Conservation of expression and alternative splicing in the prosaposin gene

Molecular Brain Research 129 (2004) 8 – 19 www.elsevier.com/locate/molbrainres

Research report

Conservation of expression and alternative splicing in the prosaposin gene Tsadok Cohena, Liat Ravida, Netta Altmana, Liora Madar-Shapiroa,1, Amos Feinb, Miguel Weila, Mia Horowitza,* b

a Department of Cell Research and Immunology, Faculty of Life Sciences, Tel Aviv University, Ramat Aviv 69978, Israel Department of Cell and Developmental Biology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv 69978, Israel

Accepted 14 June 2004 Available online 14 August 2004

Abstract Prosaposin is the precursor of four lysosomal activator molecules known as saposins A, B, C and D. It is also secreted and was proposed to be a neurotrophic factor. The neurotrophic function was attributed to the amino terminus of saposin C. In man, mouse and rat prosaposin is transcribed to two major isoforms differing in the inclusion of 9 bps of exon 8 within the saposin B domain. In the present study, we show that there is evolutionary conservation of the prosaposin structure and alternative splicing in chick and zebrafish as well. Moreover, there is conservation in prosaposin expression as tested immunohistochemically in the mouse and chick developing brain. We developed a sensitive assay to quantitate the prosaposin alternatively spliced forms. Our results indicate that, in mouse brain, skeletal and cardiac muscle the exon 8-containing RNA is most abundant, while it is almost absent from visceral and smooth muscle-containing organs. We observed temporal and differential expression of the alternatively spliced prosaposin mRNAs in mouse and chick brain as well as during development. The elevation in the abundance of exon 8-containing prosaposin RNA during mouse and chick brain development may suggest a role for the exon 8containing prosaposin form in this process. D 2004 Elsevier B.V. All rights reserved. Theme: Development and regeneration Topic: Neurotrophic factors: expression and regulation Keywords: Prosaposin; Saposins; Alternative splicing

1. Introduction Hydrolysis of membrane sphingolipids in the lysosomes is mediated by exohydrolytic enzymes, some of which require activators for their activity [56]. Prosaposin is the precursor of four lysosomal activator proteins known as saposins (A–D), which are necessary for degradation of glycosphingolipids by lysosomal hydrolases [12,45,46,55]. Prosaposin reaches the lysosomes through sortilin-mediated trafficking and is processed there into saposins through proteolysis, brokered mainly by cathepsin D [21,35]. * Corresponding author. Tel.: +972 3 6409285; fax: +972 3 6422046. E-mail address: [email protected] (M. Horowitz). 1 Present address: Department of Cancer Prevention, Tel Aviv Sourasky Medical Center, 6 Weizmann St., Tel Aviv 64239, Israel. 0169-328X/$ - see front matter D 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.molbrainres.2004.06.027

All four saposins contain six equally placed cysteines and a conserved N-glycosylation site [29]. The physiologic significance of the saposins was demonstrated by their respective deficiency state. A deficiency of saposin B results in a clinical syndrome resembling metachromatic leukodystrophy (MLD). Three mutations in the saposin B domain of prosaposin have an effect on the glycosylation site [32,51,53,63]. Another mutation results in the substitution of serine for the fifth cysteine [25]. The fifth mutation is a point mutation within intron 7 of the prosaposin gene, generating a new splice site and resulting in the insertion of a 33-bps intronic fragment within the saposin B domain [66]. Saposin C deficiency leads to accumulation of glucosylceramide, owing to the reduced activity of lysosomal glucocerebrosidase, resulting in the manifestation of

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

Gaucher disease. Two point mutations, whereby the same cysteine residue at position 382 is substituted to phenylalanine [58] or glycine [52], were found in the saposin C domain. No mutations in saposin A or saposin D are associated with human genetic disorders. However, a mouse model, in which the fourth cysteine in saposin A was substituted to phenylalanine, resulting in destruction of one of the disulfide bridges, presented with signs of late onset Krabbe disease [38]. Addition of saposin D to fibroblasts from patients with total prosaposin deficiency led to the degradation of the accumulated ceramide to nearly normal levels [30], suggesting that saposin D is involved in the hydrolysis of ceramide by ceramidase. Prosaposin is also a secreted protein. It is present in milk, cerebrospinal fluid, pancreatic juice, bile and seminal fluids [20,31]. A neurotrophic activity was attributed to a 14 amino acid stretch, located at the N-terminal part of saposin C [48,49]. A number of peptides, designated prosaptides, which encompass the neurotrophic sequence, have been synthesized and showed effects similar to that of the intact prosaposin. Prosaposin and synthetic prosaptides stimulated neurite outgrowth in murine cells, choline acetyltransferase (ChAT) activity in human neuroblastoma cells [47,48] and prevented the apoptosis of neuronal cells in tissue culture [6,22,61]. Prosaposin and prosaptides exhibited neuroprotective and regenerative properties in vivo following brain injury [4,26,28]. Prosaposin was suggested to be a myelinotrophic factor [6,23] since it stimulated the synthesis of sulfatide, a major component of myelin, in Schwann cells and oligodendrocytes through its participation in signaling pathways such as the mitogen activator protein kinase (MAPK) [6,41] or phosphatidylinositol 3-kinase (PI3K)/Akt [7] pathways. Hypomyelination was observed in prosaposin-deficient humans [17,27] and mice [11]. Prosaposin was found to be important in development, maintenance and differentiation of male reproductive organs [42–44], spermatogenesis [60] and fertilization [2,16,37]. It has a myotrophic role in the differentiation from myoblasts to myotubes in tissue culture cells [54]. However, the exact function of the secreted form of prosaposin is not clear. The prosaposin gene contains 15 exons. It is transcribed into several mRNAs generated by alternative splicing of exon 8 [12,25]. Exon 8 in man, mouse and rat contains 9 bps (CAG GAT CAG) that encode the amino acids Gln– Asp–Gln within the saposin B domain of prosaposin. These extra 9 bps are preceded by the sequence gttcaacag (gttcaacagCAGGATCAG), which serves as an acceptor splice site. Within the 9-bps exon, the AG preceding the six bases GATCAG might also serve as an acceptor site, yielding a 6-bps containing exon. However, the function of the three alternative mRNA species is unclear. Expression of exon 8-containing mRNA is tissue-specific in man, rat [24,33] and mouse [67]. It was found in brain,

9

heart and skeletal muscle, and decreased after stab wound and ischemia in rat brain [24]. We now document the conservation of the prosaposin structure and its alternative splicing. We observed temporal and differential expression of the alternatively spliced prosaposin mRNAs in mouse and chick brain as well as during development.

