- Email: [email protected]
Configuration of β-globin messenger RNA in rabbit reticulocytes
J. Mol. Riol. (l!M4) 178, 881-896
Configuration of P-Globin Messenger RNA in Rabbit Reticulocytes Identification GLENN
of Sites Exposed to Endogenous AI,HRECHT,
ANNA
KROWCZYNSKA
and Exogenous
ASD CIWRGE
Nucleases
BRAWERMAN
of Riochemirtry and Tufts 1‘niversity School of
Departm,ent 136 Harrison
Avenue, (Received
Pharmacology Medicine Boston, MA 0217 I. C’.A\.A . 27 May
7984)
Masked and exposed sites in rabbit fi-globin rnessenger RXA were identified through 8, nuclease mapping of RiYase T, cleavage sites. Sites exposed to this enzyme were compared in deproteinized polysomal Rh’A and in mRNA in its native configuration in reticulocyte extracts. The analysis showed that most of t)he 3’ non-coding region is well accessible to the enzyme, both in deproteinized RSA and in the cell extract. A possible protecting function for the poly(A) sequence is suggested by the fact that molecules with very short poly(A) segments were cleaved preferentially in this region. The G residues in the 5’ non-coding region were inaccessible to RNase T,. A highly sensitive site adjacent to the initiation AUC codon was evident in the deproteinized RSA. This site was far less accessible to the enzyme in the mRPr’A associated with ribosomes in the cell extract. The first 150 nueleotidcs in the coding region showed very little susceptibility to digestion by t,hr enzyme. in deproteinized R?u’A as well as in the c+rll extracts. Preparations of untreated mRl\jA showed the occurrence of truncated molecules, apparently generated by cleavage by endogenous nucleases. These cleavages were most prevalent, in the two non-coding regions. They occurred at sites containing A-U sequences in the 3’ non-coding region, and at sites with different sequences in the 5’ non-coding region. Incubation of cell extracts at 37°C did not cause any increase in these endogenous cleavages. It is suggested that they may have been generated in the intact cells. possibly as part of the mRSA degradation process in maturing ret,irulocytes.
1. Introduction The processes concerned with the biogenesis, translation and breakdown of messenger RiYA require the interaction of specific sites on the RXA with other macromolecules. Thus, accessibility of these sites in the cell must play an important role in the control of these processes. Messenger RNA molecules can differ greatly with respect to efficiency of translation and metabolic stabilit) (l,odish, 1971; Sonenshein & Krawerman, 1976: Nevins, 1983). The nature of the factors responsible for these differences is poorly understood. Knowledge of R,XA 002%- 2836:84/280881-16
$0%.00/O
XXI
N; 19X1 Acadrmic
Press Inc. (Lortdo~l) Ltd.
HHL’
i;
\i,liI:~;(‘tl’l’
L.‘T
,I /,
(~olrligrrr~al ion iir intliviclrrnl rrr RNA strec~it3 ant1 ifr t trcbir t~r~~~u~sorb shorrttl f,r.c,vittc~ iirsigtrt into tflcl (~xtr~rri to nhicsh 1his (~o~~fi~rrr;\ti(rn tlrt~~rrrrinr~x t IIP cti\-c~t~;iit~~irk f~outtl also sllf~tl tight oI1 t tIv Ililt ,Irf’ ot’ t tlfz m I< SAI trrhrrvior. Srrc*tr kllO\Vtettgf~ irrtc~ritc~tions c*onc~r~rrrcdwith rnK NX function. Atittit ionat nrrttc~rstirnttirrg c~,uttt t)(. tlerivtd f’rom thra id~ntificat~iorr of’ c~1ea.vq.y~ that take place in the (~11 1~st);rrt of t hf, t)rYrr’essf’s r~orr(~r~rirfd with rn RNA maturation in the nucalrus arrtt tlPgKltl;~tic~ll in the c~ytoptastn. T’rGsr knowledge of mRN’A c-orrfigurdion is very limited. Pavlakis pt al. (1980) huvr investigat~etl the secondary structure of the r- and P-gtohin rnRS.As of mouse and rahhit t)y identifying &es f~xposett to nucteascs in purified rnotr~cutrs tatrf+d at the 5’ t~errninus wit’h radioac+t~ive phosphate. These studies ted to the suggestioil that the ttegrt~(~ of a,cc*cssit)itity to the initial Ali(: codon could TV respnsibtr for t.hc tiifferc~nc*es in initiation eflic:ienc*y between t hc, x- and /II-gtohin rnKXA species. This approach rquircas purified prqrarations c~ontaining a sin@ rn RNA specir~s. ant1 caanrrot rc>vrd st.ructural features that ma)- exist only in ttrr mRXA as it or*r’urs in tht, wII, prior to deprol,rinizat,ion. Patt~on M (‘hae (1983) have ovr’r(+orrlc~ this difficulty to some rxtcnt by int reducing thr, USP of doncd DSX prohrs spdfic for individual rnRKA spe&!s. This permits the arralysis of a given mRSA without having t,o tleproteiniz~~ it and srparst’r it from other species. The latter procrtlurr~ involves extensivcb rruclcas~ digrstion of’ cytoptasmic particles bearing the rnRN.4 ant1 itlr~nt~ificatiorr of Ihe RNA segments that arc’ prott~ctrtl in the partidrs. This analysis showed that thrl ritrosomes associated with the chicken P-gtohin rnRNr\ RNA segmcmts extending 12 riudeotides upstream from t hr. in potysomes protect initial AL:(:. This procedure, however. does not reveal individual cleavage sites. ant1 seems unsuitable for tine structure analysis. Arrothfsr produre. that involves limited fragmentation of thr RNA and clsterrsiorr of labeled primers complementary to spedic regions of the RXLA permits t)he ittentificat,ion of individual cleavage sitf+i (Qu rt II/.. 19X3). LVr have developed a procdure that also uses cloned comptPmentar~ t)iKA prohcs. ant1 that permits thr identification of individual cleavagt~ sites ohtainrtl t,- limited nucteasr digestion of the mRXA or of cy,-toplasmic> particles hearing the, rnR,I’A. Thr, RX.-! fragments otrtained in this fashion are annealed to end-laheted DSA probes and ttlf) tij-t)ritts m-f‘ digested with S, nuctease to remorc sing+stranded I)SA segments rrol c~~\-r~r~d try RNA. This procedure was applied to thr, study of rahtrit /I-gtohirr m RNA. The psr~nt results indicate that the 5’.t)errninal region of the mRSA r~hairrs is rt~atlil~ draved by RXase T,, both in drproteinizecl RX.4 and in the mRS.4 as it exists itr thr retic~ulocy+r~ tysat’e. The other end of the mRNA contains few sitrs at~cessitrt~~ to this cay,-rnc. hut has one highly sensitive site next to t hcs initiation Al’(: cdorr. The analJ.sis also indicated that RNA chains with very short ply(A) segments a,ppear to he c~teavetl preferentially. \Z’e also observed that thr rnRXA4 derivrtl from pot~somes csotrtains a small population of fragmented molec~ules. These appeared to have hren protluc~l 113 clravLtges at spcific~ sites. toc*atrtl primarily in thp two non-coding regions. Thfl cleavages in the 3’ notr-cdin g region appear4 to tw dirrctrd at A-l’ sequrnces. The significance of thesrl endogrnous cleavages and t,heir possible relation to the process of mRNA degradation during reticulocyte maturation are discussed.
(‘ONFORMATION
OF RAlSIIIT
/j-GLOH1S
mliSA
8X3
2. Materials and Methods (a) Preparation
of retitulocyte
lysate and polysomal
RX4
Reticulocytes were obtained from white Xew Zealand long-eared rabbits made anemic with phenylhydrazine, as described by Pelham & ,Jackson (1976). The cells were washed twicxr with saline and lysed with 0.5 vol. water. The Igsate was cleared by centrifugation Polysomes were prepared from portions of the lysatr byand stored at -70°C. c,entrifugation at 36.000 revs/min for 40 min in the Beckman rotor T40. using a 4 ml caushion of 209, (w/v) sucrose. .50 rnnl-Tris. HCI (pH 7.6). 1 mM-?uIgCX, in g-ml centrifuge tubes. I’olysomal KSA was extracted from the ppllrt by the alkaline phenol extraction ~wowtiure ((ieoghegan sf al.. 1978). (h) Fragmentation
of m KAYA
Samples of lgsate (40 ~1) were incubated in a total volume of lOO@ of solution 20 mM-HEPES (S-2-hydroxyethyl-piperazine-N’-Cethanesulfonic acid) containing (pH 7.(J), 80 rnx-KU, 0.5 mM-MgCl,. 50 pg cycloheximide/ml. The incubations were at 3’7”(’ for 10 min. in the presence or absence of R,P;ase T,. Polysomes were isolated from the incubation mixtures as described above. and were used for the preparation of polysomal RNA. For the fragmentation of deproteinized RS&\. polysomal RXA isolated from untreated lysatr was incubated under t,he same conditions, but without cycloheximide, at, a concentration of 20 pg/lOO ~1; 5 pg yeast transfer RNA/100 ~1 was included in the polysomal RSA incubation. The reactions were terminated by addition of 10 ~1 1 u-Tris. HC’I (pH 9.0). 2.5 ~1 20°, (n/v) sodium dodecay sulfate. The mixtures were extracted first with phenol. then nit,h phenol/chloroform (1 : 1. v/v). and finally with ether to remove the phenol from the aqueous phase. The RSA was precipitated by adjusting the salt c*onc*rntration to 0,3 M-SOtiillIII acetate. adding 2.5 vol. ethanol and keeping overnight at -2OY’. Portions of the deproteinizrd preparations were subjected to chromatography on oligo(dT)-cellulose. in order to obtain the poly(A)-deficaient components. The samples were adsorbed in 200 rnM-XaCI, 10 mM-Tris’ HCI (pH 7.6). .5 m,n-MpCl,. O.l(?& sodium dodecyl sulfate at room temperature. Thta unadsorbed frac%ion was pr&pitat,ed with ethanol in the presence of sodium acetate. The J)reripitatrs were washed twice with ethanol. dried briefly and dissolved in water.
