Complexes at the replication origin of Bacillus subtilis with homologous and heterologous DnaA protein1

J. Mol. Biol. (1997) 274, 365±380

Complexes at the Replication Origin of Bacillus subtilis with Homologous and Heterologous DnaA Protein Margret Krause, Beate RuÈckert, Rudi Lurz and Walter Messer* Max-Planck-Institut fuÈr molekulare Genetik Berlin-Dahlem, Germany

The initial steps in the formation of the initiation complex at oriC of Bacillus subtilis were analyzed with special emphasis on the exchangeability of B. subtilis DnaA protein by DnaA of Escherichia coli. The DNA binding domain of B. subtilis DnaA protein was localized in the 93 C-terminal amino acids. Formation of the ``initial complex'', as analyzed by electron microscopy, was indistinguishable with B. subtilis DnaA protein or with E. coli DnaA. Similarly, both proteins were able to form loops by interaction of DnaA proteins bound to the DnaA box regions upstream and downstream of the dnaA gene in B. subtilis oriC. The region of local unwinding in the ``open complex'' was precisely de®ned. It is located at one side of a region of helical instability, a DNA unwinding element (DUE). Unwinding in oriC could only be catalyzed by the homologous DnaA protein. # 1997 Academic Press Limited

*Corresponding author

Keywords: DNA-binding; HU; initiation complex; KMnO4-footprinting; oriC

Introduction In bacteria, chromosomal replication initiates from a unique region, the replication origin oriC, which includes repetitive asymmetric nonamer sequences, the DnaA boxes (50 -TTA/TTNCACA, or a close match). These are speci®c binding sites (Fuller et al., 1984; Schaefer & Messer, 1991; Schaper & Messer, 1995; Yoshikawa & Ogasawara, 1991; Zakrzewska-Czerwinska & Schrempf, 1992) for the key replication initiator protein DnaA, the gene product of the bacterial dnaA gene, whose sequence is highly conserved even between evolutionary distant genera (for recent reviews, see Skarstad & Boye, 1994; Messer & Weigel, 1996). On the basis of sequence homologies, four domains were de®ned in DnaA proteins (Ogasawara & Yoshikawa, 1992). For the Escherichia coli DnaA protein speci®c DNA binding was found to reside in the 94 C-terminal amino acids of domain IV (Roth & Messer, 1995). The DnaA initiator proteins of Bacillus subtilis and E. coli have similar biochemical properties Abbreviations used: aa, amino acid(s); bp, base pair(s); BSA, bovine serum albumin; DUE, DNA unwinding element; IPTG, isopropyl-b-Dthiogalactopyranoside; PCR, polymerase chain reaction; SDS-PAGE, sodium dodecylsulphate-polyacrylamide gel electrophoresis. 0022±2836/97/480365±16 $25.00/0/mb971404

(Sekimizu et al., 1987; Fukuoka et al., 1990), and bind to the same consensus sequence of DnaA boxes (Fuller et al., 1984; Fukuoka et al., 1990). However, although the B. subtilis DnaA protein binds in vitro to DnaA boxes within the E. coli oriC (Fukuoka et al., 1990), it does not complement E. coli DnaA function in vivo, to the contrary, it is highly toxic for E. coli (Andrup et al., 1988). Both DnaA proteins are involved in determining the initiation frequency of chromosomal replication (Moriya et al., 1990; Loebner-Olesen et al., 1989). Common features of bacterial replication origins are AT-rich regions adjacent to multiple DnaA boxes, whose number and relative location within the origin is very different between species. In many eubacteria there is a close association between DnaA box regions and the dnaA gene (Ogasawara & Yoshikawa, 1992). However, in enterobacteriaceae and in some other species the dnaA gene is distant to oriC (S. Richter, W. R. Hess, M. Krause & W. Messer, unpublished results). The replication origin of E. coli (Figure 1) contains ®ve DnaA boxes (Fuller et al., 1984; Langer et al., 1996) and three AT-rich 13mer tandem repeats adjacent to a short AT-cluster at the left border. The ®rst step of the E. coli in vitro replication is recognition and binding of the DnaA boxes by the DnaA protein (Kornberg & Baker, 1992), # 1997 Academic Press Limited

366

DnaA Complexes at B. subtilis oriC

Figure 1. Organization of the replication origins, oriC, of B. subtilis and E. coli. Positions of DnaA boxes and AT-rich regions are shown, including DnaA boxes R5 and R6 downstream of E. coli oriC. DnaA boxes within the B. subtilis oriC are indicated according to the footprinting data (Fukuoka et al., 1990). Positions for B. subtilis refer to Moriya et al. (1985), for E. coli to Buhk & Messer (1983).

forming the ``initial complex'' with about 20 to 40 DnaA protein monomers (Fuller et al., 1984; Funnell et al., 1987; Crooke et al., 1993). In the presence of HU protein and ATP (Sekimizu et al., 1988) the E. coli DnaA protein catalyzes a local unwinding at the AT-rich region, the ``open complex'' (Bramhill & Kornberg, 1988; Gille & Messer, 1991; Hwang & Kornberg, 1992). The DnaB/DnaC helicase is delivered to the opened DNA, followed by successive priming and chain elongation (Kornberg & Baker, 1992). Within the B. subtilis oriC (Figure 1), two DnaA box regions ¯anking the dnaA gene were further subdivided into the incA, incB and incC DnaA box clusters, that exert incompatibility to different degrees (Moriya et al., 1988). Close to the incC DnaA box cluster, the initiation of replication was mapped (Moriya et al., 1994; Moriya & Ogasawara, 1996). At the borders of oriC, three AT-rich 16mer tandem repeats are localized upstream and a 27mer AT-cluster downstream of dnaA (Yoshikawa & Wake, 1993). In vitro and in vivo the functionality of the origin is maintained even when a deletion removes most of the dnaA gene (Moriya et al., 1992, 1994), if DnaA is provided in trans. The B. subtilis DnaA protein was reported to unwind the DNA within the B. subtilis oriC close to the 27mer AT-cluster (Moriya et al., 1994). Although E. coli and B. subtilis are phylogenetically unrelated organisms, the structural prerequisites and functions of both oriC regions and DnaA proteins are obviously similar, despite the different overall organization of the respective origins. For a better understanding of the initiation complexes in both systems, we analyzed which reactions in the initiation process can be exerted by the heterologous DnaA protein. Electron microscopic binding studies for complex formation are presented, and a DNA unwinding element (DUE) (Umek & Kowalski, 1988) in B. subtilis oriC is de®ned. We determine precisely the bases in the unwound region that are not base paired, and inquire the possibility of ``open complex'' formation at the reciprocal origin of replication. In addition, we

de®ne the DNA binding domain of the B. subtilis DnaA protein.

Results Localization of the DNA binding domain of the B. subtilis DnaA protein The 94 C-terminal amino acids of the E. coli DnaA protein, domain IV, are suf®cient for speci®c binding to DnaA boxes in vitro, as determined by the solid-phase DNA binding assay (Roth & Messer, 1995). In this assay fusions of deletion derivatives of E. coli DnaA to a peptide from Propionibacterium shermanii that is naturally biotinylated in E. coli (Murtif et al., 1985) were bound to streptavidin coated magnetic beads. Their ability to bind speci®cally to DnaA boxes was tested using oriC DNA. This DnaA domain IV of E. coli represents a new DNA binding motif (Roth & Messer, 1995). In order to de®ne the minimal B. subtilis DnaA peptide, which mediates speci®c binding to DNA, four pBsuBEX expression vectors were constructed. The C-terminal regions of the DnaA protein (Figure 2A: pBsuBEX1-4 with 139, 93, 77, and 69 amino acids, respectively) were fused to the Nterminal biotin target peptide in pBEX5BA. The biotinylation of the four fusion proteins was screened by blotting an SDS-PAGE to a membrane and developing with a streptavidin-alkaline phosphatase conjugate (Roth & Messer, 1995). The biotinylated fusion proteins were ®xed to magnetic beads from the crude cell extracts and their speci®c interaction with DnaA boxes was tested. A 500-bp DNA fragment carrying ®ve DnaA boxes from the E. coli oriC region (position ÿ61 to 439, Figure 1; all positions from E. coli oriC refer to Buhk & Messer (1983) was mixed with a 20-fold excess of X174/ HaeIII DNA as competitor and, after separation of the bound DNA from the unbound material, both fractions were visualized on an agarose gel (Figure 2B). Only the B. subtilis DnaA peptides from pBsuBEX1 und pBsuBEX2 bound the DnaA box carry-

