- Email: [email protected]
Conditional transformation of immunoglobulin mutation pattern from gene conversion into point mutation by controlling XRCC3 expression in the DT40 B cell line
Journal of Bioscience and Bioengineering VOL. 109 No. 4, 407 – 410, 2010 www.elsevier.com/locate/jbiosc
NOTE
Conditional transformation of immunoglobulin mutation pattern from gene conversion into point mutation by controlling XRCC3 expression in the DT40 B cell line Masamichi Kajita, Masaki Magari, Kagefumi Todo, Naoki Kanayama,⁎ and Hitoshi Ohmori Department of Bioscience and Biotechnology, Graduate School of Natural Science and Technology, Okayama University, 3-1-1 Tsushima-Naka, Kita-Ku, Okayama 700-8530, Japan Received 4 September 2009; accepted 29 September 2009 Available online 27 October 2009
A hypermutating B cell line DT40 is useful for screening antibodies and improving affinity of the selected antibodies in vitro. To perform affinity maturation efficiently, we generated an engineered DT40 line whose immunoglobulin mutation pattern can be transformed from gene conversion into point mutation by conditional suppression of XRCC3 expression. © 2009, The Society for Biotechnology, Japan. All rights reserved. [Key words: Chicken B cell line; Point mutation; Gene conversion; Monoclonal antibody; XRCC3]
Monoclonal antibodies (mAbs) are used as excellent biopharmaceuticals, diagnostics and research reagents because of their high specificity for target antigens (Ags). To obtain desired mAbs efficiently, we have been developing a novel in vitro Ab generation system using a hypermutating chicken B cell line DT40 (1, 2). DT40 cells spontaneously undergo activation-induced cytidine deaminase (AID)-dependent hypermutation of immunoglobulin (Ig) genes, thereby constituting an Ab library during culture (3–6), from which various mAbs have been obtained (2, 7, 8). However, the selected Ag-specific DT40 clones alter their Ag-specificity during further treatment unless hypermutation machinery is shut down. To overcome this problem, we established an engineered DT40 line named DT40-SW, whose AID expression can be reversibly switched on and off by using a Cre-loxP system driven by an estrogen derivative, 4-hydroxytamoxyfen (4-OHT) (1). We have shown that Ag-specific mAb-producing clones were efficiently isolated from the DT40-SW library by panning with Ag-conjugated magnetic microbeads, and the Ag-specificity of them was genetically stabilized by switching off AID expression (2). Another advantage of the DT40-SW system is that selected Abs can be improved in their affinity for the target Ag through further rounds of mutation and selection, a process resembling to “affinity maturation” that occurs in vivo to generate high-affinity Abs (9). In the chicken, but not in the human and the mouse, the Ig variable region (IgV) genes are diversified predominantly by gene conversion, in which short sequences of upstream pseudo V genes are copied onto the IgV genes (10). While gene conversion occurs mainly during B cell development and in the early phase of the germinal center reaction, point mutation has been shown to contribute to affinity maturation in ⁎ Corresponding author. Tel./fax: +81 86 251 8198. E-mail address: [email protected] (N. Kanayama).
the later phase (10, 11). DT40 cells have been shown to mutate the IgV genes predominantly by gene conversion (3, 4). It has, however, been reported that gene conversion in DT40 can be transformed into point mutation by ablating the X-ray Repair Cross Complementing (XRCC) 2 or XRCC3 gene (12). The XRCC3 protein plays an important role in the repair of double strand breaks in DNA by homologous recombination (13). Although gene conversion is effective in expanding Ab repertoire, point mutation is considered to be more suitable for improving the selected Abs by affinity maturation. The aim of the present work is to generate a novel engineered DT40-SW line whose mutation pattern in the IgV gene can be conditionally transformed from gene conversion into point mutation by switching off XRCC3 expression. We tried to regulate XRCC3 expression conditionally using the tetracycline (tet)-repressible promoter system (14, 15). DT40 cells are genetically tractable because homologous recombination with introduced exogenous genes occurs with high frequency (16). Thus, we established a modified DT40-SW line, in which two endogenous chicken XRCC3 (cXRCC3) alleles were disrupted by homologous recombination and the exogenous human XRCC3 (hXRCC3) transgene regulated by the tet-promoter was introduced (Fig. 1). The hXRCC3 gene has been shown to be functional in DT40 cells (13). The strategy for generating the cell line is briefly shown in Fig. 1A. AID expression was kept off (AID-OFF) in DT40-SW cells all through the generation steps. Primers for PCR used in engineering the cells are listed in Table 1. KOD Plus DNA polymerase (TOYOBO, Osaka, Japan) was used for PCR amplification. The cXRCC3 alleles were disrupted by deleting the exon 6 with the targeting vector containing the histidinol dehydrogenase (his-D) gene or the blasticidin S resistant (bsr) gene (Fig. 1B). Genomic DNA fragments that contain the 5′- and 3′-flanking regions of the exon 6 of the cXRCC3 gene were amplified by PCR with primer pairs; XRCC3-9 and XRCC3-6, and XRCC3-7 and XRCC3-8, respectively.