2. Materials and methods 2.1. Library screening A chick cDNA library in E ZAP (prepared from 5- to 11day embryos, a kind gift of Dr. Avihu Klar, the Hebrew University, Hadassah, Ein Karem, Jerusalem) was screened using mouse prosaposin cDNA as probe. The bluescript plasmid containing the chick prosaposin cDNA was excised from the phage DNA by coinfection with a helper phage (Stratagene) and the prosaposin insert was sequenced. The zebrafish prosaposin cDNA was cloned from a zebrafish cDNA library in E ZAP (a kind gift of Dr. Bruce Apple, University of Oregon, USA) using the chick prosaposin as probe. The plasmid containing the zebrafish cDNA was excised from the phage DNA as above. 2.2. Exon 8 detection in cDNA libraries The chick cDNA library was amplified using two primers (#1: 5V TCCAGATGATGATGC 3V, #2: 5V CCACTTGAGCTGGCACC 3V) bordering exon 8. PCR amplification of the zebrafish cDNA library was performed using two primers (#3: 5V GGAGTACATCAGCCAG 3V, #4: 5V GATGTCCTTGGGTTG 3V) that encompass exon 8. 2.3. Antibody preparation A plasmid containing the mouse prosaposin cDNA [59] was digested with MscI to yield a blunt ended 1935-bps fragment. It was cloned into each of the pET-28a-c(+) vectors (Novagen, USA), which had been previously digested with EcoRI and blunt ended. A plasmid containing the chick prosaposin cDNA, starting from nucleotide 824 (the numbering is according to GenBank, accession no. AF108656) was digested with EcoRI to yield a 1208-bps fragment. It was cloned into the pET-28b(+) vector (Novagen, USA), which had been previously digested with EcoRI. Purification of recombinant prosaposin and preparation of polyclonal antibodies was performed as described [39]. 2.4. Immunohistochemical staining Mouse and chick organs were fixed in Bouine’s fixative (saturated picric acid, 40% formaldehyde and glacial acetic acid—75:25:5) and embedded in paraffin. Six-micrometerthick sections were prepared with the use of a R. Gung

10

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

microtome and fixed on slides pretreated with 2% Tespa (Sigma/USA). Prosaposin detection was performed as described [39].

3. Results

2.5. Detection of mouse and chick prosaposin exon 8 containing isoform by RT-PCR

Evolutionary conservation of a sequence highlights its physiological importance. Therefore, we decided to test the evolutionary conservation of the prosaposin gene and its alternatively spliced exon 8 in chick and zebrafish. The chick and zebrafish cDNAs were cloned from the corresponding libraries and sequenced. The overall evolutionary conservation between the different prosaposin proteins and cDNA sequences is presented in Table 1. All prosaposin genes encode mRNAs with a long 3V UTR, containing 1142 bps in man, 868 bps in mouse, 2255 bps in chick and 730 bps in zebrafish. The open reading frame (ORF), including exon 8, consists of 522 amino acids in zebrafish and 518 in chick compared to 527 in human, 557 in rat and 556 in mouse. As in the human and mouse cDNAs, the chick and zebrafish cDNAs contain an N-terminal region and a C-terminal region, in addition to four domains corresponding to the different saposins (Fig. 1). Comparison of the prosaposin amino acid sequence among the different species indicated that, as in humans and rodents, all zebrafish and chick saposin domains contain about 80 amino acids, assuming that four mature saposins exist. In all the predicted prosaposins there is preservation of all the cysteines in the terminal regions and within the saposin domains, as well as of an N-linked glycosylation site, at homologous positions. Only the human saposin A domain has an additional nonconserved glycosylation site (asparagine 42) and only in the saposin C domain of the zebrafish is the glycosylation site missing, making this domain the least conserved. The 59-amino acid long Nterminal chain preceding saposin A, the interdomain between saposins A and B and the last 38 amino acids in the C-terminal region, are highly conserved and hydrophobic. On the other hand, the interdomains between domains B and C, and C and D and the putative neurotrophic sequence in saposin C in the chick and zebrafish display a low similarity to those of the mammalian species (Fig. 2). As regards exon 8 in chick, its sequence is: AAA GAT CAG instead of the human and mouse sequence: CAG GAT CAG. The internal acceptor splice site, CAG, does not exist

Total mouse or chick RNA from different tissues was extracted using TRI-reagent (Molecular Research Center, Cincinnati, OH, USA). A 2–5-Ag quantity of RNA was reverse transcribed in a 20-Al reaction mix using Expand reverse transcriptase (Roche Diagnostics, Indianapolis, IN, USA). The resulting cDNA was used in a PCR reaction. For amplification of exons 6–11 of mouse prosaposin (587-bps fragment), the following primers were used: 5V GCCAGGACTGTATGAAG 3V and 5V GGCAGCACAGAGGCCGAT 3V as sense and antisense, respectively. In chick, the primers used to amplify a fragment spanning exons 4–12 (1022-bps fragment) of the cDNA were: 5V CATGCGAGTTTCTTCCTGACC 3V and 5V CTGACAGACTCTGGCAGG 3V, as sense and antisense, respectively. The sense primers were labeled with the fluorescent dye 6-FAM (Integrated DNA Technologies, Coralville, IA, USA) for detection. Thermal cycling consisted of 948C for 10 min, followed by 30 cycles of denaturation (948C, 1 min), annealing (548C, 1 min) and extension (728C, 1 min) followed by a final extension at 728C for 10 min. To differentiate between prosaposin mRNAs with or without exon 8, the RT-PCR products were digested with the restriction enzyme AlwI in mouse and NspI in chick. A quantity of 1–2 Al was loaded onto a 5% blong rangerQ (Biowhittaker Molecular Applications, Rockland, ME, USA) acrylamide–6M urea gel and electrophoresed in an ABI 377XL DNA sequencer. bGenescan analysis 3.1Q software (Applied Biosystems, CA, USA) was used to determine the size and the amount of the digested RTPCR products. TAMARA 500 (for mouse) and ROX 1000 (for chick) (Applied Biosystems) were used as internal standards. 2.6. Northern blot Northern blotting was performed as previously described [39]. The 3-Ag total mouse brain RNA from different ages was used for the detection of mouse prosaposin by a 480bps PCR fragment, encompassing exons 11–14, as a probe. The 32P-labeled probe was prepared with the Rediprime II kit (Amersham) following the vendor’s protocol. Equal loadings of RNA were validated by probing with 32P-labeled rRNA cDNA.