DnaA Complexes at B. subtilis oriC

367

Figure 2. Minimal C-terminal peptide of the B. subtilis DnaA protein, which interacts speci®cally with DnaA boxes. (A) pBsuBEX constructs with N-terminal fusions to biotinylated peptides of four C-terminal regions of the DnaA protein of different lengths (pBsuBEX1: 139 aa; pBsuBEX2: 93 aa; pBsuBEX3: 77 aa; pBsuBEX4: 66 aa). The shading of the aa sequence indicates the a-helical secondary structure prediction within domain IV (Schaper & Messer, 1997). (B) Fusion proteins were immobilized on magnetic beads and the interaction with a 500 bp DnaA box carrying DNA fragment from E. coli oriC (lane 2) was assayed in the solid-phase DNA binding assay (Roth & Messer, 1995) in the presence of X174 HaeIII-fragments (lane 3) as competitor DNA (mixture in lane 1). Bound fragments (lanes 4, 6, 8, 10) were separated from the unbound fraction (lanes 5, 7, 9, 11), and subjected to agarose gel electrophoresis. pBsuBEX1 (lanes 4 and 5), pBsuBEX2 (lanes 6 and 7), pBsuBEX3 (lanes 8 and 9), pBsuBEX4 (lanes 10 and 11).

ing fragment speci®cally, whereas the two smaller fusion peptides did not interact even with unspeci®c DNA. Therefore, the 93 C-terminal amino acids of the B. subtilis DnaA protein are required and suf®cient in vitro for the interaction with the DNA target. The analysis corroborates data for the E. coli DnaA protein, where 94 C-terminal amino acids are suf®cient for speci®c binding (Roth & Messer, 1995). The secondary structure prediction suggests for both DnaA proteins a similar arrangement with six a-helices in the C-terminal region (Schaper & Messer, 1997) (Figure 2A for B. subtilis DnaA). Binding of DnaA proteins to the B. subtilis and E. coli oriC regions DnaA boxes are clustered within the replication origins of B. subtilis and of E. coli (Figure 1), whereas their arrangement in both origins is quite distinct. The speci®c interaction of the DnaA protein with its cognate binding sites is the initial step in initiation at oriC. The nucleoprotein complexes formed by the DnaA proteins of B. subtilis or E. coli and both oriC regions were studied by electron microscopy and the binding speci®cities of both proteins compared. The oriC region of B. subtilis, comprising three clusters with DnaA boxes, incA, incB and incC (Moriya et al., 1988) was assayed as a 2536 bp PCR fragment (position 68 to 2146, Figure 1; all positions at B. subtilis oriC refer to Moriya et al., 1985) with an asymmetrically situated oriC. The incA,

incB and incC DnaA box clusters were located such, that the occupation of any of these sites would produce ends of different lengths for unambigous identi®cation: a long tail upstream of incA (420 bp) and a short one downstream of incC (290 bp). The binding of the B. subtilis DnaA protein to the B. subtilis oriC region was visualized with 225 to 450 ng (4.5 to 9.0 pmoles) protein in 30 ml reaction mixtures, resulting in single and multiple complexes of DnaA protein bound to the individual fragments (Figure 3A). At 450 ng DnaA protein, the histogram of the number of nucleoprotein complexes at individual positions showed that DnaA interacted only with the incA, incB and incC DnaA box clusters on the linear fragments (Figure 3D). A considerably smaller amount of complexes was found at the incA DnaA boxes than at incB and incC positions. At 225 ng DnaA the interaction was practically exclusively with the incB DnaA box cluster. These differences in interaction with the DnaA box clusters (incB > incC > incA) by the B. subtilis DnaA protein, observed here by electron microscopy (Figure 3D), corroborate results obtained by ®lter binding (Fukuoka et al., 1990) and correlate with the levels of growth inhibition assigned to these regions (Moriya et al., 1988). In parallel experiments, heterologous nucleoprotein complexes between the E. coli DnaA protein and the B. subtilis oriC were formed in 10 ml reaction mixtures with 1 to 3 ng (20 to 60 fmoles) E. coli DnaA protein. The heterologous interaction

368

DnaA Complexes at B. subtilis oriC

Figure 3. Electron microscopic visualization of DnaA-oriC complexes at the B. subtilis oriC region. Complexes were formed with the linear 2.5 kb oriC fragment (see Figure 1) (A, B) or with supercoiled plasmid DNA (C) from which the oriC fragment was subsequently cut out. The bar represents 1 kb. (A) Nucleoprotein complexes formed with the B. subtilis DnaA protein (of 235 molecules analyzed 26% had no complexes, 32% one complex, 14% more than one complex, and 28% showed loop structures). (B) Nucleoprotein complexes formed with the E. coli DnaA protein at B. subtilis oriC (119 molecules, 3% without complex, 13% with one, 54% with more than one complex, 30% with loops). (C) Complexes formed at superhelical B. subtilis oriC of the pBsoriC4 plasmid. Subsequently, the plasmid was linearized outside the 2.5 kb oriC insert. (D) Histogram of complexes of linear B. subtilis oriC with B. subtilis DnaA protein, from A. DnaA boxes are indicated by vertical bars.

resulted in single and multiple occupation of the DnaA box regions at the B. subtilis oriC (Figure 3B). The positions of the E. coli DnaA protein were measured along the oriC molecules (data not shown) and revealed a predominant interaction at the incA, incB and incC DnaA box clusters, also with a reduced af®nity to the incA cluster. The binding properties of the E. coli DnaA protein to B. subtilis oriC were thus very similar to those of the B. subtilis DnaA protein. Even when used in a large molar excess over DNA, both DnaA proteins bound almost exclusively to DnaA boxes. Reciprocal experiments, which detected the complexes of both DnaA pro-

teins with the E. coli oriC region (data not shown), resulted as well in an identical interaction by the B. subtilis and E. coli DnaA proteins. DnaA protein mediated DNA loop formation at oriC regions As target for binding DnaA proteins, the B. subtilis oriC comprises two distant DnaA box regions ¯anking the dnaA gene. In the preparations described above both the B. subtilis and the E. coli DnaA protein were able to mediate intramolecular DNA loops at higher DnaA protein concentrations by joining the distant binding sites via contacts

369

DnaA Complexes at B. subtilis oriC

between DnaA protein complexes at oriC. At 450 to 900 ng (9 to 18 pmol) B. subtilis DnaA protein per 30 ml reaction mixture, loop formation was observed at a high percentage of the total DNA molecules (Figure 3A). Identical structures were found upon addition of 2 to 5 ng (40 to 100 fmol) E. coli DnaA protein to the B. subtilis oriC region (10 ml reaction mixtures; Figure 3B). For looped DNA molecules the sizes of the long tail, loop and short tail were determined for complexes with each DnaA protein. The lengths of the shorter and longer tail segments corresponded to the regions outside the incA and incC regions, whereas the looped out structure was identical to the length of the dnaA gene between the ®xation points. Even by eye, the pair of short and long tails outside the junction is easily visible (Figure 3A and B). With increasing amounts of each of the DnaA proteins, large nucleoprotein aggregations were observed (data not shown), apparently involving more proteins and DNA molecules within the complexes. The close association between two separate DnaA box regions within the B. subtilis oriC region, mediated by the initiator protein DnaA, could represent in vivo an intermediate of the initiation from oriC. Since in vivo initiation requires supercoiled DNA, we analyzed speci®c complexes with the superhelical oriC template of the pBsoriC4 plasmid. After incubation with the B. subtilis DnaA protein and ®xation, the 2.5 kb oriC segment (Figure 1) was excised from the plasmid by SmaI digestion. A large number of looped molecules in the electron micrographs con®rmed, that the B. subtilis DnaA protein supported the formation of loops with the dnaA gene on superhelical oriC (Figure 3C). The two distinct arm lengths outside the asymmetrically positioned DnaA box regions showed that the B. subtilis DnaA protein maintained its speci®city for the DnaA box regions also on the superhelical oriC. The looped out dnaA gene was held in twisted superhelical structure between the attachment points. Counting from the base of the loop, the number of crossover nodes observed under these conditions was typically two per 1.5 kb length of the loop. DnaA protein-mediated loop formations were also observed within the oriC region of E. coli, between the ®ve DnaA boxes in oriC and two additional DnaA boxes R5 and R6, which are localized more than 500 bp downstream of oriC (Figure 1). The E. coli DnaA protein was found to establish the looping (C. Weigel, A. Schmidt, R. Lurz, B. RuÈckert & W. Messer, unpublished results), whereas the B. subtilis DnaA protein did not sustain such a structure, although it bound speci®cally to the DnaA boxes within oriC and the DnaA boxes R5 and R6 (data not shown). In summary, loop formation by DnaA proteins on oriC templates in vitro due to protein ±protein interaction, was not limited to the corresponding initiator protein of each replication origin. Loops were obtained at the B. subtilis oriC region even with the E. coli DnaA protein. But the heterologous