1389-1723/$ - see front matter © 2009, The Society for Biotechnology, Japan. All rights reserved. doi:10.1016/j.jbiosc.2009.09.050
408
KAJITA ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Generation of DT40-SW-hXR, an engineered cell line whose XRCC3 expression can be controlled. (A) The strategy for generation of DT40-SW-hXR. (B) Disruption vectors for the cXRCC3 gene. The first allele of the cXRCC3 gene in DT40-SW cells was disrupted with the pXRCC3-his-D vector. The second allele in an XRCC3 heterozygous DT40-SW clone was disrupted with the construct pXRCC3-bsr. (C) Confirmation of heterozygous (+/−) and homozygous (−/−) disruption of the cXRCC3 gene by genomic PCR. Primer pairs used are shown as arrowheads in panel B. The genomic DNA of the IgL gene was amplified using primes CVLF-6 and CVLR-3 as the control. (D) Transcription of the chicken and human XRCC3 genes in DT40-SW-hXR cells. DT40-SW cells were used as the wild type control (WT). After culture of cells in a medium with or without 1 μg/ml Dox for 96 h, total RNA was extracted and used for RT-PCR. Transcription of the IgL gene was assessed using primers CCL5 and CCMVCVLR as the control.
PCR products were cloned into pCR-Blunt (Invitrogen, Carlsbad, CA, USA) and confirmed by sequence analysis. The cloned 5′- and 3′flanking regions of the cXRCC3 exon 6 were subcloned stepwise into pBluescript II SK(+), and the his-D or bsr gene was inserted between two flanking regions. The targeting vectors were designated pXRCC3his-D and pXRCC3-bsr, respectively. To establish tet-repressible expression of the XRCC3 gene in DT40-SW cells, we used Tet-Off gene expression system (Clontech, Mountain View, CA, USA). The xanthine-guanine phosphoribosyl transferase (gpt) gene flanked by two loxP sites (17) was inserted into the XhoI site of the pTet-Off vector which bears the tet-responsive transcriptional activator (tTA) gene, and the tTA gene construct was named pTet-OFF-gpt. The loxPflanked bsr gene derived from the pLoxBsr vector (18) was ligated
TABLE 1. Oligonucleotide primer sequences. Primer XRCC3-9 XRCC3-6 XRCC3-7 XRCC3-8 hXRCC3-1 hXRCC3-2 HIS-1 BSR-3 XRCC3-R2 XRCC3-14 XRCC3-15 TET-F TET-R CVLF-6 CVLR-3 CLL5 CCMVCVLR
Sequence (5′ to 3′) ACACTAGTACAGAAGATGCATTCCCAAG CCAGGATCCAAACAGACAGCATTAGAACAG TGCGGGATCCGAGAGTTGGAATGGAGATG AGCTCGAGGTGACGGTTCAGGTTG GTCGACAGCCCACCGACAAAATG GATATCTTCGGATGAGAAAGTGGAGC GCCGTGACCCTGCGCGTAAACGCCCTCAAGG CTGTGGTGTGACATAATTGGACAAACTACCTACAGAG AGTCCTCATGCTTGCAGGGTGGTGT CTCCACGGTGCCGTATCAGGACATG TTGGACCAGGATGCTATACTGCAGA CCCGAATTCATATGTCTAGATTAG CGCGGATCCTACCCACCGTACTCGTC CAGGAGCTCGCGGGGCCGTCACTGATTGCCG GCGCAAGCTTCCCCAGCCTGCCGCCAAGTCCAAG CGGCGTGGGGATCCACAGCTGCTGGGATT GGAGCCATCGATCACCCAATCCAC
into the XhoI site of the pTRE2hyg vector that contains the tetresponsible promoter. The cDNA fragment of the hXRCC3 gene (accession no. AF035586) was obtained from a human lung cancer cell line A549 by RT-PCR using a primer pair, hXRCC3-1 and hXRCC32, and inserted downstream of the tetO-minimal promoter of the modified pTRE2hyg vector. This tet-promoter–hXRCC3 gene construct was named pTRE2-hXRCC3-bsr. AID-OFF DT40-SW cells were first transfected with pXRCC3-his-D as described previously (1), and a histidinol-resistant clone with one allele of the cXRCC3 gene being disrupted was selected by genomic PCR with a primer pair, HIS-1 and XRCC3-R2 (designated as +/− in Fig. 1C). Then, the cXRCC3+/− mutant clone was transfected consecutively with pTet-OFF-gpt and pTRE2-hXRCC3-bsr, and selected in the media containing mycophenolic acid and blasticidin S, respectively. Drug-resistant clones were cultured for 96 h in the presence or absence of 1 μg/ml doxycyclin (Dox) (Sigma-Aldrich, St. Louis, MO, USA), and Dox-repressible expression of the hXRCC3 mRNA was confirmed by RT-PCR (data not shown). The loxP-flanked gpt and bsr genes in the tTA and hXRCC3 transgenes, respectively, were removed by treating transfected cells with 4-OHT, which activates the Cre-recombinase fused with mutant estrogen receptor (Cre-ER) that had been introduced into DT40-SW cells, thereby enabling to use these selectable markers again (1,18,19). Finally, the second cXRCC3 allele was disrupted with pXRCC3-bsr in a clone that displayed strict Dox-repressible expression of the hXRCC3 gene. This order of gene transfer was critical to avoid growth retardation due to the lack of XRCC3 expression (13). The successful targeted disruption of the second cXRCC3 gene was examined by genomic PCR using primers BSR-3 and XRCC3-R2 (Fig. 1C). Results of three representative clones 1, 2 and 3 were presented. In these cXRCC3−/− clones, expression of the tTA, cXRCC3, and hXRCC3 genes was examined by RT-PCR using primer pairs; TET-F and TET-R for the tTA gene; XRCC3-14 and XRCC3-15 for the cXRCC3 gene; hXRCC3-1
