrangement, have been reported in both ALL [32] and AML [33]. This case demonstrates the impact of the c o m b i n e d cytogenetic, FISH, a n d molecular techniques used in clinical evaluation. In addition, the analysis of these complex karyotypes using such methods will continue to provide clues for the genetic and molecular events involved in leukemogenesis.

123

15.

16. We would like to thank Dr. Michael Lankiewicz for providing clinical material, Linda Schmidt for technical assistance, and Donald Russell and Douglas Bugel for help in the preparation of the manuscript.

17.

18.

REFERENCES 1. Nowell PC, Hungerford DA (1960): A minute chromosome in human chronic granulocytic leukemia. Science 132:1497. 2. Rowley JD (1973): A new consistent chromosomal abnormality in chronic myelogenous leukemia identified by quinacrine fluorescence and Giemsa staining. Nature 243:290-293. 3. Kantarjian H, Deiseeroth A, Kurzrock R, Estrov Z, Talpaz M (1993): Chronic myelogenous leukemia: A concise update. Blood 82:691-703. 4. Kantarjian H, Talpaz M, Estey E, Ku S, Kurzrock R (1994): What is the contribution of molecular studies to the diagnosis of BCR-ABL-positive disease in adult acute leukemia? Am J Med 96:133-138. 5. Ben-Neriah Y, Daley GQ, Mes-Masson AM, Witte ON, Baltimore D (1986): The chronic myelogenous leukemia-specific P210 protein is the product of the bcr/abl hybrid gene. Science 233:212-214. 6. Kurzrock R, Kloetzer WS, Talpaz M, Blick M, Waiters R, Arlinghaus RB, Gutterman JU (1987): Identification of molecular variants of p210 bcr-abl in chronic myelogenous leukemia. Blood 70:233-236. 7. Kurzrock R, Shtalrid M, Romero P, Kloetzer WS, Talpas M, Trujillo JM, Blick M, Beran M, Gutterman JU (1987): A novel c-abl protein product in Philadelphia-positive acute lymphoblastic leukaemia. Nature 325:631-635. 8. Kawasaki ES, Clark SS, Coyne MY, Smith SD, Champlin R, Witte ON, McCormick FP (1988): Diagnosis of chronic myeloid and acute lymphocytic leukemias by detection of leukemia-specific mRNA sequences amplified in vitro. Proc Natl Acad Sci USA 85:5698-5702. 9. Denny CT, Shah NP, Ogden S, Willman C, McConnell T, Crist W, Carroll A, Witte ON (1989): Localization of preferential sites of rearrangement within the BCR gene in Philadelphia chromosome-positive acute lymphoblastic leukemia. Proc Natl Acad Sci USA 86:4254-4258. 10. Clark SS, McLaughlin J, Crist WM, Champlin R, Witte ON (1987): Unique forms of the abl tyrosine kinase distinguish Phi-positive CML from Phi-positive ALL. Science 235:85-88. 11. Lugo TG, Pendergast AM, Muller AJ, Witte ON (1990): Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science 247:1079-1082. 12. Kelliher M, Knott A, McLaughlin J, Witte ON, Rosenberg N (1991): Differences in oncogenic potency but not target cell specificity distinguish the two forms of the BCR/ABL oncogene. Mol Cel Biol 11:4710-4716. 13. Mitelman F (1994): Catalog of Chromosome Aberrations in Cancer, 5th Ed. Wiley-Liss Publishing, New York. 14. Dube I, Dixon J, Beckett T, Grossman A, Weinstein M, Benn

P, McKeithan T, Norman C, Pinkerton C, Pinkerton P (1989): Locations of breakpoints within the major breakpoint cluster region Cbcr) in 33 patients with bcr rearrangement-positive chronic myeloid leukemia (CML) with complex or absent Philadelphia chromosomes. Genes Chromosom Cancer 1:106-111. Zaccaria A, Testoni N, Tassinari A, Celso B, Rassool F, Saglio G, Guerrasio A, Rosti G, Tura S [1989): Cytogenetic and molecular studies in patients with chronic myeloid leukemia and variant Philadelphia translocations. Cancer Genet Cytogenet 42:191-201. Sessarego M, Fugazza G, Canepa L, Bacigalupo A, Bruzzone R, Patrone F (1995): Fluorescence in situ hybridization provides evidence for two-step rearrangement in a masked Ph chromosome formation. Lank Res 19:921-925. Przepiorka D, Thomas ED (1988): Prognostic significance of cytogenetic abnormalities in patients with chronic myelogenous leukemia. Bone Marrow Transplant 3:113-119. Blick M, Romero P, Talpaz M, Kurzrock R, Shtalrid M, Andersson B, Trujillo J, Beran M, Gutterman J (1987): Molecular characteristics of chronic myelogenous leukemia in blast crisis. Cancer Genet Cytogenet 27:349-356.

