- Email: [email protected]
Conserved regulatory elements in the promoters of two allelochemical-inducible cytochrome P450 genes differentially regulate transcription
Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139 www.elsevier.com/locate/ibmb
Conserved regulatory elements in the promoters of two allelochemical-inducible cytochrome P450 genes differentially regulate transcription Cynthia M. McDonnell a, Rebecca Petersen Brown a,1, May R. Berenbaum a, Mary A. Schuler b, a
b
Department of Entomology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA Department of Cell and Structural Biology, University of Illinois at Urbana-Champaign, 190 ERML, 1201 West Gregory Drive, Urbana, IL 61801, USA Received 8 March 2004; received in revised form 18 June 2004; accepted 24 June 2004
Abstract CYP6B4, a cytochrome P450 gene from the tiger swallowtail Papilio glaucus, is transcriptionally induced in the midgut by dietary furanocoumarins, plant allelochemicals that can crosslink DNA in their UV-activated form. The CYP6B4 promoter contains an overlapping EcRE/ARE/XRE-xan element similar to that used for basal and xanthotoxin-inducible expression of the CYP6B1 promoter from the black swallowtail Papilio polyxenes. Transfection of the CYP6B4 promoter:CAT reporter construct into Sf9 cells demonstrates that the basal and xanthotoxin-inducible expression levels observed reflect the relative expression levels of this gene in the midguts of tiger swallowtail larvae. Transfections of mutant CYP6B4 promoter constructs into Sf9 cells indicate that the EcRE/ARE/XRE-xan element is necessary for CYP6B4 induction by xanthotoxin but not for its minimal basal expression. In addition to these elements, the CYP6B4 and CYP6B1 promoters also contain putative XRE-AhR elements identical to the aryl hydrocarbon response elements present in mammalian phase I detoxification genes. Transfections of CYP6B4 and CYP6B1 promoters containing EcRE/ARE/XRE-xan and XRE-AhR elements indicate that both are induced significantly by benzo(a)pyrene, an aryl hydrocarbon widespread in the environment, as well as by xanthotoxin, an allelochemical encountered in their hostplants. # 2004 Elsevier Ltd. All rights reserved. Keywords: Cytochrome P450s; Transcriptional regulation; Aryl hydrocarbon responses; Furanocoumarin responses; Insect–plant interactions
1. Introduction Induction of a detoxification gene by a toxic chemical and metabolism of the chemical by the induced enzyme establishes a close association between an enzyme and its chemical inducer, but understanding the evolutionary significance of this association depends on identifying the molecular basis of the process. Among the better Corresponding author. Tel.: +1-217-333-8784; fax: +1-217-2441336. E-mail address: [email protected] (M.A. Schuler). 1 Present address: Department of Organismal Biology and Anatomy, The University of Chicago, 1027 East 57th Street, Chicago, IL 60637-1508, USA.
0965-1748/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2004.06.014
studied molecular interactions that have been defined in insects are the furanocoumarin-inducible cytochrome P450 monooxygenases (P450s) that metabolize furanocoumarins in the midguts of the swallowtail caterpillars Papilio polyxenes and Papilio glaucus (Hung et al., 1995a,b, 1996, 1997; Li et al., 2001, 2002, 2003). The specialist P. polyxenes caterpillar feeds on furanocoumarin-containing plants and has detectable constitutive and high furanocoumarin-inducible levels of CYP6B1 transcripts in its midgut (Cohen et al., 1992; Prapaipong et al., 1994; Hung et al., 1995b; Petersen et al., 2001). The generalist P. glaucus caterpillar feeds on many different plant species of which a few contain furanocoumarins. Conserving its transcriptional
1130
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
machinery, P. glaucus does not constitutively express CYP6B4 and CYP6B4-like transcripts at any detectable level and significantly induces them (300-fold) in response to linear furanocoumarins in its diet (Hung et al., 1997; Li et al., 2001). Heterologous expressions of the CYP6B1 protein from a specialist and the CYP6B4 protein from a generalist in Sf9 lepidopteran cells have demonstrated that both proteins metabolize linear as well as angular furanocoumarins (Chen et al., 2002; Baudry et al., 2003; Wen et al., 2003). Molecular modeling and mutagenesis studies have indicated that these two enzymes have diverged at several positions that are key determinants in their substrate binding sites (Chen et al., 2002; Baudry et al., 2003). And, as a result, CYP6B1 metabolizes some linear furanocoumarins (i.e., xanthotoxin) at higher rates than CYP6B4 and CYP6B4 metabolizes angular furanocoumarins at higher rates than CYP6B1 (Chen et al., 2002; Baudry et al., 2003; Li et al., 2003; Wen et al., 2003). The differences in activities between these enzymes reflect the feeding strategies employed by each species.
Despite divergence in their coding sequences and furanocoumarin-metabolizing capabilities, the promoter sequences of the CYP6B4 and CYP6B1 genes are highly conserved in a number of sequences identified as response elements in other invertebrate and vertebrate genes (Fig. 1). The EcRE element originally identified in the ecdysone-inducible Eip28/29 genes from Drosophila melanogaster (Cherbas et al., 1991) has been shown to bind to a nuclear receptor heterodimer comprised of ecdysone receptor (EcR) and ultraspiracle (Usp) in gel shift assays conducted with hsp27 and Fbp1 promoters (Antoniewski et al., 1993). Mutational analysis of the EcRE-like element present in the CYP6B1 promoter has demonstrated that it is important for constitutive and xanthotoxin-inducible transcription but not for the repressive effects of 20-hydroxyecdysone on CYP6B1 transcription (Brown et al., 2004). Within the CYP6B1 promoter, this EcRE element overlaps two elements, an XRE-xan element (xenobiotic response element to xanthotoxin) that has been determined to be necessary, but not sufficient, for high constitutive and xanthotoxininducible expression of the CYP6B1 promoter in Sf9 cells (Petersen et al., 2003) and an antioxidant response
Fig. 1. Conserved promoter elements. (A) Aligned sequences from the promoters of CYP6B1 (146/60) and CYP6B4 (508/422). (B) Conserved regulatory sequences in CYP6B4 and CYP6B1 with consensus sequences for each element. The consensus sequence for the XRE-xan element is from the promoter of CYP6B1 (Prapaipong et al., 1994; Petersen et al., 2003). The XRE-AhR and Oct-1 elements are based on sequences in the vertebrate CYP1A1 promoter (Denison et al., 1988). The EcRE element is from the Drosophila melanogaster hsp27 gene (Antoniewski et al., 1993). The consensus sequence for the ARE element is derived from a variety of vertebrate promoters (Rushmore et al., 1991; Wasserman and Fahl, 1997). Positions are designated relative to the transcription start site for each gene.
