- Email: [email protected]
Conidial anastomosis fusion between Colletotrichum species
Mycol. Res. 108 (11): 1320–1326 (November 2004). f The British Mycological Society
1320
DOI: 10.1017/S0953756204000838 Printed in the United Kingdom.
Conidial anastomosis fusion between Colletotrichum species
Maria Gabriela ROCA1,2#, Lisete C. DAVIDE1, Livia M. C. DAVIDE1, Maria C. MENDES-COSTA1$, Rosane F. SCHWAN1 and Alan E. WHEALS1,2* 1
Department of Biology, Universidade Federal de Lavras (UFLA), Lavras – MG 37-200 000, MG, Brazil. Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK. E-mail : [email protected] 2
Received 12 September 2003; accepted 19 June 2004.
Colletotrichum lindemuthianum is a pathogen of the common bean plant (Phaseolus vulgaris) causing anthracnose. Large numbers of isolates can rapidly arise with different genetic and chromosomal compositions but their origin is unknown since sexual fruit bodies have only been found in the laboratory. We have recently described the occurrence of special kinds of hyphae that create anastomoses directly between conidia. In this work we show that conidial anastomoses can occur between two different Colletotrichum species. The implications of this observation on the generation of genetic diversity in these species are discussed.
INTRODUCTION Colletotrichum species are amongst the most successful plant pathogenic fungi, causing anthracnose on a wide range of growing plants from both temperate and tropical environments (Bailey et al. 1992). C. lindemuthianum produces damage on the stems, leaves and fruit of the common bean, Phaseolus vulgaris (Rava & Sartorato 1994, Perfect, Hughes & O’Connell 1999) and C. gossypii infects cotton plants (Waller 1992). The genus is of considerable economic importance, yet little is known about the phylogenetic relationships within this group of species, particularly C. lindemuthianum and C. gossypii (Bailey et al. 1992, Manners et al. 1992). Chromosome polymorphisms were found in C. lindemuthianum by pulsed-field gel electrophoresis (PFGE) and microscopy (O’Sullivan et al. 1998, Roca, Mendes-Costa & Davide 2003). A cytogenetic study during sexual reproduction partially confirmed this chromosomal variation (Roca, Davide & Mendes-Costa 2003). Co-inoculation of different isolates of the related C. gloeosporioides has been shown to lead to single chromosome transfer between different strains (He et al. 1998). However, there is a dearth of * Corresponding author. # Present address: University of Edinburgh, ICMB-King’s Building, Edinburgh EH9 3JG, UK. $ Present address: UNILAVRAS, Rua Padre Jose´ Poggel 506, Lavras – MG 37200-000, Brazil.
knowledge about the actual mechanisms that could be involved allowing fusion between different strains. Attempts to demonstrate the parasexual cycle in C. lindemuthianum have been unsuccessful (Bos 1985, Brooker et al. 1991, Chacko et al. 1994, Roca 1997, He et al. 1998). Hyphal anastomoses that allow cytoplasmic connections and nuclear exchange in filamentous fungi can occur in the laboratory, but whether these connections can be found in nature is unknown (Zeigler 1998, Glass, Jacobsen & Shiu 2000). A wide diversity of C. lindemuthianum isolates was found, suggesting that some kind of recombination had occurred during the asexual stage and not by sexual reproduction (Brygoo et al. 1998, Rodriguez-Guerra et al. 2003). Genetic diversity analysis of 200 isolates of C. lindemuthianum using molecular data revealed it to be a highly variable species at levels that were ‘ common for sexually reproducing pathogens ’ (Mahuku & Riascos 2004). A low diversity even exists within C. lindemuthianum isolates obtained from the same plant, and even from the same lesion (RodriguezGuerra et al. 2003). Hyphal fusion is ubiquitous in fungi and is found during many stages in their life-cycles, but its physiological roles are still poorly understood and require further experimental analysis (Glass et al. 2004). Fusions have been reported to occur in ca 20 species (De Bary 1884, Laibach 1928, Roca et al. 2003 : Table 5) and even between members of different species (Ko¨hler
M. G. Roca and others
1321
Table 1. Colletotrichum lindemuthianum strains used. Collectiona
Physiological raceb
Origin
H2c 458, 466, 467 1004, 1006, 1012 401, 538, 1023 1020, 1020F, 1020C
0 64 73 81 2047
Unknown Vic¸osa – Brazil South Minas Gerais – Brazil South Minas Gerais – Brazil Central America
a Code in the collection of the Department of Biology, Federal University of Lavras, Minas Gerais, Brazil. b The physiological race of each strain was confirmed twice by inoculating a conidial suspension to 12 differential test cultivars following standard procedure and methodologies. The degree of pathogenicity was measured by the International Binomial Standard Method (Menezes & Dianese 1988). c Genetically modified by transformation with a plasmid (pAN7-1) containing a hygromycin-resistance gene (Punt et al. 1987) and a GFP fusion protein gene with an endopolygalacturonase gene promoter (Dumas et al. 1999). It was re-isolated by monospore culture.
1930, Ishitani & Sakaguchi 1956). We have recently shown that condidial anastomosis tubes (CATs) form readily between conidia within acervuli during conidiogenesis in C. lindemuthianum and C. gossypii (Roca et al. 2003). Cytoplasm and organelles move along the tubes resulting in conidia without nuclei or with more than one nucleus. This observation led us to conjecture that CATs could provide a novel mechanism for nuclear exchange and would help to explain both literature reports of genetic variation and some horizontal transfer events that have been demonstrated in these species (Poplawsky et al. 1997, He et al. 1998). Here we demonstrate the fusion between different species and the appearance of strains of mixed parentage.
MATERIAL AND METHODS Strains and culture conditions The species used were strains of Colletotrichum lindemuthianum (Table 1) and a single isolate of C. gossypii from cotton plants. Strain H2 is hygromycin-resistant. Monosporic cultures used in this study were obtained using a diluted suspension of conidia in 0.1 % Triton X-100 spread on a Petri dish. After germination of single conidia, single spores were picked up with a needle from the resulting colonies. The monoculture colonies were maintained for growth and sporulation on modified Mathur’s (M3S) medium (Tu 1985) at 20 xC. Cytology The in vivo fluorescent stains Calcofluor White (for cell walls), DAPI (for nuclei) and DiCO6 (for mitochondria) were from Molecular Probes (Haugland 1996) and were observed with an Olympus BX-60 fluorescence microscope or a confocal microscope LSM510.