VOL. 109, 2010 and hXRCC3-2 for the hXRCC3 gene (Fig. 1D). The tTA gene was constitutively transcribed and the cXRCC3 mRNA was not produced under any conditions tested. On the other hand, the hXRCC3 gene was shown to be expressed in the absence of Dox but strictly repressed after addition of Dox (Fig. 1D). One of these three clones, DT40-SWhXR was chosen for further analysis. In DT40-SW cells, one AID allele was disrupted, and the other allele was replaced by the loxP-flanked AID cDNA that was linked tandem to IRES-GFP (Fig. 2A) (1). Thus, AID-expressing (AID-ON) DT40-SW cells simultaneously become positive for GFP expression and can be isolated by cell sorter (Fig. 2B). To examine whether Dox treatment can lead to the transformation of Ig gene conversion into point mutation, AID-OFF DT-40-SW-hXR cells were treated with 4-OHT to switch on AID expression as described (1). Single GFP-positive (AIDON) cells were sorted by using FACS Aria with Auto Cell Deposit Unit for single cell isolation (BD Bioscience, Mountain View, CA, USA) and cultured for 2 months in the presence or absence of 1 μg/ml of Dox. Mutation pattern in the rearranged IgV genes in the light chain locus (IgVL) was examined in these cultured DT-40-SW-hXR cells. cDNA was synthesized from total RNA of DT-40-SW-hXR cells. The IgVL genes were amplified by primers CLL5 and CCMVCVLR, cloned into pCR-Blunt, and sequenced with ABI PRISM 310 Genetic Analyzer
NOTE
409
(Applied Biosystems, Foster City, CA, USA). The nucleotide sequence of each IgVL clone was compared with that of the unmutated clone derived from the original AID-OFF DT40-SW cell line (accession no. AB193002). Mutations were found in 8 out of 54 analyzed IgVL clones isolated from DT40-SW-hXR cells cultured in the absence of Dox, and similarly in 9 out of 52 clones from cells in the presence of Dox. These mutations were classified into point mutation, gene conversion tracts or single-nucleotide substitutions that could be results of point mutation or gene conversion as described previously (12,17). In DT40SW-hXR cells that were cultured in the absence of Dox, gene conversion tracts were predominantly observed, suggesting that hXRCC3 expression was sufficient to functionally compensate disruption of the endogenous cXRCC3 gene (Fig. 2C). On the other hand, almost all mutations were changed to point mutation in the cells cultured in the presence of Dox in which hXRCC3 expression was suppressed. These results clearly indicate that the pattern of hypermutation in DT-40-SW-hXR cells can be transformed from gene conversion into point mutation conditionally by treating with Dox. A novel DT40 line, DT40-SW-hXR that we generated here is useful for altering the mutation pattern from gene conversion into point mutation when it is necessary. Gene conversion generates a wide range of Ab repertoire, from which desired mAbs can be screened. On
FIG. 2. Mutation pattern in the IgVL genes of DT-40-SW-hXR cells after switching on AID expression. (A) Switching of AID expression by the use of the 4-OHT-regulated Cre-loxP system. The AID cDNA is placed in tandem with IRES-GFP between two loxP sites that are in the opposite direction each other. The loxP-flanked genes are inverted by the action of the Cre-ER activated with 4-OHT. (B) Cell sorting of AID-ON and AID-OFF cells. After treatment of DT-40-SW-hXR cells with 4-OHT, GFP+ (AID-ON) and GFP− (AID-OFF) cells were sorted, respectively and cultured with or without Dox. (C) Comparison of mutation pattern in the IgVL genes from DT-40-SW-hXR cells cultured in the presence and absence of Dox. Horizontal lines represent the IgVL genes with mutations. Point mutation, gene conversion tract, and single-nucleotide substitution are indicated as lollipop shape, thick horizontal bar above line, and vertical bar, respectively.