3.1. Evolutionary conservation of the prosaposin gene

Table 1 Evolutionary conservation of prosaposin amino acid and cDNA sequences Zebrafish

Chick

Mouse

Rat

59.6 55.7 53.5 63

68.9 (54.3) 63.8 (56.4) 62.4 (53)

74.5 (72) 91.6 (90.5)

78 (73.3)

2.7. Restriction enzymes

Human Rat Mouse Chick

(52.6) (51.9) (51.2) (53.5)

Restriction enzymes were purchased from several companies and used according to the manufacturers’ instructions.

Percent of similarity between the different amino acids and cDNA sequences (in brackets), as determined using the GAP program from the GCG package.

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

11

Fig. 1. Structure of prosaposin from different vertebrates. Illustrated structure of prosaposin cDNA from different organisms is shown. The boxes represent the different saposin domains (A–D); the cysteines are denoted as lines and the glycosylation sites—as Y-shapes. Putative polyadenylation sites are denoted as rhombuses. ATG—initiation codon; TAG, TAA—termination codons.

and, therefore, the prosaposin mRNA containing the extra 6 bps should be missing. As shown in Fig. 3A, PCR amplification of a chick cDNA library confirmed the existence of only two cDNA species, with or without the 9 bps, represented by 114- and 105-bps fragments, respectively. The length of exon 8 in zebrafish is only 6 bps, with the sequence GAA CAG. Thus, only two prosaposin mRNA species are expected, without exon 8 or with an extra 6 bps of exon 8. PCR amplification of a zebrafish cDNA library demonstrated the existence of the two expected prosaposin species, 73 and 67 bps in size, corresponding to the isoforms with and without exon 8 (Fig. 3B). In summary, exon 8 encodes two or three amino acids of which at least two are hydrophilic: Q D Q in human, rat and mouse, K D in chick, and E Q in zebrafish (see Table 2). 3.2. Conservation of prosaposin expression Prosaposin was shown to have a neurotrophic effect, attributed to 14 amino acids in the N-terminal region of saposin C [48,49]. A comparison of this region between different organisms revealed a very low homology, arguing against the reported function of the N-terminal region of saposin C (see Fig. 2). Despite this observation, prosaposin has been documented as a neurotrophic factor. Therefore, we decided to examine prosaposin expression pattern in the neuronal tissues of mouse and chick embryos and in adults. To this end, polyclonal antibodies were prepared against recombinant chick and mouse prosaposins expressed in bacteria. The antibodies were used for immunohistochemical analysis of mouse and chick tissue sections. In the chick, prosaposin expression was not detected in the undifferentiated eye of a 7-day-old chick embryo, but at day 10, expression was already evident, although the eye was not fully differentiated (Fig. 4A). Prosaposin was highly expressed in the ganglion cell layer, less expression was observed in the inner and outer nuclear layers as

well as the segment layer of rods and cons at E12. The fully developed eye showed prosaposin expression in the four above mentioned layers at E15. Staining of the eye pigment layer did not appear to be specific. In the mouse eye, prosaposin expression was already evident at E13.5, although the eye was not fully differentiated. At E15.5 and E17.5, expression was detected in the inner and outer nuclear layers. The fully developed eye showed prosaposin expression in the inner and outer nuclear layers and in the ganglion cell and rods and cons layers in adult retina (Fig. 4A). At day 7 of embryonic development in the chick, there was no prosaposin expression in the cerebrum. However, at day 10, expression was evident in more externally located neurons of the developing cortex. At days E12 and E15, expression was very clear in the neurons of the cortex. In the mouse, prosaposin expression was not detected at E12.5, but at day 13.5 it was evident in the developing cortex. Higher expression was noted at E14.5 and E15.5 (Fig. 4B). In chick cerebellum, expression was already noted in Purkinje cells and in neurons of the molecular layer at day E10. At day E15, prosaposin was highly and specifically expressed in Purkinje cells and the cerebellum had already been differentiated into the internal granular and molecular layers. In the mouse cerebellum, prosaposin showed a similar expression pattern, in Purkinje cells at E15.5. However, differentiation of the cerebellum into internal granular and molecular layers was evident only in the adult and not at embryonic day 15.5 (Fig. 4C). Table 3 summarizes prosaposin expression in chick and mouse neuronal tissues. Neural cells expressing prosaposin included: Purkinje cells of the cerebellum, the outer and inner nuclear layers and the ganglion layer of the retina, neurons in the cerebrum, sensory neurons in the dorsal ganglia and sensory epithelial cells of the nose (data not shown). In chick and mouse, prosaposin expression followed the differentiation of the cells expressing it and continued throughout adult life.

12 T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19 Fig. 2. Alignment of the amino acid sequences of prosaposins from different vertebrates. The sequence alignment of zebrafish and chick prosaposin with those of mouse, rat and human was generated with clustalW. Identical amino acids in all five species are shaded. Highly conserved cysteine residues and the potential N-glycosylation sites are marked with asterisks and arrowheads, respectively. Saposin domains (A–D) are indicated with upper line and are based on the human saposin domains. The broken lower line within the box designates the suggested neurotrophic sequence in saposin C. The box in saposin B indicates the amino acids encoded by exon 8.

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

13

Fig. 3. Alternative splicing of prosaposin’s exon 8 in chick and zebrafish. Chick and zebrafish cDNA libraries were amplified as described in Section 2. The products were separated through a 12% polyacrylamide, nondenaturing gel, which was stained with ethidium bromide. (A) In chick, the 114- and 105-bps fragments correspond to mRNAs with or without exon 8, respectively. (B) In zebrafish, the 73- and 67-bps fragments correspond to prosaposin mRNA, with and without exon 8, respectively.

3.3. Alternative splicing in the prosaposin gene We next aimed to assess the abundance of the different prosaposin RNAs, with and without exon 8. To determine the presence and abundance of the different isoforms during mouse and chick development and in adult tissues, we developed a unique and sensitive approach based on restriction digest of fluorescently labeled RT-PCR products. The amplification stage of the RT-PCR reaction was performed using a fluorescent sense primer. To differentiate between exon 8-containing prosaposin cDNAs and those lacking it in mouse, the RT-PCR products were digested with the restriction enzyme AlwI, which cleaves within exon 8 of the prosaposin cDNA (Fig. 5A). As exemplified in Fig. 5D,E, the 9- and 0-bps-containing prosaposin RNAs were the major forms. As shown in Fig. 5B, the relative abundance of prosaposin mRNA containing exon 8 was highest in brain (including the eye) and in cardiac and skeletal muscle (60–70% of prosaposin mRNA). The prosaposin mRNA detected in liver, lung, kidney, spleen, stomach and large and small intestine was almost devoid of exon 8. The exon 8-containing isoform constituted only 18% of total prosaposin RNA expressed in testes, whereas the prosaposin mRNA detected in uterus was almost devoid of exon 8. In mouse brain, olfactory bulb, hippocampus and cerebrum 70–80% of the expressed prosaposin mRNA contained exon 8, while in cerebellum, brain stem and corpus callosum 60–65% of the prosaposin mRNA included it (Fig. 5C). Table 2 The amino acids encoded by prosaposin exon 8 in different species Species

Nuc. sequence of exon 8

Amino acid sequence

Isolated forms (bp)

Human Mouse Chick Zebrafish

CAG GAT CAG CAG GAT CAG AAA GAT CAG GAA CAG

Gln, Asp, Gln Gln, Asp, Gln Lys, Asp, Gln Glu, Gln

0, 0, 0, 0,

6, 9 6, 9 9 6

Comparison of cDNA, amino acid sequence of exon 8 and the isolated forms resulting from the alternative splicing of exon 8.