19. Anastasi J, Feng J, Le Beau MM, Larson RA, Rowley JD, Vardiman JW [1995): The relationship between secondary chromosomal abnormalities and blast transformation in chronic myelogenous leukemia. Leukemia 9:628-633. 20. Hughes TP, Morgan GJ, Martiat P, Goldman JM (1991): Detection of residual leukemia after bone marrow transplant for chronic myeloid leukemia: Role of polymerase chain reaction in predicting relapse. Blood 77:874-878. 21. Pederson-Bjergaard J, Rowley JD (1994): The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation. Blood 83:27802786. 22. Bloomfield CD, Lawrence D, Arthur DC, Berg DT, Schiffer CA, Mayer RJ (1994): Curative impact of intensification with high dose cytarabine (HiDAC) in acute myeloid leukemia (AML) varies by cytogenetic group. Blood 84:111 (abstract). 23. Nichols J, Nimer SD (1992): Transcription factors, translocations, and leukemia. Blood 80:2953-2963. 24. Korbling M, Przepiorka D, Huh YO, Engel H, van Besien K, Giralt S, Andersson B, Kleine HD, Seong D, Deisseroth AB, Andreeff M, Champlin R. (1995): allogeneic blood stem cell transplantation for refractory leukemia and lymphoma: Potential advantage of blood over marrow allografts. Blood 85:1659-1665. 25. London B, Pinkerton PH, Senn JS (1986): A new translocation in chronic myeloid leukemia-t(4;9;22)-resulting in a masked Philadelphia chromosome. Cancer Genet Cytogenet 20:5-9. 26. Zhang J, Meltzer P, Jenkins R, Guan XY, Trent J (1993): Application of chromosome microdissection probes for elucidation of BCR-ABL fusion and variant Philadelphia chromosome translocations in chronic myelogenous leukemia. Blood 81:3365-3371. 27. Kurzrock R, Shtalrid M, Talpaz M, Kloetzer WS, Gutterman JU (1987): Expression of c-abl in Philadelphia-positive acute myelogenous leukemia, Blood 70:1584-1588. 28. Hirsch-Ginsberg C, Childs C, Chang KS, Beran M, Cork A, Reuben J, Freireich EJ, Chang LC, Bollum FJ, Trujillo J, Stass SA (1988): Phenotypic and molecular heterogeneity in Philadelphia chromosome-positive acute leukemia. Blood 71:186195. 29. Tien HF, Wang CH, Chuang SM, Lee FY, Liu MC, Chen YC, Shen MC, Lin DT, Lin KH, Lin KS (1992): Characterization of Philadelphia-chromosome-positive acute leukemia by clinical, imnmnocytochemical, and gene analysis. Leukemia 6:907-914. 30. Pui CH, Raimondi SC, Head DR, Schell MJ, Rivera GK, Mirro

124

E . S . M a r t i n et al.

J Jr, Crist WM, Behm FG (1991): Characterization of childhood acute leukemia with multiple myeloid and lymphoid markers at diagnosis and at relapse. Blood 78:1327-1337. 31. Voncken JW, Kaartinen V, Pattengale PK, Germeraad WT, Groffen J, Heisterkamp N (1995): BCR/ABL P210 and P190 cause distinct leukemia in transgenic mice. Blood 86:4603-4611. 32. Dow LW, Tachibana N, Raimondi SC, Lauer SJ, Witte ON,

Clark SS (1989): Comparative biochemical and cytogenetic studies of childhood acute lymphoblastic leukemia with the Philadelphia chromosome and other 2 2 q l l variants. Blood 73:1291-1297. 33. Xiao H, Baer MR, Block AW, Sait SN, Kakati S (1993): Deletion of chromosome 22 without bcr rearrangement and without juxtaposition of c-abl in a case of acute myeloid leukemia. Cancer Genet Cytogenet 67:141-144.