Pairings Vegetative incompatibility tests (Brooker, Leslie & Dickman 1991) were made using conventional methodologies between all pairwise combinations of the strains listed in Table 1. This was assessed with a mycelial incompatibility test. Pairings were also promoted using a mixed conidial suspension that was inoculated onto M3S medium plates (Tu 1985). Two kinds of pairings were made : intraspecific in different combinations, between C. lindemuthianum strains H2, 401 and 1020 and interspecific between H2 and C. gossypii. After 20–30 d, individual acervuli were isolated, crushed and the spores resuspended. Single conidia were replated by dilution in hygromycinselective medium for interspecific pairings. Slide culture Samples were grown in microscope slide wells filled with solid M3S media and covered with a cover slip. Conidial suspensions were diluted and ca 200 conidia were inoculated between the medium and the cover slip. The germination process was monitored in the microscope every 3 h for the first 2 d, then every 6 h until the formation of a colony and recorded using a digital camera on a phase contrast microscope. PCR PCR was performed on the parents and the isolates from the original pairing after passage (subculture) onto M3S+hygromycin (400 mg mlx1) medium to confirm resistance. Fresh template DNA was isolated in high temperature incubation (van Zeijl et al. 1998, Roca, Davide & Wheals 2003) from a small quantity of mycelium. Parental samples were from liquid medium surface culture. The 5k–3k sequences of primer pair hphr1 (GCAGCCGGTCGCGGAGGCCATGG) and hphr6 (CGCCCGGAGCCGCGGCGATCCTGC) were designed on the hygromycin-resistance gene of plasmid pAN7-1 (Punt et al. 1987) using 55 x as annealing temperature under standard conditions. There are 3 integrated copies of plasmid pAN7-1 in strain H2 (Dr. B. Dumas ; personal communication) and the banding pattern could be altered in recombinant strains (Arnau & Oliver 1993). A 50 bp ladder (50 bp–2 kb) was used (NovagenTM, Darmstadt) as a marker. Subcultured monoconidial colonies of the original strains were routinely monitored using these primers throughout the course of the experiments and showed no significant difference to the original isolates. Passage The first passage (replication) was made onto a water agar square (7 mm2) that was immediately transferred on to M3S medium (for anastomosed conidia coming from intraspecific pairings) or M3S+hygromycin
Conidial anastomosis fusion in Colletotrichum medium (for single conidia coming from interspecific pairings). Successive passages (subcultures) were made with needles (using single spore isolates at least for the first three subcultures ; see above). Parental strains and strains coming from pairings were tested in different media (M3S and M3S+400 mg mlx1 hygromycin) over at least seven passages (once every 3–4 wk) extending over approx. six months. C. lindemuthianum strain H2 is hygromycin-resistant at 400 mg mlx1 (Dumas et al. 1999) with black mycelia. C. gossypii is hygromycin-sensitive and has pink mycelia. Both strains have salmon-pink coloured acervuli or conidial mass. The fifth passage was through bean cultivars in the glasshouse to confirm anthracnosis symptoms (Menezes & Dianese 1988).
1322
5d
RESULTS The Colletotrichum lindemuthianum isolates used showed complete vegetative incompatibility in all pairwise combinations in standard tests (Figs 1–2). This indicates that heterokaryosis did not occur by this method in these series of experiments. The role of growth inhibition by deficient or depleted media was tested by cutting samples from the region of potential contact and placing them on fresh medium (Fig. 2). The strains grew and sporulated but did not intermingle (Fig. 2). CATs between conidia of different parentage occur when they were placed in close proximity. This was achieved in two ways ; first, by the development of a single acervulus from two conidia. When two conidia from a conidial suspension germinate close together they can form coiled hyphae producing a single asexual fruiting body (Figs 3–4). Secondly, it could occur by having adjacent fruiting bodies in very close proximity (Figs 5–6). Fruiting bodies develop at high density, may contain 1r106 spores and the open boundaries of the acervuli could permit direct contact between conidia from different sources (Figs 7–8). The cotton plant pathogen C. gossypii produces CATs, has a faster extension rate than C. lindemuthianum, is hygromycin sensitive, has a pink-coloured colony and the conidia are elongated in shape. These different phenotypic markers were used to compare with C. lindemuthianum Strain H2 (Figs 9–10). High-density co-inoculation of conidia was used to attempt the creation of recombinant strains between a hygromycin resistant strain of C. lindemuthianum and C. gossypii (Figs 9–10). The ensuing culture (Fig. 11) was allowed to mature for 30 days and a uninucleate spore suspension at a density of 4.1r106 conidia mlx1 was made from a single asexual fruiting body. 100 ml of suspension (4.1r105 conidia) was spread on M3S+hygromycin medium and yielded a mean of 226 colonies per plate (n=5; SD=¡60), a germination rate of 0.6r10x4. This compares to a typical germination rate of between 2 and 17% for either species in
Figs 1–8. Intra-specific pairings ; C, conidium. Fig. 1. Incompatibility test in M3S medium after 25 d growth. Fig. 2. Depleted medium test; the large arrow indicates no intermingling region; the small arrows indicate some sporulation. Fig. 3. Coiled germ tubes from conidia from a slide culture pairing after 12 h. Bar=11 mm. Fig. 4. Acervulus formed from the same sample after 5 d. Bar=25 mm. Fig. 5. Two acervuli (arrows) that were close enough to allow conidia from each to be in physical contact; the original sample contained a mixture of conidia from two different strains. (s) seta. Bar=50 mm. Fig. 6. Digital drawing of two adjacent acervuli (lateral view). Fig. 7. Crushed, complete acervulus in aqueous suspension ; transmission light microscopy. Bar=20 mm. Fig. 8. Detail of the marked area in Fig. 7 ; DiOC6 staining a group of mitochondria and membranes (arrow). CATs (a). Bar=8 mm.
M3S medium and a similar value for C. lindemuthianum and 0 % for C. gossypii in M3SH medium. Over 200 independent hygromycin-resistant colonies were subcultured (first passage). The developing colonies were very variable in appearance with some showing distinct phenotypic
M. G. Roca and others
1323
Figs 9–17. Inter-specific pairings ; C, conidium ; and (a) CATs. Fig. 9. Parents, Colletotrichum lindemuthianum strain H2 (C.l.) and C. gossypii (C.g.). Fig. 10. Uninucleate conidia of parents. Bar=4.5 mm. Fig. 11. Mixture of conidial types ; the arrow points to a group of acervuli. Fig. 12. Some hygromycin resistant colonies after the second subculture. Fig. 13. Third subculture on solid media. Fig. 14. PCR of the putative hybrid using the pAN7-1 plasmid primers hphr1–hphr6 ; MM, 100 bp ladder; Cl, C. lindemuthianum strain H2 ; Cg, C. gossypii; x, hybrid ; P, plasmid as a control. Figs 15–17. Some anastomosed conidia from the third subculture of recombinant plates ; Cl and Cg denote species ‘ types ’; in vivo stain with Calcofluor White. Bar: 5 mm. Fig. 15. A CAT between Cl-type conidia. Fig. 16. A CAT between Cg-type conidia. Fig. 17. A CAT between Cl-type and Cg-type conidia.
sectors of both parental types (Figs 12–13). Eighteen of these isolates with pink-coloured colony C. gossypii phenotypes were subcultured (second passage) without hygromycin. To obtain monosporic cultures, first a Triton-wettable spore suspension was made and
plated and secondly, after individual conidia began to germinate they were cut out under the microscope and propagated individually on fresh medium. Later passages were subcultured alternately with and without hygromycin, a procedure that would further select for
Conidial anastomosis fusion in Colletotrichum
1324
Table 2. Average growth rate of Colletotrichum parents and putative hybrids.
Strain
Growth rate of isolates (cm dx1)a
C. lindemuthianum H2 C. gossypii Second passage (n=9) Third passage (n=7)
0.52 a 0.96 b 0.49 a 0.64 c
The data are growth on M3S medium. a Different letters signify means that are significantly different by Tukey’s test with 18 replications.