410
KAJITA ET AL.
the other hand, point mutation will contribute to affinity maturation of selected clones more effectively. Thus, the device for switching gene conversion into point mutation in affinity maturation may be useful for generating high-affinity mAbs. The sequence data described here have been submitted to the DDBJ/EMBL/GenBank databases under accession nos. AB519244– AB519260. ACKNOWLEDGMENTS We thank Dr. H. Arakawa (GSF National Research Center for Environment and Health, Neuherverg-Munich, Germany) for the loxP-flanked gpt and bsr genes, and Dr. M. Takata (Kyoto University, Kyoto, Japan) for gene constructs and related information of the cXRCC3 gene. This work was supported in part by Grants from Japan Science and Technology Agency (JST) and from New Energy and Industrial Technology Development Organization (NEDO). References 1. Kanayama, N., Todo, K., Reth, M., and Ohmori, H.: Reversible switching of immunoglobulin hypermutation machinery in a chicken B cell line, Biochem. Biophys. Res. Commun., 327, 70–75 (2005). 2. Todo, K., Miyake, K., Magari, M., Kanayama, N., and Ohmori, H.: Novel in vitro screening system for monoclonal antibodies using hypermutating chicken B cell library, J. Biosci. Bioeng., 102, 478–481 (2006). 3. Kim, S., Humphries, E. H., Tjoelker, L., Carlson, L., and Thompson, C. B.: Ongoing diversification of the rearranged immunoglobulin light-chain gene in a bursal lymphoma cell line, Mol. Cell. Biol., 10, 3224–3231 (1990). 4. Buerstedde, J. M., Reynaud, C. A., Humphries, E. H., Olson, W., Ewert, D. L., and Weill, J. C.: Light chain gene conversion continues at high rate in an ALV-induced cell line, EMBO J., 9, 921–927 (1990). 5. Arakawa, H., Hauschild, J., and Buerstedde, J. M.: Requirement of the activationinduced deaminase (AID) gene for immunoglobulin gene conversion, Science, 295, 1301–1306 (2002).
J. BIOSCI. BIOENG., 6. Harris, R. S., Sale, J. E., Petersen-Mahrt, S. K., and Neuberger, M. S.: AID is essential for immunoglobulin V gene conversion in a cultured B cell line, Curr. Biol., 12, 435–438 (2002). 7. Cumbers, S. J., Williams, G. T., Davies, S. L., Grenfell, R. L., Takeda, S., Batista, F. D., Sale, J. E., and Neuberger, M. S.: Generation and iterative affinity maturation of antibodies in vitro using hypermutating B-cell lines, Nat. Biotechnol., 20, 1129–1134 (2002). 8. Seo, H., Masuoka, M., Murofushi, H., Takeda, S., Shibata, T., and Ohta, K.: Rapid generation of specific antibodies by enhanced homologous recombination, Nat. Biotechnol., 23, 731–735 (2005). 9. Rajewsky, K.: Clonal selection and learning in the antibody system, Nature, 381, 751–758 (1996). 10. Arakawa, H. and Buerstedde, J. M.: Immunoglobulin gene conversion: insights from bursal B cells and the DT40 cell line, Dev. Dyn., 229, 458–464 (2004). 11. Arakawa, H., Kuma, K., Yasuda, M., Furusawa, S., Ekino, S., and Yamagishi, H.: Oligoclonal development of B cells bearing discrete Ig chains in chicken single germinal centers, J. Immunol., 160, 4232–4241 (1998). 12. Sale, J. E., Calandrini, D. M., Takata, M., Takeda, S., and Neuberger, M. S.: Ablation of XRCC2/3 transforms immunoglobulin V gene conversion into somatic hypermutation, Nature, 412, 921–926 (2001). 13. Takata, M., Sasaki, M. S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D., Thompson, L. H., and Takeda, S.: Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs, Mol. Cell. Biol., 21, 2858–2866 (2001). 14. Wang, J., Takagaki, Y., and Manley, J. L.: Targeted disruption of an essential vertebrate gene: ASF/SF2 is required for cell viability, Genes Dev., 10, 2588–2599 (1996). 15. Gossen, M. and Bujard, H.: Tight control of gene expression in mammalian cells by etracycline-responsive promoters, Proc. Natl. Acad. Sci. USA, 89, 5547–5551 (1992). 16. Buerstedde, J. M. and Takeda, S.: Increased ratio of targeted to random integration after transfection of chicken B cell lines, Cell, 67, 179–188 (1991). 17. Arakawa, H., Saribasak, H., and Buerstedde, J. M.: Activation-induced cytidine deaminase initiates immunoglobulin gene conversion and hypermutation by a common intermediate, PLoS Biol., 2, E179 (2004). 18. Arakawa, H., Lodygin, D., and Buerstedde, J. M.: Mutant loxP vectors for selectable marker recycle and conditional knock-outs, BMC Biotechnol., 1, 7 (2001). 19. Zhang, Y., Riesterer, C., Ayrall, A. M., Sablitzky, F., Littlewood, T. D., and Reth, M.: Inducible site-directed recombination in mouse embryonic stem cells, Nucleic Acids Res., 24, 543–548 (1996).