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
element (ARE) that has been identified as important for antioxidant-inducible expression of mammalian phase II detoxification genes (Rushmore et al., 1991; Hayes and Pulford, 1995; Wasserman and Fahl, 1997). Within the CYP6B4 promoter, a region sharing 60% identity with this overlapping EcRE/ARE/XRE-xan element in the CYP6B1 promoter (Fig. 1A) is situated 481–505 nucleotides upstream from the transcription start site (Li et al., 2002). In addition to these elements, both of the CYP6B1 and CYP6B4 promoters contain XRE-AhR elements (xenobiotic response element to the aryl hydrocarbon receptor) similar to those found in mammalian P450 promoters that are activated by binding to activated aryl hydrocarbon receptor (AhR)–ARNT complexes (Schmidt and Bradfield, 1996; Whitlock, 1999; Ma, 2001). Mutational analysis of the CYP6B1 promoter has indicated that the XRE-AhR element is necessary for both constitutive and xanthotoxin-inducible expression of the CYP6B1 promoter (Brown, 2003). The CYP6B1 and CYP6B4 promoters also contain varying numbers of Oct-1 binding sites (one in CYP6B1; three in CYP6B4) that were identified as negative regulatory elements in the rat cytochrome CYP1A1 gene (Sterling and Bresnick, 1996). Given the differences observed in the basal and xanthotoxin-inducible expression of CYP6B4 and CYP6B1 transcripts in insect larvae, the degree of conservation in these elements is striking. It is likely that the variations in spacing, number, and/or sequence of these elements contribute to the differential regulation of these promoters in vivo. In this study, we set out, first, to determine whether the xanthotoxin responses of the CYP6B4 promoter in transfected Sf9 cells mirror those in xanthotoxin-induced larvae and, second, to determine whether the overlapping EcRE/ARE/XRE-xan element in the distal region of the CYP6B4 promoter mediates xanthotoxin responses as it did in our original investigations of the CYP6B1 promoter (Petersen et al., 2003). These studies indicate that deletion of the region containing the overlapping element found in the distal region of the CYP6B4 promoter reduced the magnitude of xanthotoxin-inducible expression without affecting the marginal basal activity of this promoter. Because the existence of XRE-AhR elements in the CYP6B4 and CYP6B1 promoters suggests that these genes might also be capable of responding to a range of aryl hydrocarbons found in the environment, we also set out to determine the responses of the CYP6B1 and CYP6B4 promoters to benzo(a)pyrene, an aryl hydrocarbon that is a byproduct of wood combustion and, therefore, ubiquitous in terrestrial landscapes. It was hypothesized that swallowtail caterpillars, which likely encounter benzo(a)pyrene in the environment while feeding on furanocoumarin-containing host plants, might use the aryl hydrocarbon response cas-
1131
cade and its required XRE-AhR element to respond to both types of compounds. To explore this hypothesis, we compared the responses of the CYP6B4 and CYP6B1 promoters to individual and combined treatments with benzo(a)pyrene and xanthotoxin. Both promoters of CYP6B4 and CYP6B1 respond to benzo(a)pyrene in a dose-dependent manner, suggesting that an aryl hydrocarbon response mechanism is present in insect cells. These studies indicated that both promoters respond to individual treatments with benzo(a)pyrene and xanthotoxin and to combined treatments with these compounds. That simultaneous exposure to xanthotoxin and benzo(a)pyrene induces expression in an additive manner, rather than a synergistic manner, strongly suggesting that transcription of these promoters depends on saturating a receptor capable of interacting with both xanthotoxin and benzo(a)pyrene.
2. Materials and methods 2.1. Materials Most reagents were obtained from Sigma (St. Louis, MO), organic solvents were obtained from Fisher Scientific (Hampton, NH) and sterile tissue culture dishes and flasks were obtained from Corning (Corning, NY). Restriction enzymes and DNA ligases were obtained from Invitrogen Life Sciences (Carlsbad, CA). [14C]acetyl-CoA (57 mCi/mmol) was obtained from Amersham Life Sciences (Arlington Heights, IL). 2.2. Cloning of deletion mutants Deletion mutants of the CYP6B4 promoter were constructed by polymerase chain reaction (PCR) using the reverse primer 6B4 þ 29RXBAI and one of the four forward primers, 6B41812L, 6B4508L, 6B4459L, 6B4191L, which amplified 1812/+29, 506/+29, 449/+29 and 286/+29 nucleotides of the promoter, respectively (Table 1). Throughout this paper, we report nucleotide positions in the proximal promoter relative to the transcriptional start site indicated by +1, with upstream or sequences 50 of it preceded by ‘‘’’ and downstream or 30 sequences preceded by ‘‘+’’. The reverse primer was engineered with an XbaI restriction enzyme site and the forward primer was engineered with a PstI restriction enzyme site for direct cloning into the pCAT-Basic plasmid (Promega, Madison, WI). The pCAT-Basic plasmid contains the bacterial chloramphenicol acetyl transferase (CAT) reporter gene immediately downstream from the XbaI and PstI cloning sites. Positive clones were sequenced on both DNA strands using a series of internal promoter primers and vector primers.
1132
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
Table 1 Oligonucleotides used in this study Primer
Sequence (50 -30 )
Region of identity/complementarity
6B4 þ 29RXBAI 6B41816L 6B4508L 6B4459L 6B4191L CAT2
GATGTCTAGACGTCACTGCGCACTGTT GGGGCTGCAGGTACACTCTGCATC GGGGCTGCAGTAAAATACAATGACAA GGGGCTGCAGTATGTAAAGATACCT GGGGCTGCAGCTAATTACATTCTAAA GGAAACAGCTATGACC
Complementary to +29 to +13 of CYP6B4v2 Identical to 1816 to 1803 of CYP6B4v2 Identical to 499 to 483 of CYP6B4v2 Identical to 448 to 433 of CYP6B4v2 Identical to 285 to 269 of CYP6B4v2 Sequence in pCAT vector upstream from polylinker
The center column contains the primer sequences used to generate the CYP6B4v2:CAT clones. The bold letters indicate nucleotides identical or complementary to the CYP6B4v2 gene. The underlined letters represent restriction site sequences engineered for use in subcloning.