Table 3. Colletotrichum conidial shapes and sizes. Conidia
Strain C. lindemuthianum H2 C. gossypii Second passage (n=2) Third passage (n=4)
Length, L (mm)*
Width, W (mm)
L/W
Shape
6.75
1.2
Oval
15.0 e 12.4–13.2*1c–d
5.8 n.d.
2.58 n.d.
11.3–12.2*1b–c
6.5
1.79
Elongate Small, elongate Elongate
8.0 a
The sample size to calculate the mean parental values was 30 conidia from fresh samples suspended in PBS buffer. * Different letters signifies means that are significantly different by the Scott Knott test. 1 =Range of means; n.d.=not done.
hygromycin-resistance (a C. lindemuthianum phenotype) but allow the faster growing C. gossypii an advantage on hygromycin-free medium. One pink-coloured colony that also had C. gossypii-like spore shape and size was selected for study (after the second passage on hygromycin-free medium). Putative hybrid strains were subcultured seven more times every 3–4 wk. On non-selective media the colonies were approximately an equal mixture of pink/black and pink colonies with a few purely black colonies. The same strains when grown on M3S medium plus hygromycin were mostly black. C. gossypii is the more rapidly growing of the two species but the hybrid strains had an intermediate growth rate on plates (Table 2). Examination of the spore shape also suggested that the spore suspensions were not a mixture of two types of spores but were hybrid spores with a length :width ratio intermediate between the two parents (Table 3). The putative recombinant form was tested for its ability to grow on bean cultivars (see legend to Table 1). C. lindemuthianum parental strain H2 was classified as race zero (non pathogenic to tester cultivars) and strain 1020 was race 2047 (pathogenic to tester cultivars). Three different hybrid strains between C. lindemuthianum and C. gossypii were evaluated and the results varied in race designation from zero in two isolates to ca 3500 in a third one, the most pathogenic isolate so far reported in Brazil and one of the higher
race values found (Balardin & Kelly 1998, Mahuku & Riascos 2004). Other colonies were scored with respect to mycelial colour and hgromycin resistance and showed wide phenotypic variation. Serial propagation through a total of seven passages with maintenance of periodic selection for hygromycinresistance still resulted in colonies that became progressively like C. gossypii both in mycelial colour and conidial shape (Figs 9–10) while retaining hygromycin-resistance, the basis of which is a chromosomally integrated gene (Dumas et al. 1999) from C. lindemuthianum strain H2 (Fig. 14). After one year of alternating subculturing over ten times on the two media, the hybrid was completely pink, independently of the medium, gossypii-like in form, hygromycin resistant but could no longer cause disease in beans (a change that had occurred after 8 months). Cytological observations of conidia in the putative recombinants showed different combinations of conidial shapes and abilities to form CATs (Figs 15–17).
DISCUSSION Our data provide prime facie evidence for a novel mechanism that allows fusion between two different species and probably permits the exchange of genetic material between Colletotrichum gossypii and C. lindemuthianum based on transmission through CATs that develop within acervuli (Roca et al. 2003) : micromanipulated conidia when located close to one another can produce a single acervulus ; mass inoculation of conidia at high density with strong selection can yield apparently inter-specific heterokaryon or strains of mixed parentage ; these forms are sufficiently stable to be maintained in culture for over one year even when selection is only for one parent ; and the strains show phenotypic properties intermediate between the parents. The monosporic cultures strongly suggest that the strains are some kind of recombinant. The frequency of these inter-specific recombinants was very low when isolated on hygromycin medium. This could simply be due to frequent hybridisation followed by the faster growing C. gossypii species outgrowing (or out-replicating) C. lindemuthianum. However, since the germination rate of the ‘ hybrid ’ was less than the hygromycin-resistant parent from which it came, it suggests that the process is rare and/or of low efficiency and/or the initial hybrids were less fit. Despite this, natural selection will ensure propagation of any hybrid with a selective advantage. It has proved possible to get anastomoses developing outside the acervulus only very rarely (Roca et al. 2003) and we were not able to confirm hybrid production directly by micromanipulation. However, Fig. 17 provides evidence of hybrid anastomoses derived from different anastomosed conidia, although it does not provide evidence of colony production of vegetatively incompatible strains. What remains to be determined is the genetic structure of
M. G. Roca and others the ‘hybrids ’, the rate of segregation of parental characters, whether it is possible to create hybrid anastomosed conidia directly and what is the mechanism for avoiding vegetative incompatibility. If a diploid or dikaryotic stage does occur via CATs it must be unstable (Bos 1985, Brooker, Leslie & Dickman 1991, Roca 1997) and binucleated conidia were not found using DAPI staining of early stages of fusion. He et al. (1998) showed that a limited genetic recombination occurs between incompatible strains of C. gloeosporioides via a nonsexual pathway, and, as we found previously, C. gloeosporioides does form CATs (Roca et al. 2003). Natural co-infection of a plant with different strains of C. lindemuthianum could easily lead to adjacent or mixed fruiting bodies with CATs between different strains. Rodriguez-Guerra et al. (2003) showed the occurrence of distinct haplotypes within single masses of conidia in plant lesions collected from the field in Mexico. In the saprophytic stage, growth of adjacent colonies of different species on decaying plant material could provide opportunities for fusion between different strains. With normal vegetative incompatibility barriers overcome this mechanism provides a route for the introgression of genetic material (horizontal gene transfer) as has been suggested by He et al. (1998) : CAT fusions could provide the opportunity to acquire supernumerary chromosomes (He et al. 1998) and also provide an explanation for the origin of genetic diversity in species with rare or no sexual reproduction (Kistler & Miao 1992, Rosewich & Kistler 2000, Mahuku & Riascos 2004). Further work on the genetic implications of CATs in this genus and other genera in which CATs have been seen, for example Botrytis and Neurospora (Roca & Read, unpubl.), could help resolve this paradox. The relationship between observed variation and the mechanisms for creating it in Colletorichum and other species is controversial (Brygoo et al. 1998, Saupe 2000) since there is little direct evidence on the mechanism of how hybrid fungi could rise in nature. It is an important issue because the evolutionary potential of a population is proportional to its level of genetic variation (Brasier 2000). Our observations could help to provide an explanation for the complex dynamics of Colletotrichum populations in the absence of both sexuality and parasexuality. ACKNOWLEDGEMENTS We thank Eduardo de Souza Lambert for statistical analyses and Bernard Dumas (Universite´ de Toulouse, France) for strain H2. This work was supported by a fellowship to MGR from CAPES and–financial support and scholarships from FAPEMIG.
REFERENCES Arnau, J. & Oliver, R. P. (1993) Inheritance and alteration of transforming DNA during an induced parasexual cycle in the imperfect fungus Cladosporium-fulvum. Current Genetics 23: 508–511.