loop structures between the B. subtilis DnaA protein at the E. coli oriC region were not found. Open complex formation by the B. subtilis DnaA protein During the initiation processes of both transcription and replication DNA is partially unwound at promoters or the AT-rich origin regions, respectively. Potassium permangante footprinting was used to probe for helical distortions of B-form DNA within the E. coli oriC region (Gille & Messer, 1991; Woelker & Messer, 1993). At physiological pH, KMnO4 selectively oxidizes unpaired pyrimidines, especially thymine residues, in singlestranded DNA and in helically distorted duplex DNA (Sasse-Dwight & Gralla, 1991). Oxidized pyrimidines prevent primer extension by the Klenow fragment of DNA polymerase I beyond the modi®ed residues. Within the B. subtilis oriC, the region downstream of the incC DnaA box cluster was reported to be sensitive to treatment by KMnO4 after the addition of the B. subtilis DnaA protein in vitro (Moriya et al., 1994). Here, we analyzed the DnaA protein induced unwinding in detail on the plasmid pBsoriC4, carrying the B. subtilis oriC (Figure 1). The supercoiled plasmid (1.25 mg) was incubated with the B. subtilis DnaA protein (0.25 to 2 mg) in the presence of the heterologous E. coli HU protein (130 ng). The DnaA box regions, upstream and downstream of the dnaA gene, were examined for DnaA-dependent helical distortions. The region upstream of the incA DnaA boxes, where three AT-rich tandem repeat 16mers are localized, was found unaffected (data not shown). But the B. subtilis DnaA protein caused strong distortions in vitro at the 27mer AT-cluster downstream of the dnaA gene. The onset of the unwinding process (Figure 4A, lanes 2) was detected with a molar ratio in the reaction of about 15 DnaA molecules per oriC plasmid (5 pmoles protein and 330 fmoles plasmid) and the maximal effect (Figure 4A, lanes 5) was accomplished with about 90 DnaA protein monomers per oriC (30 pmoles protein and 330 fmoles plasmid). The precise location of the bases involved was obtained relative to sequencing standards with the same primers (Figure 4A, lanes A, C, G, T), and the helical distortions were assigned to the B. subtilis oriC positions 2077 to 2104. With the lower DnaA protein concentration (long arrows in Figure 5), the unwinding was limited to the region upstream of the 27mer AT-cluster just next to the incC DnaA boxes. At higher DnaA protein levels (short arrows in Figure 5), the unwinding proceeded into the ATcluster. Bases from 2105 to 2111 (thin arrows in Figure 5) were affected to a minor extent in some experiments. The susceptible region was sharply delineated on the left and rather diffusely on the right. Additional distortions were detected within the incC DnaA box region at positions 1970, 1992, 2012 and 2026 (Figure 4A, arrowheads aside lane 6

Figure 4. ``Open complex'' formation by the B. subtilis DnaA protein (A) and localization of the DUE (B) on the B. subtilis oriC, probed with KMnO4 on the pBsoriC4 plasmid. Dideoxy sequencing reactions (lanes A, C, G, T) are shown as reference. Open boxes indicate the 27-mer AT-cluster, and arrows denote DnaA boxes of the incC DnaA box region. Additional distortions were detected at the top strand around positions 1970, 1992, 2012 and 2026 (see Figure 5) and are indicated by horizontal arrowheads. The supercoiled pBsoriC4 plasmid (1.25 mg) was (A) incubated with 130 ng E. coli HU protein and increasing amounts of B. subtilis DnaA protein, or (B) without DnaA or HU proteins in different buffer conditions, treated with KMnO4 and linearized by XmnI. Incubation conditions were: (A) unwinding buffer with (1) 0 ng, (2) 250 ng, (3) 500 ng, (4) 1 mg, (5) 1.5 mg, (6) 2 mg B. subtilis DnaA protein; (B) all experiments were done in 20 mM Hepes (pH 7.6) 1 mM EDTA, using (lane 1) PstI-linearized or (lanes 2 to 4) superhelical pBsoriC4 plasmid. In lanes 3 and 4 the pBsoriC4 template was assayed in superhelical conformation including (3) 5 mM MgCl2 or (4) 5 mM Mg-acetate in the reaction.

371

DnaA Complexes at B. subtilis oriC

Figure 5. KMnO4-sensitive nucleotides within the B. subtilis oriC. The region is located at the right border of oriC in Figure 1 (from position 1960 to 2069 only the top strand is shown). The incC DnaA boxes and the 27mer AT-cluster are outlined. The region includes a DNA unwinding element (DUE) of about 120 bp. Reactive thymines are marked by ®lled boxes. Speci®c helical distortions as catalyzed by the B. subtilis DnaA protein are indicated by arrows. The long arrows point to the strongest reaction sites, the shorter ones to sensitive thymines in the presence of a high amount of DnaA protein, and thin arrows correspond to marginal reactions. In addition, the B. subtilis DnaA protein induced distortions in the top strand around positions 1970, 1992, 2012 and 2026 are indicated by arrows. Nucleotide positions refer to Moriya et al. (1985).

of the top strand), indicating further DnaA protein dependent torsional stress at its binding sites (Figure 5). The induction of helical distortions by the B. subtilis DnaA protein was dependent on a superhelical oriC template, since the linearized pBsoriC4 plasmid was unaffected by KMnO4 (data not shown). Unwinding was also observed in a plasmid in which the incA and incB regions were deleted (data not shown). The B. subtilis DnaA protein performed the unwinding reaction even in the absence of HU protein, however at reduced ef®ciency (Figure 6, lanes 2 and 3), therefore HU protein assisted in the unwinding process. HU protein alone did not induce helical distortions when the B. subtilis DnaA protein was omitted from the reaction (Figure 4A, lane 1). The B. subtilis DnaA protein promoted the speci®c DNA unwinding independent of the source of HU protein. Helical distortions in Figure 4 were catalyzed in the presence of the heterologous E. coli HU protein, but the reaction was indistinguishable when B. subtilis HU protein (HBsu) (Micka et al., 1991) was used (data not shown). E. coli HU protein exists as homodimer or heterodimer, a2, b2, and a,b. Two concentrations (65 and 130 ng) of each type were compared in their ef®ciencies (Figure 6). All three E. coli HU variants assisted the ``open complex'' formation identically (b2-homodimer: lanes 4, 5; a2homodimer: lanes 6, 7; a,b-heterodimer: lanes 8, 9). In each case, the higher HU concentration supported the full reaction (as in Figure 4A), while the lower one gave a reduced signal.

The B. subtilis DnaA protein mediated unwinding occurs within a DUE AT-rich DNA sequences are commonly found within the starting regions of prokaryotic and eukaryotic DNA replication conferring a lower melting temperature and instability to the double stranded B-form DNA helix. Such a region of instability, that allows distortion in the absence of protein, was termed a DNA unwinding element (DUE). These were found in yeast ars sequences (Umek & Kowalski, 1988), E. coli oriC (Kowalski & Eddy, 1989) and the SV40 origin (Lin & Kowalski, 1994). In E. coli DUEs could only be detected at reduced Mg2‡ concentrations (Gille & Messer, 1991; Woelker & Messer, 1993). The B. subtilis DnaA protein speci®cally unwinds the left part of the AT-rich 27mer including 15 bp upstream (Figure 5). To test the helical stability of this region, the oriC carrying plasmid pBsoriC4 was subjected to KMnO4 treatment under various conditions and analyzed by primer extension. The reaction was carried out either in 10 mM HepesKOH (pH 7,6), 0.5 mM EDTA buffer (Figure 4B) or in water (data not shown) with identical results. Linearization of the plasmid with PstI (the PstI site is located 2.5 kb distant to the distorted region) eliminated the KMnO4 sensitivity in the 27mer ATcluster region (Figure 4B, lane 1). However, when the reaction was performed with supercoiled plasmid, strong hypersensitivities were observed (Figure 4B, lane 2). The reactivity was completely abolished when 5 mM MgCl2 (Figure 4B, lane 3) or 5 mM magnesium-acetate (Figure 4B, lane 4) were included. The molecules obtained by primer exten-

372

DnaA Complexes at B. subtilis oriC

Figure 6. Effect of E. coli HU protein on ``open complex'' formation by the B. subtilis DnaA protein. The B. subtilis oriC was assayed by KMnO4 modi®cation. KMnO4 sensitive sites of the top strand are shown next to sequencing standards (A, C, G, T). The position of the 27mer AT-cluster is indicated by an open box, and the DnaA boxes of the incC DnaA box region by arrows. The unwinding reaction was done either without HU or DnaA protein or with the amounts of both proteins given at the top. The different HU proteins refer to the E. coli HU protein subtypes: (b2), b2-homodimers; (a2), a2-homodimers; (a,b), a,b-heterodimers.