IJ/I’GI. a recombinant plasmid containing all but the first 13 nucleotides of rabbit fi-globin mRSX inserted into the ,QoKT sit,e of pMB9 (Efstratiadis d a,l., 1977). was kindI> provided by Dr Efstratiadis. The plasmid was grown in the Eschrrichia coli strain RV200 in the Jmlsenre of tet)racvcline, and isolated as described by Fenofsky et al. (1982). Probes for t,he 3’-terminal and 57terminal portions of the mRSA were obtained by first cleaving the plasmid DXA with the restriction rndonuclrase EcoRI (Bet)hesda Research Laboratory. Rockvillr, MD) and labeling the 3’ and 5’.termini. respectively (Fig. 1). The EcoRI digestion was caarried out at 3i”C’ for 1 h in the presence of 50 ~1 50 rnx-Tris. HCl (pH 7.5). 50 InM-Sa(‘l. 10 mM-&$l,. 1 mM-dithiothrritol. and EcoRI (10 units/5 pg DKA). The reaction was stopped by addition of 50 ~1 5 >I-ammonium acetate and ethylenediamine trtraacaetate t,o a concentration of 10 ~JI. The fragmented l)SA was extracted with 200 ~1 c*hloroform. and the organic phase was re-extracted with 100 ~1 Tris-F:DTA (pH 8.0). The (*ombineti aqueous phases were precipitated with 2.5 vol. ethanol at - 70°C for 15 min, c*ollrc+rtl by rentrifugation. washed once with ethanol. dried and dissolved in water. The 3’ &oRT probe was obtained by incubating I pg of cleaved plasmid with 1 unit of the large fragment of E. coli DNA polymerase (Klenow fragment: KRL) in the presence of IO0 /d(‘i [N-~~P](IATP (3000 (‘i/mmol: Xew F:ngland Su&ar. Boston. MA). 40 rn>l-
r(t4-l
(:. .\I,liKE(‘H’I’
EY .-I/,
potassium phosphate (pH 74). I rn~-/)‘-mer~aptoethanol. 6.2 m~~hlg(‘l, at 20-C for 15 nritr (Sanger rt IL/.. 1977). The labeled 1)X,\ was isolated as desrribed above. For the preparation of the 5’ EcoRI probe, 0.5 unit caalf’alkaline phosphatasr (\\‘orthing:ton Biochemic~al (‘o.. Frrehold, K-,J)/lO pg plasmid DiYA was ineluded in the incsuhation with EroKT. The digest was heated at 70”(’ for 15 tnin in t,he presence of O,jO,, sodium dotlevy sulfate. and the DNA was isolated l,y 2 extracations with phenol;chloroform~ one extraction with chloroform. and precipitation with ethanol. It was resuspended in 20 ~1 50 miv-Tris (pH 7.6), 10 mM-MgC’l,, 5 m~dithiothreitol. 0.1 m.n-spermidine. 0.1 rn>f-EDTA, and incaubated at 37°C: for 30 min with 200 &‘i (y-32P]ATI’ (9000 (:i/mmol) and 20 units of polynucleotidr kinase (KRL) (M axam & Ciilhert. 1980). The DIl’A was isolated as described above and dissolved in 500 ~1 water. A shorter probe for the .i’-terminal region was obtained by first digesting the plasmid DSA with HuPTII. labeling the 5’.trrmini. and further (aleaving the fragments with EcoRI (see Fig. 2). The DiK;,4 was incubated for 1 h at 37°C with 5 units of HaaT (BRL) and 0.5 unit of calf alkaline phosphatasr in 50 ~1 10 mmTris (pH 7.5). 50 mM-XaCI. 10 mMMg!(‘l,. 1 mM-dithiothreitol. The digest was incubated at 70°C for 15 min in the presence of 0.5’+, sodium dodecyl sulfate, and the DKA was then extracted with phenol/chloroform and with chloroform as described above, and precipitated with ethanol. The DNA was next dissolved in 40 ~1 20 mM-Trix (pH 9.5). 1 rnM-spermidine. 0.1 mmEDT4. The solut,ion was brought to a temperature of 70°C: and chilled quickly on ice. It was next brought to a volume of 70 ~1 with water and 7 ~1 0.5 M-Tris (pH 9.0), 0.1 M-MgCl,, 50 mM-dithiothreitol, 5Oy, glycerol and incubated with 200 &i [y-32P]ATP and 20 units polynucleotide kinase at 37°C‘ for 30 min. The reaction was stopped and the labeled Dru’A isolated as described for the .i’ EcoRI probe. The precipitated DICA was dissolved in 50 ~1 of EcoRI digestion buffer and incubated at 37°C’ for I h with 10 units &oRI. It was deproteinized by treatment with l)henol/c~hloroform, precipitated with ethanol and dissolved in water. (d) Hybridization
and digestion
with 8, nzzlease
Approximately 50-ng samples of labeled probe were mixed with RKA samples containing about 1 pg polysomal RNA and dried in a vacuum centrifuge. The mixtures were dissolved in 5 ~1 80% (v/v) formamide, 0.4 M-Ka(!l, 30 rnM-PIPES (piperazine-iV,N-bis(2-ethanesulfonic acid) (pH 6.4). 1 mM-EDTA. and placed in 20 ~1 capillary tubes. The ends of the tubes were sealed and the DNA was denatured by heating at 85°C for 5 min. The samples were placed immediately in a 50°C oven and allowed to hybridize overnight. Under these condttlons less than .‘O,;, of the 1)&A reannealed. The reaction mixtures were diluted into 2.50 PI ice-cold 250 mM-NaCI, 50 mM-sodium acetate (pH 4.5). 3 rn>f-ZnSO,. It was important to avoid slow cooling of the reaction mixtures prior to dilution. After inclusion of 10 pg yeast tRNA, the mixtures were digested with S, nuclease (BRL) at 45°C for 30 min. The reactions were stopped by addition of 650 ~1 ethanol and by placing the mixtures at -70°C. The precipitates were collected; washed twice with ethanol and dried. Separation of the labeled Dh’A fragments was done according to Maxam & Gilbert (1980) on So/:, (w/v) polyacrylamide slab gels 0.35 mm thick. After pre-electrophoresis for 30 min. the samples were dissolved in 3 ~1 YOoi, (v/v) f ormamide. 10 mM-Nash, 1 mM-EDTA. O.lO:, (w/v) xylene cyan01 FF and O.Io/, (w/v) b romophenol blue, heated at 90°C for 2 min, and subjected to electrophoresis at 70 W constant power. The gels were dried and subjected to autoradiography. For size markers, the plasmid pBR322 was digested with the restriction endonuclease HhaI and the fragments were labeled hy the polynucleotide kinase reaction as described above.
3. Results (a) t/:xperimontal
design
Cleavage sites were analyzed by R, nuclease mapping probes generated from a cloned rabbit /?-globin cDNA.
of RNA fragments using A recombinant plasmid,
(‘ONFORMATION
OF RAUUIT
13 43
mR N A
p-t:LORIS
361
77
t
7MeGaa.
-
G
----
pAATT
CTTAAp
+ ----
AA---A
-------
GAATTC CTTAAG
----
+----
95 4
+ ----
cDNA
8%
mKNA
G
----
C G
pAATTC
CTTAAp
*
!EG
-----_-
+ -
-------
+ -
+
+ AA---A AA---A AA---A AA---A 400
+
AA---A +
172
Fro. 1 Experimental design for mapping of cleavage &es. The recombinant plasmid pBG1 was cleaved at the single E’coRI site, located within the coding region of the mRNA sequence as indicated in the Figure. The fragmented plasmid was labeled either by the polynucleotide reaction, to provide a probe for the Sterminal region of the mRNA, or by the DNA polymerase reaction, to provide a probe for the other side of the mRNA. The labeled residues on the cDNA strand complementary to the mRSA (minus strand) are indicated by asterisks. The probes were annealed to the fragmented RNA preparations fraction. The hybrids were digested with 8, nuclease to remove single-stranded regions. and the undigested DNA fragments were separated by gel electrophoresis and visualized by autoradiography. The sizes of the protected fragments correspond to the distances between the cleavage sites and the EcoRI site. The boxed-in area of the mRNA represents the coding region, and the dotted line indicates the 13 nuclrotide stretch not represented in the cloned cDNA. Numbers represent distances (in nucleotides) between different regions. Thick lines in the mRNA fragments represent segments that will anneal to the probe and yield labeled protected DNA fragments. Arrows pointing at the RNA fragments indicate the position of the EcoRI site. Numbers on fragments indicate the expected maximum length of protected probe. Sequence hyphens have been omitted from the Figure for clarity.
p/%1, bearing nearly the entire sequence of the mRXA (Efstratiadis et al., 1977) contains a single EcoRI restriction site was used in this study. The plasmid located within the coding region, about 172 nucleotides away from the poly(A) sequence at the 3’ end of the mRNA and 417 nucleotides from the 5’ terminus (Fig. 1). The plasmid, cleaved with this restrict’ion enzyme. was labeled either with polynucleotide kinase to provide a probe for the 5’ portion of the mRNA, or with DNA polymerase to yield a probe for the S-terminal portion. The labeled c*ornponents are designated as 5’ EcoRI probe and 3’ EcoRI probe, respectively. .Another probe. covering the 5’ non-coding region and a small portion of the adjacent coding region, was also used. It was generated by first cleaving the plasmid with the restriction enzyme HaeIII and labeling the 5’.termini of the fragments with polynucleotide kinase. This yielded two labeled fragments complementary to the globin mRNA (Fig. 2). Subsequent cleavage with EcoRl cwnvert’ed one of these to a labeled fragment of only 47 nucleotides. The other
122
282
c
123 I Hae Jll
t
I
I
1
I
I
;y. I
I
1
5’ Labeling 122 I
122 I
+c I I
331
311 I
I
I. Eco RI
7
47% to-
FIG. 2. Preparation of the tZaeII1 probe for mapping of the F&terminal region of P-globin mKNA. _. Krcomhmant plasmid was cleaved with endonuclease Haelll, and the 5’.&mini of the fragments were labeled by reaction with poiynucleotide kinase. Subsequent cleavage with EcoRI converted one of the two fragments covering the cDNA sequence to a labeled fragment of 47 nucleotides, and left a longer labeled probe for the S-terminal portion of the mRNA. The segment corresponding to the cDNA insert is marked by a box and adjacent plasmid sequences by a thin line. Arrows indicate restriction sites and asterisks represent 32P-labelrd Stermini of strands complementary to mRN4. Numbers indicate distances (in number of nucleotides) between restriction &es. and between these sites a,nd thr boundaries of the (*DNA
fragment, that covers 122 nucleotides at the 5’ end of the mRPZA; could be used for mapping the 5’ non-coding region and about 2.5 nucleotides of the adjacent) (Loding region without interference from the shorter labeled fragment (see Fig. 6). The experimental design for the identification of cleavage sites is outlined in Figure 1. Preparations of lysate and of RNA were incubated with RNase T, under conditions designed to produce a limited number of cleavages and to leave a high proportion of intact molecules. After deproteinization, the RNA fragments were annealed to labeled probes and the hybrids subjected to F, nuclease in order to locate the sites of cleavages. In some cases. portions of the treated and untreated RNA preparations were fractionated on oligo(dT)-cellulose and the fraction unable to bind to this adsorbent was recovered and used for 6, mapping. The latter material represents RNA chains with no poly(A) and chains wit’h poly(A) segments too short for stable interaction with the oligo(dT). This fractionation step allowed us to distinguish between intact mRNA molecules with long and very short poly(A) segments (see Fig. 3). It also facilitated the detection of cleavages at the G residue next to the poly(A) sequence (see Figs 3 and 4).