1325 Balardin, R. S. & Kelly, J. D. (1998) Interaction between Colletotrichum lindemuthianum races and gene pool diversity in Phaseolus vulgaris. Journal of American Society of Horticultural Science 123: 1038–1047. Bailey, J. A., O’Connell, R. J., Pring, R. J. & Nash, C. (1992) Infection strategies of Colletotrichum species. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 88–120. CAB International, Wallingford. Bos, C. J. (1985) Induced mutation and somatic recombination as tools for genetic analysis and breeding of imperfect fungi. PhD thesis, Wageningen Agricultural University. Brasier, C. (2000) The rise of the hybrid fungi. Nature 405: 134–135. Brooker, N. L., Leslie, J. F. & Dickman, M. B. (1991) Nitrate non-utilizing mutants of Colletotrichum and their use in studies of vegetative compatibility and genetic relatedness. Phytopathology 81: 672–677. Brygoo, Y., Caffier, V., Carlier, J., Fabre, V., Fernandez, D., Giraud, T., Mourichon, X., Neema, C., Nottenghem, J., Pope, C., Tharreau, D. & Lebrun, T. (1998) Reproduction and population structure in phytopathogenic fungi: molecular variability of fungal pathogens. In Molecular Variability of Fungal Pathogens. (P. Bridge, Y. Couteaudier & J. Clarkson, eds): 133–148. CAB International, Wallingford. Chacko, R. J., Weidemann, C. J., Tebeest, C. G. & Correll, J. C. (1994) The use of vegetative compatibility and heterokaryosis to determine potential asexual gene exchange in Colletotrichum gloeosporioides. Biological Control 4: 382–389. De Bary, A. (1884) Vergleichende Morphologie und Biologie der Pilze, Mycetozoen und Bakterium. 2nd edn. Englemann, Leipzig. Dumas, B., Centis, S., Sarrazin, N. & Esquerre´-Tugaye´, M. T. (1999) Use of green fluorescent protein to detect expression of an endopolygalacturonase gene of Colletotrichum lindemuthianum during bean infection. Applied and Environmental Microbiology 65: 1769–1771. Glass, N. L., Jacobson, D. J. & Shiu, P. K. (2000) The genetics of hyphal fusion and vegetative incompatibility in filamentous ascomycetes. Annual Review of Genetics 34: 165–186. Glass, N. L., Rasmussen, C., Roca, M. G. & Read, N. D. (2004) Hyphal homing, fusion and mycelial interconnectedness. Trends in Microbiology 12: 135–141. Haugland, R. P. (1996) Handbook of Fluorescent Probes and Research Chemicals. 6th edn. Molecular Probes, Eugene. He, C., Rusu, A. G., Poplawski, A. M., Irwin, J. A. G. & Manners, J. M. (1998) Transfer of a supernumerary chromosome between vegetatively incompatible biotypes of the fungus Colletotrichum gloeosporioides. Genetics 150: 1459–1466. Ishitani, C. & Sakaguchi, K.-I. (1956) Hereditary variation and recombination in Koji-Molds (Aspergillus oryzae and Asp. sojae) V. Heterokaryosis. Journal of Genetics and Applied Microbiology 2: 345–400. Kistler, H. C. & Miao, V. P. (1992) New modes of genetic change in filamentous fungi. Annual Review of Phytopathology 30: 131–152. Ko¨hler, E. (1930) Zur Kenntnis der vegetativen Anastomosen der Pilze. II. Planta 10 : 495–522. Laibach, F. (1928) Ueber Zellfusionen bei Pilzen. Planta 5: 340–359. Mahuku, G. S. & Riascos, J. J. (2004) Virulence and molecular diversity within Colletotrichum lindemuthianum isolates from Andean and Mesoamerican bean varieties and regions. European Journal of Plant Pathology 110 : 253–263. Manners, J. M., Masel, A. M., Braithwaite, J. I. & Irwin, J. A. G. (1992) Molecular analysis of Colletotrichum gloeosporioides pathogenic in the tropical pasture legume Stylosanthes. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 250–268. CAB International, Wallingford. Menezes, J. R. & Dianese, J. C. (1988) Race characterisation of Brazilian isolates of Colletotrichum lindemuthianum and detection of resistance to anthracnose in Phaseolus vulgaris. Phytopathology 78: 650–655. O’Sullivan, D., Tosi, P., Creusot, F., Cooke, M., Phan, T., Dron, M. & Langin, T. (1998) Variation in genome organization of the plant
Conidial anastomosis fusion in Colletotrichum pathogenic fungus Colletotrichum lindemuthianum. Current Genetics 33 : 291–298. Perfect, S. E., Hughes, H. B. & O’Connell, R. J. (1999) Colletotrichum: a model genus for studies on pathology and fungal-plant interactions. Fungal Genetics and Biology 27: 186–198. Poplawski, A. M., He, C., Irwin, J. A. G. & Manners, J. M. (1997) Transfer of an autonomously replicating vector between vegetatively incompatible bitypes of Colletotrichum gloeosporioides. Current Genetics 32: 66–72. Punt, P. J., Oliver, R. P., Dingemanse, M. A., Pouwels, P. H. & van den Hondel, C. A. M. J. J. (1987) Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 56: 117–124. Rava, A. C. & Sartorato, A. (1994) Antracnose. In Principais Doenc¸as do Feijoeiro Comum e seu Controle (A. C. Rava & A. Sartorato, eds): 17–40. EMBRAPA, Brası´ lia. Roca Magallanes, M. G. (1997) Aspectos citolo´gicos da variabilidade gene´tica em Glomerella cingulata (Stonem.) Spauld & Schrenck f. sp. phaseoli (Colletotrichum lindemuthianum (Sacc. & Magn) Scribner). MSc dissertation, Federal University of Lavras, Brazil. Roca, M. G., Davide, L. C., Mendes-Costa, M. C. & Wheals, A. (2003) Conidial anastomoses tubes in Colletotrichum. Fungal Genetics and Biology 40: 138–145. Roca, M. G., Davide, L. C. & Wheals, A. E. (2003) DNA preparation for rapid PCR in Colletotrichum lindemuthianum. Brazilian Journal of Microbiology 33 : 1–4. Roca Magallanes, M. G., Davide, L. C. & Mendes-Costa, M. C. (2003) Cytogenetics of Colletotrichum lindemuthianum (Glomerella cingulata f.sp. phaseoli). Fitopatologia Brasileira 28: 367–373.
1326 Rodriguez-Guerra, R., Ramirez-Rueda, M. T., Martinez, O. & Simpson, J. (2003) Variation in genotype, pathotype and anastomosis groups of Colletotrichum lindemuthianum isolates from Mexico. Plant Pathology 52 : 228–235. Rosewich, U. L. & Kistler, H. C. (2000) Role of horizontal gene transfer in the evolution of fungi. Annual Review of Phytopathology 38: 325–363. Saupe, S. J. (2000) Molecular genetics of heterokaryon incompatibility in filamentous ascomycetes. Microbiology and Molecular Biology Review 64: 489–502. Tu, J. C. (1985) An improved Mathur’s medium for growth, sporulation, and germination of spores of Colletotrichum lindemuthianum. Microbios 44: 87–93. van Zeijl, C. M. J., van Kamp, E. H. M., Punt, P. J., Selten, G. C. M., Hauer, B., van Gorcom, R. F. M. & van den Hondel, C. A. M. J. J. (1998) An improved colony-PCR method for filamentous fungi for amplification of PCR fragments of several kilobases. Journal of Biotechnology 59: 221–224. Waller, J. M. (1992) Colletotrichum diseases of perennial and other cash crops. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 167–185. CAB International, Wallingford. Zeigler, R. S. (1998) Recombination in Magnaporthe grisea. Annual Review of Phytopathology 36 : 249–275.