2.3. DNA transient transfections and reporter gene assays Wildtype and mutant CYP6B4 promoter constructs were co-transfected into Sf9 (Spodoptera frugiperda) cells (Invitrogen Life Sciences) along with an actin:bgalactosidase transfection control plasmid. In xanthotoxin induction assays, the minimal functional CYP6B1 promoter:CAT construct (146/+22 CYP6B1:CAT) described in Petersen et al. (2003) served as a positive control and the pCAT basic vector served as a negative control. For all transfections, Sf9 cells from generations 10– 30 were grown in Sf900IISFM insect cell culture media (Gibco-BRL) supplemented with 10% v/v fetal bovine serum (FBS) (Sigma), 80 U/l penicillin, and 80 ug/l streptomycin (BioWhittaker, Walkersville, MD). For individual transfection assays, 10 ml of cells were plated at a density of 4 5 106 in 100 mm polystyrene v tissue culture plates (Corning) and incubated at 28 C. After 16–24 h, each plate of cells was transfected with 10 lg of CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase control plasmid using a calcium phosphate coprecipitate prepared as described in Sambrook and Russell (2001). After 16 h, cells were washed with 5 ml of Sf900IISFM medium and then 40 ll of 1 or 2 mg/ml xanthotoxin in methanol or DMSO (final concentrations 18.5 or 37 lM), 40 ll of 1.2 or 2.4 mg/ ml benzo(a)pyrene in DMSO (final concentrations of 18.5 or 37 lM), or 20 ll each of 1 mg/ml xanthotoxin and 1.2 mg/ml benzo(a)pyrene (18.5 lM of each) was added to 10 ml of medium supplemented with antibiotics and FBS. Control cells were treated with equivalent amounts of methanol or DMSO. After 24 h, cells were collected and lysed by freezing and thawing once in a volume of 900 ll of 1 Reporter Lysis Buffer (Promega) and cell lysates were cleared by centrifuging at 13 000g for 3 min. The resulting cell lysates were frov zen in liquid nitrogen and stored at 80 C. b-galactosidase enzyme activity in a 150 ll aliquot of each cell lysate was monitored by following the colorimetric conversion of the colorless substrate ONPG (O-nitrophenyl b-d-galactopyranoside) at 420 nm to a
yellow product. CAT activity in a 150 ll aliquot of each cell lysate was measured by monitoring the level of acetylated chloramphenicol produced in a 3–6 h reaction conducted using [14C] acetyl-CoA as in Sambrook and Russell (2001). CAT activities were normalized to the b-galactosidase activity defined for each transfection and are reported as a proportion of the basal activity obtained for the 506/+29 CYP6B4:CAT or 146/+22 CYP6B1:CAT constructs in the same transfection series. All transfections were done in triplicate. 2.4. Statistics Significant differences among treatments or constructs within a transfection series were determined using the mixed-analysis-of-variance and test-of-effectslices subprograms within SAS 8.2 (SAS Institute, Cary, NC). 3. Results 3.1. 50 deletion analysis of the CYP6B4 promoter To determine if the overlapping EcRE/ARE/XRExan element in the CYP6B4 promoter is necessary for basal or xanthotoxin-inducible expression, promoter constructs containing varying lengths of the 50 promoter region (to 1812, 506, 449, 286) fused to the CAT reporter gene were transfected into Sf9 cells and treated for 24 h with methanol or 18.5 lM xanthotoxin in methanol. Normalization of the CAT activities against b-gal activities derived from a co-transfected actin:b-gal control plasmid indicated that while the three shorter constructs (506/+29; 449/+29; 286/ +29) maintained the same low level of basal expression as the negative pCAT-Basic control plasmid (Fig. 2A,B), the longest construct (1812/+29) sometimes attained levels of basal expression as high as xanthotoxin-inducible expression of the 506/+29 construct (Fig. 2B). In the presence of xanthotoxin, the promoter construct with 506/+29 nucleotides of the CYP6B4 promoter, which contains the overlapping element, was significantly induced by xanthotoxin in
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
1133
Fig. 2. Basal and xanthotoxin-inducible expression of the CYP6B4 deletion mutant promoter constructs in the Sf9 cell transfection system. (A) and (B) are replicate experiments. In each, the schematic diagram of the deletion mutants of the CYP6B4 promoter:CAT construct shows putative response elements on the left side of each panel as patterned boxes, the TATA box as a white box and the transcription start site as a bent arrow and +1. The XRE-xan element is indicated by a black box, the EcRE element by crossed hashed lines, the XRE-AhR element by vertical stripes and the Oct-1 elements by diagonal lines. The longer promoter constructs 1812/+29 and 506/+29 contain all of the putative response elements identified in the CYP6B4 promoter. The two shortest promoter constructs, 449/+29 and 286/+29, lack the overlapping EcRE/ARE/XRE-xan element. On the right side of each panel, insect Sf9 cells were transfected with 10 lg of CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control using a calcium phosphate coprecipitate prepared as described in Sambrook and Russell (2001). Cells were induced with 40 ll of 1 mg/ml xanthotoxin for a final concentration of 18.5 lM or 40 ll of methanol alone and harvested as detailed in Materials and methods. Each treatment was repeated in triplicate with the CAT activity normalized to b-galactosidase activity and the average activity reported as a proportion of basal activity for the 506/+29 CYP6B4:CAT construct. Letters indicate significant differences determined by the mixed ANOVA procedure and an effect of slice test at a ¼ 0:05 using SAS 8.2 software.
three different transfection series (Fig. 2A,B and data not shown). The promoter construct with 1812/+29 nucleotides of the CYP6B4 promoter, which also contains the overlapping element, was significantly induced by xanthotoxin to a higher level than the 506/+29 CYP6B4:CAT construct in two independent transfection series (Fig. 2B and data not shown) and to a lower level in a third transfection series (Fig. 2A). The
promoter constructs with 449/+29 or 286/+29 nucleotides of the CYP6B4 promoter that lack the overlapping element but retain other putative response elements (i.e., XRE-AhR, Oct-1, EcRE) show either lower inducible expression than the 1812/+29 and 506/+29 constructs (Fig. 2A and data not shown) or no response at all to xanthotoxin (Fig. 2B and data not shown). These data indicate that the region containing
1134
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
the EcRE/ARE/XRE-xan element is required for the strongest response to xanthotoxin and that it functions in concert with additional upstream and downstream elements. In this same transfection series, the CYP6B1 promoter displays 20- to 30-fold higher basal activities and 17- to 20-fold higher xanthotoxin-inducible activities than the CYP6B4 promoter. 3.2. CYP6B promoter responses to xanthotoxin and benzo(a)pyrene To determine if the CYP6B4 and CYP6B1 promoters are capable of responding to the naturally occurring aryl hydrocarbon, benzo(a)pyrene, cells transfected with the wildtype CYP6B4 (506/+29) and CYP6B1 (146/+22) promoter constructs were induced with final concentrations of 18.5 and 37 lM benzo(a)pyrene or xanthotoxin. In addition, to determine if these promoters respond to these inducers using the same signaling cascade, cells transfected with these constructs were induced with a combined dose of xanthotoxin and benzo(a)pyrene at final concentrations of 18.5 lM for each. These transfection series, which are plotted separately for the CYP6B4 (Fig. 3) and CYP6B1 (Fig. 4) constructs because of substantial differences in their transcriptional activities, indicate that both promoters respond to benzo(a)pyrene and to xanthotoxin with the higher concentration of xanthotoxin more strongly activating transcription than the higher concentration of benzo(a)pyrene. These transfection series also indicate that combining two lower doses (18.5 lM) of benzo(a)pyrene and xanthotoxin activated the CYP6B4 or CYP6B1 promoters as much as the higher dose of benzopyrene (37 lM) suggesting an additive effect of the two compounds. In three independent transfection series, as the dose of xanthotoxin was increased from 18.5 to 37 lM, activity of the 506/+29 CYP6B4:CAT promoter construct increased from 2.5- to 13.4-fold (Fig. 3A), 2.4- to 8-fold (Fig. 3B) and 3.5- to 17.6-fold over constitutive levels (data not shown). In these same transfection series, benzo(a)pyrene induced the 506/+29 CYP6B4:CAT promoter construct from 7.4- to 8.8-fold (Fig. 3A), 5.0- to 5.5-fold (Fig. 3B) and 7.4- to 15.5fold (data not shown) as the dose was increased from 18.5 to 37 lM. By comparison, xanthotoxin induced the 146/+22 CYP6B1:CAT promoter construct from 1.9- to 3.5-fold (Fig. 4A), 2.3- to 11.2-fold (Fig. 4B) and 3.3- to 15.8-fold (not shown) over constitutive levels when the dose increased from 18.5 to 37 lM. Benzo(a)pyrene induced the 146/+22 CYP6B1:CAT promoter construct from 2.2- to 2.6-fold (Fig. 4A), 4.3to 7.6-fold (Fig. 4B) and 8.3- to 9.4-fold (data not shown) in these same trials as the dose was increased from 18.5 to 37 lM. In all three of these transfections, combining xanthotoxin and benzo(a)pyrene at 18.5 lM
each did not statistically increase activity over a single dose of xanthotoxin at 37 lM (Figs. 3 and 4 and data not shown).