sion with KMnO4 modi®ed templates were electrophoresed in parallel to sequencing standards and the affected bases are indicated in Figure 5. On the complementary strands, the region of helical instability covered a stretch of about 120 bp from position 2078 to 2198, possibly in a slightly asymmetrical fashion, since the top strand showed reduced sensitivity at the ends of the region. The helical instability was obvious only in the absence of Mg2‡ since the stable B-form DNA was recovered in the presence of 5 mM Mg2‡. We conclude that the structural basis for the B. subtilis DnaA protein dependent ``open complex'' formation is the lower free energy required for unwinding in this region. Furthermore, a superhelical conformation of the oriC template is essential to lower the energy for unwinding the duplex DNA. Unwinding of oriC by DnaA proteins is species specific In E. coli DnaA mediated unwinding occurs in AT-rich 13mers at the left border of oriC (Bramhill & Kornberg, 1988; Gille & Messer, 1991). The ATrich regions that are unwound in the E. coli or B. subtilis oriC, respectively, are thus quite different. On the other hand, both DnaA proteins bind to the same sequences, DnaA boxes, and the complexes formed by heterologous DnaA proteins are indistinguishable. It might therefore be possible that unwinding by DnaA simply opens the most labile structure, and that therefore, the two proteins might be able to replace each other also in the unwinding reaction. In order to test this we monitored reciprocal oriC unwinding by the heterologous DnaA protein. The reaction conditions for

permanganate footprinting were identical for both DnaA proteins, and KMnO4 sensitive bases were detected by primer extension. Each of the DnaA proteins induced the ``open complex'' at the homologous oriC (Figure 7A and B). The B. subtilis DnaA protein reacted as shown before (Figure 7A, lanes 2 to 4). E. coli DnaA protein induced helical distortions in the top strand of E. coli oriC from position 45 to 62 and in the bottom strand from position 32 to 63 (Figure 7B, lanes 2 to 4). This corresponds to the published positions of local unwinding (Bramhill & Kornberg, 1988; Gille & Messer, 1991; Hwang & Kornberg, 1992; Woelker & Messer, 1993). Both DnaA proteins were unable to form an ``open complex'' at the heterologous origin. Neither the E. coli DnaA protein (Figure 7A, lanes 5 to 7) nor the B. subtilis DnaA protein (Figure 7B, lanes 6 to 8) could induce any helical distortion at the heterologous oriC. Although both DnaA proteins reacted in binding to the reciprocal oriC region always in an indistinguishable manner, this result clearly shows, that the transition from the ``initial complex'' to the ``open complex'' is a highly speci®c event during the initiation of replication.

Discussion Most of our knowledge on the molecular events at the initiation of replication derives from E. coli (for a recent review, see Messer & Weigel, 1996). DnaA proteins are found in all eubacteria and even among evolutionary distant species they are highly homologous. DnaA proteins bind to the

Figure 7. Induction of DnaA protein-induced ``open complexes'' at the B. subtilis and E. coli oriC regions by both DnaA proteins. The oriC-carrying plasmids were incubated with 130 ng E. coli HU protein and with increasing amounts of DnaA protein and treated with KMnO4. (A) B. subtilis oriC on the plasmid pBsoriC4. Open boxes indicate the 27mer AT-cluster and arrows incC DnaA boxes. Amount of DnaA protein: (1) 0, (2, 5) 500 ng, (3, 6) 1 mg, (4, 7) 2 mg. (B) E. coli oriC on plasmid pOC170. Open boxes refer to the AT-rich 13mers (Figure 1). Amount of DnaA protein: (1, 5) 0, (2) 250 ng, (3) 500 ng, (4) 750 ng, (6) 500 ng, (7) 1 mg, (8) 2 mg.

374 same DnaA box consensus sequence that is present in all bacterial origins analyzed so far. The experiments discussed here involve the ®rst two stages of oriC-dependent initiation of replication. DnaA proteins act by binding to the DnaA box repeats within oriC, forming the ``initial complex'', and subsequent local unwinding results in ``open complex'' formation. We analyzed the activities of the B. subtilis DnaA protein at the B. subtilis oriC region, and especially which reactions can be ful®lled by the heterologous E. coli DnaA protein at B. subtilis oriC, and vice versa. The DNA binding region of the B. subtilis DnaA protein was de®ned in vitro using the solid-phase DNA binding assay (Roth & Messer, 1995). As in E. coli the 93 C-terminal amino acids (94 in the case of E. coli) were found to be required and suf®cient for speci®c DNA binding (Figure 2A). Similar results were obtained for the DnaA proteins of Streptomyces lividans (Majka et al., 1997) and of cyanobacteria (S. Richter, W.R. Hess, M. Krause & W. Messer, unpublished results). Secondary structure prediction suggests six a-helices for domain IV of DnaA proteins (Schaper & Messer, 1997). Presumably, the four or ®ve C-terminal ones, including a conserved basic loop region, build up the functional DNA binding motif. The structural elements within oriC, DnaA boxes and AT-rich regions, are found in both origins, of E. coli and B. subtilis, although they differ in number and in spatial arrangement (Figure 1). In the B. subtilis oriC two DnaA box regions, separated by 1.4 kb, are required in cis for initiation (Moriya et al., 1992, 1994). These are subdivided into the incA, incB and incC DnaA box clusters (Moriya et al., 1988). Electron microscopy was used to monitor the interaction of puri®ed DnaA proteins with the different DnaA box clusters of the B. subtilis oriC in vitro. Both the E. coli and the B. subtilis DnaA proteins bound to the oriC region in an indistinguishable manner (Figure 3A, B), with an obvious preference to the incB cluster and lower af®nity to the incA DnaA boxes. These results are in agreement with the different impacts on growth inhibition of these regions, i.e. incompatibility (Moriya et al., 1988), or with ®lter binding studies (Fukuoka et al., 1990). At somewhat higher DnaA concentrations, both DnaA proteins formed stable looped complexes on the B. subtilis oriC template, with the B. subtilis or the E. coli DnaA protein bound at the base of the loop and the intervening dnaA gene looped out (Figure 3A, B). The looped out region fell into the size range expected for contacts between the separated DnaA box regions. The possibility, that this higher order nucleoprotein structure might be existent in B. subtilis in vivo is supported by the fact, that the B. subtilis DnaA protein formed loops also on a superhelical oriC template (Figure 3C). A model for a coupled control for dnaA expression and the initiation of replication by intramolecular loop formation has been suggested (Yoshikawa & Wake, 1993), and might be supported by the data

DnaA Complexes at B. subtilis oriC

shown. We do not think that the looped structures represent intermediates of a negative regulation similar to a handcuf®ng-type control of replication. In handcuf®ng, the pairing of initiator protein binding sites is between two origins in trans, inhibiting the activity of both origins (McEachern et al., 1989; Pal & Chattoraj, 1988; Blasina et al., 1996). In the experiments discussed here, most contacts formed by the B. subtilis DnaA protein were within the same molecule, and only in very few cases between two separate oriC molecules (data not shown). However, the observed loops could well be regulatory structures for initiation control in cis, by association of normally physically separated DnaA box regions. The upstream DnaA boxes incA and/ or incB might serve as replication enhancers for the replication start site around the incC DnaA box region. Similar models have been suggested for the replication of plasmid R6K (Miron et al., 1992; Wu et al., 1992) and for the Epstein ±Barr virus initiation control (Frappier & O'Donnell, 1991; Su et al., 1991). Loops were also found at the E. coli oriC, as analyzed by electron microscopy. They involved the DnaA boxes of the E. coli oriC with the two distant DnaA boxes R5 and R6 (C. Weigel, A. Schmidt, R. Lurz, B. RuÈckert & W. Messer, unpublished results). However, only E. coli DnaA protein induced loops at E. coli oriC. Since this region with DnaA boxes R5/R6 can be deleted from the E. coli chromosome and from minichromosomes without much effect on the regulation of initiation (Loebner-Olesen & Boye, 1992; Bogan & Helmstetter, 1996), we may assume that loop formation in E. coli is an evolutionary relic. Another functional element within bacterial replication origins are AT-rich tracts. They facilitate local DNA unwinding caused by the initiator protein, when it binds to DnaA boxes at a region ¯anking the AT-rich sequences. This unwound part presumably provides the entry site for the replicative helicase. Within the E. coli oriC (Figure 1) three AT-rich 13mers (L, M, R) are the sites of DnaA protein-induced local distortions of the B-form helix (Bramhill & Kornberg, 1988; Gille & Messer, 1991; Hwang & Kornberg, 1992; Woelker & Messer, 1993). Similar unwinding activities by origin binding protein have been identi®ed in the E. coli plasmids R1162 (Kim & Meyer, 1991), R6K (Mukherjee et al., 1985), mini-F (Kawasaki et al., 1996), and P1 (Mukhopadhyay et al., 1993), in bacteriophage l (Schnos et al., 1988), and in the eukaryotic viruses SV40 (Borowiec & Hurwitz, 1988), herpes simplex virus (Koff et al., 1991), Epstein-Barr virus (Frappier & O'Donnell, 1992), bovine papillomavirus (Gillette et al., 1994) and murine polyomavirus (Bhattacharyya et al., 1995). In B. subtilis local unwinding in the region of the AT-rich 27mer adjacent to incC has been proposed (Moriya et al., 1994). Here we present a precise localization of the bases involved (Figure 5).