Corresponding Editor: S. J. Assinder
1320
DOI: 10.1017/S0953756204000838 Printed in the United Kingdom.
Conidial anastomosis fusion between Colletotrichum species
Maria Gabriela ROCA1,2#, Lisete C. DAVIDE1, Livia M. C. DAVIDE1, Maria C. MENDES-COSTA1$, Rosane F. SCHWAN1 and Alan E. WHEALS1,2* 1
Department of Biology, Universidade Federal de Lavras (UFLA), Lavras – MG 37-200 000, MG, Brazil. Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK. E-mail : [email protected] 2
Received 12 September 2003; accepted 19 June 2004.
Colletotrichum lindemuthianum is a pathogen of the common bean plant (Phaseolus vulgaris) causing anthracnose. Large numbers of isolates can rapidly arise with different genetic and chromosomal compositions but their origin is unknown since sexual fruit bodies have only been found in the laboratory. We have recently described the occurrence of special kinds of hyphae that create anastomoses directly between conidia. In this work we show that conidial anastomoses can occur between two different Colletotrichum species. The implications of this observation on the generation of genetic diversity in these species are discussed.
INTRODUCTION Colletotrichum species are amongst the most successful plant pathogenic fungi, causing anthracnose on a wide range of growing plants from both temperate and tropical environments (Bailey et al. 1992). C. lindemuthianum produces damage on the stems, leaves and fruit of the common bean, Phaseolus vulgaris (Rava & Sartorato 1994, Perfect, Hughes & O’Connell 1999) and C. gossypii infects cotton plants (Waller 1992). The genus is of considerable economic importance, yet little is known about the phylogenetic relationships within this group of species, particularly C. lindemuthianum and C. gossypii (Bailey et al. 1992, Manners et al. 1992). Chromosome polymorphisms were found in C. lindemuthianum by pulsed-field gel electrophoresis (PFGE) and microscopy (O’Sullivan et al. 1998, Roca, Mendes-Costa & Davide 2003). A cytogenetic study during sexual reproduction partially confirmed this chromosomal variation (Roca, Davide & Mendes-Costa 2003). Co-inoculation of different isolates of the related C. gloeosporioides has been shown to lead to single chromosome transfer between different strains (He et al. 1998). However, there is a dearth of * Corresponding author. # Present address: University of Edinburgh, ICMB-King’s Building, Edinburgh EH9 3JG, UK. $ Present address: UNILAVRAS, Rua Padre Jose´ Poggel 506, Lavras – MG 37200-000, Brazil.
knowledge about the actual mechanisms that could be involved allowing fusion between different strains. Attempts to demonstrate the parasexual cycle in C. lindemuthianum have been unsuccessful (Bos 1985, Brooker et al. 1991, Chacko et al. 1994, Roca 1997, He et al. 1998). Hyphal anastomoses that allow cytoplasmic connections and nuclear exchange in filamentous fungi can occur in the laboratory, but whether these connections can be found in nature is unknown (Zeigler 1998, Glass, Jacobsen & Shiu 2000). A wide diversity of C. lindemuthianum isolates was found, suggesting that some kind of recombination had occurred during the asexual stage and not by sexual reproduction (Brygoo et al. 1998, Rodriguez-Guerra et al. 2003). Genetic diversity analysis of 200 isolates of C. lindemuthianum using molecular data revealed it to be a highly variable species at levels that were ‘ common for sexually reproducing pathogens ’ (Mahuku & Riascos 2004). A low diversity even exists within C. lindemuthianum isolates obtained from the same plant, and even from the same lesion (RodriguezGuerra et al. 2003). Hyphal fusion is ubiquitous in fungi and is found during many stages in their life-cycles, but its physiological roles are still poorly understood and require further experimental analysis (Glass et al. 2004). Fusions have been reported to occur in ca 20 species (De Bary 1884, Laibach 1928, Roca et al. 2003 : Table 5) and even between members of different species (Ko¨hler
M. G. Roca and others
1321
Table 1. Colletotrichum lindemuthianum strains used. Collectiona
Physiological raceb
Origin
H2c 458, 466, 467 1004, 1006, 1012 401, 538, 1023 1020, 1020F, 1020C
0 64 73 81 2047
Unknown Vic¸osa – Brazil South Minas Gerais – Brazil South Minas Gerais – Brazil Central America
a Code in the collection of the Department of Biology, Federal University of Lavras, Minas Gerais, Brazil. b The physiological race of each strain was confirmed twice by inoculating a conidial suspension to 12 differential test cultivars following standard procedure and methodologies. The degree of pathogenicity was measured by the International Binomial Standard Method (Menezes & Dianese 1988). c Genetically modified by transformation with a plasmid (pAN7-1) containing a hygromycin-resistance gene (Punt et al. 1987) and a GFP fusion protein gene with an endopolygalacturonase gene promoter (Dumas et al. 1999). It was re-isolated by monospore culture.
1930, Ishitani & Sakaguchi 1956). We have recently shown that condidial anastomosis tubes (CATs) form readily between conidia within acervuli during conidiogenesis in C. lindemuthianum and C. gossypii (Roca et al. 2003). Cytoplasm and organelles move along the tubes resulting in conidia without nuclei or with more than one nucleus. This observation led us to conjecture that CATs could provide a novel mechanism for nuclear exchange and would help to explain both literature reports of genetic variation and some horizontal transfer events that have been demonstrated in these species (Poplawsky et al. 1997, He et al. 1998). Here we demonstrate the fusion between different species and the appearance of strains of mixed parentage.
MATERIAL AND METHODS Strains and culture conditions The species used were strains of Colletotrichum lindemuthianum (Table 1) and a single isolate of C. gossypii from cotton plants. Strain H2 is hygromycin-resistant. Monosporic cultures used in this study were obtained using a diluted suspension of conidia in 0.1 % Triton X-100 spread on a Petri dish. After germination of single conidia, single spores were picked up with a needle from the resulting colonies. The monoculture colonies were maintained for growth and sporulation on modified Mathur’s (M3S) medium (Tu 1985) at 20 xC. Cytology The in vivo fluorescent stains Calcofluor White (for cell walls), DAPI (for nuclei) and DiCO6 (for mitochondria) were from Molecular Probes (Haugland 1996) and were observed with an Olympus BX-60 fluorescence microscope or a confocal microscope LSM510.