4. Discussion The deletion studies reported here indicate that the CYP6B4 promoter utilizes a sequence in the region between 506 and 449 to activate transcription in response to xanthotoxin. Comparisons of this region with the 197 to 97 region of the CYP6B1 promoter already known to mediate transcriptional responses to xanthotoxin (Prapaipong, 1995; Petersen et al., 2003) indicate that these two promoter segments are 28% identical (31/110 nucleotides) overall with 11/12 nucleotides conserved (AAA(t/g)ACAATGAC) at the 50 end of the overlapping EcRE/ARE/XRE-xan region and substantial AT-richness in the downstream XRExan region (Hung et al., 1996). Site-directed mutagenesis in Sf9 cells has indicated that mutations in the terminal TGAC or the terminal C abolish basal and xanthotoxin-inducible expression from the more highly expressed CYP6B1 promoter (Brown, 2003; Petersen et al., 2003). Based on the conservation of this nucleotide sequence (but not its position) in the CYP6B4 promoter and the detrimental effects of its deletion, it is apparent that sequences found in the overlapping EcRE/ARE/XRE-xan region mediate some part of this promoter’s responses to xanthotoxin. As indicated in Fig. 1, the position of the overlapping element relative to the transcription start site and the sequences found within its core vary between the CYP6B4 and CYP6B1 promoters, which could explain the observation that the basal and inducible levels of expression from the CYP6B4 promoter never reach the high basal level of expression from the CYP6B1 promoter and that deletion of the EcRE/ARE/XRE-xan element from the CYP6B4 promoter does not completely eliminate its induction by xanthotoxin. Related to this, mutational analysis of the CYP6B1 promoter in the AT-rich region downstream within the XRE-xan element and several other 50 UTR elements has indicated that the high basal and inducible transcription levels of the CYP6B1 promoter depend on many interactive elements existing in the region between the EcRE/ARE/XRE-xan sequence and the translation start site (Brown et al., 2004). Variations in the EcRE/ ARE/XRE-xan sequence, including the additional EcRE element and Oct-1 elements in the CYP6B4 promoter and, probably most importantly, their more extended spacing contribute to the reduced transcription efficiency of this promoter. By analyzing promoter strengths from individual cytochrome P450 genes in a way that is not possible in P. glaucus larvae, which express a large number of
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
1135
Fig. 3. Activation of the wildtype CYP6B4 promoter by individual doses of xanthotoxin and benzo(a)pyrene at increasing concentrations and a combined dose. (A) and (B) are replicate experiments. Schematic diagram of the 506/+29 CYP6B4 promoter:CAT construct shows putative response elements as designated in Fig. 2. Insect Sf9 cells were transfected with 10 lg of 506/+29 CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control as designated in Fig. 2. Cells were induced with 40 ll of 1 or 2 mg/ml xanthotoxin in DMSO (final concentrations 18.5 or 37 lM), 40 ll 1.2 or 2.4 mg/ml benzo(a)pyrene in DMSO (final concentrations 18.5 or 37 lM) or a 20 ll each of 1 mg/ml xanthotoxin and 1.2 mg/ml benzo(a)pyrene (18.5 lM of each). Control cells were treated with 40 ll of DMSO. Cells were harvested as detailed in Materials and methods. Each treatment was repeated in triplicate with reporter gene assays normalized and statistically analyzed as in Fig. 2.
CYP6B4-like transcripts (Li et al., 2001), it is now clear that these two swallowtails have differentially evolved in their responses to xanthotoxin, with one (P. polyxenes) achieving high levels of expression of a single gene (CYP6B1) at all times due to the juxtaposition of many elements near the transcription site and another (P. glaucus) achieving substantially lower expression of multiple related genes (CYP6B4 and others) in the absence of inducer and moderate expression in the presence of inducer. Whereas the strong xanthotoxin-
inducible expression of a CYP6B1 protein efficient at metabolizing a range of furanocoumarins may be needed for P. polyxenes to tolerate continual exposure to furanocoumarins in its hostplants, the lower basal and xanthotoxin-inducible expression of a CYP6B4 protein (and its relatives) efficient at metabolizing a broad range of substrates may be needed to accommodate the occasional exposure of P. glaucus larvae to these toxins without compromising their viability in the absence of these toxins. At higher levels of these toxins, elevated
1136
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
Fig. 4. Activation of the wildtype CYP6B1 promoter by individual doses of xanthotoxin and benzo(a)pyrene at increasing concentrations and a combined dose. (A) and (B) are replicate experiments. Schematic diagram of the 146/+22 CYP6B1 promoter:CAT construct shows putative response elements as designated in Fig. 2. Insect Sf9 cells were transfected with 10 lg of 146/+22 CYP6B1:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control. Transfection methods are as described in Fig. 2 with the exception that the average transcriptional activity is reported as a proportion of basal activity for the 146/+22 CYP6B1:CAT construct.