375

DnaA Complexes at B. subtilis oriC

Regions of thermodynamical instability, called DUE (DNA unwinding element) were found that mediate helical distortions in the absence of initiator protein (Umek & Kowalski, 1988). This cisacting sequence is required for origin function. DUEs are located in replication origins as shown for E. coli (Kowalski & Eddy, 1989), Saccharomyces cerevisae (Umek & Kowalski, 1990), SV40 (Lin & Kowalski, 1994) and Tetrahymena (Du et al., 1995). Within the B. subtilis oriC we found such a DUE as structural basis for the initiator protein-mediated unwinding in vitro, consisting of a 120 bp stretch downstream of the incC DnaA boxes, including the AT-rich 27mer cluster (Figure 5). In the absence of Mg2‡, this region existed stably unwound on a supercoiled plasmid, whereas at a level of 5 mM Mg2‡, the B-form DNA was re-established. The DUE colocalized with the replication start region near to the incC DnaA box cluster (Moriya et al., 1994; Moriya & Ogasawara, 1996). A region of inherent instability of similar length is quite unusual, since so far the only extended DUE was found for the ARS (autonomous replicating sequence) in ribosomal DNA repeats in S. cerevisae (Miller & Kowalski, 1993). The DUE re¯ects a helical instability and, under physiological magnesium levels, gives a propensity to be unwound by the DnaA initiator protein, which promotes the ``open complex'' at the B. subtilis oriC. In the presence of Mg2‡, the unpairing was completely dependent on the addition of B. subtilis DnaA protein and required a negatively supercoiled template. The B. subtilis DnaA protein unwound the B. subtilis oriC sequentially along 28 bp and the initially distorted region was at 14 bp distance to the neighboring DnaA boxes of the incC cluster (Figure 5). The extensive structural changes were located at the leftmost border of the DUE, just outside the adjacent AT-rich 27mer cluster. With higher DnaA concentration, the unwound region extended into the left part of the 27mer cluster. Interestingly, the three AT-rich 16mer tandem repeats at the left border of the B. subtilis oriC did not exhibit any structural unstability, with or without Mg2‡ or DnaA protein, respectively. The processes at the B. subtilis oriC revealed similarities and differences to the formation of the ``open complex'' in E. coli in vitro replication. Both DnaA protein-mediated unwinding reactions are strictly dependent on negative supercoiling and occur in the presence of ATP and Mg2‡ (Bramhill & Kornberg, 1988; Sekimizu et al., 1988; Gille & Messer, 1991). In B. subtilis oriC both strands in the unwound region were equally reactive, and all T residues were oxidized by KMnO4. In contrast, in E. coli oriC, reactivity to single-strand speci®c nuclease and KMnO4 due to DnaA-dependent unwinding has been observed in a larger region in the bottom strand than in the top strand (Bramhill & Kornberg, 1988; Gille & Messer, 1991; Hwang & Kornberg, 1992; Woelker & Messer, 1993). Strand bias was found to be extreme in the P1 origin,

where only one of the two strands reacted with KMnO4 (Mukhopadhyay et al., 1993). In E. coli, the ``open complex'' formation is stimulated by low levels of HU protein (Hwang & Kornberg, 1992). The unwinding at the B. subtilis oriC was assisted by the B. subtilis Hbsu protein (Figure 6), the B. subtilis counterpart of E. coli HU (Micka et al., 1991). E. coli HU protein stimulated DnaA mediated helical distortion in B. subtilis to the same extent. A similar exchange of the Hbsu protein by the E. coli HU homologue was also possible in other HU dependent reactions, e.g. a B. subtilis in vitro recombination system (Alonso et al., 1995). DnaA protein-mediated unwinding at the B. subtilis oriC was stimulated to the same extent by the a2-, b2- and a,b-subtypes of E. coli HU protein (Figure 6). a2- and a,b- but not b2-HU protein were found to restrain DNA supercoiling (L. Claret & J. RouvieÁre-Yaniv, personal communication). We conclude that the HU activity involved in ``open complex'' formation is not related to a modulation of DNA superhelicity but has a more speci®c structural role. In both, the B. subtilis and the E. coli origins, the unwound AT-rich tract is adjacent to multiple DnaA box repeats, and the distance between the closest DnaA box and the initially unwound region is 14 bp. However, neither the B. subtilis nor the E. coli DnaA protein was capable of supporting unwinding of the heterologous oriC region. Thus, although the binding to DnaA boxes and the formation of the ``initial complex'' was indistinguishable between DnaA proteins bound to the cognate or the heterologous origin, the transition from an ``initial complex'' to the ``open complex'' required the origin-speci®c DnaA protein. This origin speci®city may re¯ect a more global difference in the regulation of initiation at the origins of B. subtilis and E. coli, respectively. The Dam methylation system in E. coli allows the cells to discriminate between origins that have initiated from those that have not yet initiated. Therefore, regulation of initiation can be somewhat relaxed, exempli®ed by the relatively high (10) copy number of E. coli minichromosomes (Loebner-Olesen et al., 1987) and by a missing incompatibility between chromosome and minichromosomes. This is different for B. subtilis that lacks an origin-speci®c methylation system. By de®nition, the DnaA boxes of the inc regions exert incompatibility, and the copy number of B. subtilis minichromosomes is less than one (Moriya et al., 1992). The initiation of replication at oriC is thus much more stringently controlled in B. subtilis.

Materials and Methods Bacterial strains and growth conditions E. coli strains (except for AQ3519) were grown in LB broth (Sambrook et al., 1989) supplemented with 75 mg mlÿ1 ampicillin for bla-selection of all plasmids.

376

DnaA Complexes at B. subtilis oriC WM2121 (ara,
(lac-pro), ®s::Km, recA56, rpsL, srlC300::Tn10, thi) (Gille et al., 1991) was grown at 37 C and used in the construction of the pdnaA116 plasmid and overproduction of the DnaA protein of E. coli. The pBsoriC4 plasmid was propagated in TC3478 (araD139,
(ara-leu)7679,
(lac)X74, dnaA::cat, galK, galU, hsdR, rnh373, rpsL, thi) (from T. Atlung) growing at 30 C in the presence of 5 mg mlÿ1 chloramphenicol. The recombinant pBsuBEX plasmids were introduced into the host TG1 (supE, hsdD5, thi,
(lac-proAB), F'[traD36, proAB ‡ , lacIq, lacZ(M15I]) (Sambrook et al., 1989). The biotinylated fusion proteins were overproduced (two hours with 1 mM IPTG) at 30 C in the host WM1704 (araD139, chr::Tn10,
(lacU169 proA‡),
(lon), h¯A150, rpsL) (Young & Davis, 1983).

Plasmids Figure 8. Map of the pLEX5BA plasmid expression vector.

pLEX5BA (Figure 8)

The strain AQ3519 (argH, deo, dnaA850::Tn10, his-29, metB, metD88, pro, rnh::cat, thyA, trpA9605) (Kline et al., 1986), used for construction of the pBsdnaA1 plasmid and B. subtilis dnaA expression, was grown at 30 C with 25 mg mlÿ1 chloramphenicol and 10 mg mlÿ1 tetracyclin in AB-minimal-medium (Clark & Maaloe, 1967) supplemented with 0.5% Casamino acids, 0.2% glucose, 10 mg mlÿ1 thiamin, 20 mg mlÿ1 thymine, 40 mg mlÿ1 tryptophan, 40 mg mlÿ1 methionine, 40 mg mlÿ1 proline, 1 mM FeCl3. The strain DH5a (
(lac)U169, endA1, gyrA46, hsdR17, j80
(lacZ)M15, recA1, relA1, supE44, thi-1) was used for the propagation of the pOC170 plasmid and construction of the pLEX5BA vector. Strain

The pLEX expression vectors (Diederich et al., 1994) have the common feature of two exchangeable cassettes: the promoter cassette, with XhoI ends, upstream of an optimized Shine ± Dalgarno sequence, and the replication origin cassette ¯anked by NotI sites. The XmnI site of the polylinker region de®nes the A of the start codon. The pLEX5BA plasmid (Figure 8; Table 1) was derived from the pLEX1B vector (Diederich et al., 1994) by replacing the `lacZ gene from HindIII to EcoRV by the E. coli rrnBt1t2 terminator, taken from the plasmid pJF118EH (Fuerste et al., 1986). An new XhoI promoter cassette was inserted, consisting of the trpA terminator, the lacI repressor gene and, in diverging transcriptional direction, the PA1-03/04 promoter from the plasmid pUHE25-2 (H. Bujard). The IPTG inducible PA1-03/04 promoter ± operator sequence combines the T7 A1 promoter with two lac operators (Lanzer & Bujard, 1988) and is patented by F. Hoffmann-La Roche & Co., AG, Basel, Switzerland.

Table 1. Coordinates of the pLEX5BA vector pLEX5BA coordinates 1 ±6 7 ±37 38 ±46 47 ±488 489 ±500 501 ±530 531 ±1563

Sequence designation XmnI adaptor pNM480 pJF118EH pT7-7 pT7-7

1564±1571 1572±2401 2402±2409 2410±2587 2588±2594 2595±2599 2600±2649

NotI linker pT7-7 NotI linker pT7-7 BamHI adaptor XhoI linker Synthetic

2650±2671 2672±4124

pUHE25-2 pJF118EH

4125±4214 4215±4221 4222±4239

pUHE25-2 XhoI linker XmnI adaptor

AGCTTC 8450±8480 AGCTTGGGC 62 ±503 GATCCCCATCCT 30 ±1 2501±1469 Position 1247: G to C transition GCGGCCGC 1464±635 GCGGCCGC 630 ±453 GATCCCC TCGAG AAAAAAAAGCCCGCTCATT AGGCGGGCTGGTTAGGTT AACTTAGTCGAGG GGCCCTTTCGTCTTCACCTCGA 3737±5189 Position 3892: changed to lacI‡ 2 ±91 CCTCGAG GGATCTAGGAGTAAGAAT

Function

rrnBt1t2 bla ori colE1

trpA terminator

lacI‡ PA1-03/04 promoter

References: pJF118EH (Fuerste et al., 1986); pNM480 (Minton, 1984); pT7-3 and pT7-7 (Tabor & Richardson, 1985); pUHE25-2 (from H. Bujard).