Pairings Vegetative incompatibility tests (Brooker, Leslie & Dickman 1991) were made using conventional methodologies between all pairwise combinations of the strains listed in Table 1. This was assessed with a mycelial incompatibility test. Pairings were also promoted using a mixed conidial suspension that was inoculated onto M3S medium plates (Tu 1985). Two kinds of pairings were made : intraspecific in different combinations, between C. lindemuthianum strains H2, 401 and 1020 and interspecific between H2 and C. gossypii. After 20–30 d, individual acervuli were isolated, crushed and the spores resuspended. Single conidia were replated by dilution in hygromycinselective medium for interspecific pairings. Slide culture Samples were grown in microscope slide wells filled with solid M3S media and covered with a cover slip. Conidial suspensions were diluted and ca 200 conidia were inoculated between the medium and the cover slip. The germination process was monitored in the microscope every 3 h for the first 2 d, then every 6 h until the formation of a colony and recorded using a digital camera on a phase contrast microscope. PCR PCR was performed on the parents and the isolates from the original pairing after passage (subculture) onto M3S+hygromycin (400 mg mlx1) medium to confirm resistance. Fresh template DNA was isolated in high temperature incubation (van Zeijl et al. 1998, Roca, Davide & Wheals 2003) from a small quantity of mycelium. Parental samples were from liquid medium surface culture. The 5k–3k sequences of primer pair hphr1 (GCAGCCGGTCGCGGAGGCCATGG) and hphr6 (CGCCCGGAGCCGCGGCGATCCTGC) were designed on the hygromycin-resistance gene of plasmid pAN7-1 (Punt et al. 1987) using 55 x as annealing temperature under standard conditions. There are 3 integrated copies of plasmid pAN7-1 in strain H2 (Dr. B. Dumas ; personal communication) and the banding pattern could be altered in recombinant strains (Arnau & Oliver 1993). A 50 bp ladder (50 bp–2 kb) was used (NovagenTM, Darmstadt) as a marker. Subcultured monoconidial colonies of the original strains were routinely monitored using these primers throughout the course of the experiments and showed no significant difference to the original isolates. Passage The first passage (replication) was made onto a water agar square (7 mm2) that was immediately transferred on to M3S medium (for anastomosed conidia coming from intraspecific pairings) or M3S+hygromycin
Conidial anastomosis fusion in Colletotrichum medium (for single conidia coming from interspecific pairings). Successive passages (subcultures) were made with needles (using single spore isolates at least for the first three subcultures ; see above). Parental strains and strains coming from pairings were tested in different media (M3S and M3S+400 mg mlx1 hygromycin) over at least seven passages (once every 3–4 wk) extending over approx. six months. C. lindemuthianum strain H2 is hygromycin-resistant at 400 mg mlx1 (Dumas et al. 1999) with black mycelia. C. gossypii is hygromycin-sensitive and has pink mycelia. Both strains have salmon-pink coloured acervuli or conidial mass. The fifth passage was through bean cultivars in the glasshouse to confirm anthracnosis symptoms (Menezes & Dianese 1988).
1322
5d
RESULTS The Colletotrichum lindemuthianum isolates used showed complete vegetative incompatibility in all pairwise combinations in standard tests (Figs 1–2). This indicates that heterokaryosis did not occur by this method in these series of experiments. The role of growth inhibition by deficient or depleted media was tested by cutting samples from the region of potential contact and placing them on fresh medium (Fig. 2). The strains grew and sporulated but did not intermingle (Fig. 2). CATs between conidia of different parentage occur when they were placed in close proximity. This was achieved in two ways ; first, by the development of a single acervulus from two conidia. When two conidia from a conidial suspension germinate close together they can form coiled hyphae producing a single asexual fruiting body (Figs 3–4). Secondly, it could occur by having adjacent fruiting bodies in very close proximity (Figs 5–6). Fruiting bodies develop at high density, may contain 1r106 spores and the open boundaries of the acervuli could permit direct contact between conidia from different sources (Figs 7–8). The cotton plant pathogen C. gossypii produces CATs, has a faster extension rate than C. lindemuthianum, is hygromycin sensitive, has a pink-coloured colony and the conidia are elongated in shape. These different phenotypic markers were used to compare with C. lindemuthianum Strain H2 (Figs 9–10). High-density co-inoculation of conidia was used to attempt the creation of recombinant strains between a hygromycin resistant strain of C. lindemuthianum and C. gossypii (Figs 9–10). The ensuing culture (Fig. 11) was allowed to mature for 30 days and a uninucleate spore suspension at a density of 4.1r106 conidia mlx1 was made from a single asexual fruiting body. 100 ml of suspension (4.1r105 conidia) was spread on M3S+hygromycin medium and yielded a mean of 226 colonies per plate (n=5; SD=¡60), a germination rate of 0.6r10x4. This compares to a typical germination rate of between 2 and 17% for either species in
Figs 1–8. Intra-specific pairings ; C, conidium. Fig. 1. Incompatibility test in M3S medium after 25 d growth. Fig. 2. Depleted medium test; the large arrow indicates no intermingling region; the small arrows indicate some sporulation. Fig. 3. Coiled germ tubes from conidia from a slide culture pairing after 12 h. Bar=11 mm. Fig. 4. Acervulus formed from the same sample after 5 d. Bar=25 mm. Fig. 5. Two acervuli (arrows) that were close enough to allow conidia from each to be in physical contact; the original sample contained a mixture of conidia from two different strains. (s) seta. Bar=50 mm. Fig. 6. Digital drawing of two adjacent acervuli (lateral view). Fig. 7. Crushed, complete acervulus in aqueous suspension ; transmission light microscopy. Bar=20 mm. Fig. 8. Detail of the marked area in Fig. 7 ; DiOC6 staining a group of mitochondria and membranes (arrow). CATs (a). Bar=8 mm.
M3S medium and a similar value for C. lindemuthianum and 0 % for C. gossypii in M3SH medium. Over 200 independent hygromycin-resistant colonies were subcultured (first passage). The developing colonies were very variable in appearance with some showing distinct phenotypic
M. G. Roca and others
1323
Figs 9–17. Inter-specific pairings ; C, conidium ; and (a) CATs. Fig. 9. Parents, Colletotrichum lindemuthianum strain H2 (C.l.) and C. gossypii (C.g.). Fig. 10. Uninucleate conidia of parents. Bar=4.5 mm. Fig. 11. Mixture of conidial types ; the arrow points to a group of acervuli. Fig. 12. Some hygromycin resistant colonies after the second subculture. Fig. 13. Third subculture on solid media. Fig. 14. PCR of the putative hybrid using the pAN7-1 plasmid primers hphr1–hphr6 ; MM, 100 bp ladder; Cl, C. lindemuthianum strain H2 ; Cg, C. gossypii; x, hybrid ; P, plasmid as a control. Figs 15–17. Some anastomosed conidia from the third subculture of recombinant plates ; Cl and Cg denote species ‘ types ’; in vivo stain with Calcofluor White. Bar: 5 mm. Fig. 15. A CAT between Cl-type conidia. Fig. 16. A CAT between Cg-type conidia. Fig. 17. A CAT between Cl-type and Cg-type conidia.
sectors of both parental types (Figs 12–13). Eighteen of these isolates with pink-coloured colony C. gossypii phenotypes were subcultured (second passage) without hygromycin. To obtain monosporic cultures, first a Triton-wettable spore suspension was made and
plated and secondly, after individual conidia began to germinate they were cut out under the microscope and propagated individually on fresh medium. Later passages were subcultured alternately with and without hygromycin, a procedure that would further select for
Conidial anastomosis fusion in Colletotrichum
1324
Table 2. Average growth rate of Colletotrichum parents and putative hybrids.
Strain
Growth rate of isolates (cm dx1)a
C. lindemuthianum H2 C. gossypii Second passage (n=9) Third passage (n=7)
0.52 a 0.96 b 0.49 a 0.64 c
The data are growth on M3S medium. a Different letters signify means that are significantly different by Tukey’s test with 18 replications.
Table 3. Colletotrichum conidial shapes and sizes. Conidia
Strain C. lindemuthianum H2 C. gossypii Second passage (n=2) Third passage (n=4)
Length, L (mm)*
Width, W (mm)
L/W
Shape
6.75
1.2
Oval
15.0 e 12.4–13.2*1c–d
5.8 n.d.