(b) Analysis
of t/w 3’-terminal
region
of /Cglobin
,mRXL4
The results of the 8, mapping analysis with the 3’ EroRT probe are shown in Figure 3, and the localization of cleavage sites along the mRXA sequence is displayed in Figure 4. The procedure yielded well-defined bands corresponding to cleavages throughout the 3’ non-coding region and at the end of the coding region. The heavy top bands represent probe fragments protected by intact mRNA
I
Lysok
0
bcdebcdefqhiof
I
RNA
I
qhioi
FIG. 3. S, nuclease mapping of cleavage sites in Y’-terminal region of P-globin mRXA. RNA preparations were subjected to S, mapping analysis with the 3’ EcoRI probe, as described in Materials and Methods. Samples of lysate were incubated in the presence or absence of RNase T,, as described in from polysomes isolated after the incubations (lanes Materials and Methods, and RNA was obtained h to P). I)eproteinized polysomal RNA from the untreated lysatr was incubated with or without KNasr T, (lanes f to i). Samples of total RNA from each preparation and of the RNA fraction that does not, bind to oligo(dT)-cellulose (poly(A)RNA) were used for S, mapping. Lanes b, RNA from uninwhated lysate: lanes c and f, samples of lysate and of deproteinized RBA incubated without RNasr T,; lanes d and e, samples from lysate incubated with 5 x IO-’ and 5 x 10m4 units of RNase T,. respectively; lanes g. h and i, RNA incubated with 1.5 x 10m6. 1.5 x 10m5 and 1.5 x IO-& units of RNase of pHR322 labeled by reaction with ‘I‘, respectively; lanes a, HhaI restriction fragments plynuc~lrotide kinase: lane j. probe hybridized with 1 pp of yeast RSA instead of polysomal RNrl fragments.
xxx
(; 480
490
.~I,I~t
87’ .1/.
1tw
51u
120
110
GCUCACAAAVACCACUGAGAUCVVVUUCCCUCUGCCAAAAAUUAVGGGGACAUCAVGAAG IO
8”
90
100
110
!?”
Endogenou?
RNase
-
0
T,
540
550
560
570
580
589
CCCCVUGAGCAUCUGACVUCVGGCVAAUAAAGGAAAUUUAVVUUCAVVGCAAA----A 130
T,
150
160
110
--
Endogenous
RNose
110
---
ho. 4. Map of cleavage sites in the Sterminal region of P-globin mRNA. Ckavage sites are represented by bars under the mRNA sequence. The location of sites was derived from the sizes of protected probe fragments shown in Figure 3. Numbers above sequences indicate distances (in nucleotides) from 5’ end of mRNA: numbers below sequences indicate expected sizes of protected probe fragments at given positions on the mRNA chain. The open bar represents a cluster of G residues that is not cleaved by RNasr T,. The termination codon is UGA at positions 495 tjo 497. Sequence data are from Efstratiadis r/ al. (1977). Sequence hyphens have been omitted from the Figure for clarity.
molecules, and also by molecules that were fragmented outside the region between the EcoRT site and the 3’-terminus (see Fig. 1). The probe contains two T residues complementary to the beginning of the poly(A) sequence (Efstratiadis et al., 1977), and the fragment protected by intact mRSA should have 172 residues. This is close to the 174 size estimate for the top band. The lanes in Figure 3 that represent’ undigested polysomal RNA (b and f) show additional bands. These can be accounted for by the presence of truncated mRXA chains, presumably derived from intact molecules by endogenous cleavages. The sites of cleavage, estimated from the sizes of the protected probe fragments, are indicated in Figure 4. The fact that each site is represented by a cluster of bands is probably due in part’ to the inability of SI nuclease to stop the digestion precisely at the boundary of hybrids. This enzyme has been shown to nibble at the ends of DNA-RSA hybrids and also to leave overhanging ends (Weaver & Weissmann, 1979; Green B Roeder, 1980; Hentschel et al., 1980). All the endogenous sites contain A-U sequences and every A-U sequence in this region is represented by a cleavage site (Fig. 4). The bands vary in intensity and the more intense clusters of bands tend to represent sites with more than one A-l’ sequence. One of the bands, corresponding to site 549 to 553. is very weak. The endogenous bands are considerably enriched in the polysomal R’KA fraction that does not bind to oligo(dT)-cellulose, as could be expected of RI\;A fragments devoid of poly(A). This fraction still has a substantial proportion of intact molecules with at least the first two A residues of the poly(A)
CONFORMATION
OF RABBIT
/Y-GLOBIN
mKS.4
889
sequence, as indicated by the fact that it can protect a probe fragment that, includes the two complementary T residues. The above cleavages could have been generated by an endogenous enzyme during the preparation of the cell lysate and the isolation of the polysomes. In order to examine this possibility, the lysate was incubated at 37°C before isolation of the polysomes. The analysis of the polysomal RNA from the incubated lysates showed that this treatment did not cause any increase in the endogenous cleavages (compare lanes b and c). The decrease in band intensity seen in lane c was not observed consistently. In these experiments, the lysate had been supplemented with buffer at pH 7-0, salts and cycloheximide to prevent ribosome runoff. Incubation of the lysate without any of these additives, t’o approximate the conditions prevailing during cell lysis. also failed to generate any increase in the cleavages (data not shown). The globin mRNA in the lysate was susceptible to the action of RXase T,. As can be seen in Figure 3, lanes d and e, the exogenous enzyme caused additional cleavages. h’early all the G-containing sit’es were cleaved by the enzyme. One site consisting of a cluster of four G residues at positions 525 to 528 was inaccessible to the exogenous nuclease and the G residue next to the poly(A) sequence seemed to be affected to a relatively small extent. Incubation of deproteinized polysomal RSA with RSase T, resulted in a pattern of cleavages very similar to t’he one generated in the whole lysate (see lanes g, h and i). The G cluster at 525 to 528 remained unaffected, but the G next to the poly(A) seemed more accessible. The incubations with R?iase T, affected a relatively small portion of t,he mRXA molecules. This is indicated by the fact that there was little decrease in the intensity of the top band derived from the mapping of the unfractionated mRKA preparations. The molecules with short poly(A) segment’s unable to bind t,o oligo(dT)-cellulose seemed far more vulnerable to t,he enzyme. This is indicated by the nearly complete disappearance from this fraction of the top band. representing intact mRNA with oligo(A) segments. This preferential digestion of the mRKA chains with short poly(A) segments occurred both in the whole lysate and in deproteinized RNA (see Fig. 3).
(c) The St-terminal
region of p-glob&
mR,VL4
The 5’ EcoRT probe covers a large portion of the mRNA (see Fig. 1). It yielded information on cleavage sites within the first 250 nucleotides of the globin RSA chain. Relatively few endogenous cleavages were observed in this region (Fig. 5. lane a). These were distributed at widely scattered positions in the coding region and were more prevalent in the 5’ non-coding region. The labeled bands corresponding to the latter cleavages, however, were not well resolved because of their large sizes. The shorter, 5’ NaeIII probe, generated as outlined in Figure 2, permitted a better resolution of the cleavage sites in the 5’ non-coding region. This probe covers the first 122 nucleotides of the mRNA (past the first 13 residues not included in the cDNA insert), but is contaminated by a labeled fragment 47 nucleotide long that covers a segment far inside the coding region (see Fig. 2). The
270 259
190
(‘ONFOKMATION
0
b
c
OF RABBIT
d
I
,C(:I,OBlS
e
f
mKX.1
9
891
h
kc:. 6. S, nucleasr mapping of thp beginning of the 5’.trrminal region of &&bin mRSA. obtained wit,h the .5’ liar11 I probe. See Fig. 5 for details. Lane i represents a probe hyhridizrd with 1 /~g yrast tRS.4 instead of the polysomal KS.\ preparations.
(;. .\I,RIiE(‘H’I
E7’ .-II. 40
20
60
ACACAACUGUGUUUACUUGCAAUCCCCCAAAACAGACAGAAUGGUGC (110) (90) II-
m S
61
100
80
120
AUCUGUCCAGUGAGGAGAAGUCUGCGGUCACUGCCCUGUGGGGCAAGGUGAAUGUGGAAG (50) 320 (70) Endogenous RNose
T,
w
-
121
m 140
160
180
AAGUUGGUGGUGAGGCCCUGGGCAGGCUGCUGGUUGUCUACCCAUGGACCCAGAGGUUCU 300 260 260 Endogenous RNase
T, 161
Endogenous RNase
T,
220
200
240
UCGAGUCCUUUGGGGACCUGUCCUCUGCAAAUGCUGUUAUGAACAAUCCUAAGGUGAAGG 200 220 240 --
FIG, 7. Map of cleavage sites in the 5’.terminal portion of /3-globin mRNA. Numbers above sequences indicate distance (in nucleotides) from 5’ end of mRNA; numbers in parentheses below sequences indicate expected sizes of the protected 5’ Hue111 probe fragments at given positions: numbers without parentheses are corresponding sizes of the protected 5’ EcoRI probe. The double bar indicates a site highly exposed to RSase T, next to initiation codon AVG. For other details see Fig. 4. Sequence hyphens have been omitted from the Figure for clarity.
results of 8, mapping with this probe are shown in Figure 6. The major top band represents a labeled fragment of 124 residues. This is close to the expected size of probe fragment protected by intact mRNA (122 residues). The other major band, of 47 residues, corresponds to the smaller labeled fragment fully protected by mRNA. The region between these two bands covers cleavage sites in the 5’.terminal portion of the mRNA that can be mapped by the 5’ HaeTII probe. The control lane with RNA omitted from the hybridization mixture (lane i) showed several bands, which probably represent reannealed Hue111 plasmid DNA fragments. These bands were not observed with the EcoRI probes. They had relatively little adverse effect on the identification of cleavage sites. The cleavage sites identified with the use of the 5’ probes are indicated in Figure 7. A major portion of the non-coding region contains sites subject to endogenous cleavage, but only three such cleavage sites were observed among the first 180 residues in the coding region. Few of the endogenous cleavages were at or near A-U sites and most of the A-U sequences in the region subjected to analysis were not subject to endogenous cleavage. Again, preincubation of the lysate at 37°C did not cause any increase in endogenous cleavages. This incubation caused a reduction in the cleavages at positions 42 to 47 (compare lanes a and b in Fig. 5; see also Fig. 6). This effect was observed consistently. but we have no information concerning its possible significance.