377

DnaA Complexes at B. subtilis oriC pBsdnaA1

pOC170

The expression plasmid pBsdnaA1 (5559 bp) for the B. subtilis dnaA gene carries the dnaA gene downstream of the PA1-03/04 promoter. For construction, the dnaA reading frame, taken from the plasmid ptac-dnaA (Fukuoka et al., 1990) with six additional bases (position 614 to 1959) and followed by GATCTCTAG, was inserted into the linearized (XmnI and HindIII with subsequent Klenow enzyme treatment) pLEX5BA plasmid.

pOC170 (Roth & Messer, 1995) carries the E. coli oriC region (position ÿ176 to ‡1497), the bla gene for selection, and the ColE1 rop origin from pUC19.

pdnaA116 The expression vector pdnaA116 (5762 bp) for the DnaA protein of E. coli is pLEX5BA (Figure 8) in which base pairs 2 to 23 were replaced by the dnaA reading frame from position 887 to 2292 with additional sequences up to position 2438 (Hansen et al., 1982). In addition, base pairs 496 to 502 of pLEX5BA have been deleted. pBsoriC4 The pBsoriC4 plasmid (5752 bp) carries the B. subtilis oriC region with ¯anking sequences. First the pLEX5BA vector (Figure 8) was modi®ed. In order to obtain a SmaI-excisable oriC fragment, a SmaI DNA linker (TCCCCCGGGGGA) was inserted into the HindIII site of the polylinker region (after Klenow ®lling in). The XhoI promoter cassette of pLEX5BA was removed and, in order to reduce the copy number, the NotI replication origin cassette (originally ropÿ) was replaced by the equivalent wild-type rop‡ pBR322 origin sequence (position 1916 to 2107; Sutcliffe, 1978) with ¯anking NotI linker fragments. The B. subtilis oriC fragment was generated by PCR with B. subtilis 168 chromosomal DNA as template (position ÿ221 to 2314) and inserted in counterclockwise orientation into the polylinker region (SalI restriction and Klenow enzyme ®lling in) of the pLEX5BA-derived plasmid. pBsuBEX vectors The pBsuBEX expression vectors were derived from the pBEX5BA plasmid (S. Richter, W.R. Hess, M. Krause & W. Messer, unpublished results), which is an expression system for biotinylated N-terminal fusion proteins. pBEX5BA was obtained by inserting the coding region of a naturally biotinylated gene of Propionibacterium shermanii (PinPoint Xa-3 vector, Promega) (Murtif et al., 1985) into the XmnI restriction site of the plasmid pLEX5BA (Figure 8). For in-frame fusions downstream of the N-terminal biotinylated peptide, the leftmost endonuclease site of the polylinker region (XmnI in pLEX5BA) was changed to NruI in pBEX5BA. For the analysis of the B. subtilis DnaA protein binding domain, four pBsuBEX expression vectors were constructed with the pBEX5BA plasmid. Four inserts corresponding to C-termial peptides of the DnaA protein with different lengths were ampli®ed by PCR on the pBsdnaA1 plasmid with a downstream tailed PstI site and ligated into the NruI and PstI linearized pBEX5BA. The constructs expressed the following C-terminal DnaA peptides: in pBsuBEX1 aa 308 to 446 (position 1534 to 2523), in pBsuBEX2 aa 354 to 446 (position 1672 to 2523), in pBsuBEX3 aa 370 to 446 (position 1720 to 2523), in pBsuBEX4 aa 378 to 446 (position 1744 to 2523).

DNA manipulations Standard protocols (Sambrook et al., 1989) were used for cloning techniques, plasmid isolation and labeling of DNA. Plasmid puri®cation for electron microscopy and permanganate footprinting was by CsCl-ethidium bromide density gradient centrifugation. Enzymes were purchased from Boehringer Mannheim, New England Biolabs or Perkin Elmer. The oligonucleotide primers for PCR and primer extension analysis were synthesized by the Institute's service group. Purification of DnaA proteins The B. subtilis DnaA protein was overproduced from the pBsdnaA1 plasmid by a three hour induction with 2 mM IPTG in the E. coli strain AQ3519, which was grown as described above. Puri®cation was similar to (Fukuoka et al., 1990). The cells of a 4 l culture were harvested, brought to 20 ml sonication buffer (25 mM Hepes, 500 mM potassium glutamate, 1 mM DTT, 1 mM p-aminobenzamidine) and soni®ed. The lysate was centrifuged (45,000 revs/min, 30 minutes), the DNA removed from the crude extract by polyethyleneimine (Sigma) precipitation (0.0021% per A260) and the protein fraction precipitated with ammonium sulfate at 46% saturation. The precipitate was dissolved in 10 ml and desalted in starting buffer (45 mM Hepes (pH 7.6), 100 mM potassium glutamate, 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 0.5 mM EDTA, 20% (w/ v) sucrose). The protein was applied to a MonoS column (Pharmacia HR10/10) and eluted with a FPLC-generated gradient of potassium glutamate (0.1 to 1 M in 40 ml). After desalting, the DnaA containing fractions were further puri®ed by a similar gradient on a MonoQ column (Pharmacia HR10 /10). The E. coli DnaA protein was overproduced from a 2 l culture harboring the pdnaA116 plasmid in the E. coli strain WM2121 by a two to three hour induction with 1 mM IPTG. The cells were harvested and resuspended in sonication buffer (1 to 2 ml per g wet weight) with 100 mM potassium glutamate and lysed by sonication. After centrifugation (45,000 revs/min, 30 minutes), the supernatant was precipitated with 0.28 mg/ml ammonium sulfate and the precipitate dissolved and desalted in starting buffer. The sample was loaded onto a MonoS column (Pharmacia HR10/10) and eluted with a FPLC-generated gradient of potassium glutamate (0.1 to 1 M in 40 ml) (Schaper & Messer, 1995). Solid-phase DNA binding assay The solid-phase DNA binding assay was performed as described previously (Roth & Messer, 1995; Langer et al., 1996). Electron microscopy Linear 2536 bp fragments carrying the replication origin oriC of B. subtilis (identical to the one cloned into the pBsoriC4 plasmid shown in Figure 1: position ÿ221 to 2314) were ampli®ed by PCR with chromosomal DNA

378 from B. subtilis 168. 225 to 900 ng (4.5 to 18.0 pmoles) B. subtilis DnaA protein were incubated (15 minutes at room temperature) with 100 ng PCR fragment (60 fmoles), or 3 mg B. subtilis DnaA protein (60 pmol) were incubated with 300 ng pBsoriC4 plasmid (80 fmol), in 30 ml binding buffer (25 mM triethanolamin-Cl (pH 7.5), 10 mM MgCl2, 50 mM NaCl, 0.5 mM EDTA, 2.5 mM ATP) followed by ®xation (15 minutes at room temperature) in 0.2% glutaraldehyde. Fixed complexes were separated from unbound protein and glutaraldehyde by BioGelA5m gel ®ltration (column buffer: 25 mM triethanolamin-Cl, 10 mM MgCl2, 50 mM NaCl). In general, higher ratios of DnaA to DNA were used for electron microscopy as compared to KMnO4 footprinting because different buffers were used. In addition, more DnaA was used when complexes were subsequently puri®ed by gel ®ltration. The plasmid DNA was cleaved by SmaI within the SmaI linkers on both sides of the oriC insert in pBsoriC4, followed by a second gel ®ltration on BioGelA5m. The DNA-protein complexes were adsorbed to mica, positively stained in 2% uranylacetate, washed three times in water, rotary shadowed with Pt/Ir, and covered with a carbon ®lm (Spiess & Lurz, 1988). The heterologous complexes with the E. coli DnaA protein were formed (15 min 37 C) with 1 to 5 ng (20 to 100 fmol) of E. coli DnaA protein and 5 ng (3 fmol) linear B. subtilis oriC fragment in 10 ml binding buffer (20 mM Hepes-KOH pH 7.6, 5 mM magnesium acetate, 1 mM EDTA, 4 mM DTT, 0.2% Triton X-100, 100 mM ATP), ®xed in 0.2% glutaraldehyde (15 minutes at room temperature), diluted with the same volume of binding buffer and adsorbed to mica. Micrographs were taken at a magni®cation of 6700 by a Philips EM400T electron microscope on 35 mm ®lm (Agfa, RA711P). The positions of the bound proteins on the DNA were measured on 16 times enlarged negatives using a LM4 digitizer (BruÈhl, NuÈrnberg, Germany). For each histogram the data of 150 to 300 molecules with nucleoprotein complexes were evaluated using software developed in this laboratory (Perez-Martin et al., 1989). Potassium permanganate footprinting KMnO4 footprinting was performed als described (Sasse-Dwight & Gralla, 1991; Gille & Messer, 1991; Woelker & Messer, 1993) with minor modi®cations. To monitor the unwinding reaction by DnaA proteins in vitro, the puri®ed B. subtilis DnaA protein or the one from E. coli (both preincubated with 1 mM ATP) were incubated with 1.25 mg oriC plasmid DNA (pBsoriC4 or pOC170) in 75 ml unwinding buffer (25 mM Hepes-KOH pH 7.6, 10 mM magnesium acetate, 5 mM ATP, 50 mg/ ml BSA, 130 ng HU protein a,b-heterodimer, unless de®ned otherwise) for three minutes at 37 C. KMnO4 was added from a 370 mM stock solution to a ®nal concentration of 8 mM. After two minutes the reaction was quenched by addition of 6 ml b-mercaptoethanol and 6 ml 500 mM EDTA. The DNA was extracted with phenol, the aqueous phase loaded onto 1 ml of packed Sephadex LH60 (Pharmacia) in a 1.5 ml spin column preequilibrated with water and centrifuged at 1800 g for three minutes. The eluate was linearized by restriction enzymes to provide a standard for primer extension termination (plasmid pBsoriC4 with XmnI; plasmid pOC170 with ClaI and EcoRI). The DNA was phenolized and puri®ed with a spin column. Half of the material was used for each primer extension analysis, which was carried out with 1 ng of 50 -labeled oligonucleotide primer according to Sasse-Dwight & Gralla (1991). The primer