2.58 n.d.
11.3–12.2*1b–c
6.5
1.79
Elongate Small, elongate Elongate
8.0 a
The sample size to calculate the mean parental values was 30 conidia from fresh samples suspended in PBS buffer. * Different letters signifies means that are significantly different by the Scott Knott test. 1 =Range of means; n.d.=not done.
hygromycin-resistance (a C. lindemuthianum phenotype) but allow the faster growing C. gossypii an advantage on hygromycin-free medium. One pink-coloured colony that also had C. gossypii-like spore shape and size was selected for study (after the second passage on hygromycin-free medium). Putative hybrid strains were subcultured seven more times every 3–4 wk. On non-selective media the colonies were approximately an equal mixture of pink/black and pink colonies with a few purely black colonies. The same strains when grown on M3S medium plus hygromycin were mostly black. C. gossypii is the more rapidly growing of the two species but the hybrid strains had an intermediate growth rate on plates (Table 2). Examination of the spore shape also suggested that the spore suspensions were not a mixture of two types of spores but were hybrid spores with a length :width ratio intermediate between the two parents (Table 3). The putative recombinant form was tested for its ability to grow on bean cultivars (see legend to Table 1). C. lindemuthianum parental strain H2 was classified as race zero (non pathogenic to tester cultivars) and strain 1020 was race 2047 (pathogenic to tester cultivars). Three different hybrid strains between C. lindemuthianum and C. gossypii were evaluated and the results varied in race designation from zero in two isolates to ca 3500 in a third one, the most pathogenic isolate so far reported in Brazil and one of the higher
race values found (Balardin & Kelly 1998, Mahuku & Riascos 2004). Other colonies were scored with respect to mycelial colour and hgromycin resistance and showed wide phenotypic variation. Serial propagation through a total of seven passages with maintenance of periodic selection for hygromycinresistance still resulted in colonies that became progressively like C. gossypii both in mycelial colour and conidial shape (Figs 9–10) while retaining hygromycin-resistance, the basis of which is a chromosomally integrated gene (Dumas et al. 1999) from C. lindemuthianum strain H2 (Fig. 14). After one year of alternating subculturing over ten times on the two media, the hybrid was completely pink, independently of the medium, gossypii-like in form, hygromycin resistant but could no longer cause disease in beans (a change that had occurred after 8 months). Cytological observations of conidia in the putative recombinants showed different combinations of conidial shapes and abilities to form CATs (Figs 15–17).
DISCUSSION Our data provide prime facie evidence for a novel mechanism that allows fusion between two different species and probably permits the exchange of genetic material between Colletotrichum gossypii and C. lindemuthianum based on transmission through CATs that develop within acervuli (Roca et al. 2003) : micromanipulated conidia when located close to one another can produce a single acervulus ; mass inoculation of conidia at high density with strong selection can yield apparently inter-specific heterokaryon or strains of mixed parentage ; these forms are sufficiently stable to be maintained in culture for over one year even when selection is only for one parent ; and the strains show phenotypic properties intermediate between the parents. The monosporic cultures strongly suggest that the strains are some kind of recombinant. The frequency of these inter-specific recombinants was very low when isolated on hygromycin medium. This could simply be due to frequent hybridisation followed by the faster growing C. gossypii species outgrowing (or out-replicating) C. lindemuthianum. However, since the germination rate of the ‘ hybrid ’ was less than the hygromycin-resistant parent from which it came, it suggests that the process is rare and/or of low efficiency and/or the initial hybrids were less fit. Despite this, natural selection will ensure propagation of any hybrid with a selective advantage. It has proved possible to get anastomoses developing outside the acervulus only very rarely (Roca et al. 2003) and we were not able to confirm hybrid production directly by micromanipulation. However, Fig. 17 provides evidence of hybrid anastomoses derived from different anastomosed conidia, although it does not provide evidence of colony production of vegetatively incompatible strains. What remains to be determined is the genetic structure of
M. G. Roca and others the ‘hybrids ’, the rate of segregation of parental characters, whether it is possible to create hybrid anastomosed conidia directly and what is the mechanism for avoiding vegetative incompatibility. If a diploid or dikaryotic stage does occur via CATs it must be unstable (Bos 1985, Brooker, Leslie & Dickman 1991, Roca 1997) and binucleated conidia were not found using DAPI staining of early stages of fusion. He et al. (1998) showed that a limited genetic recombination occurs between incompatible strains of C. gloeosporioides via a nonsexual pathway, and, as we found previously, C. gloeosporioides does form CATs (Roca et al. 2003). Natural co-infection of a plant with different strains of C. lindemuthianum could easily lead to adjacent or mixed fruiting bodies with CATs between different strains. Rodriguez-Guerra et al. (2003) showed the occurrence of distinct haplotypes within single masses of conidia in plant lesions collected from the field in Mexico. In the saprophytic stage, growth of adjacent colonies of different species on decaying plant material could provide opportunities for fusion between different strains. With normal vegetative incompatibility barriers overcome this mechanism provides a route for the introgression of genetic material (horizontal gene transfer) as has been suggested by He et al. (1998) : CAT fusions could provide the opportunity to acquire supernumerary chromosomes (He et al. 1998) and also provide an explanation for the origin of genetic diversity in species with rare or no sexual reproduction (Kistler & Miao 1992, Rosewich & Kistler 2000, Mahuku & Riascos 2004). Further work on the genetic implications of CATs in this genus and other genera in which CATs have been seen, for example Botrytis and Neurospora (Roca & Read, unpubl.), could help resolve this paradox. The relationship between observed variation and the mechanisms for creating it in Colletorichum and other species is controversial (Brygoo et al. 1998, Saupe 2000) since there is little direct evidence on the mechanism of how hybrid fungi could rise in nature. It is an important issue because the evolutionary potential of a population is proportional to its level of genetic variation (Brasier 2000). Our observations could help to provide an explanation for the complex dynamics of Colletotrichum populations in the absence of both sexuality and parasexuality. ACKNOWLEDGEMENTS We thank Eduardo de Souza Lambert for statistical analyses and Bernard Dumas (Universite´ de Toulouse, France) for strain H2. This work was supported by a fellowship to MGR from CAPES and–financial support and scholarships from FAPEMIG.
REFERENCES Arnau, J. & Oliver, R. P. (1993) Inheritance and alteration of transforming DNA during an induced parasexual cycle in the imperfect fungus Cladosporium-fulvum. Current Genetics 23: 508–511.