metabolism can be attained by recruiting additional CYP6B4-like genes, such as those described in Li et al. (2001), to supplement the moderate transcription of this single CYP6B4 gene. Thus, in P. glaucus larvae carrying a collection of CYP6B4 genes, expression from CYP6B4 and CYP6B4-like promoters is undetectable in the absence of furanocoumarins and 300-fold induced in their presence (Li et al., 2001), and expression from the CYP6B1 promoter occurs at a detectable basal level and is 4- to 5-fold induced by xanthotoxin (Cohen et al., 1992; Petersen et al., 2001; Prapaipong et al., 1994). These differences in the expression patterns of CYP6B4 and CYP6B1 tran-
scripts depict two strategies for responding to environmental toxins that reflect the probability of these larvae encountering these toxins in their diet. Determining the evolutionary significance of inducible or constitutive expression of P450s in insects is complicated by the fact that only a tiny fraction of taxa have been examined and those that are most thoroughly characterized are widely distributed phylogenetically. Early evidence suggested that high constitutive expression of P450s may be characteristic of insecticide resistance whereas inducible expression is a defining attribute of allelochemical resistance (Feyereisen, 1999). In support of this, overexpression of P450 loci
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
has been associated with insecticide resistance in at least 19 P450 cases (Li et al., 2004). Among these, CYP6D1 from M. domestica is overexpressed in pyrethroid-resistant populations at such high levels that its induction by phenobarbital in susceptible populations is masked (Scott and Lee, 1993; Tomita et al., 1995; Kasai and Scott, 2000). CYP6A8 and CYP6G1 from D. melanogaster are overexpressed in DDT-resistant laboratory strains and field populations but at levels that still permit detection of CYP6A8 induction by phenobarbital (Maitra et al., 1996; Daborn et al., 2002). In those cases in which the molecular basis for overexpression has been analyzed, it appears that the constitutively high expression of these P450s associated with resistance to insecticides occurs as the result of insertions/deletions in cis-acting promoter and/or trans-acting regulatory loci. As examples, CYP6G1 expression is enhanced by the presence of a single transposable element in its promoter in many resistant strains (Daborn et al., 2002) and CYP6A8 expression is enhanced by inactivation of a trans-acting repressor expressed from the third chromosome rather than differences in its promoter (Maitra et al., 2000, 2002). Also in support of this, inducible expression of many allelochemical-metabolizing P450s in the CYP6B subfamilies of Papilio and Helicoverpa has been correlated with allelochemical resistances. However, as examples of allelochemical-induced P450s metabolizing synthetic insecticides (H. zea CYP6B8; Li et al., 2003) and arylhydrocarbon-induced P450s metabolizing natural allelochemicals (P. glaucus CYP6B4 and P. polyxenes CYP6B1; this study) have begun to accumulate, distinctions between allelochemical and insecticide metabolism become less clear. The fact that these last two CYP6B4 and CYP6B1 promoters respond to benzo(a)pyrene, an aryl hydrocarbon pervasive in the environment of these insects, in a manner paralleling their different transcriptional responses to xanthotoxin suggests the responses to both of these exogenous chemicals is moderated by the inherent strengths of these promoters. The fact that both promoters respond more strongly to the lower dose of benzo(a)pyrene than to the lower dose of xanthotoxin (when these chemicals are administered individually) and both respond substantially more strongly to higher doses of xanthotoxin than to higher doses of benzo(a)pyrene indicates that the molar quantities of these chemicals needed to saturate receptors responsible for these responses are lower for benzo(a)pyrene than for xanthotoxin. The dose-dependencies of the ‘‘combined’’ responses (when these chemicals are administered together) indicate that these chemicals additively enhance transcription either because they interact with the same receptor or because their signaling cascades interact at some point prior to promoter activation. While our results cannot completely eliminate
1137
the latter possibility, it is intuitively less likely that two receptors capable of binding different planar molecules have independently evolved than it is that a single receptor has evolved to be capable of binding both types of planar molecules with different affinities. In accord with this suggestion, a recent study has indicated that mammalian AhR function is agonistically affected by a variety of plant allelochemicals, including flavonoids (Zhang et al., 2003), that are biochemically related to the phenylpropanoid derivative (xanthotoxin) studied here. Even so, known AhR homologues from D. melanogaster and Caenorhabiditis elegans do not bind typical aryl hydrocarbon ligands, such as dioxin and b-naphthoflavone, despite the fact that these proteins contain PAS-B repeats embedded in PAS domains that are important for ligand binding in the vertebrate AhR proteins (Duncan et al., 1998; Powell-Coffman et al., 1998; Butler et al., 2001). Although ligand-dependent AhR proteins analogous to that found in vertebrates have not yet been identified in insects (Hahn, 2002), the induction of insect cytochrome P450 activities by various aryl hydrocarbons has been documented. In particular, cytochrome P450 activities in Spodoptera eridania, the southern armyworm, are induced by pentamethylbenzene, naphthalene and polychlorinated cyclic biphenyls (PCBs) (Anderson, 1978; Chang et al., 1983) but not by dioxin (Denison et al., 1985). Cytochrome P450 activities are also induced by benzo(a)pyrene in a mutant strain of Drosophila simulans that is susceptible to the toxic effects of benzo(a)pyrene but not in the wildtype strain that is resistant to benzo(a)pyrene (Fuchs et al., 1992). Our ability to activate expression of insect CYP6B promoters with benzo(a)pyrene in insect cells derived from another lepidopteran species provides us with the potential to biochemically dissect the receptors and transcriptional activators for the insect aryl hydrocarbon cascade. In addition, testing whether the CYP6B4 and CYP6B1 proteins can metabolize benzo(a)pyrene at any significant efficiency and whether the reaction products are toxic allows us to determine whether this response of the CYP6B promoters is adaptive as is the case with their response to xanthotoxin. Acknowledgements Ms. Erin Fancher made the 506/+29, 449/+29 and 286/+29 CYP6B4 promoter constructs, Dr. Hataichanoke Prapaipong Niamsup made the 146/ +22 CYP6B1 wildtype promoter and Dr. Weimin Li provided the CYP6B4v2 genomic DNA clone for making the 1812/+29 CYP6B4 promoter construct. The internal actin: b-galactosidase control plasmid was a gift from Dr. Lucy Cherbas at Indiana University. This
1138
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
work has been supported by NSF grant IBN0212242 to MRB and USDA grant 01-35302-10884 to MAS and MRB. CMM was supported by fellowships from the University of Illinois Toxicology Scholars program and NIH Cell and Molecular Biology Training Grant at the University of Illinois Urbana-Champaign. RPB was supported by a fellowship from the University of Illinois Toxicology Scholars program. References Anderson, R.S., 1978. Aryl hydrocarbon hydroxylase induction in an insect, Spodoptera eridania (Cramer), by polychlorinated biphenyls (PCBs). Comparative Biochemistry and Physiology, Part C 60, 51–55. Antoniewski, C., Laval, M., Lepesant, J.A., 1993. Structural features critical to the activity of an ecdysone receptor binding site. Insect Biochemistry and Molecular Biology 23, 105–114. Baudry, J., Li, W., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Molecular docking of substrates and inhibitors in the catalytic site of CYP6B1, an insect cytochrome P450 monooxygenase. Protein Engineering 16, 577–587. Brown, R.A.P., 2003. Interactions among steroid and xenobiotic response cascades in the regulation of CYP6B1. Ph.D. Thesis, University of Illinois, Urbana-Champaign. Brown, R.P., Berenbaum, M.R., Schuler, M.A., 2004. Transcription of a lepidoteran cytochrome P450 promoter is modulated by multiple elements in its 50 UTR and repressed by 20-hydroxyecdysone. Insect Molecular Biology 13, 337–347. Butler, R.A., Kelley, M.L., Powell, W.H., Hahn, M.E., Van Beneden, R.J., 2001. An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and b-naphthoflavone binding. Gene 278, 223–234. Chang, K.M., Wilkinson, C.F., Hetnarski, K., Murray, M., 1983. Aryl hydrocarbon hydroxylase in larvae of the southern armyworm (Spodoptera eridania). Insect Biochemistry 13, 87–94. Chen, J.S., Berenbaum, M.R., Schuler, M.A., 2002. Amino acids in SRS1 and SRS6 are critical for furanocoumarin metabolism by CYP6B1v1, a cytochrome P450 monooxygenase. Insect Molecular Biology 11, 175–186. Cherbas, L., Lee, K., Cherbas, P., 1991. Identification of ecdysone response elements by analysis of the Drosophila Eip28/29 gene. Genes and Development 5, 120–131. Cohen, M.B., Schuler, M.A., Berenbaum, M.R., 1992. A hostinducible cytochrome P-450 from a host-specific caterpillar: molecular cloning and evolution. Proceedings of the National Academy of Sciences of the United States of America 89, 10920–10924. Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers, S., Tijet, N., Perry, T., Heckel, D., Batterham, P., et al., 2002. A single P450 allele associated with insecticide resistance in Drosophila. Science 297, 2253–2256. Denison, M.S., Hamilton, J.W., Wilkinson, C.F., 1985. Comparative studies of aryl hydrocarbon hydroxylase and the Ah receptor in nonmammalian species. Comparative Biochemistry and Physiology, Part C 80, 319–324. Denison, M.S., Fisher, J.M., Whitlock Jr., ., J.P., 1988. The DNA recognition site for the dioxin–Ah receptor complex. Nucleotide sequence and functional analysis. Journal of Biological Chemistry 263, 17221–17224. Duncan, D.M., Burgess, E.A., Duncan, I., 1998. Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes and Development 12, 1290–1303.