(IONFORMATION
OF RABBIT
b-GLOBIN
mKNA
893
The 5’-terminal portion contained relatively few sites accessible to Rh’ase T, (see Fig. 5, lanes c, d, f, g and h). The 5’ non-coding region, which is rich in endogenous cleavage sites, showed very little sensitivity to this enzyme (Figs 5 and 6). The deproteinized RNA had one highly sensitive site, located in the vicinity of the initiation ACG codon. This site was far less exposed in the lysate. This difference in extent of cleavage was not due to low a,ctivity of the added enzyme in the l-pate, as indicated by the extensive cleavages at the 3’ end of the mRNA under the same conditions (see Fig. 3. lanes e). The segment between positions 213 and 236 in the coding region was exposed to the action of the both in deproteinized RNA and in the cell lysate (Figs exogenous enzyme, 5 and 7). The same segment contained two of the three endogenous cleavage sites identified in the coding region. Another site, representing a cluster of G residues at positions 192 to 195, was exposed to some extent in the RXA and masked in the lysatr. Some G residues around positions 114 and 123. on the other hand, were somewhat exposed in the lysate and masked in the free RXA.
4. Discussion (a) Identi$cation
of cleavage sites
The S, nuclease mapping procedure described in this paper permits the identification of cleavage sites in mRNA molecules that have been subjected to limited fragmentation. The precision of this procedure is somewhat limited. because of the inability of the enzyme to cut exactly at the boundary of basepaired regions of DNA-RNA hybrids. Thus, individual cleavage sites are represented not by protected probe fragments of unique size, but by clusters of fragments. The degree of precision of the procedure can be assessed by comparing the RNase T, cleavage sites determined experimentally with the location of G residues along the RNA sequence. As can be seen in Figure 4, the T, cleavage sites, defined by the sizes of band clusters, overlap the positions of G residues. The boundaries of these sites are not more than three nucleotides away from the G positions. This degree of precision proved to be sufficient’ for the unambiguous identification of the G residues in the 3’ non-coding region that are accessible to RNase T,. One cluster of G residues was clearly protected from the action of the enzyme. The band clusters that appear to represent, endogenous cleavages are about as broad as those representing RNase T, cleavages. In all but one case. t’he boundaries of these endogenous cleavage sites are within two nucleotides of A-I’ sequences. The three broadest clusters represent sites with two such sequences. These features lead us to believe that the RXA preparations contain chains cleaved by an enzymatic system directed specifically at A-U sequences. The identification of cleavage sites in the Fit-terminal region of the mRNA was less straightforward. The region beyond position 48 is rich in G residues, and the sites affected by RNase T, could not all be defined precisely. The site that is highly sensitive in the deproteinized RXA is clearly close to the initiation AUG codon. but the identification of some of the other sites is less certain. The 5’ non-
X94
(:. AI,I~Rl<('HT
h"/‘ AI,
coding region contains several endogenous cleavage sites. but only one of them appears to represent an A- I’ sequemf%. Some of the cleavages in the coding region muld ha,ve been produced by the enzyme specific* for ,\-I1 sites as well. It seems fairly certain that different endogcnous enzymes were involvcld in the generation of cleavages at the two extremities of’ the mRr\;A (*hair]. (h) SiqniJicn rice of the endoqenous cleavaqes
The endogenous cleavages in the 3’-terminal region appear to have been generated by an endonuclease that recognizes A-U sequences. A nuclease with this specificity has been identified in HeLa cells, where it is associated with lysosomes (Saha et al., 1979; Saha, 1982). This type of enzyme could have been responsible for the observed cleavages, but it remains to be determined whether these were produced as part’ of the mRXA decay process in maturing reticulocytes, OK whether they were generated only after cell lysis. The reticulocyte lysate contains nuclease activity. as indicated by the fact that labeled deprot,einized RKA is degraded extensively when incubated with small samples of the extract. The endogenous a&iv+,- is great’er at neutral pH than at pH 5.5, unlike the acidic lysosomal HeLa cell enzyme. Incubation of the lysate at 37”C, however, did not cause any increase in t,he endogenous cleavages in the globin mR?iA. It appears that the conditions in the extract after cell lysis are not favorable for the action of endogenous nucleases on the globin mRNA in its native configuration. The possibility remains, however. that an enzyme analogous t’o the lysosomal HeLa cell nuclease occurs in reticulocytes, and that transient) exposure to such an enzyme during cell lysis could have generated some of the cleavages in the globin mRNA. The cleavages in the 5’ non-coding region appear to have been directed at U-U-A, U-C-G and A-A-U sequences. as well as at a cluster of A residues. The four G residues near these sit’es are not accessible to R?iase T, in the extracts. This tends to indicate that the sites in the 5’ non-coding region would not have been reached easily by an endogenous nuclease active during cell lysis. It is more likely, therefore. that the endogenous cleavages might have been generated primarily in the intact cells. These findings raise the possibility that mR?\‘,4 decay begins with cleavages at specific sites and that intermediates in the degradation process could be identified. Further work will he required t)o determine whether any of the endogenous cleavages identified in this study are part of the process of mRP\‘A degradation in rrt,iculocytex. (c) A possible effect of ply(A)
on mRNA
protection
The analysis of the RNA fraction unable to bind to oligo(dT)-cellulose provided information possibly relevant to the question of poly(A) function. This fraction, although designated as “poly(ARXA”, includes mRNA chains with short poly(A) segments. Tt has been estimated that molecules with less than 10 to 30 adenylate residues are unable to bind to this adsorbent’ (Brawerman, 1981). These chains terminated by oligo(A) segments are represented in S, mapping patterns of
(IONFORMATION
OF RABBIT
fi-(iLOUIS
mR?i.A
895
poly(A)- RNA by the band of 174 residues seen in Figure 3. The intensity of this band is sharply reduced when poly(A)- fract,ions from preparations exposed to RNase T, are analyzed. This leads us to conclude that mRNA chains with short poly(A) segments are preferentially digested by this enzyme. This finding suggests that the presence of t.he longer poly(A) sequences on mR?iA can make these molecules less sensitive to digestion by nucleases. The greater sensit’ivity of poly(A)- mRX,4 chains was observed both in deproteinizetl RNA and in the RNA as it exists in the cell Iysate. (tl) Features
of r&it
fl-globin
m
RXA configuration
The analysis of sit’es sensitive to R?\‘ase T, provided some insight into the configuration of the p-globin mRNA. The 3’ non-coding region proved to br highly accessible to this enzyme, both in deproteinized mR?iA and in mRNA in its native configuration in the lysate. Tn contrast, the 5’ non-coding region was essentially inaccessible to RNase T,, even in the deproteinized mRNA. The latter contains one highly exposed site, next to the initiation AIIG codon. This site was far less accessible in the lysate. possibly because of the presence of ribosomes on the mRNA chains. The high degree of accessibility of the initiation AUG in drproteinized rabbit P-globin mRXA has been described (Pavlakis et nl., 1980). The segment covering the first, 150 nucleotides of the coding region is remarkably resistant to the action of RNase T,. This indicates the occurrence of a high degree of folding in this RNA species. Only relatively minor differences in conformation have been observed so far in the mRSA in its presumably native state in rrticulocyte extracts. Further studies of the mR?L’A in different functional states might, reveal &u&Ural features possibly relat,ed to the translation process. \Vr thank Dr John C’offin. who suggested the basic experimental approach, I>r St,uart TA$ricr and Mr Brian Mermer for t’echnical advice and MS Ann Boyle for technical assistance. This work was supported by research grants from the National Institutes of Health ((:M17973) and t,he National Science Foundation (P(‘M8020712). REFFRE’CC’FU 1 I/AS 10. I-38. Rrawrrman, G. (1981). (‘rit. Rev. Riochem. Efstratiadis, A., Kafatos, F. C. & Maniat’is, T. (1977). Crll, 10, S--585. Groghegan, T. E., Sonenshein, G. E. & Brawerman. (:. (1978). Biochemistry. 17, 4200-4207. Crew. M. R. bt Roeder, R. U. (1980). CPU,22, 231-242. HrntscGhrl, C‘.. lrminger. .I. C.. Buchrr. 0. Br Rirnstirl. M. T,. (1980). ,Vaturr (London), 285. 147-151. Lodish. H. F. (1971). J. Hid. Chem. 246, 7131-7138. Maxam. A. M. & Gilbert, W. (1980). Methods Enzymol. 65. I. 499-560. Sevins, .I. R. (1983). Annu. Rev. Biochem. 52, 441-466. I’att,on, .J. R. & Chae, C’. B. (1983). J. Biol. Cham. 258. 3991L399.5. Pavlakis. C:. S., Lockard, R. E.. Vamvakopoulos. S.. Riesrr. I,., RajBhandary. I’. L. B Vournakis. ,J. S. (1980). Cell, 19, 91-102. l’c~lharn. H. R. B. & *Jackson, R. ,J. (1976). E’ur. J. Biochem. 67, 247-256. Qu. 1,. H., Michot, B. & Bachellerie. J. P. (1983). Sucl. Acids Kes. 11. 5903-5920. &ha. K. K. (1982). NucZ. Acids Res. 10, 645--652. Saha. ti. K.. Ciraham, M. Y. $ Srhlessinger. I). (1979). J. Niol. f’hrm. 254. .5951-5957.