NOTE
Conditional transformation of immunoglobulin mutation pattern from gene conversion into point mutation by controlling XRCC3 expression in the DT40 B cell line Masamichi Kajita, Masaki Magari, Kagefumi Todo, Naoki Kanayama,⁎ and Hitoshi Ohmori Department of Bioscience and Biotechnology, Graduate School of Natural Science and Technology, Okayama University, 3-1-1 Tsushima-Naka, Kita-Ku, Okayama 700-8530, Japan Received 4 September 2009; accepted 29 September 2009 Available online 27 October 2009
A hypermutating B cell line DT40 is useful for screening antibodies and improving affinity of the selected antibodies in vitro. To perform affinity maturation efficiently, we generated an engineered DT40 line whose immunoglobulin mutation pattern can be transformed from gene conversion into point mutation by conditional suppression of XRCC3 expression. © 2009, The Society for Biotechnology, Japan. All rights reserved. [Key words: Chicken B cell line; Point mutation; Gene conversion; Monoclonal antibody; XRCC3]
Monoclonal antibodies (mAbs) are used as excellent biopharmaceuticals, diagnostics and research reagents because of their high specificity for target antigens (Ags). To obtain desired mAbs efficiently, we have been developing a novel in vitro Ab generation system using a hypermutating chicken B cell line DT40 (1, 2). DT40 cells spontaneously undergo activation-induced cytidine deaminase (AID)-dependent hypermutation of immunoglobulin (Ig) genes, thereby constituting an Ab library during culture (3–6), from which various mAbs have been obtained (2, 7, 8). However, the selected Ag-specific DT40 clones alter their Ag-specificity during further treatment unless hypermutation machinery is shut down. To overcome this problem, we established an engineered DT40 line named DT40-SW, whose AID expression can be reversibly switched on and off by using a Cre-loxP system driven by an estrogen derivative, 4-hydroxytamoxyfen (4-OHT) (1). We have shown that Ag-specific mAb-producing clones were efficiently isolated from the DT40-SW library by panning with Ag-conjugated magnetic microbeads, and the Ag-specificity of them was genetically stabilized by switching off AID expression (2). Another advantage of the DT40-SW system is that selected Abs can be improved in their affinity for the target Ag through further rounds of mutation and selection, a process resembling to “affinity maturation” that occurs in vivo to generate high-affinity Abs (9). In the chicken, but not in the human and the mouse, the Ig variable region (IgV) genes are diversified predominantly by gene conversion, in which short sequences of upstream pseudo V genes are copied onto the IgV genes (10). While gene conversion occurs mainly during B cell development and in the early phase of the germinal center reaction, point mutation has been shown to contribute to affinity maturation in ⁎ Corresponding author. Tel./fax: +81 86 251 8198. E-mail address: [email protected] (N. Kanayama).
the later phase (10, 11). DT40 cells have been shown to mutate the IgV genes predominantly by gene conversion (3, 4). It has, however, been reported that gene conversion in DT40 can be transformed into point mutation by ablating the X-ray Repair Cross Complementing (XRCC) 2 or XRCC3 gene (12). The XRCC3 protein plays an important role in the repair of double strand breaks in DNA by homologous recombination (13). Although gene conversion is effective in expanding Ab repertoire, point mutation is considered to be more suitable for improving the selected Abs by affinity maturation. The aim of the present work is to generate a novel engineered DT40-SW line whose mutation pattern in the IgV gene can be conditionally transformed from gene conversion into point mutation by switching off XRCC3 expression. We tried to regulate XRCC3 expression conditionally using the tetracycline (tet)-repressible promoter system (14, 15). DT40 cells are genetically tractable because homologous recombination with introduced exogenous genes occurs with high frequency (16). Thus, we established a modified DT40-SW line, in which two endogenous chicken XRCC3 (cXRCC3) alleles were disrupted by homologous recombination and the exogenous human XRCC3 (hXRCC3) transgene regulated by the tet-promoter was introduced (Fig. 1). The hXRCC3 gene has been shown to be functional in DT40 cells (13). The strategy for generating the cell line is briefly shown in Fig. 1A. AID expression was kept off (AID-OFF) in DT40-SW cells all through the generation steps. Primers for PCR used in engineering the cells are listed in Table 1. KOD Plus DNA polymerase (TOYOBO, Osaka, Japan) was used for PCR amplification. The cXRCC3 alleles were disrupted by deleting the exon 6 with the targeting vector containing the histidinol dehydrogenase (his-D) gene or the blasticidin S resistant (bsr) gene (Fig. 1B). Genomic DNA fragments that contain the 5′- and 3′-flanking regions of the exon 6 of the cXRCC3 gene were amplified by PCR with primer pairs; XRCC3-9 and XRCC3-6, and XRCC3-7 and XRCC3-8, respectively.
1389-1723/$ - see front matter © 2009, The Society for Biotechnology, Japan. All rights reserved. doi:10.1016/j.jbiosc.2009.09.050
408
KAJITA ET AL.