Feyereisen, R., 1999. Insect P450 enzymes. Annual Review of Entomology 44, 507–533. Fuchs, S., Spiegelman, V.S., Safaev, R.D., Belitsky, G.A., 1992. Xenobiotic-metabolizing enzymes and benzo[a]pyrene metabolism in the benzo[a]pyrene-sensitive mutant strain of Drosophila simulans. Mutation Research 269, 185–191. Hahn, M.E., 2002. Aryl hydrocarbon receptors: diversity and evolution. Chemico-Biological Interactions 141, 131–160. Hayes, J.D., Pulford, D.J., 1995. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Critical Reviews in Biochemistry and Molecular Biology 30, 445–600. Hung, C.F., Harrison, T.L., Berenbaum, M.R., Schuler, M.A., 1995a. CYP6B3: a second furanocoumarin-inducible cytochrome P450 expressed in Papilio polyxenes. Insect Molecular Biology 4, 149–160. Hung, C.F., Prapaipong, H., Berenbaum, M.R., Schuler, M.A., 1995b. Differential induction of cytochrome P450 transcripts in Papilio polyxenes by linear and angular furanocoumarins. Insect Biochemistry and Molecular Biology 25, 89–99. Hung, C.F., Holzmacher, R., Connolly, E., Berenbaum, M.R., Schuler, M.A., 1996. Conserved promoter elements in the CYP6B gene family suggest common ancestry for cytochrome P450 monooxygenases mediating furanocoumarin detoxification. Proceedings of the National Academy of Sciences of the United States of America 93, 12200–12205. Hung, C.F., Berenbaum, M.R., Schuler, M.A., 1997. Isolation and characterization of CYP6B4, a furanocoumarin-inducible cytochrome P450 from a polyphagous caterpillar (Lepidoptera: Papilionidae). Insect Biochemistry and Molecular Biology 27, 377–385. Kasai, S., Scott, J.G., 2000. Overexpression of cytochrome P450 CYP6D1 is associated with monooxygenase-mediated pyrethroid resistance in house flies from Georgia. Pesticide Biochemistry and Physiology 68, 34–41. Li, W., Berenbaum, M.R., Schuler, M.A., 2001. Molecular analysis of multiple CYP6B genes from polyphagous Papilio species. Insect Biochemistry and Molecular Biology 31, 999–1011. Li, W., Petersen, R.A., Schuler, M.A., Berenbaum, M.R., 2002. CYP6B cytochrome P450 monooxygenases from Papilio canadensis and Papilio glaucus: potential contributions of sequence divergence to host plant associations. Insect Molecular Biology 11, 543–551. Li, W., Schuler, M.A., Berenbaum, M.R., 2003. Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: specificity and substrate encounter rate. Proceedings of the National Academy of Science of the United States of America 100 (Suppl. 2), 14593–14598. Li, X., Schuler, M.A., Berenbaum, M.R., 2004. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics (in preparation). Ma, Q., 2001. Induction of CYP1A1. The AhR/DRE paradigm: transcription, receptor regulation, and expanding biological roles. Current Drug Metabolism 2, 149–164. Maitra, S., Dombrowski, S.M., Waters, L.C., Ganguly, R., 1996. Three second chromosome-linked clustered Cyp6 genes show differential constitutive and barbital-induced expression in DDTresistant and susceptible strains of Drosophila melanogaster. Gene 180, 165–171. Maitra, S., Dombrowski, S.M., Basu, M., Raustol, O., Waters, L.C., Ganguly, R., 2000. Factors on the third chromosome affect the level of Cyp6a2 and Cyp6a8 expression in Drosophila melanogaster. Gene 248, 147–156. Maitra, S., Price, C., Ganguly, R., 2002. Cyp6a8 of Drosophila melanogaster: gene structure, and sequence and functional analysis of the upstream DNA. Insect Biochemistry and Molecular Biology 32, 859–870.