Configuration of P-Globin Messenger RNA in Rabbit Reticulocytes Identification GLENN
of Sites Exposed to Endogenous AI,HRECHT,
ANNA
KROWCZYNSKA
and Exogenous
ASD CIWRGE
Nucleases
BRAWERMAN
of Riochemirtry and Tufts 1‘niversity School of
Departm,ent 136 Harrison
Avenue, (Received
Pharmacology Medicine Boston, MA 0217 I. C’.A\.A . 27 May
7984)
Masked and exposed sites in rabbit fi-globin rnessenger RXA were identified through 8, nuclease mapping of RiYase T, cleavage sites. Sites exposed to this enzyme were compared in deproteinized polysomal Rh’A and in mRNA in its native configuration in reticulocyte extracts. The analysis showed that most of t)he 3’ non-coding region is well accessible to the enzyme, both in deproteinized RSA and in the cell extract. A possible protecting function for the poly(A) sequence is suggested by the fact that molecules with very short poly(A) segments were cleaved preferentially in this region. The G residues in the 5’ non-coding region were inaccessible to RNase T,. A highly sensitive site adjacent to the initiation AUC codon was evident in the deproteinized RSA. This site was far less accessible to the enzyme in the mRPr’A associated with ribosomes in the cell extract. The first 150 nueleotidcs in the coding region showed very little susceptibility to digestion by t,hr enzyme. in deproteinized R?u’A as well as in the c+rll extracts. Preparations of untreated mRl\jA showed the occurrence of truncated molecules, apparently generated by cleavage by endogenous nucleases. These cleavages were most prevalent, in the two non-coding regions. They occurred at sites containing A-U sequences in the 3’ non-coding region, and at sites with different sequences in the 5’ non-coding region. Incubation of cell extracts at 37°C did not cause any increase in these endogenous cleavages. It is suggested that they may have been generated in the intact cells. possibly as part of the mRSA degradation process in maturing ret,irulocytes.
1. Introduction The processes concerned with the biogenesis, translation and breakdown of messenger RiYA require the interaction of specific sites on the RXA with other macromolecules. Thus, accessibility of these sites in the cell must play an important role in the control of these processes. Messenger RNA molecules can differ greatly with respect to efficiency of translation and metabolic stabilit) (l,odish, 1971; Sonenshein & Krawerman, 1976: Nevins, 1983). The nature of the factors responsible for these differences is poorly understood. Knowledge of R,XA 002%- 2836:84/280881-16
$0%.00/O
XXI
N; 19X1 Acadrmic
Press Inc. (Lortdo~l) Ltd.
HHL’
i;
\i,liI:~;(‘tl’l’
L.‘T
,I /,
(~olrligrrr~al ion iir intliviclrrnl rrr RNA strec~it3 ant1 ifr t trcbir t~r~~~u~sorb shorrttl f,r.c,vittc~ iirsigtrt into tflcl (~xtr~rri to nhicsh 1his (~o~~fi~rrr;\ti(rn tlrt~~rrrrinr~x t IIP cti\-c~t~;iit~~irk f~outtl also sllf~tl tight oI1 t tIv Ililt ,Irf’ ot’ t tlfz m I< SAI trrhrrvior. Srrc*tr kllO\Vtettgf~ irrtc~ritc~tions c*onc~r~rrrcdwith rnK NX function. Atittit ionat nrrttc~rstirnttirrg c~,uttt t)(. tlerivtd f’rom thra id~ntificat~iorr of’ c~1ea.vq.y~ that take place in the (~11 1~st);rrt of t hf, t)rYrr’essf’s r~orr(~r~rirfd with rn RNA maturation in the nucalrus arrtt tlPgKltl;~tic~ll in the c~ytoptastn. T’rGsr knowledge of mRN’A c-orrfigurdion is very limited. Pavlakis pt al. (1980) huvr investigat~etl the secondary structure of the r- and P-gtohin rnRS.As of mouse and rahhit t)y identifying &es f~xposett to nucteascs in purified rnotr~cutrs tatrf+d at the 5’ t~errninus wit’h radioac+t~ive phosphate. These studies ted to the suggestioil that the ttegrt~(~ of a,cc*cssit)itity to the initial Ali(: codon could TV respnsibtr for t.hc tiifferc~nc*es in initiation eflic:ienc*y between t hc, x- and /II-gtohin rnKXA species. This approach rquircas purified prqrarations c~ontaining a sin@ rn RNA specir~s. ant1 caanrrot rc>vrd st.ructural features that ma)- exist only in ttrr mRXA as it or*r’urs in tht, wII, prior to deprol,rinizat,ion. Patt~on M (‘hae (1983) have ovr’r(+orrlc~ this difficulty to some rxtcnt by int reducing thr, USP of doncd DSX prohrs spdfic for individual rnRKA spe&!s. This permits the arralysis of a given mRSA without having t,o tleproteiniz~~ it and srparst’r it from other species. The latter procrtlurr~ involves extensivcb rruclcas~ digrstion of’ cytoptasmic particles bearing the rnRN.4 ant1 itlr~nt~ificatiorr of Ihe RNA segments that arc’ prott~ctrtl in the partidrs. This analysis showed that thrl ritrosomes associated with the chicken P-gtohin rnRNr\ RNA segmcmts extending 12 riudeotides upstream from t hr. in potysomes protect initial AL:(:. This procedure, however. does not reveal individual cleavage sites. ant1 seems unsuitable for tine structure analysis. Arrothfsr produre. that involves limited fragmentation of thr RNA and clsterrsiorr of labeled primers complementary to spedic regions of the RXLA permits t)he ittentificat,ion of individual cleavage sitf+i (Qu rt II/.. 19X3). LVr have developed a procdure that also uses cloned comptPmentar~ t)iKA prohcs. ant1 that permits thr identification of individual cleavagt~ sites ohtainrtl t,- limited nucteasr digestion of the mRXA or of cy,-toplasmic> particles hearing the, rnR,I’A. Thr, RX.-! fragments otrtained in this fashion are annealed to end-laheted DSA probes and ttlf) tij-t)ritts m-f‘ digested with S, nuctease to remorc sing+stranded I)SA segments rrol c~~\-r~r~d try RNA. This procedure was applied to thr, study of rahtrit /I-gtohirr m RNA. The psr~nt results indicate that the 5’.t)errninal region of the mRSA r~hairrs is rt~atlil~ draved by RXase T,, both in drproteinizecl RX.4 and in the mRS.4 as it exists itr thr retic~ulocy+r~ tysat’e. The other end of the mRNA contains few sitrs at~cessitrt~~ to this cay,-rnc. hut has one highly sensitive site next to t hcs initiation Al’(: cdorr. The analJ.sis also indicated that RNA chains with very short ply(A) segments a,ppear to he c~teavetl preferentially. \Z’e also observed that thr rnRXA4 derivrtl from pot~somes csotrtains a small population of fragmented molec~ules. These appeared to have hren protluc~l 113 clravLtges at spcific~ sites. toc*atrtl primarily in thp two non-coding regions. Thfl cleavages in the 3’ notr-cdin g region appear4 to tw dirrctrd at A-l’ sequrnces. The significance of thesrl endogrnous cleavages and t,heir possible relation to the process of mRNA degradation during reticulocyte maturation are discussed.
(‘ONFORMATION
OF RAlSIIIT
/j-GLOH1S
mliSA
8X3
2. Materials and Methods (a) Preparation
of retitulocyte
lysate and polysomal
RX4
Reticulocytes were obtained from white Xew Zealand long-eared rabbits made anemic with phenylhydrazine, as described by Pelham & ,Jackson (1976). The cells were washed twicxr with saline and lysed with 0.5 vol. water. The Igsate was cleared by centrifugation Polysomes were prepared from portions of the lysatr byand stored at -70°C. c,entrifugation at 36.000 revs/min for 40 min in the Beckman rotor T40. using a 4 ml caushion of 209, (w/v) sucrose. .50 rnnl-Tris. HCI (pH 7.6). 1 mM-?uIgCX, in g-ml centrifuge tubes. I’olysomal KSA was extracted from the ppllrt by the alkaline phenol extraction ~wowtiure ((ieoghegan sf al.. 1978). (h) Fragmentation
of m KAYA
Samples of lgsate (40 ~1) were incubated in a total volume of lOO@ of solution 20 mM-HEPES (S-2-hydroxyethyl-piperazine-N’-Cethanesulfonic acid) containing (pH 7.(J), 80 rnx-KU, 0.5 mM-MgCl,. 50 pg cycloheximide/ml. The incubations were at 3’7”(’ for 10 min. in the presence or absence of R,P;ase T,. Polysomes were isolated from the incubation mixtures as described above. and were used for the preparation of polysomal RNA. For the fragmentation of deproteinized RS&\. polysomal RXA isolated from untreated lysatr was incubated under t,he same conditions, but without cycloheximide, at, a concentration of 20 pg/lOO ~1; 5 pg yeast transfer RNA/100 ~1 was included in the polysomal RSA incubation. The reactions were terminated by addition of 10 ~1 1 u-Tris. HC’I (pH 9.0). 2.5 ~1 20°, (n/v) sodium dodecay sulfate. The mixtures were extracted first with phenol. then nit,h phenol/chloroform (1 : 1. v/v). and finally with ether to remove the phenol from the aqueous phase. The RSA was precipitated by adjusting the salt c*onc*rntration to 0,3 M-SOtiillIII acetate. adding 2.5 vol. ethanol and keeping overnight at -2OY’. Portions of the deproteinizrd preparations were subjected to chromatography on oligo(dT)-cellulose. in order to obtain the poly(A)-deficaient components. The samples were adsorbed in 200 rnM-XaCI, 10 mM-Tris’ HCI (pH 7.6). .5 m,n-MpCl,. O.l(?& sodium dodecyl sulfate at room temperature. Thta unadsorbed frac%ion was pr&pitat,ed with ethanol in the presence of sodium acetate. The J)reripitatrs were washed twice with ethanol. dried briefly and dissolved in water.