1325 Balardin, R. S. & Kelly, J. D. (1998) Interaction between Colletotrichum lindemuthianum races and gene pool diversity in Phaseolus vulgaris. Journal of American Society of Horticultural Science 123: 1038–1047. Bailey, J. A., O’Connell, R. J., Pring, R. J. & Nash, C. (1992) Infection strategies of Colletotrichum species. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 88–120. CAB International, Wallingford. Bos, C. J. (1985) Induced mutation and somatic recombination as tools for genetic analysis and breeding of imperfect fungi. PhD thesis, Wageningen Agricultural University. Brasier, C. (2000) The rise of the hybrid fungi. Nature 405: 134–135. Brooker, N. L., Leslie, J. F. & Dickman, M. B. (1991) Nitrate non-utilizing mutants of Colletotrichum and their use in studies of vegetative compatibility and genetic relatedness. Phytopathology 81: 672–677. Brygoo, Y., Caffier, V., Carlier, J., Fabre, V., Fernandez, D., Giraud, T., Mourichon, X., Neema, C., Nottenghem, J., Pope, C., Tharreau, D. & Lebrun, T. (1998) Reproduction and population structure in phytopathogenic fungi: molecular variability of fungal pathogens. In Molecular Variability of Fungal Pathogens. (P. Bridge, Y. Couteaudier & J. Clarkson, eds): 133–148. CAB International, Wallingford. Chacko, R. J., Weidemann, C. J., Tebeest, C. G. & Correll, J. C. (1994) The use of vegetative compatibility and heterokaryosis to determine potential asexual gene exchange in Colletotrichum gloeosporioides. Biological Control 4: 382–389. De Bary, A. (1884) Vergleichende Morphologie und Biologie der Pilze, Mycetozoen und Bakterium. 2nd edn. Englemann, Leipzig. Dumas, B., Centis, S., Sarrazin, N. & Esquerre´-Tugaye´, M. T. (1999) Use of green fluorescent protein to detect expression of an endopolygalacturonase gene of Colletotrichum lindemuthianum during bean infection. Applied and Environmental Microbiology 65: 1769–1771. Glass, N. L., Jacobson, D. J. & Shiu, P. K. (2000) The genetics of hyphal fusion and vegetative incompatibility in filamentous ascomycetes. Annual Review of Genetics 34: 165–186. Glass, N. L., Rasmussen, C., Roca, M. G. & Read, N. D. (2004) Hyphal homing, fusion and mycelial interconnectedness. Trends in Microbiology 12: 135–141. Haugland, R. P. (1996) Handbook of Fluorescent Probes and Research Chemicals. 6th edn. Molecular Probes, Eugene. He, C., Rusu, A. G., Poplawski, A. M., Irwin, J. A. G. & Manners, J. M. (1998) Transfer of a supernumerary chromosome between vegetatively incompatible biotypes of the fungus Colletotrichum gloeosporioides. Genetics 150: 1459–1466. Ishitani, C. & Sakaguchi, K.-I. (1956) Hereditary variation and recombination in Koji-Molds (Aspergillus oryzae and Asp. sojae) V. Heterokaryosis. Journal of Genetics and Applied Microbiology 2: 345–400. Kistler, H. C. & Miao, V. P. (1992) New modes of genetic change in filamentous fungi. Annual Review of Phytopathology 30: 131–152. Ko¨hler, E. (1930) Zur Kenntnis der vegetativen Anastomosen der Pilze. II. Planta 10 : 495–522. Laibach, F. (1928) Ueber Zellfusionen bei Pilzen. Planta 5: 340–359. Mahuku, G. S. & Riascos, J. J. (2004) Virulence and molecular diversity within Colletotrichum lindemuthianum isolates from Andean and Mesoamerican bean varieties and regions. European Journal of Plant Pathology 110 : 253–263. Manners, J. M., Masel, A. M., Braithwaite, J. I. & Irwin, J. A. G. (1992) Molecular analysis of Colletotrichum gloeosporioides pathogenic in the tropical pasture legume Stylosanthes. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 250–268. CAB International, Wallingford. Menezes, J. R. & Dianese, J. C. (1988) Race characterisation of Brazilian isolates of Colletotrichum lindemuthianum and detection of resistance to anthracnose in Phaseolus vulgaris. Phytopathology 78: 650–655. O’Sullivan, D., Tosi, P., Creusot, F., Cooke, M., Phan, T., Dron, M. & Langin, T. (1998) Variation in genome organization of the plant
Conidial anastomosis fusion in Colletotrichum pathogenic fungus Colletotrichum lindemuthianum. Current Genetics 33 : 291–298. Perfect, S. E., Hughes, H. B. & O’Connell, R. J. (1999) Colletotrichum: a model genus for studies on pathology and fungal-plant interactions. Fungal Genetics and Biology 27: 186–198. Poplawski, A. M., He, C., Irwin, J. A. G. & Manners, J. M. (1997) Transfer of an autonomously replicating vector between vegetatively incompatible bitypes of Colletotrichum gloeosporioides. Current Genetics 32: 66–72. Punt, P. J., Oliver, R. P., Dingemanse, M. A., Pouwels, P. H. & van den Hondel, C. A. M. J. J. (1987) Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene 56: 117–124. Rava, A. C. & Sartorato, A. (1994) Antracnose. In Principais Doenc¸as do Feijoeiro Comum e seu Controle (A. C. Rava & A. Sartorato, eds): 17–40. EMBRAPA, Brası´ lia. Roca Magallanes, M. G. (1997) Aspectos citolo´gicos da variabilidade gene´tica em Glomerella cingulata (Stonem.) Spauld & Schrenck f. sp. phaseoli (Colletotrichum lindemuthianum (Sacc. & Magn) Scribner). MSc dissertation, Federal University of Lavras, Brazil. Roca, M. G., Davide, L. C., Mendes-Costa, M. C. & Wheals, A. (2003) Conidial anastomoses tubes in Colletotrichum. Fungal Genetics and Biology 40: 138–145. Roca, M. G., Davide, L. C. & Wheals, A. E. (2003) DNA preparation for rapid PCR in Colletotrichum lindemuthianum. Brazilian Journal of Microbiology 33 : 1–4. Roca Magallanes, M. G., Davide, L. C. & Mendes-Costa, M. C. (2003) Cytogenetics of Colletotrichum lindemuthianum (Glomerella cingulata f.sp. phaseoli). Fitopatologia Brasileira 28: 367–373.
1326 Rodriguez-Guerra, R., Ramirez-Rueda, M. T., Martinez, O. & Simpson, J. (2003) Variation in genotype, pathotype and anastomosis groups of Colletotrichum lindemuthianum isolates from Mexico. Plant Pathology 52 : 228–235. Rosewich, U. L. & Kistler, H. C. (2000) Role of horizontal gene transfer in the evolution of fungi. Annual Review of Phytopathology 38: 325–363. Saupe, S. J. (2000) Molecular genetics of heterokaryon incompatibility in filamentous ascomycetes. Microbiology and Molecular Biology Review 64: 489–502. Tu, J. C. (1985) An improved Mathur’s medium for growth, sporulation, and germination of spores of Colletotrichum lindemuthianum. Microbios 44: 87–93. van Zeijl, C. M. J., van Kamp, E. H. M., Punt, P. J., Selten, G. C. M., Hauer, B., van Gorcom, R. F. M. & van den Hondel, C. A. M. J. J. (1998) An improved colony-PCR method for filamentous fungi for amplification of PCR fragments of several kilobases. Journal of Biotechnology 59: 221–224. Waller, J. M. (1992) Colletotrichum diseases of perennial and other cash crops. In Colletotrichum: biology, pathology and control (J. A. Bailey & M. J. Jeger, eds): 167–185. CAB International, Wallingford. Zeigler, R. S. (1998) Recombination in Magnaporthe grisea. Annual Review of Phytopathology 36 : 249–275.
Corresponding Editor: S. J. Assinder