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139 Petersen, R.A., Zangerl, A.R., Berenbaum, M.R., Schuler, M.A., 2001. Expression of CYP6B1 and CYP6B3 cytochrome P450 monooxygenases and furanocoumarin metabolism in different tissues of Papilio polyxenes (Lepidoptera: Papilionidae). Insect Biochemistry and Molecular Biology 31, 679–690. Petersen, R.A., Niamsup, H., Berenbaum, M.R., Schuler, M.A., 2003. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals. Biochimica et Biophysica Acta 1619, 269–282. Powell-Coffman, J.A., Bradfield, C.A., Wood, W.B., 1998. Caenorhabditis elegans orthologs of the aryl hydrocarbon receptor and its heterodimerization partner the aryl hydrocarbon receptor nuclear translocator. Proceedings of the National Academy of Sciences of the United States of America 95, 2844–2849. Prapaipong, H., 1995. Transcriptional regulation of CYP6B1v3, a furanocoumarin-inducible P450 gene from the black swallowtail (Papilio polyxenes). Ph.D. Dissertation, University of Illinois, Urbana-Champaign. Prapaipong, H., Berenbaum, M.R., Schuler, M.A., 1994. Transcriptional regulation of the Papilio polyxenes CYP6B1 gene. Nucleic Acids Research 22, 3210–3217. Rushmore, T.H., Morton, M.R., Pickett, C.B., 1991. The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. Journal of Biological Chemistry 266, 11632–11639. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
1139
Schmidt, J.V., Bradfield, C.A., 1996. Ah receptor signaling pathways. Annual Review of Cell and Developmental Biology 12, 55–89. Scott, J.G., Lee, S.S., 1993. Purification and characterization of a cytochrome P-450 from insecticide susceptible and resistant strains of housefly, Musca domestica L., before and after phenobarbital exposure. Archives of Insect Biochemistry and Physiology 24, 1–19. Sterling, K., Bresnick, E., 1996. Oct-1 transcription factor is a negative regulator of rat CYP1A1 expression via an octamer sequence in its negative regulatory element. Molecular Pharmacology 49, 329–337. Tomita, T., Liu, N., Smith, F.F., Sridhar, P., Scott, J.G., 1995. Molecular mechanisms involved in increased expression of a cytochrome P450 responsible for pyrethroid resistance in the housefly, Musca domestica. Insect Molecular Biology 4, 135–140. Wasserman, W.W., Fahl, W.E., 1997. Functional antioxidant responsive elements. Proceedings of the National Academy of Science of the United States of America 94, 5361–5366. Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and angular furanocoumarins by Papilio polyxenes CYP6B1 co-expressed with NADPH cytochrome P450 reductase. Insect Biochemistry and Molecular Biology 33, 937–947. Whitlock Jr., ., J.P., 1999. Induction of cytochrome P4501A1. Annual Review of Pharmacology and Toxicology 39, 103–125. Zhang, S., Qin, C., Safe, S.F., 2003. Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environmental Health Perspectives 111, 1877–1882.
Conserved regulatory elements in the promoters of two allelochemical-inducible cytochrome P450 genes differentially regulate transcription Cynthia M. McDonnell a, Rebecca Petersen Brown a,1, May R. Berenbaum a, Mary A. Schuler b, a
b
Department of Entomology, University of Illinois at Urbana-Champaign, Urbana, IL 61801, USA Department of Cell and Structural Biology, University of Illinois at Urbana-Champaign, 190 ERML, 1201 West Gregory Drive, Urbana, IL 61801, USA Received 8 March 2004; received in revised form 18 June 2004; accepted 24 June 2004
Abstract CYP6B4, a cytochrome P450 gene from the tiger swallowtail Papilio glaucus, is transcriptionally induced in the midgut by dietary furanocoumarins, plant allelochemicals that can crosslink DNA in their UV-activated form. The CYP6B4 promoter contains an overlapping EcRE/ARE/XRE-xan element similar to that used for basal and xanthotoxin-inducible expression of the CYP6B1 promoter from the black swallowtail Papilio polyxenes. Transfection of the CYP6B4 promoter:CAT reporter construct into Sf9 cells demonstrates that the basal and xanthotoxin-inducible expression levels observed reflect the relative expression levels of this gene in the midguts of tiger swallowtail larvae. Transfections of mutant CYP6B4 promoter constructs into Sf9 cells indicate that the EcRE/ARE/XRE-xan element is necessary for CYP6B4 induction by xanthotoxin but not for its minimal basal expression. In addition to these elements, the CYP6B4 and CYP6B1 promoters also contain putative XRE-AhR elements identical to the aryl hydrocarbon response elements present in mammalian phase I detoxification genes. Transfections of CYP6B4 and CYP6B1 promoters containing EcRE/ARE/XRE-xan and XRE-AhR elements indicate that both are induced significantly by benzo(a)pyrene, an aryl hydrocarbon widespread in the environment, as well as by xanthotoxin, an allelochemical encountered in their hostplants. # 2004 Elsevier Ltd. All rights reserved. Keywords: Cytochrome P450s; Transcriptional regulation; Aryl hydrocarbon responses; Furanocoumarin responses; Insect–plant interactions
1. Introduction Induction of a detoxification gene by a toxic chemical and metabolism of the chemical by the induced enzyme establishes a close association between an enzyme and its chemical inducer, but understanding the evolutionary significance of this association depends on identifying the molecular basis of the process. Among the better Corresponding author. Tel.: +1-217-333-8784; fax: +1-217-2441336. E-mail address: [email protected] (M.A. Schuler). 1 Present address: Department of Organismal Biology and Anatomy, The University of Chicago, 1027 East 57th Street, Chicago, IL 60637-1508, USA.
0965-1748/$ - see front matter # 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2004.06.014
studied molecular interactions that have been defined in insects are the furanocoumarin-inducible cytochrome P450 monooxygenases (P450s) that metabolize furanocoumarins in the midguts of the swallowtail caterpillars Papilio polyxenes and Papilio glaucus (Hung et al., 1995a,b, 1996, 1997; Li et al., 2001, 2002, 2003). The specialist P. polyxenes caterpillar feeds on furanocoumarin-containing plants and has detectable constitutive and high furanocoumarin-inducible levels of CYP6B1 transcripts in its midgut (Cohen et al., 1992; Prapaipong et al., 1994; Hung et al., 1995b; Petersen et al., 2001). The generalist P. glaucus caterpillar feeds on many different plant species of which a few contain furanocoumarins. Conserving its transcriptional
1130
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
machinery, P. glaucus does not constitutively express CYP6B4 and CYP6B4-like transcripts at any detectable level and significantly induces them (300-fold) in response to linear furanocoumarins in its diet (Hung et al., 1997; Li et al., 2001). Heterologous expressions of the CYP6B1 protein from a specialist and the CYP6B4 protein from a generalist in Sf9 lepidopteran cells have demonstrated that both proteins metabolize linear as well as angular furanocoumarins (Chen et al., 2002; Baudry et al., 2003; Wen et al., 2003). Molecular modeling and mutagenesis studies have indicated that these two enzymes have diverged at several positions that are key determinants in their substrate binding sites (Chen et al., 2002; Baudry et al., 2003). And, as a result, CYP6B1 metabolizes some linear furanocoumarins (i.e., xanthotoxin) at higher rates than CYP6B4 and CYP6B4 metabolizes angular furanocoumarins at higher rates than CYP6B1 (Chen et al., 2002; Baudry et al., 2003; Li et al., 2003; Wen et al., 2003). The differences in activities between these enzymes reflect the feeding strategies employed by each species.