IJ/I’GI. a recombinant plasmid containing all but the first 13 nucleotides of rabbit fi-globin mRSX inserted into the ,QoKT sit,e of pMB9 (Efstratiadis d a,l., 1977). was kindI> provided by Dr Efstratiadis. The plasmid was grown in the Eschrrichia coli strain RV200 in the Jmlsenre of tet)racvcline, and isolated as described by Fenofsky et al. (1982). Probes for t,he 3’-terminal and 57terminal portions of the mRSA were obtained by first cleaving the plasmid DXA with the restriction rndonuclrase EcoRI (Bet)hesda Research Laboratory. Rockvillr, MD) and labeling the 3’ and 5’.termini. respectively (Fig. 1). The EcoRI digestion was caarried out at 3i”C’ for 1 h in the presence of 50 ~1 50 rnx-Tris. HCl (pH 7.5). 50 InM-Sa(‘l. 10 mM-&$l,. 1 mM-dithiothrritol. and EcoRI (10 units/5 pg DKA). The reaction was stopped by addition of 50 ~1 5 >I-ammonium acetate and ethylenediamine trtraacaetate t,o a concentration of 10 ~JI. The fragmented l)SA was extracted with 200 ~1 c*hloroform. and the organic phase was re-extracted with 100 ~1 Tris-F:DTA (pH 8.0). The (*ombineti aqueous phases were precipitated with 2.5 vol. ethanol at - 70°C for 15 min, c*ollrc+rtl by rentrifugation. washed once with ethanol. dried and dissolved in water. The 3’ &oRT probe was obtained by incubating I pg of cleaved plasmid with 1 unit of the large fragment of E. coli DNA polymerase (Klenow fragment: KRL) in the presence of IO0 /d(‘i [N-~~P](IATP (3000 (‘i/mmol: Xew F:ngland Su&ar. Boston. MA). 40 rn>l-
r(t4-l
(:. .\I,liKE(‘H’I’
EY .-I/,
potassium phosphate (pH 74). I rn~-/)‘-mer~aptoethanol. 6.2 m~~hlg(‘l, at 20-C for 15 nritr (Sanger rt IL/.. 1977). The labeled 1)X,\ was isolated as desrribed above. For the preparation of the 5’ EcoRI probe, 0.5 unit caalf’alkaline phosphatasr (\\‘orthing:ton Biochemic~al (‘o.. Frrehold, K-,J)/lO pg plasmid DiYA was ineluded in the incsuhation with EroKT. The digest was heated at 70”(’ for 15 tnin in t,he presence of O,jO,, sodium dotlevy sulfate. and the DNA was isolated l,y 2 extracations with phenol;chloroform~ one extraction with chloroform. and precipitation with ethanol. It was resuspended in 20 ~1 50 miv-Tris (pH 7.6), 10 mM-MgC’l,, 5 m~dithiothreitol. 0.1 m.n-spermidine. 0.1 rn>f-EDTA, and incaubated at 37°C: for 30 min with 200 &‘i (y-32P]ATI’ (9000 (:i/mmol) and 20 units of polynucleotidr kinase (KRL) (M axam & Ciilhert. 1980). The DIl’A was isolated as described above and dissolved in 500 ~1 water. A shorter probe for the .i’-terminal region was obtained by first digesting the plasmid DSA with HuPTII. labeling the 5’.trrmini. and further (aleaving the fragments with EcoRI (see Fig. 2). The DiK;,4 was incubated for 1 h at 37°C with 5 units of HaaT (BRL) and 0.5 unit of calf alkaline phosphatasr in 50 ~1 10 mmTris (pH 7.5). 50 mM-XaCI. 10 mMMg!(‘l,. 1 mM-dithiothreitol. The digest was incubated at 70°C for 15 min in the presence of 0.5’+, sodium dodecyl sulfate, and the DKA was then extracted with phenol/chloroform and with chloroform as described above, and precipitated with ethanol. The DNA was next dissolved in 40 ~1 20 mM-Trix (pH 9.5). 1 rnM-spermidine. 0.1 mmEDT4. The solut,ion was brought to a temperature of 70°C: and chilled quickly on ice. It was next brought to a volume of 70 ~1 with water and 7 ~1 0.5 M-Tris (pH 9.0), 0.1 M-MgCl,, 50 mM-dithiothreitol, 5Oy, glycerol and incubated with 200 &i [y-32P]ATP and 20 units polynucleotide kinase at 37°C‘ for 30 min. The reaction was stopped and the labeled Dru’A isolated as described for the .i’ EcoRI probe. The precipitated DICA was dissolved in 50 ~1 of EcoRI digestion buffer and incubated at 37°C’ for I h with 10 units &oRI. It was deproteinized by treatment with l)henol/c~hloroform, precipitated with ethanol and dissolved in water. (d) Hybridization
and digestion
with 8, nzzlease
Approximately 50-ng samples of labeled probe were mixed with RKA samples containing about 1 pg polysomal RNA and dried in a vacuum centrifuge. The mixtures were dissolved in 5 ~1 80% (v/v) formamide, 0.4 M-Ka(!l, 30 rnM-PIPES (piperazine-iV,N-bis(2-ethanesulfonic acid) (pH 6.4). 1 mM-EDTA. and placed in 20 ~1 capillary tubes. The ends of the tubes were sealed and the DNA was denatured by heating at 85°C for 5 min. The samples were placed immediately in a 50°C oven and allowed to hybridize overnight. Under these condttlons less than .‘O,;, of the 1)&A reannealed. The reaction mixtures were diluted into 2.50 PI ice-cold 250 mM-NaCI, 50 mM-sodium acetate (pH 4.5). 3 rn>f-ZnSO,. It was important to avoid slow cooling of the reaction mixtures prior to dilution. After inclusion of 10 pg yeast tRNA, the mixtures were digested with S, nuclease (BRL) at 45°C for 30 min. The reactions were stopped by addition of 650 ~1 ethanol and by placing the mixtures at -70°C. The precipitates were collected; washed twice with ethanol and dried. Separation of the labeled Dh’A fragments was done according to Maxam & Gilbert (1980) on So/:, (w/v) polyacrylamide slab gels 0.35 mm thick. After pre-electrophoresis for 30 min. the samples were dissolved in 3 ~1 YOoi, (v/v) f ormamide. 10 mM-Nash, 1 mM-EDTA. O.lO:, (w/v) xylene cyan01 FF and O.Io/, (w/v) b romophenol blue, heated at 90°C for 2 min, and subjected to electrophoresis at 70 W constant power. The gels were dried and subjected to autoradiography. For size markers, the plasmid pBR322 was digested with the restriction endonuclease HhaI and the fragments were labeled hy the polynucleotide kinase reaction as described above.
3. Results (a) t/:xperimontal
design
Cleavage sites were analyzed by R, nuclease mapping probes generated from a cloned rabbit /?-globin cDNA.
of RNA fragments using A recombinant plasmid,
(‘ONFORMATION
OF RAUUIT
13 43
mR N A
p-t:LORIS
361
77
t
7MeGaa.
-
G
----
pAATT
CTTAAp
+ ----
AA---A
-------
GAATTC CTTAAG
----
+----
95 4
+ ----
cDNA
8%
mKNA
G
----
C G
pAATTC
CTTAAp
*
!EG
-----_-
+ -
-------
+ -
+
+ AA---A AA---A AA---A AA---A 400
+
AA---A +
172
Fro. 1 Experimental design for mapping of cleavage &es. The recombinant plasmid pBG1 was cleaved at the single E’coRI site, located within the coding region of the mRNA sequence as indicated in the Figure. The fragmented plasmid was labeled either by the polynucleotide reaction, to provide a probe for the Sterminal region of the mRNA, or by the DNA polymerase reaction, to provide a probe for the other side of the mRNA. The labeled residues on the cDNA strand complementary to the mRSA (minus strand) are indicated by asterisks. The probes were annealed to the fragmented RNA preparations fraction. The hybrids were digested with 8, nuclease to remove single-stranded regions. and the undigested DNA fragments were separated by gel electrophoresis and visualized by autoradiography. The sizes of the protected fragments correspond to the distances between the cleavage sites and the EcoRI site. The boxed-in area of the mRNA represents the coding region, and the dotted line indicates the 13 nuclrotide stretch not represented in the cloned cDNA. Numbers represent distances (in nucleotides) between different regions. Thick lines in the mRNA fragments represent segments that will anneal to the probe and yield labeled protected DNA fragments. Arrows pointing at the RNA fragments indicate the position of the EcoRI site. Numbers on fragments indicate the expected maximum length of protected probe. Sequence hyphens have been omitted from the Figure for clarity.
p/%1, bearing nearly the entire sequence of the mRXA (Efstratiadis et al., 1977) contains a single EcoRI restriction site was used in this study. The plasmid located within the coding region, about 172 nucleotides away from the poly(A) sequence at the 3’ end of the mRNA and 417 nucleotides from the 5’ terminus (Fig. 1). The plasmid, cleaved with this restrict’ion enzyme. was labeled either with polynucleotide kinase to provide a probe for the 5’ portion of the mRNA, or with DNA polymerase to yield a probe for the S-terminal portion. The labeled c*ornponents are designated as 5’ EcoRI probe and 3’ EcoRI probe, respectively. .Another probe. covering the 5’ non-coding region and a small portion of the adjacent coding region, was also used. It was generated by first cleaving the plasmid with the restriction enzyme HaeIII and labeling the 5’.termini of the fragments with polynucleotide kinase. This yielded two labeled fragments complementary to the globin mRNA (Fig. 2). Subsequent cleavage with EcoRl cwnvert’ed one of these to a labeled fragment of only 47 nucleotides. The other
122
282
c
123 I Hae Jll
t
I
I
1
I
I
;y. I
I
1
5’ Labeling 122 I
122 I
+c I I
331
311 I
I
I. Eco RI
7
47% to-
FIG. 2. Preparation of the tZaeII1 probe for mapping of the F&terminal region of P-globin mKNA. _. Krcomhmant plasmid was cleaved with endonuclease Haelll, and the 5’.&mini of the fragments were labeled by reaction with poiynucleotide kinase. Subsequent cleavage with EcoRI converted one of the two fragments covering the cDNA sequence to a labeled fragment of 47 nucleotides, and left a longer labeled probe for the S-terminal portion of the mRNA. The segment corresponding to the cDNA insert is marked by a box and adjacent plasmid sequences by a thin line. Arrows indicate restriction sites and asterisks represent 32P-labelrd Stermini of strands complementary to mRN4. Numbers indicate distances (in number of nucleotides) between restriction &es. and between these sites a,nd thr boundaries of the (*DNA
fragment, that covers 122 nucleotides at the 5’ end of the mRPZA; could be used for mapping the 5’ non-coding region and about 2.5 nucleotides of the adjacent) (Loding region without interference from the shorter labeled fragment (see Fig. 6). The experimental design for the identification of cleavage sites is outlined in Figure 1. Preparations of lysate and of RNA were incubated with RNase T, under conditions designed to produce a limited number of cleavages and to leave a high proportion of intact molecules. After deproteinization, the RNA fragments were annealed to labeled probes and the hybrids subjected to F, nuclease in order to locate the sites of cleavages. In some cases. portions of the treated and untreated RNA preparations were fractionated on oligo(dT)-cellulose and the fraction unable to bind to this adsorbent was recovered and used for 6, mapping. The latter material represents RNA chains with no poly(A) and chains wit’h poly(A) segments too short for stable interaction with the oligo(dT). This fractionation step allowed us to distinguish between intact mRNA molecules with long and very short poly(A) segments (see Fig. 3). It also facilitated the detection of cleavages at the G residue next to the poly(A) sequence (see Figs 3 and 4).