J. BIOSCI. BIOENG.,
FIG. 1. Generation of DT40-SW-hXR, an engineered cell line whose XRCC3 expression can be controlled. (A) The strategy for generation of DT40-SW-hXR. (B) Disruption vectors for the cXRCC3 gene. The first allele of the cXRCC3 gene in DT40-SW cells was disrupted with the pXRCC3-his-D vector. The second allele in an XRCC3 heterozygous DT40-SW clone was disrupted with the construct pXRCC3-bsr. (C) Confirmation of heterozygous (+/−) and homozygous (−/−) disruption of the cXRCC3 gene by genomic PCR. Primer pairs used are shown as arrowheads in panel B. The genomic DNA of the IgL gene was amplified using primes CVLF-6 and CVLR-3 as the control. (D) Transcription of the chicken and human XRCC3 genes in DT40-SW-hXR cells. DT40-SW cells were used as the wild type control (WT). After culture of cells in a medium with or without 1 μg/ml Dox for 96 h, total RNA was extracted and used for RT-PCR. Transcription of the IgL gene was assessed using primers CCL5 and CCMVCVLR as the control.
PCR products were cloned into pCR-Blunt (Invitrogen, Carlsbad, CA, USA) and confirmed by sequence analysis. The cloned 5′- and 3′flanking regions of the cXRCC3 exon 6 were subcloned stepwise into pBluescript II SK(+), and the his-D or bsr gene was inserted between two flanking regions. The targeting vectors were designated pXRCC3his-D and pXRCC3-bsr, respectively. To establish tet-repressible expression of the XRCC3 gene in DT40-SW cells, we used Tet-Off gene expression system (Clontech, Mountain View, CA, USA). The xanthine-guanine phosphoribosyl transferase (gpt) gene flanked by two loxP sites (17) was inserted into the XhoI site of the pTet-Off vector which bears the tet-responsive transcriptional activator (tTA) gene, and the tTA gene construct was named pTet-OFF-gpt. The loxPflanked bsr gene derived from the pLoxBsr vector (18) was ligated
TABLE 1. Oligonucleotide primer sequences. Primer XRCC3-9 XRCC3-6 XRCC3-7 XRCC3-8 hXRCC3-1 hXRCC3-2 HIS-1 BSR-3 XRCC3-R2 XRCC3-14 XRCC3-15 TET-F TET-R CVLF-6 CVLR-3 CLL5 CCMVCVLR
Sequence (5′ to 3′) ACACTAGTACAGAAGATGCATTCCCAAG CCAGGATCCAAACAGACAGCATTAGAACAG TGCGGGATCCGAGAGTTGGAATGGAGATG AGCTCGAGGTGACGGTTCAGGTTG GTCGACAGCCCACCGACAAAATG GATATCTTCGGATGAGAAAGTGGAGC GCCGTGACCCTGCGCGTAAACGCCCTCAAGG CTGTGGTGTGACATAATTGGACAAACTACCTACAGAG AGTCCTCATGCTTGCAGGGTGGTGT CTCCACGGTGCCGTATCAGGACATG TTGGACCAGGATGCTATACTGCAGA CCCGAATTCATATGTCTAGATTAG CGCGGATCCTACCCACCGTACTCGTC CAGGAGCTCGCGGGGCCGTCACTGATTGCCG GCGCAAGCTTCCCCAGCCTGCCGCCAAGTCCAAG CGGCGTGGGGATCCACAGCTGCTGGGATT GGAGCCATCGATCACCCAATCCAC
into the XhoI site of the pTRE2hyg vector that contains the tetresponsible promoter. The cDNA fragment of the hXRCC3 gene (accession no. AF035586) was obtained from a human lung cancer cell line A549 by RT-PCR using a primer pair, hXRCC3-1 and hXRCC32, and inserted downstream of the tetO-minimal promoter of the modified pTRE2hyg vector. This tet-promoter–hXRCC3 gene construct was named pTRE2-hXRCC3-bsr. AID-OFF DT40-SW cells were first transfected with pXRCC3-his-D as described previously (1), and a histidinol-resistant clone with one allele of the cXRCC3 gene being disrupted was selected by genomic PCR with a primer pair, HIS-1 and XRCC3-R2 (designated as +/− in Fig. 1C). Then, the cXRCC3+/− mutant clone was transfected consecutively with pTet-OFF-gpt and pTRE2-hXRCC3-bsr, and selected in the media containing mycophenolic acid and blasticidin S, respectively. Drug-resistant clones were cultured for 96 h in the presence or absence of 1 μg/ml doxycyclin (Dox) (Sigma-Aldrich, St. Louis, MO, USA), and Dox-repressible expression of the hXRCC3 mRNA was confirmed by RT-PCR (data not shown). The loxP-flanked gpt and bsr genes in the tTA and hXRCC3 transgenes, respectively, were removed by treating transfected cells with 4-OHT, which activates the Cre-recombinase fused with mutant estrogen receptor (Cre-ER) that had been introduced into DT40-SW cells, thereby enabling to use these selectable markers again (1,18,19). Finally, the second cXRCC3 allele was disrupted with pXRCC3-bsr in a clone that displayed strict Dox-repressible expression of the hXRCC3 gene. This order of gene transfer was critical to avoid growth retardation due to the lack of XRCC3 expression (13). The successful targeted disruption of the second cXRCC3 gene was examined by genomic PCR using primers BSR-3 and XRCC3-R2 (Fig. 1C). Results of three representative clones 1, 2 and 3 were presented. In these cXRCC3−/− clones, expression of the tTA, cXRCC3, and hXRCC3 genes was examined by RT-PCR using primer pairs; TET-F and TET-R for the tTA gene; XRCC3-14 and XRCC3-15 for the cXRCC3 gene; hXRCC3-1