DnaA Complexes at B. subtilis oriC oligonucleotides corresponded to the following coordinates: B. subtilis oriC (pBsoriC4) position 2199 to 2223 for the analysis of the top strand, and position 1999 to 2023 for the bottom strand; for the E. coli oriC (pOC170) position 204 to 230 for the analysis of the top strand, and position ÿ32 to ÿ55 for the bottom strand. The samples were subjected to electrophoresis on 8% polyacrylamide/8 M urea sequencing gels next to DNA sequencing lanes and visualized by autoradiography on X-ray ®lm.

Acknowledgments We thank H. Bujard for plasmid pUHE25-2 carrying the promoter PA1-03/04, J. RouvieÁre-Yaniv and A. Subramanian for E. coli HU protein, and U. Heinemann for protein Hbsu. This work was in part supported by grant SFB344, project A9, of the Deutsche Forschungsgemeinschaft.

References Alonso, J. C., Weise, F. & Rojo, F. (1995). The Bacillus subtilis histone-like protein HBsu is required for DNA resolution and DNA inversion mediated by the b recombinase of plasmid pSM19035. J. Biol. Chem. 270, 2938± 2945. Andrup, L., Atlung, T., Ogasawara, N., Yoshikawa, H. & Hansen, F. G. (1988). Interaction of the Bacillus subtilis DnaA-like protein with the Escherichia coli DnaA protein. J. Bacteriol. 170, 1333 ±1338. Bhattacharyya, S., Lorimer, H. E. & Prives, C. (1995). Murine polyomavirus and simian virus 40 large T antigens produce different structural alterations in viral origin DNA. J. Virol. 69, 7579± 7585. Blasina, A., Kittell, B. L., Toukdarian, A. E. & Helinski, D. R. (1996). Copy-up mutants of the plasmid RK2 replication initiation protein are defective in coupling RK2 replication origins. Proc. Natl Acad. Sci. USA, 93, 3559± 3564. Bogan, J. A. & Helmstetter, C. E. (1996). mioC transcription, initiation of replication, and the eclipse in Escherichia coli. J. Bacteriol. 178, 3201± 3206. Borowiec, J. A. & Hurwitz, J. (1988). Localized melting and structural changes in the SV40 origin of replication induced by T-antigen. EMBO J. 7, 3149± 3158. Bramhill, D. & Kornberg, A. (1988). Duplex opening by dnaA protein at novel sequences in initiation of replication at the origin of the E. coli chromosome. Cell, 52, 743± 755. Buhk, H. J. & Messer, W. (1983). Replication origin region of Escherichia coli: nucleotide sequence and functional units. Gene, 24, 265± 279. Clark, D. J. & Maaloe, O. (1967). DNA replication and the division cycle in Escherichia coli. J. Mol. Biol. 23, 99±112. Crooke, E., Thresher, R., Hwang, D. S., Grif®th, J. & Kornberg, A. (1993). Replicatively active complexes of DnaA protein and the Escherichia coli chromosomal origin observed in the electron microscope. J. Mol. Biol. 233, 16± 24. Diederich, L., Roth, A. & Messer, W. (1994). A versatile plasmid vector system for the expression of genes in Escherichia coli. BioTechniques, 16, 916± 923. Du, C., Sanzgiri, R. P., Shiau, W.-L., Choi, J.-K., Hou, Z., Benbow, R. M. & Dobbs, D. L. (1995). Modular

DnaA Complexes at B. subtilis oriC structural elements in the replication origin region of Tetrahymena rDNA. Nucl. Acids Res. 23, 1766± 1774. Frappier, L. & O'Donnell, M. (1991). Epstein ± Barr nuclear antigen 1 mediates a DNA loop within the latent replication origin of Epstein-Barr virus. Proc. Natl Acad. Sci. USA, 88, 10875± 10879. Frappier, L. & O'Donnell, M. (1992). EBNA1 distorts oriP, the Epstein ± Barr virus latent replication origin. J. Virol. 66, 1786± 1790. Fuerste, J. P., Pansegrau, W., Frank, R., Bloecker, H., Scholz, P., Bagdasarian, M. & Lanka, E. (1986). Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacP expression vector. Gene, 48, 117± 129. Fukuoka, T., Moriya, S., Yoshikawa, H. & Ogasawara, N. (1990). Puri®cation and characterization of an initiation protein for chromosomal replication, DnaA, in Bacillus subtilis. J. Biochem. (Tokyo), 107, 732± 739. Fuller, R. S., Funnell, B. E. & Kornberg, A. (1984). The dnaA protein complex with the E. coli chromosomal origin (oriC) and other sites. Cell, 38, 889 ± 900. Funnell, B. E., Baker, T. A. & Kornberg, A. (1987). In vitro assembly of a prepriming complex at the origin of the Escherichia coli chromosome. J. Biol. Chem. 262, 10327± 10334. Gille, H. & Messer, W. (1991). Localized unwinding and structural pertubations in the origin of replication, oriC, of Escherichia coli in vitro and in vivo. EMBO J. 10, 1579± 1584. Gille, H., Egan, J. B., Roth, A. & Messer, W. (1991). The FIS protein binds and bends the origin of chromosomal DNA replication, oriC, of Escherichia coli. Nucl. Acids Res. 19, 4167±4172. Gillette, T. G., Lusky, M. & Borowiec, J. A. (1994). Induction of structural changes in the bovine papillomavirus type 1 origin of replication by the viral E1 and E2 proteins. Proc. Natl Acad. Sci. USA, 91, 8846± 8850. Hansen, E. B., Hansen, F. G. & von Meyenburg, K. (1982). The nucleotide sequence of the dnaA gene and the ®rst part of the dnaN gene of Escherichia coli K12. Nucl. Acids Res. 10, 7373± 7385. Hwang, D. S. & Kornberg, A. (1992). Opening of the replication origin of Escherichia coli by DnaA protein with protein HU or IHF. J. Biol. Chem. 267, 23083± 23086. Kawasaki, Y., Matsunaga, F., Kano, Y., Yura, T. & Wada, C. (1996). The localized melting of mini-F by the combined action of the mini-F initiator protein (RepE) and HU and DnaA of Escherichia coli. Mol. Gen. Genet. 253, 42± 49. Kim, Y.-J. & Meyer, R. J. (1991). An essential iteronbinding protein required for plasmid R1162 replication induces localized melting within the origin at a speci®c site in AT-rich DNA. J. Bacteriol. 173, 5539± 5545. Kline, B. C., Kogoma, T., Tam, J. E. & Shields, M. S. (1986). Requirement of the Escherichia coli dnaA gene product for plasmid F maintenance. J. Bacteriol. 168, 440± 443. Koff, A., Schwedes, J. F. & Tegtmeyer, P. (1991). Herpes simplex virus origin-binding protein (UL9) loops and distorts the viral replication origin. J. Virol. 65, 3284± 3292. Kornberg, A. & Baker, T. A. (1992). DNA Replication. W. H. Freeman and Company, New York.