(b) Analysis
of t/w 3’-terminal
region
of /Cglobin
,mRXL4
The results of the 8, mapping analysis with the 3’ EroRT probe are shown in Figure 3, and the localization of cleavage sites along the mRXA sequence is displayed in Figure 4. The procedure yielded well-defined bands corresponding to cleavages throughout the 3’ non-coding region and at the end of the coding region. The heavy top bands represent probe fragments protected by intact mRNA
I
Lysok
0
bcdebcdefqhiof
I
RNA
I
qhioi
FIG. 3. S, nuclease mapping of cleavage sites in Y’-terminal region of P-globin mRXA. RNA preparations were subjected to S, mapping analysis with the 3’ EcoRI probe, as described in Materials and Methods. Samples of lysate were incubated in the presence or absence of RNase T,, as described in from polysomes isolated after the incubations (lanes Materials and Methods, and RNA was obtained h to P). I)eproteinized polysomal RNA from the untreated lysatr was incubated with or without KNasr T, (lanes f to i). Samples of total RNA from each preparation and of the RNA fraction that does not, bind to oligo(dT)-cellulose (poly(A)RNA) were used for S, mapping. Lanes b, RNA from uninwhated lysate: lanes c and f, samples of lysate and of deproteinized RBA incubated without RNasr T,; lanes d and e, samples from lysate incubated with 5 x IO-’ and 5 x 10m4 units of RNase T,. respectively; lanes g. h and i, RNA incubated with 1.5 x 10m6. 1.5 x 10m5 and 1.5 x IO-& units of RNase of pHR322 labeled by reaction with ‘I‘, respectively; lanes a, HhaI restriction fragments plynuc~lrotide kinase: lane j. probe hybridized with 1 pp of yeast RSA instead of polysomal RNrl fragments.
xxx
(; 480
490
.~I,I~t
87’ .1/.
1tw
51u
120
110
GCUCACAAAVACCACUGAGAUCVVVUUCCCUCUGCCAAAAAUUAVGGGGACAUCAVGAAG IO
8”
90
100
110
!?”
Endogenou?
RNase
-
0
T,
540
550
560
570
580
589
CCCCVUGAGCAUCUGACVUCVGGCVAAUAAAGGAAAUUUAVVUUCAVVGCAAA----A 130
T,
150
160
110
--
Endogenous
RNose
110
---
ho. 4. Map of cleavage sites in the Sterminal region of P-globin mRNA. Ckavage sites are represented by bars under the mRNA sequence. The location of sites was derived from the sizes of protected probe fragments shown in Figure 3. Numbers above sequences indicate distances (in nucleotides) from 5’ end of mRNA: numbers below sequences indicate expected sizes of protected probe fragments at given positions on the mRNA chain. The open bar represents a cluster of G residues that is not cleaved by RNasr T,. The termination codon is UGA at positions 495 tjo 497. Sequence data are from Efstratiadis r/ al. (1977). Sequence hyphens have been omitted from the Figure for clarity.
molecules, and also by molecules that were fragmented outside the region between the EcoRT site and the 3’-terminus (see Fig. 1). The probe contains two T residues complementary to the beginning of the poly(A) sequence (Efstratiadis et al., 1977), and the fragment protected by intact mRSA should have 172 residues. This is close to the 174 size estimate for the top band. The lanes in Figure 3 that represent’ undigested polysomal RNA (b and f) show additional bands. These can be accounted for by the presence of truncated mRXA chains, presumably derived from intact molecules by endogenous cleavages. The sites of cleavage, estimated from the sizes of the protected probe fragments, are indicated in Figure 4. The fact that each site is represented by a cluster of bands is probably due in part’ to the inability of SI nuclease to stop the digestion precisely at the boundary of hybrids. This enzyme has been shown to nibble at the ends of DNA-RSA hybrids and also to leave overhanging ends (Weaver & Weissmann, 1979; Green B Roeder, 1980; Hentschel et al., 1980). All the endogenous sites contain A-U sequences and every A-U sequence in this region is represented by a cleavage site (Fig. 4). The bands vary in intensity and the more intense clusters of bands tend to represent sites with more than one A-l’ sequence. One of the bands, corresponding to site 549 to 553. is very weak. The endogenous bands are considerably enriched in the polysomal R’KA fraction that does not bind to oligo(dT)-cellulose, as could be expected of RI\;A fragments devoid of poly(A). This fraction still has a substantial proportion of intact molecules with at least the first two A residues of the poly(A)
CONFORMATION
OF RABBIT
/Y-GLOBIN
mKS.4
889
sequence, as indicated by the fact that it can protect a probe fragment that, includes the two complementary T residues. The above cleavages could have been generated by an endogenous enzyme during the preparation of the cell lysate and the isolation of the polysomes. In order to examine this possibility, the lysate was incubated at 37°C before isolation of the polysomes. The analysis of the polysomal RNA from the incubated lysates showed that this treatment did not cause any increase in the endogenous cleavages (compare lanes b and c). The decrease in band intensity seen in lane c was not observed consistently. In these experiments, the lysate had been supplemented with buffer at pH 7-0, salts and cycloheximide to prevent ribosome runoff. Incubation of the lysate without any of these additives, t’o approximate the conditions prevailing during cell lysis. also failed to generate any increase in the cleavages (data not shown). The globin mRNA in the lysate was susceptible to the action of RXase T,. As can be seen in Figure 3, lanes d and e, the exogenous enzyme caused additional cleavages. h’early all the G-containing sit’es were cleaved by the enzyme. One site consisting of a cluster of four G residues at positions 525 to 528 was inaccessible to the exogenous nuclease and the G residue next to the poly(A) sequence seemed to be affected to a relatively small extent. Incubation of deproteinized polysomal RSA with RSase T, resulted in a pattern of cleavages very similar to t’he one generated in the whole lysate (see lanes g, h and i). The G cluster at 525 to 528 remained unaffected, but the G next to the poly(A) seemed more accessible. The incubations with R?iase T, affected a relatively small portion of t,he mRXA molecules. This is indicated by the fact that there was little decrease in the intensity of the top band derived from the mapping of the unfractionated mRKA preparations. The molecules with short poly(A) segment’s unable to bind t,o oligo(dT)-cellulose seemed far more vulnerable to t,he enzyme. This is indicated by the nearly complete disappearance from this fraction of the top band. representing intact mRNA with oligo(A) segments. This preferential digestion of the mRKA chains with short poly(A) segments occurred both in the whole lysate and in deproteinized RNA (see Fig. 3).
(c) The St-terminal
region of p-glob&
mR,VL4
The 5’ EcoRT probe covers a large portion of the mRNA (see Fig. 1). It yielded information on cleavage sites within the first 250 nucleotides of the globin RSA chain. Relatively few endogenous cleavages were observed in this region (Fig. 5. lane a). These were distributed at widely scattered positions in the coding region and were more prevalent in the 5’ non-coding region. The labeled bands corresponding to the latter cleavages, however, were not well resolved because of their large sizes. The shorter, 5’ NaeIII probe, generated as outlined in Figure 2, permitted a better resolution of the cleavage sites in the 5’ non-coding region. This probe covers the first 122 nucleotides of the mRNA (past the first 13 residues not included in the cDNA insert), but is contaminated by a labeled fragment 47 nucleotide long that covers a segment far inside the coding region (see Fig. 2). The
270 259
190
(‘ONFOKMATION
0
b
c
OF RABBIT
d
I
,C(:I,OBlS
e
f
mKX.1
9
891
h
kc:. 6. S, nucleasr mapping of thp beginning of the 5’.trrminal region of &&bin mRSA. obtained wit,h the .5’ liar11 I probe. See Fig. 5 for details. Lane i represents a probe hyhridizrd with 1 /~g yrast tRS.4 instead of the polysomal KS.\ preparations.
(;. .\I,RIiE(‘H’I
E7’ .-II. 40
20
60
ACACAACUGUGUUUACUUGCAAUCCCCCAAAACAGACAGAAUGGUGC (110) (90) II-
m S
61
100
80
120
AUCUGUCCAGUGAGGAGAAGUCUGCGGUCACUGCCCUGUGGGGCAAGGUGAAUGUGGAAG (50) 320 (70) Endogenous RNose
T,
w
-
121
m 140
160
180
AAGUUGGUGGUGAGGCCCUGGGCAGGCUGCUGGUUGUCUACCCAUGGACCCAGAGGUUCU 300 260 260 Endogenous RNase
T, 161
Endogenous RNase
T,
220
200
240
UCGAGUCCUUUGGGGACCUGUCCUCUGCAAAUGCUGUUAUGAACAAUCCUAAGGUGAAGG 200 220 240 --
FIG, 7. Map of cleavage sites in the 5’.terminal portion of /3-globin mRNA. Numbers above sequences indicate distance (in nucleotides) from 5’ end of mRNA; numbers in parentheses below sequences indicate expected sizes of the protected 5’ Hue111 probe fragments at given positions: numbers without parentheses are corresponding sizes of the protected 5’ EcoRI probe. The double bar indicates a site highly exposed to RSase T, next to initiation codon AVG. For other details see Fig. 4. Sequence hyphens have been omitted from the Figure for clarity.
results of 8, mapping with this probe are shown in Figure 6. The major top band represents a labeled fragment of 124 residues. This is close to the expected size of probe fragment protected by intact mRNA (122 residues). The other major band, of 47 residues, corresponds to the smaller labeled fragment fully protected by mRNA. The region between these two bands covers cleavage sites in the 5’.terminal portion of the mRNA that can be mapped by the 5’ HaeTII probe. The control lane with RNA omitted from the hybridization mixture (lane i) showed several bands, which probably represent reannealed Hue111 plasmid DNA fragments. These bands were not observed with the EcoRI probes. They had relatively little adverse effect on the identification of cleavage sites. The cleavage sites identified with the use of the 5’ probes are indicated in Figure 7. A major portion of the non-coding region contains sites subject to endogenous cleavage, but only three such cleavage sites were observed among the first 180 residues in the coding region. Few of the endogenous cleavages were at or near A-U sites and most of the A-U sequences in the region subjected to analysis were not subject to endogenous cleavage. Again, preincubation of the lysate at 37°C did not cause any increase in endogenous cleavages. This incubation caused a reduction in the cleavages at positions 42 to 47 (compare lanes a and b in Fig. 5; see also Fig. 6). This effect was observed consistently. but we have no information concerning its possible significance.