VOL. 109, 2010 and hXRCC3-2 for the hXRCC3 gene (Fig. 1D). The tTA gene was constitutively transcribed and the cXRCC3 mRNA was not produced under any conditions tested. On the other hand, the hXRCC3 gene was shown to be expressed in the absence of Dox but strictly repressed after addition of Dox (Fig. 1D). One of these three clones, DT40-SWhXR was chosen for further analysis. In DT40-SW cells, one AID allele was disrupted, and the other allele was replaced by the loxP-flanked AID cDNA that was linked tandem to IRES-GFP (Fig. 2A) (1). Thus, AID-expressing (AID-ON) DT40-SW cells simultaneously become positive for GFP expression and can be isolated by cell sorter (Fig. 2B). To examine whether Dox treatment can lead to the transformation of Ig gene conversion into point mutation, AID-OFF DT-40-SW-hXR cells were treated with 4-OHT to switch on AID expression as described (1). Single GFP-positive (AIDON) cells were sorted by using FACS Aria with Auto Cell Deposit Unit for single cell isolation (BD Bioscience, Mountain View, CA, USA) and cultured for 2 months in the presence or absence of 1 μg/ml of Dox. Mutation pattern in the rearranged IgV genes in the light chain locus (IgVL) was examined in these cultured DT-40-SW-hXR cells. cDNA was synthesized from total RNA of DT-40-SW-hXR cells. The IgVL genes were amplified by primers CLL5 and CCMVCVLR, cloned into pCR-Blunt, and sequenced with ABI PRISM 310 Genetic Analyzer
NOTE
409
(Applied Biosystems, Foster City, CA, USA). The nucleotide sequence of each IgVL clone was compared with that of the unmutated clone derived from the original AID-OFF DT40-SW cell line (accession no. AB193002). Mutations were found in 8 out of 54 analyzed IgVL clones isolated from DT40-SW-hXR cells cultured in the absence of Dox, and similarly in 9 out of 52 clones from cells in the presence of Dox. These mutations were classified into point mutation, gene conversion tracts or single-nucleotide substitutions that could be results of point mutation or gene conversion as described previously (12,17). In DT40SW-hXR cells that were cultured in the absence of Dox, gene conversion tracts were predominantly observed, suggesting that hXRCC3 expression was sufficient to functionally compensate disruption of the endogenous cXRCC3 gene (Fig. 2C). On the other hand, almost all mutations were changed to point mutation in the cells cultured in the presence of Dox in which hXRCC3 expression was suppressed. These results clearly indicate that the pattern of hypermutation in DT-40-SW-hXR cells can be transformed from gene conversion into point mutation conditionally by treating with Dox. A novel DT40 line, DT40-SW-hXR that we generated here is useful for altering the mutation pattern from gene conversion into point mutation when it is necessary. Gene conversion generates a wide range of Ab repertoire, from which desired mAbs can be screened. On
FIG. 2. Mutation pattern in the IgVL genes of DT-40-SW-hXR cells after switching on AID expression. (A) Switching of AID expression by the use of the 4-OHT-regulated Cre-loxP system. The AID cDNA is placed in tandem with IRES-GFP between two loxP sites that are in the opposite direction each other. The loxP-flanked genes are inverted by the action of the Cre-ER activated with 4-OHT. (B) Cell sorting of AID-ON and AID-OFF cells. After treatment of DT-40-SW-hXR cells with 4-OHT, GFP+ (AID-ON) and GFP− (AID-OFF) cells were sorted, respectively and cultured with or without Dox. (C) Comparison of mutation pattern in the IgVL genes from DT-40-SW-hXR cells cultured in the presence and absence of Dox. Horizontal lines represent the IgVL genes with mutations. Point mutation, gene conversion tract, and single-nucleotide substitution are indicated as lollipop shape, thick horizontal bar above line, and vertical bar, respectively.