During embryonic development there was an elevation in the relative abundance of prosaposin mRNA containing exon 8 in mouse brain. The exon 8-containing mRNA level increased from embryonic day 12.5, peaking after birth, when it accounted for 80% of the prosaposin mRNA. It then decreased to 60% and remained so throughout the tested duration (Fig. 6A). Since there were no gross changes in the amount of total prosaposin mRNA during development, as indicated by the results of northern analysis (Fig. 6A,B), the elevation in the amount of exon 8 containing prosaposin during brain development is absolute. In the chick, differentiation between the two prosaposin isoforms was based on cleavage of the RT-PCR products with the restriction enzyme NspI (Fig. 6C,D). As shown in Fig. 6E, in the 3, 5 and 7 somite stages of chick development, low levels of the exon 8-containing isoform was detected. At embryonic day 7, the expression level of this form was dominant. It accounted for 80–90% of prosaposin RNA at embryonic days 15 and 17. The results clearly indicate a similar expression pattern of the exon 8containing prosaposin RNA during chick and mouse brain development. In both cases there was an age dependent elevation of the exon 8-containing prosaposin RNA during embryonic development.

4. Discussion Prosaposin is an intriguing protein, involved in a variety of biological processes [44]. It is the precursor of four small lysosomal glycoproteins that participate in the hydrolysis of glycosphingolipids, catalysed by several lysosomal enzymes [56]. It is also a secreted protein, whose physiological role is not completely understood. We chose to study the evolutionary conservation of the prosaposin gene and its expression pattern, since it is widely accepted that evolutionary conservation of protein’s structure and expression pattern indicates its importance in the differentiation or maintenance of the cells producing it.

14

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

Fig. 4. Prosaposin expression in chick and mouse tissues during development. Sections of eye (A), cerebrum (B) and cerebellum (C) from chick and mouse tissues were fixed and embedded in paraffin. Slides were reacted with rabbit anti chick or mouse prosaposin antibodies. Detection was performed with horseradish peroxidase conjugated goat anti-rabbit antibodies in the presence of HRP substrate (3V3V diaminbenzodin in 0.3% H2O2). All sections were then stained with 1% methylene blue to visualize cells. Out, outer nuclear layer; Int, internal nuclear layer; Gan, ganglion cell layer; Mol, molecular layer; Gra, internal granular cell layer; Purk, Purkinje cell bodies; E, embryonic day.

Chick and zebrafish prosaposin cDNAs were cloned and their sequence was determined. A partial sequence of the chick cDNA, containing the entire open reading frame, has already been published [3] but most of its 3V UTR was missing. We cloned a chick prosaposin cDNA containing the entire 3V UTR (2255 bps). There is overall conservation between all the prosaposins. They all contain four saposin domains, with conserved cysteines and glycosylation sites

(aside from the glycosylation site in zebrafish saposin C). The long 3V UTR in all the prosaposin mRNAs may point to some regulatory function of this region in prosaposin expression. 3V UTR can control gene expression by affecting the localization, stability and translation of mRNAs [10]. 3V UTR sequences may form secondary stem-loop structures facilitating binding of regulatory btrans-actingQ proteins. Alternatively, binding of proteins

Table 3 Prosaposin expression during development in chick and mouse Chick

Eye Cerebellum Cerebrum Dorsal ganglia Nose

Mouse

E7

E10

E12

E15

E10.5

E12.5

E13.5

E15.5

E17.5

+ + +

+ + + + NT

+ + + + +

+

NT

+

+/

+(RNA)

+(RNA)

+ + +

+ + + + +

+ + + + +

NT

NT

Prosaposin expression was followed by in situ hybridization to embryos or interaction of sections with polyclonal anti recombinant chick and mouse antibodies, raised in rabbits. +/ : weak expression, +: high expression, : no expression, NT: not tested, +(RNA): expression detected by hybridization to RNA. E: embryonic.

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

15

Fig. 5. Alternative splicing of prosaposin mRNA in mouse. Schematic representation of the mouse prosaposin cDNA. There is an additional AlwI restriction site in exon 8. The numbers within the boxes denote the exons (A). RT-PCR products of prosaposin, from different tissues (B) or different brain regions (C) were digested with AlwI and separated by electrophoresis through agarose gel (B, C) or sequencing gel (D, E) and quantified by scanning the corresponding gel with Genescan 672 software. The exon 8-containing isoform with 9 bp, yielded three fragments, 280, 187 and 120 bps in size, while the isoform without exon 8 yielded two fragments, 458 and 120 bps in size. Exon 8 with 6 bps yielded 280-, 184- and 120-bps fragments. Since only the sense primer was fluorescently labeled, the 187 (+184)-bps fragment represented the exon 8-containing isoform, whereas the 458-bps fragment represented the isoform lacking it. The data represents the mean of at least three separate measurements.

to other cis-acting elements can alter the susceptibility of mRNAs to endonucleolytic cleavage [19]. For example, AU-rich elements (AREs) are cis-acting determinants of rapid cytoplasmic mRNA turnover found in the 3V UTRs of many constitutively labile transcripts, including some encoding oncoproteins, inflammatory mediators, G-protein-coupled receptors and cytokines [8]. However, sequence alignment of the different propasopin 3V UTRs did not reveal conserved elements such as AU-rich regions. In both, mouse and chick, the expression pattern of prosaposin in brain was conserved during embryonic development and in adult, not only in terms of the cells expressing prosaposin, but also with regard to the differential expression of the different isoforms. In both organisms, cells expressing prosaposin included: internal and external nuclear layers and the ganglion layer of the retina; the sensory epithelium of the nose; sensory neurons of the dorsal ganglia; Purkinje cells of the cerebellum and neurons in the cortex of the cerebrum. As regards alternative splicing there was a continuous elevation in the abundance of the prosaposin RNA containing exon 8 during embryonic brain development. Interestingly, it was recently reported that the relative abundance of the exon 8-containing isoform sharply declined following ischemic injury in rat brain [24]. Ischemic injury represents a degenerative (dedifferentiation)