(IONFORMATION
OF RABBIT
b-GLOBIN
mKNA
893
The 5’-terminal portion contained relatively few sites accessible to Rh’ase T, (see Fig. 5, lanes c, d, f, g and h). The 5’ non-coding region, which is rich in endogenous cleavage sites, showed very little sensitivity to this enzyme (Figs 5 and 6). The deproteinized RNA had one highly sensitive site, located in the vicinity of the initiation ACG codon. This site was far less exposed in the lysate. This difference in extent of cleavage was not due to low a,ctivity of the added enzyme in the l-pate, as indicated by the extensive cleavages at the 3’ end of the mRNA under the same conditions (see Fig. 3. lanes e). The segment between positions 213 and 236 in the coding region was exposed to the action of the both in deproteinized RNA and in the cell lysate (Figs exogenous enzyme, 5 and 7). The same segment contained two of the three endogenous cleavage sites identified in the coding region. Another site, representing a cluster of G residues at positions 192 to 195, was exposed to some extent in the RXA and masked in the lysatr. Some G residues around positions 114 and 123. on the other hand, were somewhat exposed in the lysate and masked in the free RXA.
4. Discussion (a) Identi$cation
of cleavage sites
The S, nuclease mapping procedure described in this paper permits the identification of cleavage sites in mRNA molecules that have been subjected to limited fragmentation. The precision of this procedure is somewhat limited. because of the inability of the enzyme to cut exactly at the boundary of basepaired regions of DNA-RNA hybrids. Thus, individual cleavage sites are represented not by protected probe fragments of unique size, but by clusters of fragments. The degree of precision of the procedure can be assessed by comparing the RNase T, cleavage sites determined experimentally with the location of G residues along the RNA sequence. As can be seen in Figure 4, the T, cleavage sites, defined by the sizes of band clusters, overlap the positions of G residues. The boundaries of these sites are not more than three nucleotides away from the G positions. This degree of precision proved to be sufficient’ for the unambiguous identification of the G residues in the 3’ non-coding region that are accessible to RNase T,. One cluster of G residues was clearly protected from the action of the enzyme. The band clusters that appear to represent, endogenous cleavages are about as broad as those representing RNase T, cleavages. In all but one case. t’he boundaries of these endogenous cleavage sites are within two nucleotides of A-I’ sequences. The three broadest clusters represent sites with two such sequences. These features lead us to believe that the RXA preparations contain chains cleaved by an enzymatic system directed specifically at A-U sequences. The identification of cleavage sites in the Fit-terminal region of the mRNA was less straightforward. The region beyond position 48 is rich in G residues, and the sites affected by RNase T, could not all be defined precisely. The site that is highly sensitive in the deproteinized RXA is clearly close to the initiation AUG codon. but the identification of some of the other sites is less certain. The 5’ non-
X94
(:. AI,I~Rl<('HT
h"/‘ AI,
coding region contains several endogenous cleavage sites. but only one of them appears to represent an A- I’ sequemf%. Some of the cleavages in the coding region muld ha,ve been produced by the enzyme specific* for ,\-I1 sites as well. It seems fairly certain that different endogcnous enzymes were involvcld in the generation of cleavages at the two extremities of’ the mRr\;A (*hair]. (h) SiqniJicn rice of the endoqenous cleavaqes
The endogenous cleavages in the 3’-terminal region appear to have been generated by an endonuclease that recognizes A-U sequences. A nuclease with this specificity has been identified in HeLa cells, where it is associated with lysosomes (Saha et al., 1979; Saha, 1982). This type of enzyme could have been responsible for the observed cleavages, but it remains to be determined whether these were produced as part’ of the mRXA decay process in maturing reticulocytes, OK whether they were generated only after cell lysis. The reticulocyte lysate contains nuclease activity. as indicated by the fact that labeled deprot,einized RKA is degraded extensively when incubated with small samples of the extract. The endogenous a&iv+,- is great’er at neutral pH than at pH 5.5, unlike the acidic lysosomal HeLa cell enzyme. Incubation of the lysate at 37”C, however, did not cause any increase in t,he endogenous cleavages in the globin mR?iA. It appears that the conditions in the extract after cell lysis are not favorable for the action of endogenous nucleases on the globin mRNA in its native configuration. The possibility remains, however. that an enzyme analogous t’o the lysosomal HeLa cell nuclease occurs in reticulocytes, and that transient) exposure to such an enzyme during cell lysis could have generated some of the cleavages in the globin mRNA. The cleavages in the 5’ non-coding region appear to have been directed at U-U-A, U-C-G and A-A-U sequences. as well as at a cluster of A residues. The four G residues near these sit’es are not accessible to R?iase T, in the extracts. This tends to indicate that the sites in the 5’ non-coding region would not have been reached easily by an endogenous nuclease active during cell lysis. It is more likely, therefore. that the endogenous cleavages might have been generated primarily in the intact cells. These findings raise the possibility that mR?\‘,4 decay begins with cleavages at specific sites and that intermediates in the degradation process could be identified. Further work will he required t)o determine whether any of the endogenous cleavages identified in this study are part of the process of mRP\‘A degradation in rrt,iculocytex. (c) A possible effect of ply(A)
on mRNA
protection
The analysis of the RNA fraction unable to bind to oligo(dT)-cellulose provided information possibly relevant to the question of poly(A) function. This fraction, although designated as “poly(ARXA”, includes mRNA chains with short poly(A) segments. Tt has been estimated that molecules with less than 10 to 30 adenylate residues are unable to bind to this adsorbent’ (Brawerman, 1981). These chains terminated by oligo(A) segments are represented in S, mapping patterns of
(IONFORMATION
OF RABBIT
fi-(iLOUIS
mR?i.A
895
poly(A)- RNA by the band of 174 residues seen in Figure 3. The intensity of this band is sharply reduced when poly(A)- fract,ions from preparations exposed to RNase T, are analyzed. This leads us to conclude that mRNA chains with short poly(A) segments are preferentially digested by this enzyme. This finding suggests that the presence of t.he longer poly(A) sequences on mR?iA can make these molecules less sensitive to digestion by nucleases. The greater sensit’ivity of poly(A)- mRX,4 chains was observed both in deproteinizetl RNA and in the RNA as it exists in the cell Iysate. (tl) Features
of r&it
fl-globin
m
RXA configuration
The analysis of sit’es sensitive to R?\‘ase T, provided some insight into the configuration of the p-globin mRNA. The 3’ non-coding region proved to br highly accessible to this enzyme, both in deproteinized mR?iA and in mRNA in its native configuration in the lysate. Tn contrast, the 5’ non-coding region was essentially inaccessible to RNase T,, even in the deproteinized mRNA. The latter contains one highly exposed site, next to the initiation AIIG codon. This site was far less accessible in the lysate. possibly because of the presence of ribosomes on the mRNA chains. The high degree of accessibility of the initiation AUG in drproteinized rabbit P-globin mRXA has been described (Pavlakis et nl., 1980). The segment covering the first, 150 nucleotides of the coding region is remarkably resistant to the action of RNase T,. This indicates the occurrence of a high degree of folding in this RNA species. Only relatively minor differences in conformation have been observed so far in the mRSA in its presumably native state in rrticulocyte extracts. Further studies of the mR?L’A in different functional states might, reveal &u&Ural features possibly relat,ed to the translation process. \Vr thank Dr John C’offin. who suggested the basic experimental approach, I>r St,uart TA$ricr and Mr Brian Mermer for t’echnical advice and MS Ann Boyle for technical assistance. This work was supported by research grants from the National Institutes of Health ((:M17973) and t,he National Science Foundation (P(‘M8020712). REFFRE’CC’FU 1 I/AS 10. I-38. Rrawrrman, G. (1981). (‘rit. Rev. Riochem. Efstratiadis, A., Kafatos, F. C. & Maniat’is, T. (1977). Crll, 10, S--585. Groghegan, T. E., Sonenshein, G. E. & Brawerman. (:. (1978). Biochemistry. 17, 4200-4207. Crew. M. R. bt Roeder, R. U. (1980). CPU,22, 231-242. HrntscGhrl, C‘.. lrminger. .I. C.. Buchrr. 0. Br Rirnstirl. M. T,. (1980). ,Vaturr (London), 285. 147-151. Lodish. H. F. (1971). J. Hid. Chem. 246, 7131-7138. Maxam. A. M. & Gilbert, W. (1980). Methods Enzymol. 65. I. 499-560. Sevins, .I. R. (1983). Annu. Rev. Biochem. 52, 441-466. I’att,on, .J. R. & Chae, C’. B. (1983). J. Biol. Cham. 258. 3991L399.5. Pavlakis. C:. S., Lockard, R. E.. Vamvakopoulos. S.. Riesrr. I,., RajBhandary. I’. L. B Vournakis. ,J. S. (1980). Cell, 19, 91-102. l’c~lharn. H. R. B. & *Jackson, R. ,J. (1976). E’ur. J. Biochem. 67, 247-256. Qu. 1,. H., Michot, B. & Bachellerie. J. P. (1983). Sucl. Acids Kes. 11. 5903-5920. &ha. K. K. (1982). NucZ. Acids Res. 10, 645--652. Saha. ti. K.. Ciraham, M. Y. $ Srhlessinger. I). (1979). J. Niol. f’hrm. 254. .5951-5957.