379 Kowalski, D. & Eddy, M. J. (1989). The DNA unwinding element: a novel, cis-acting component that facilitates opening of the Escherichia coli replication origin. EMBO J. 8, 4335± 4344. Langer, U., Richter, S., Roth, A., Weigel, C. & Messer, W. (1996). A comprehensive set of DnaA box mutations in the replication origin, oriC, of Escherichia coli. Mol. Microbiol. 21, 301 ± 311. Lanzer, M. & Bujard, H. (1988). Promoters largely determine the ef®ciency of repressor action. Proc. Natl Acad. Sci. USA, 85, 8973± 8977. Lin, S. & Kowalski, D. (1994). DNA helical instability facilitates initiation at the SV40 replication origin. J. Mol. Biol. 235, 496± 507. Loebner-Olesen, A. & Boye, E. (1992). Different effects of mioC transcription on initiation of chromosomal and minichromosomal replication in Escherichia coli. Nucl. Acids Res. 20, 3029 ±3036. Loebner-Olesen, A., Atlung, T. & Rasmussen, K. V. (1987). Stability and replication control of E coli minichromosomes. J. Bacteriol. 169, 2835± 2842. Loebner-Olesen, A., Skarstad, K., Hansen, F. G., von Meyenburg, K. & Boye, E. (1989). The DnaA protein determines the initiation mass of Escherichia coli K-12. Cell, 57, 881 ± 889. Majka, J., Messer, W., Schrempf, H. & ZakrzewskaCzerwinska, J. (1997). Puri®cation and characterization of the Streptomyces lividans initiator protein DnaA. J. Bacteriol. 179, 2426± 2432. McEachern, M. J., Bott, M. A., Tooker, P. A. & Helinski, D. R. (1989). Negative control of plasmid R6K replication: possible role of intermolecular coupling of replication origins. Proc. Natl Acad. Sci. USA, 86, 7942± 7946. Messer, W. & Weigel, C. (1996). Initation of chromosome replication. In Escherichia coli and Salmonella, Cellular and Molecular Biology (Neidhardt, F. C., Curtiss, R., III, Ingraham, J., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M. & Umbarger, H. E., eds), pp. 1579± 1601, ASM, Washington, D.C. Micka, B., Groch, N., Heinemann, U. & Marahiel, M. A. (1991). Molecular cloning, nucleotide sequence, and characterization of the Bacillus subtilis gene encoding the DNA-binding protein HBsu. J. Bacteriol. 173, 3191± 3198. Miller, C. A. & Kowalski, D. (1993). cis-Acting components in the replication origin from ribosomal DNA of Saccharomyces cerevisiae. Mol. Cell. Biol. 13, 5360± 5369. Minton, N. P. (1984). Improved plasmid vectors for the isolation of translational lac gene fusions. Gene, 31, 269 ± 273. Miron, A., Mukherjee, S. & Bastia, D. (1992). Activation of distant replication origins in vivo by DNA looping as revealed by a novel mutant form of an initiator protein defective in cooperativity at a distance. EMBO J. 11, 1205± 1216. Moriya, S. & Ogasawara, N. (1996). Mapping of the replication origin of the Bacillus subtilis chromosome by the two-dimensional gel method. Gene, 176, 81 ± 84. Moriya, S., Ogasawara, N. & Yoshikawa, H. (1985). Structure and function of the region of the replication origin of the Bacillus subtilis chromosome. III. Nucleotide sequence of some 10,000 base pairs in the origin region. Nucl. Acids Res. 13, 2251 ±2265. Moriya, S., Fukuoka, T., Ogasawara, N. & Yoshikawa, H. (1988). Regulation of initiation of the chromoso-

380

DnaA Complexes at B. subtilis oriC

mal replication by DnaA-boxes in the origin of the Bacillus subtilis chromosome. EMBO J. 7, 2911± 2917. Moriya, S., Kato, K., Yoshikawa, H. & Ogasawara, N. (1990). Isolation of a dnaA mutant of Bacillus subtilis defective in initiation of replication: amount of DnaA protein determines cells' initiation potential. EMBO J. 9, 2905± 2910. Moriya, S., Atlung, T., Hansen, F. G., Yoshikawa, H. & Ogasawara, N. (1992). Cloning of an autonomously replicating sequence (ars) from the Bacillus subtilis chromosome. Mol. Microbiol. 6, 309± 315. Moriya, S., Firshein, W., Yoshikawa, H. & Ogasawara, N. (1994). Replication of a Bacillus subtilis oriC plasmid in vitro. Mol. Microbiol. 12, 469± 478. Mukherjee, S., Patel, P. & Bastia, D. (1985). Conformational changes in a replication origin induced by an initiator protein. Cell, 43, 189± 197. Mukhopadhyay, G., Carr, K. M., Kaguni, J. M. & Chattoraj, D. K. (1993). Open-complex formation by the host initiator, DnaA, at the origin of P1 plasmid replication. EMBO J. 12, 4547 ±4554. Murtif, V. L., Bahler, C. R. & Samols, D. (1985). Cloning and expression of the 1.3 S biotin-containing subunit of transcarboxylase. Proc. Natl Acad. Sci. USA, 82, 5617± 5621. Ogasawara, N. & Yoshikawa, H. (1992). Genes and their organization in the replication origin region of the bacterial chromosome. Mol. Microbiol. 6, 629 ± 634. Pal, S. K. & Chattoraj, D. K. (1988). P1 plasmid replication: initiator sequestration is inadequate to explain control by initiator-binding sites. J. Bacteriol. 170, 3554± 3560. Perez-Martin, J., Del, Solar G. H., Lurz, R., De la, Campa A. G., Dobrinski, B. & Espinosa, M. (1989). Induced bending of plasmid pLS1 by the plasmidencoded protein RepA. J. Biol. Chem. 264, 21334± 21339. Roth, A. & Messer, W. (1995). The DNA binding domain of the initiator protein DnaA. EMBO J. 14, 2106± 2111. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sasse-Dwight, S. & Gralla, J. D. (1991). Footprinting protein-DNA complexes in vivo. Methods Enzymol. 208, 146± 168. Schaefer, C. & Messer, W. (1991). DnaA protein/DNA interaction. Modulation of the recognition sequence. Mol. Gen. Genet. 226, 34 ± 40. Schaper, S. & Messer, W. (1995). Interaction of the initiator protein DnaA of Escherichia coli with its DNA target. J. Biol. Chem. 270, 17622± 17626. Schaper, S. & Messer, W. (1997). Prediction of the structure of the replication initiator protein DnaA. Proteins: Struct. Funct. Genet. 28, 1 ± 9. Schnos, M., Zahn, K., Inman, R. B. & Blattner, F. R. (1988). Initiation protein induced helix destabilization at the lambda origin: a prepriming step in DNA replication. Cell, 52, 385± 395.

Sekimizu, K., Bramhill, D. & Kornberg, A. (1987). ATP activates dnaA protein in initiating replication of plasmids bearing the origin of the E. coli chromosome. Cell, 50, 259± 265. Sekimizu, K., Bramhill, D. & Kornberg, A. (1988). Sequential early stages in the in vitro initiation of replication at the origin of the Escherichia coli chromosome. J. Biol. Chem. 263, 7124± 7130. Skarstad, K. & Boye, E. (1994). The initiator protein DnaA: evolution, properties and function. Biochim. Biophys. Acta, 1217, 111 ± 130. Spiess, E. & Lurz, R. (1988). Electron microscopic analysis of nucleic acids and nucleic acid-protein complexes. Methods Microbiol. 20, 293± 323. Su, W., Middleton, T., Sugden, B. & Echols, H. (1991). DNA looping between the origin of replication of Epstein-Barr virus and its enhancer site: stabilization of an origin complex with Epstein-Barr nuclear antigen 1. Proc. Natl Acad. Sci. USA, 88, 10870± 10874. Sutcliffe, J. G. (1978). Complete nucleotide sequence of the E. coli plasmid pBR322. Cold Spring Harbor Symp. Quant. Biol. 43, 77 ± 90. Tabor, S. & Richardson, C. C. (1985). A bacteriophage T7 RNA polymerase/promoter system for controlled exclusive expression of speci®c genes. Proc. Natl Acad. Sci. USA, 82, 1074± 1078. Umek, R. M. & Kowalski, D. (1988). The ease of DNA unwinding as a determinant of initiation at yeast replication origins. Cell, 52, 559± 567. Umek, R. M. & Kowalski, D. (1990). Thermal energy suppresses mutational defects in DNA unwinding at a yeast replication origin. Proc. Natl Acad. Sci. USA, 87, 2486± 2490. Woelker, B. & Messer, W. (1993). The structure of the initiation complex at the replication origin, oriC, of Escherichia coli. Nucl. Acids Res. 21, 5025± 5033. Wu, F., Goldberg, I. & Filutowicz, M. (1992). Roles of a 106± bp origin enhancer and Escherichia coli DnaA protein in replication of plasmid R6K. Nucl. Acids Res. 20, 811±817. Yoshikawa, H. & Ogasawara, N. (1991). Structure and function of DnaA and the DnaA-box in eubacteria: evolutionary relationships of bacterial replication origins. Mol. Microbiol. 5, 2589± 2597. Yoshikawa, H. & Wake, R. G. (1993). 36. Initiation and termination of chromosome replication. In Bacillus subtilis and Other Gram-Positive Bacteria: Biochemistry, Physiology, and Molecular Genetics (Sonenshein, A. L., Hoch, J. A. & Losick, R., eds), pp. 507± 528, ASM, Washington, D.C. Young, R. A. & Davis, R. W. (1983). Ef®cient isolation of genes by using antibody probes. Proc. Natl Acad. Sci. USA, 80, 1194. Zakrzewska-Czerwinska, J. & Schrempf, H. (1992). Characterization of an autonomously replicating region from the Streptomyces lividans chromosome. J. Bacteriol. 174, 2688± 2693.

Edited by T. Richmond (Received 20 May 1997; received in revised form 29 August 1997; accepted 5 September 1997)