process and therefore is associated with a decline in the relative abundance of exon 8-containing RNA in the brain. In the nervous system, alternative splicing has been suggested to play a role in learning and memory, neuronal cell recognition, neurotransmission, ion channel function and receptor specificity [14]. Exon 21 of the NMDR R1 (Nmethyl-d-aspartate receptor R1 unit) has been shown to be downregulated in cultured cells by Ca2+/calmodulin-dependent protein kinase IV [64]. D2 and D3 dopamine receptor subtypes, resulting from alternative splicing, have been found to vary in a tissue specific manner [9,13,15,65]. It is plausible that elevation in the expression of the three amino acidscontaining prosaposin form is directly involved with yet an unknown physiological function in the developing brain. Prosaposin was suggested to be a neurotrophic/neuroprotective agent. The activity was attributed to a 14-amino acid sequence (in human: LIDNNKTEKEILDA), located within the N-terminal part of saposin C. Moreover, the fourth (asparagine) and the last (alanine) amino acids of this sequence were shown to be essential to its neurotrophic activity [5,40,48,50]. A sequence comparison of this 14amino acid peptide failed to prove any evolutionary conservation between the different prosaposins, in contrast to the cysteines and the glycosylation sites, which are well preserved among the different prosaposins (aside from the

16 T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19 Fig. 6. Expression pattern of prosaposin during mouse and chick brain development. (A) RNA from mouse brain at different ages was purified. RT-PCR products, after digestion with AlwI, were electrophoresed as explained in the legend to Fig. 5 and the results were quantified. Squares delineate percentage of exon 8-containing RNA. Triangles represent total prosaposin RNA (in arbitrary units) as quantified from a Northern blot presented in (B). (B) RNA was electrophoresed through a 1.2% formaldehyde-agarose gel, blotted and hybridized with 32P-labeled mouse prosaposin cDNA. The blot was stripped and rehybridized with 32Plabeled rRNA cDNA. The blot was quantified using a phosphorimager (Agfa Bass). (C) Schematic representation of the chick prosaposin cDNA. There is an additional NspI restriction site in the prosaposin cDNA missing exon 8. The numbers within the boxes denote the exons. (D) RNA extracted from brain of chick embryos was subjected to RT-PCR. Following digestion with NspI, the products were separated through a 1.5% agarose gel or (E) sequencing gel. The prosaposin isoform lacking exon 8 yielded 500-, 300- and 200-bps fragments, while cleavage of the exon 8-containing isoform resulted in 800- and 200-bps fragments. In the sequencing gel, exon 8-containing RNA was represented by the fluorescently labeled 800-bps fragment, while the 500-bps labeled fragment represented the isoform devoid of exon 8. Genescan software was used to determine the size and amount of the cleavage products and the percentage of exon 9 containing prosaposin was calculated. The data represents the mean of at least three measurements (E). E-day: embryonic day, P-day: postnatal day, P-week: postnatal week.

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19

glycosylation site in saposin C in zebrafish) (Fig. 2). This observation may argue against a possible neurotrophic role for the 14-amino acid peptide, deriving from the N-terminal region of saposin C. According to another report, this prosaptide does not show a neurotrophic/neuroprotective activity in a rabbit spinal cord ischemia model [34]. Three prosaposin mRNAs, containing 0, 6 or 9 bps of exon 8 were found in human and mouse as cDNAs [25,45,62]. However, in chick, we found only two prosaposin mRNA species, containing 0 or 9 bps of exon 8. This is due to a change in the sequence of exon 8-in the chick (Table 2). The finding that prosaposin expression in mouse and chick is similar, strongly suggests that prosaposin mRNA with the 6 bps is of no biological importance. When the abundance of the three prosaposin mRNAs was determined in mouse, we observed that the 6-bps-containing mRNA was rare (Fig. 5D–E). Lamontagne and Potier [33] reported that, in human brain, a very small fraction was attributable to the mRNA containing the extra 6 bps, indicating, again, that it may not have any biological significance. We developed a very sensitive, quantitative, assay to follow differential expression of the different prosaposin forms. Using RT-PCR with one fluorescent primer and cleavage with restriction enzyme, specific to the isoform with or without exon 8 (in mouse and chick, respectively), we were able to document very low levels of the various isoforms in different tissues. The exon 8-containing isoform was most abundant in several brain regions, in skeletal muscle and in heart, as previously reported [24,33,67]. It constituted a minor component in the testes and was barely detected in visceral and smooth muscle containing organs. We hypothesize that alternative splicing of the prosaposin gene is the mechanism responsible for differential sorting of the two prosaposin forms. The prosaposin containing the extra three amino acids was found to be secreted more efficiently then the form lacking it, when tested in HeLa cells infected with vaccinia virus-derived vectors and in stably transfected BHK (baby hamster kidney) cells [18,36]. The results presented in this work indicated that the exon 8-containing prosaposin RNA exists in brain, heart and muscle. Interestingly, when tested by Western blot, the levels of unprocessed prosaposin were highest in brain, skeletal muscle and heart, while the level of saposins was higher in visceral organs [57]. These two observations together strongly imply that the prosaposin form containing exon 8 is translated to the nonlysosomal (membranal or secreted) prosaposin whereas the prosaposin without exon 8 is translated into the lysosomal prosaposin, which is the precursor of the four saposins. The secreted prosaposin may be a ligand of an unknown receptor or a dreservoir’ of saposins. For example: Sertoli cells secrete prosaposin, which may be endocytosed by sperm cells and get processed in their lysosomes to saposins. The 3D model of saposin B supports our assumption about secretion of the 3 amino acids containing prosaposin.

17

It provides evidence that the site of insertion of the exon 8derived three amino acids is within the loop between alpha helices 3 and 4 [1]. Ahn et al. proposed that insertion of the additional residues in this site could lead to a loss of the saposin B capacity to bind lipids, therefore, directing this prosaposin isoform for secretion. The functional properties of saposin B, which interacts with lipid substrates, making them susceptible to various exohydrolytic enzymes, were thought to differ from those of other saposins (A, C and D), which interact with the cognate enzymes. Alternative splicing in the prosaposin gene results in different saposin B isoforms, which may lead to different lipid binding specificities, presumably, to adapt to the variable sphingolipid composition of tissues. Lamontagne and Potier [33] have shown that synthetic peptides that derived from the saposin B domain of prosaposin (from Ser246 to Glu266), with or without the three amino acids insertion, have different binding affinities. Insertion of the Gln–Asp–Gln sequence completely abolished the capacity of the peptide to bind GM1-ganglioside, whereas its affinity for sulfatide and sphingomyelin was increased about fourfold and almost two-fold, respectively. Creation of knockout mice lacking exon 8 may uncover the physiological role of the alternative splicing in the prosaposin gene. To summarize, the evolutionary conservation of the structure and the expression pattern of prosaposin strongly suggest its biological importance as the precursor of four lysosomal activators, known as saposins A–D and as a protein highly and specifically expressed in several secreting cells and in some neurons. The expression pattern of the alternatively spliced isoforms indicates that the three amino acids containing isoform plays a role during embryonic brain development.