410
KAJITA ET AL.
the other hand, point mutation will contribute to affinity maturation of selected clones more effectively. Thus, the device for switching gene conversion into point mutation in affinity maturation may be useful for generating high-affinity mAbs. The sequence data described here have been submitted to the DDBJ/EMBL/GenBank databases under accession nos. AB519244– AB519260. ACKNOWLEDGMENTS We thank Dr. H. Arakawa (GSF National Research Center for Environment and Health, Neuherverg-Munich, Germany) for the loxP-flanked gpt and bsr genes, and Dr. M. Takata (Kyoto University, Kyoto, Japan) for gene constructs and related information of the cXRCC3 gene. This work was supported in part by Grants from Japan Science and Technology Agency (JST) and from New Energy and Industrial Technology Development Organization (NEDO). References 1. Kanayama, N., Todo, K., Reth, M., and Ohmori, H.: Reversible switching of immunoglobulin hypermutation machinery in a chicken B cell line, Biochem. Biophys. Res. Commun., 327, 70–75 (2005). 2. Todo, K., Miyake, K., Magari, M., Kanayama, N., and Ohmori, H.: Novel in vitro screening system for monoclonal antibodies using hypermutating chicken B cell library, J. Biosci. Bioeng., 102, 478–481 (2006). 3. Kim, S., Humphries, E. H., Tjoelker, L., Carlson, L., and Thompson, C. B.: Ongoing diversification of the rearranged immunoglobulin light-chain gene in a bursal lymphoma cell line, Mol. Cell. Biol., 10, 3224–3231 (1990). 4. Buerstedde, J. M., Reynaud, C. A., Humphries, E. H., Olson, W., Ewert, D. L., and Weill, J. C.: Light chain gene conversion continues at high rate in an ALV-induced cell line, EMBO J., 9, 921–927 (1990). 5. Arakawa, H., Hauschild, J., and Buerstedde, J. M.: Requirement of the activationinduced deaminase (AID) gene for immunoglobulin gene conversion, Science, 295, 1301–1306 (2002).
J. BIOSCI. BIOENG., 6. Harris, R. S., Sale, J. E., Petersen-Mahrt, S. K., and Neuberger, M. S.: AID is essential for immunoglobulin V gene conversion in a cultured B cell line, Curr. Biol., 12, 435–438 (2002). 7. Cumbers, S. J., Williams, G. T., Davies, S. L., Grenfell, R. L., Takeda, S., Batista, F. D., Sale, J. E., and Neuberger, M. S.: Generation and iterative affinity maturation of antibodies in vitro using hypermutating B-cell lines, Nat. Biotechnol., 20, 1129–1134 (2002). 8. Seo, H., Masuoka, M., Murofushi, H., Takeda, S., Shibata, T., and Ohta, K.: Rapid generation of specific antibodies by enhanced homologous recombination, Nat. Biotechnol., 23, 731–735 (2005). 9. Rajewsky, K.: Clonal selection and learning in the antibody system, Nature, 381, 751–758 (1996). 10. Arakawa, H. and Buerstedde, J. M.: Immunoglobulin gene conversion: insights from bursal B cells and the DT40 cell line, Dev. Dyn., 229, 458–464 (2004). 11. Arakawa, H., Kuma, K., Yasuda, M., Furusawa, S., Ekino, S., and Yamagishi, H.: Oligoclonal development of B cells bearing discrete Ig chains in chicken single germinal centers, J. Immunol., 160, 4232–4241 (1998). 12. Sale, J. E., Calandrini, D. M., Takata, M., Takeda, S., and Neuberger, M. S.: Ablation of XRCC2/3 transforms immunoglobulin V gene conversion into somatic hypermutation, Nature, 412, 921–926 (2001). 13. Takata, M., Sasaki, M. S., Tachiiri, S., Fukushima, T., Sonoda, E., Schild, D., Thompson, L. H., and Takeda, S.: Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs, Mol. Cell. Biol., 21, 2858–2866 (2001). 14. Wang, J., Takagaki, Y., and Manley, J. L.: Targeted disruption of an essential vertebrate gene: ASF/SF2 is required for cell viability, Genes Dev., 10, 2588–2599 (1996). 15. Gossen, M. and Bujard, H.: Tight control of gene expression in mammalian cells by etracycline-responsive promoters, Proc. Natl. Acad. Sci. USA, 89, 5547–5551 (1992). 16. Buerstedde, J. M. and Takeda, S.: Increased ratio of targeted to random integration after transfection of chicken B cell lines, Cell, 67, 179–188 (1991). 17. Arakawa, H., Saribasak, H., and Buerstedde, J. M.: Activation-induced cytidine deaminase initiates immunoglobulin gene conversion and hypermutation by a common intermediate, PLoS Biol., 2, E179 (2004). 18. Arakawa, H., Lodygin, D., and Buerstedde, J. M.: Mutant loxP vectors for selectable marker recycle and conditional knock-outs, BMC Biotechnol., 1, 7 (2001). 19. Zhang, Y., Riesterer, C., Ayrall, A. M., Sablitzky, F., Littlewood, T. D., and Reth, M.: Inducible site-directed recombination in mouse embryonic stem cells, Nucleic Acids Res., 24, 543–548 (1996).