Acknowledgements We would like to thank Ms. Hassida Orenstein for preparing the slides for immunohistochemical analysis and to Mr. Tslil Ofir for electrophoresis of the sequencing gels and their quantitative analysis. This project was partially funded by grants from The Binational, Israel–USA, Science Foundation (BSF), The Israel Science Foundation (ISF) and Genzyme, USA (to MH).

References [1] V.E. Ahn, K.F. Faull, J.P. Whitelegge, A.L. Fluharty, G.G. Prive, Crystal structure of saposin B reveals a dimeric shell for lipid binding, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 38 – 43. [2] R.P. Amann, G.E. Seidel, Z.A. Brink, Exposure of thawed frozen bull sperm to a synthetic peptide before artificial insemination increases fertility, J. Androl. 20 (1999) 42 – 46. [3] N. Azuma, H.C. Seo, O. Lie, Q. Fu, R.M. Gould, M. Hiraiwa, D.W. Burt, I.R. Paton, D.R. Morrice, J.S. O’Brien, Y. Kishimoto, Cloning,

18

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14] [15]

[16]

[17]

[18]

[19]

[20]

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19 expression and map assignment of chicken prosaposin, Biochem. J. 330 (1998) 321 – 327. N.A. Calcutt, W.M. Campana, N.L. Eskeland, L. Mohiuddin, K.C. Dines, A.P. Mizisin, J.S. O’Brien, Prosaposin gene expression and the efficacy of a prosaposin-derived peptide in preventing structural and functional disorders of peripheral nerve in diabetic rats, J. Neuropathol. Exp. Neurol. 58 (1999) 628 – 636. W.M. Campana, M. Hiraiwa, K.C. Addison, J.S. O’Brien, Induction of MAPK phosphorylation by prosaposin and prosaptide in PC12 cells, Biochem. Biophys. Res. Commun. 229 (1996) 706 – 712. W.M. Campana, M. Hiraiwa, J.S. O’Brien, Prosaptide activates the MAPK pathway by a G-protein-dependent mechanism essential for enhanced sulfatide synthesis by Schwann cells, FASEB J. 12 (1998) 307 – 314. W.M. Campana, S.J. Darin, J.S. O’Brien, Phosphatidylinositol 3kinase and Akt protein kinase mediate IGF-I- and prosaptide-induced survival in Schwann cells, J. Neurosci. Res. 57 (1999) 332 – 341. C.Y. Chen, A.B. Shyu, AU-rich elements: characterization and importance in mRNA degradation, Trends Biochem. Sci. 20 (1995) 465 – 470. R. Dal Toso, B. Sommer, M. Ewert, A. Herb, D.B. Pritchett, A. Bach, B.D. Shivers, P.H. Seeburg, The dopamine D2 receptor: two molecular forms generated by alternative splicing, EMBO J. 8 (1989) 4025 – 4034. C.J. Decker, R. Parker, Diversity of cytoplasmic functions for the 3V untranslated region of eukaryotic transcripts, Curr. Opin. Cell Biol. 7 (1995) 386 – 392. N. Fujita, K. Suzuki, M.T. Vanier, B. Popko, N. Maeda, A. Klein, M. Henseler, K. Sandhoff, H. Nakayasu, K. Suzuki, Targeted disruption of the mouse sphingolipid activator protein gene: a complex phenotype, including severe leukodystrophy and wide-spread storage of multiple sphingolipids, Hum. Mol. Genet. 5 (1996) 711 – 725. W. Fqrst, W. Machleidt, K. Sandhoff, The precursor of sulfatide activator protein is processed to three different proteins, Biol. Chem. Hoppe-Seyler 369 (1988) 317 – 328. B. Giros, P. Sokoloff, M.P. Martres, J.F. Riou, L.J. Emorine, J.C. Schwartz, Alternative splicing directs the expression of two D2 dopamine receptor isoforms, Nature 342 (1989) 923 – 926. P.J. Grabowski, D.L. Black, Alternative RNA splicing in the nervous system, Prog. Neurobiol. 65 (2001) 289 – 308. D.K. Grandy, M.A. Marchionni, H. Makam, R.E. Stofko, M. Alfano, L. Frothingham, J.B. Fischer, K.J. Burke-Howie, J.R. Bunzow, A.C. Server, et al., Cloning of the cDNA and gene for a human D2 dopamine receptor, Proc. Natl. Acad. Sci. U. S. A. 86 (1989) 9762 – 9766. R.H. Hammerstedt, P.G. Cramer, G.F. Barbato, R.P. Amann, J.S. O’Brien, M.D. Griswold, A fragment of prosaposin (SGP-1) from rooster sperm promotes sperm-egg binding and improves fertility in chickens, J. Androl. 22 (2001) 361 – 375. K. Harzer, B.C. Paton, A. Poulos, B. Kustermann-Kuhn, W. Roggendorf, T. Grisar, M. Popp, Sphingolipid activator protein deficiency in a 16-weekold atypical Gaucher disease patient and his fetal sibling: biochemical signs of combined sphingolipidoses, Eur. J. Pediatr. 149 (1989) 31 – 39. M. Henseler, A. Klein, G.J. Glombitza, K. Suziki, K. Sandhoff, Expression of the three alternative forms of the sphingolipid activator protein precursor in baby hamster kidney cells and functional assays in a cell culture system, J. Biol. Chem. 271 (1996) 8416 – 8423. M.W. Hentze, L.C. Kuhn, Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 8175 – 8182. T. Hineno, A. Sano, K. Kondoh, S. Ueno, Y. Kakimoto, K. Yoshida, Secretion of sphingolipid hydrolase activator precursor, prosaposin, Biochem. Biophys. Res. Commun. 176 (1991) 668 – 674.

[21] M. Hiraiwa, B.M. Martin, Y. Kishimoto, G.E. Conner, S. Tsuji, J.S. O’Brien, Lysosomal proteolysis of prosaposin, the precursor of saposins (sphingolipid activator proteins): its mechanism and inhibition by ganglioside, Arch. Biochem. Biophys. 341 (1997) 17 – 24. [22] M. Hiraiwa, E.M. Taylor, W.M. Campana, S.J. Darin, J.S. O’Brien, Cell death prevention, mitogen-activated protein kinase stimulation, and increased sulfatide concentrations in Schwann cells and oligodendrocytes by prosaposin and prosaptides, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 4778 – 4781. [23] M. Hiraiwa, W.M. Campana, A.P. Mizisin, L. Mohiuddin, J.S. O’Brien, Prosaposin: a myelinotrophic protein that promotes expression of myelin constituents and is secreted after nerve injury, Glia 26 (1999) 353 – 360. [24] M. Hiraiwa, J. Liu, A.G. Lu, C.Y. Wang, R. Misasi, T. Yamauchi, I. Hozumi, T. Inuzuka, J.S. O’Brien, Regulation of gene expression in response to brain injury: enhanced expression and alternative splicing of rat prosaposin (SGP-1) mRNA in injured brain, J. Neurotrauma 20 (2003) 755 – 765. [25] H. Holtschmidt, K. Sandhoff, H.Y. Kwon, K. Harzer, T. Nakano, K. Suzuki, Sulfatide activator protein. Alternative splicing that generates three mRNAs and a newly found mutation responsible for a clinical disease, J. Biol. Chem. 266 (1991) 7556 – 7560. [26] I. Hozumi, M. Hiraiwa, T. Inuzuka, Y. Yoneoka, K. Akiyama, R. Tanaka, K. Kikugawa, R. Nakano, S. Tsuji, J.S. O’Brien, Administration of prosaposin ameliorates spatial learning disturbance and reduces cavity formation following stab wounds in rat brain, [in process citation]Neurosci. Lett. 267 (1999) 73 – 76. [27] H. Hulkova´, M. Cervenkova´, J. Ledvinova´, M. Tocha´ckova´, M. Hrebı´cek, H. Poupetova´, A. Befekadu, L. Berna´, B.C. Paton, K. Harzer, A. Bffr, F. Sˇmı´d, M. Elleder, A novel mutation in the coding region of the prosaposin gene leads to a complete deficiency of prosaposin and saposins, and is associated with a complex sphingolipidosis dominated by lactosylceramide accumulation, Hum. Mol. Genet. 10 (2001) 927 – 940. [28] K. Igase, J. Tanaka, Y. Kumon, B. Zhang, Y. Sadamoto, N. Maeda, S. Sakaki, M. Sakanaka, An 18-mer peptide fragment of prosaposin ameliorates place navigation disability, cortical infarction, and retrograde thalamic degeneration in rats with focal cerebral ischemia, J. Cereb. Blood Flow Metab. 19 (1999) 298 – 306. [29] Y. Kishimoto, M. Hiraiwa, J.S. O’Brien, Saposins: structure, function, distribution, and molecular genetics, J. Lipid Res. 33 (1992) 1255 – 1267. [30] A. Klein, M. Henseler, C. Klein, K. Suzuki, K. Harzer, K. Sandhoff, Sphingolipid activator protein D (Sap-D) stimulates the lysosomal degradation of ceramide in-vivo, Biochem. Biophys. Res. Commun. 200 (1994) 1440 – 1448. [31] K. Kondoh, T. Hineno, A. Sano, Y. Kakimoto, Isolation and characterization of prosaposin from human milk, Biochem. Biophys. Res. Commun. 181 (1991) 286 – 292. [32] K.A. Kretz, G.S. Carson, S. Morimoto, Y. Kishimoto, A.L. Fluharty, J.S. O’Brien, Characterization of a mutation in a family with saposin B deficiency: a glycosylation site defect, Proc. Natl. Acad. Sci. U. S. A. 87 (1990) 2541 – 2544. [33] S. Lamontagne, M. Potier, Modulation of human saposin B sphingolipidbinding specificity by alternative splicing. A study with saposin B-derived synthetic peptides, J. Biol. Chem. 269 (1994) 20528 – 20532. [34] P.A. Lapchak, D.M. Araujo, D.A. Shackelford, J.A. Zivin, Prosaptide exacerbates ischemia-induced behavioral deficits in vivo; an effect that does not involve mitogen-activated protein kinase activation, Neuroscience 101 (2000) 811 – 814. [35] S. Lefrancois, J. Zeng, A.J. Hassan, M. Canuel, C.R. Morales, The lysosomal trafficking of sphingolipid activator proteins (SAPs) is mediated by sortilin, EMBO J. 22 (2003) 6430 – 6437. [36] L. Madar-Shapiro, M. Pasmanik-Chor, A.M. Vaccaro, T. Dinur, A. Dagan, S. Gatt, M. Horowitz, Importance of splicing for prosaposin sorting, Biochem. J. 337 (1999) 433 – 443.

T. Cohen et al. / Molecular Brain Research 129 (2004) 8–19 [37] S.F. Magargee, P.G. Cramer, R.H. Hammerstedt, Increased in vitro binding and fertilizing ability of mouse sperm exposed to a synthetic peptide, Mol. Reprod. Dev. 57 (2000) 406 – 411. [38] J. Matsuda, M.T. Vanier, Y. Saito, J. Tohyama, K. Suzuki, A mutation in the saposin A domain of the sphingolipid activator protein (prosaposin) gene results in a late-onset, chronic form of globoid cell leukodystrophy in the mouse, Hum. Mol. Genet. 10 (2001) 1191 – 1199. [39] L. Mintz, E. Galperin, M. Pasmanik-Chor, S. Tulzinsky, Y. Bromberg, C.A. Kozak, A. Joyner, A. Fein, M. Horowitz, EHD1—an EHdomain-containing protein with a specific expression pattern, Genomics 59 (1999) 66 – 76. [40] R. Misasi, M. Sorice, G.S. Carson, T. Griggi, L. Lenti, G.M. Pontieri, J.S. O’Brien, Prosaposin and prosaptide, a peptide from prosaposin, induce an increase in ganglioside content on NS20Y neuroblastoma cells, Glycoconj. J. 13 (1996) 195 – 202. [41] R. Misasi, M. Sorice, L.L. Di Marzio, W.M. Campana, S. Molinari, M.G. Cifone, A. Pavan, G.M. Pontieri, J.S. O’Brien, Prosaposin treatment induces PC12 entry in the S phase of the cell cycle and prevents apoptosis: activation of ERKs and sphingosine kinase, FASEB J. 15 (2001) 467 – 474. [42] C.R. Morales, H. Badran, Prosaposin ablation inactivates the MAPK and Akt signaling pathways and interferes with the development of the prostate gland, Asian J. Androl. 5 (2003) 57 – 63. [43] C.R. Morales, Q. Zhao, M. El-Alfy, K. Suzuki, Targeted disruption of the mouse prosaposin gene affects the development of the prostate gland and other male reproductive organs, J. Androl. 21 (2000) 765 – 775. [44] C.R. Morales, Q. Zhao, S. Lefrancois, D. Ham, Role of prosaposin in the male reproductive system: effect of prosaposin inactivation on the testis, epididymis, prostate, and seminal vesicles, Arch. Androl. 44 (2000) 173 – 186. [45] T. Nakano, K. Sandhoff, J. Stqmper, H. Christomanou, K. Suzuki, Structure of full-length cDNA coding for sulfatide activator, a Cobeta-glucosidase and two other homologous proteins: two alternate forms of the sulfatide activator, J. Biochem. (Tokyo) 105 (1989) 152 – 154. [46] J.S. O’Brien, K.A. Kretz, N. Dewji, D.A. Wenger, F. Esch, A.L. Fluharty, Coding of two sphingolipid activator proteins (SAP-1 and SAP-2) by same genetic locus, Science 241 (1988) 1098 – 1101. [47] J.S. O’Brien, G.S. Carson, H.C. Seo, M. Hiraiwa, Y. Kishimoto, Identification of prosaposin as a neurotrophic factor, Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 9593 – 9596. [48] J.S. O’Brien, G.S. Carson, H.C. Seo, M. Hiraiwa, S. Weiler, J.M. Tomich, J.A. Barranger, M. Kahn, N. Azuma, Y. Kishimoto, Identification of the neurotrophic factor sequence of prosaposin, FASEB J. 9 (1995) 681 – 685. [49] X. Qi, W. Qin, Y. Sun, K. Kondoh, G.A. Grabowski, Functional organization of saposin C. Definition of the neurotrophic and acid betaglucosidase activation regions, J. Biol. Chem. 271 (1996) 6874 – 6880. [50] X. Qi, K. Kondoh, D. Krusling, G.J. Kelso, T. Leonova, G.A. Grabowski, Conformational and amino acid residue requirements for the saposin C neuritogenic effect, Biochemistry 38 (1999) 6284 – 6291. [51] M.A. Rafi, X.L. Zhang, G. DeGala, D.A. Wenger, Detection of a point mutation in sphingolipid activator protein-1 mRNA in patients with a variant form of metachromatic leukodystrophy, Biochem. Biophys. Res. Commun. 166 (1990) 1017 – 1023. [52] M.A. Rafi, G. de Gala, X.L. Zhang, D.A. Wenger, Mutational analysis in a patient with a variant form of Gaucher disease caused by SAP-2 deficiency, Somat. Cell Mol. Genet. 19 (1993) 1 – 7.

19

[53] S. Regis, M. Filocamo, F. Corsolini, F. Caroli, J.L. Keulemans, O.P. van Diggelen, R. Gatti, An AsnNLys substitution in saposin B involving a conserved amino acidic residue and leading to the loss of the single N-glycosylation site in a patient with metachromatic leukodystrophy and normal arylsulphatase A activity, Eur. J. Hum. Genet. 7 (1999) 125 – 130. [54] M. Rende, E. Brizi, R. Donato, C. Provenzano, R. Bruno, A.P. Mizisin, R.S. Garrett, N.A. Calcutt, W.M. Campana, J.S. O’Brien, Prosaposin is immunolocalized to muscle and prosaptides promote myoblast fusion and attenuate loss of muscle mass after nerve injury, Muscle Nerve 24 (2001) 799 – 808. [55] E.G. Rorman, G.A. Grabowski, Molecular cloning of a human cobetaglucosidase cDNA: evidence that four sphingolipid hydrolase activator proteins are encoded by single genes in humans and rats, Genomics 5 (1989) 486 – 492. [56] K. Sandhoff, T. Kolter, Biosynthesis and degradation of mammalian glycosphingolipids, Philos. Trans. R. Soc. Lond., B Biol. Sci. 358 (2003) 847 – 861. [57] A. Sano, T. Hineno, T. Mizuno, K. Kondoh, S. Ueno, Y. Kakimoto, K. Inui, Sphingolipid hydrolase activator proteins and their precursors, Biochem. Biophys. Res. Commun. 165 (1989) 1191 – 1197. [58] D. Schnabel, M. Schroder, K. Sandhoff, Mutation in the sphingolipid activator protein 2 in a patient with a variant of Gaucher disease, FEBS Lett. 284 (1991) 57 – 59. [59] H. Sprecher-Levy, A. Orr-Urtreger, P. Lonai, M. Horowitz, Murine prosaposin: expression in the reproductive system of a gene implicated in human genetic diseases, Cell. Mol. Biol. (Noisy-leGrand) 39 (1993) 287 – 299. [60] S.R. Sylvester, C. Morales, R. Oko, M.D. Griswold, Sulfated glycoprotein-1 (saposin precursor) in the reproductive tract of the male rat, Biol. Reprod. 41 (1989) 941 – 948. [61] K. Tsuboi, M. Hiraiwa, J.S. O’Brien, Prosaposin prevents programmed cell death of rat cerebellar granule neurons in culture, Dev. Brain Res. 110 (1998) 249 – 255. [62] M. Tsuda, T. Sakiyama, H. Endo, T. Kitagawa, The primary structure of mouse saposin, Biochem. Biophys. Res. Commun. 184 (1992) 1266 – 1272. [63] D. Wrobe, M. Henseler, S. Huettler, S.I. Pascual, A. Chabas, K. Sandhoff, A non-glycosylated and functionally deficient mutant (N215H) of the sphingolipid activator protein B (SAP-B) in a novel case of metachromatic leukodystrophy (MLD), J. Inherit. Metab. Dis. 23 (2000) 63 – 76. [64] J. Xie, D.L. Black, A CaMK IV responsive RNA element mediates depolarization-induced alternative splicing of ion channels, Nature 410 (2001) 936 – 939. [65] G.X. Xie, K. Jones, S.J. Peroutka, P.P. Palmer, Detection of mRNAs and alternatively spliced transcripts of dopamine receptors in rat peripheral sensory and sympathetic ganglia, Brain Res. 785 (1998) 129 – 135. [66] X.L. Zhang, M.A. Rafi, G. DeGala, D.A. Wenger, The mechanism for a 33-nucleotide insertion in mRNA causing sphingolipid a ctivator protein (SAP-1)-deficient metachromatic leukodystrophy, Hum. Genet. 87 (1991) 211 – 215. [67] Q. Zhao, N. Hay, C.R. Morales, Structural analysis of the mouse prosaposin (SGP-1) gene reveals the presence of an exon that is alternatively spliced in transcribed mRNAs, Mol. Reprod. Dev. 48 (1997) 1 – 8.