Despite divergence in their coding sequences and furanocoumarin-metabolizing capabilities, the promoter sequences of the CYP6B4 and CYP6B1 genes are highly conserved in a number of sequences identified as response elements in other invertebrate and vertebrate genes (Fig. 1). The EcRE element originally identified in the ecdysone-inducible Eip28/29 genes from Drosophila melanogaster (Cherbas et al., 1991) has been shown to bind to a nuclear receptor heterodimer comprised of ecdysone receptor (EcR) and ultraspiracle (Usp) in gel shift assays conducted with hsp27 and Fbp1 promoters (Antoniewski et al., 1993). Mutational analysis of the EcRE-like element present in the CYP6B1 promoter has demonstrated that it is important for constitutive and xanthotoxin-inducible transcription but not for the repressive effects of 20-hydroxyecdysone on CYP6B1 transcription (Brown et al., 2004). Within the CYP6B1 promoter, this EcRE element overlaps two elements, an XRE-xan element (xenobiotic response element to xanthotoxin) that has been determined to be necessary, but not sufficient, for high constitutive and xanthotoxininducible expression of the CYP6B1 promoter in Sf9 cells (Petersen et al., 2003) and an antioxidant response
Fig. 1. Conserved promoter elements. (A) Aligned sequences from the promoters of CYP6B1 (146/60) and CYP6B4 (508/422). (B) Conserved regulatory sequences in CYP6B4 and CYP6B1 with consensus sequences for each element. The consensus sequence for the XRE-xan element is from the promoter of CYP6B1 (Prapaipong et al., 1994; Petersen et al., 2003). The XRE-AhR and Oct-1 elements are based on sequences in the vertebrate CYP1A1 promoter (Denison et al., 1988). The EcRE element is from the Drosophila melanogaster hsp27 gene (Antoniewski et al., 1993). The consensus sequence for the ARE element is derived from a variety of vertebrate promoters (Rushmore et al., 1991; Wasserman and Fahl, 1997). Positions are designated relative to the transcription start site for each gene.
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
element (ARE) that has been identified as important for antioxidant-inducible expression of mammalian phase II detoxification genes (Rushmore et al., 1991; Hayes and Pulford, 1995; Wasserman and Fahl, 1997). Within the CYP6B4 promoter, a region sharing 60% identity with this overlapping EcRE/ARE/XRE-xan element in the CYP6B1 promoter (Fig. 1A) is situated 481–505 nucleotides upstream from the transcription start site (Li et al., 2002). In addition to these elements, both of the CYP6B1 and CYP6B4 promoters contain XRE-AhR elements (xenobiotic response element to the aryl hydrocarbon receptor) similar to those found in mammalian P450 promoters that are activated by binding to activated aryl hydrocarbon receptor (AhR)–ARNT complexes (Schmidt and Bradfield, 1996; Whitlock, 1999; Ma, 2001). Mutational analysis of the CYP6B1 promoter has indicated that the XRE-AhR element is necessary for both constitutive and xanthotoxin-inducible expression of the CYP6B1 promoter (Brown, 2003). The CYP6B1 and CYP6B4 promoters also contain varying numbers of Oct-1 binding sites (one in CYP6B1; three in CYP6B4) that were identified as negative regulatory elements in the rat cytochrome CYP1A1 gene (Sterling and Bresnick, 1996). Given the differences observed in the basal and xanthotoxin-inducible expression of CYP6B4 and CYP6B1 transcripts in insect larvae, the degree of conservation in these elements is striking. It is likely that the variations in spacing, number, and/or sequence of these elements contribute to the differential regulation of these promoters in vivo. In this study, we set out, first, to determine whether the xanthotoxin responses of the CYP6B4 promoter in transfected Sf9 cells mirror those in xanthotoxin-induced larvae and, second, to determine whether the overlapping EcRE/ARE/XRE-xan element in the distal region of the CYP6B4 promoter mediates xanthotoxin responses as it did in our original investigations of the CYP6B1 promoter (Petersen et al., 2003). These studies indicate that deletion of the region containing the overlapping element found in the distal region of the CYP6B4 promoter reduced the magnitude of xanthotoxin-inducible expression without affecting the marginal basal activity of this promoter. Because the existence of XRE-AhR elements in the CYP6B4 and CYP6B1 promoters suggests that these genes might also be capable of responding to a range of aryl hydrocarbons found in the environment, we also set out to determine the responses of the CYP6B1 and CYP6B4 promoters to benzo(a)pyrene, an aryl hydrocarbon that is a byproduct of wood combustion and, therefore, ubiquitous in terrestrial landscapes. It was hypothesized that swallowtail caterpillars, which likely encounter benzo(a)pyrene in the environment while feeding on furanocoumarin-containing host plants, might use the aryl hydrocarbon response cas-
1131
cade and its required XRE-AhR element to respond to both types of compounds. To explore this hypothesis, we compared the responses of the CYP6B4 and CYP6B1 promoters to individual and combined treatments with benzo(a)pyrene and xanthotoxin. Both promoters of CYP6B4 and CYP6B1 respond to benzo(a)pyrene in a dose-dependent manner, suggesting that an aryl hydrocarbon response mechanism is present in insect cells. These studies indicated that both promoters respond to individual treatments with benzo(a)pyrene and xanthotoxin and to combined treatments with these compounds. That simultaneous exposure to xanthotoxin and benzo(a)pyrene induces expression in an additive manner, rather than a synergistic manner, strongly suggesting that transcription of these promoters depends on saturating a receptor capable of interacting with both xanthotoxin and benzo(a)pyrene.
2. Materials and methods 2.1. Materials Most reagents were obtained from Sigma (St. Louis, MO), organic solvents were obtained from Fisher Scientific (Hampton, NH) and sterile tissue culture dishes and flasks were obtained from Corning (Corning, NY). Restriction enzymes and DNA ligases were obtained from Invitrogen Life Sciences (Carlsbad, CA). [14C]acetyl-CoA (57 mCi/mmol) was obtained from Amersham Life Sciences (Arlington Heights, IL). 2.2. Cloning of deletion mutants Deletion mutants of the CYP6B4 promoter were constructed by polymerase chain reaction (PCR) using the reverse primer 6B4 þ 29RXBAI and one of the four forward primers, 6B41812L, 6B4508L, 6B4459L, 6B4191L, which amplified 1812/+29, 506/+29, 449/+29 and 286/+29 nucleotides of the promoter, respectively (Table 1). Throughout this paper, we report nucleotide positions in the proximal promoter relative to the transcriptional start site indicated by +1, with upstream or sequences 50 of it preceded by ‘‘’’ and downstream or 30 sequences preceded by ‘‘+’’. The reverse primer was engineered with an XbaI restriction enzyme site and the forward primer was engineered with a PstI restriction enzyme site for direct cloning into the pCAT-Basic plasmid (Promega, Madison, WI). The pCAT-Basic plasmid contains the bacterial chloramphenicol acetyl transferase (CAT) reporter gene immediately downstream from the XbaI and PstI cloning sites. Positive clones were sequenced on both DNA strands using a series of internal promoter primers and vector primers.
1132
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
Table 1 Oligonucleotides used in this study Primer
Sequence (50 -30 )
Region of identity/complementarity
6B4 þ 29RXBAI 6B41816L 6B4508L 6B4459L 6B4191L CAT2
GATGTCTAGACGTCACTGCGCACTGTT GGGGCTGCAGGTACACTCTGCATC GGGGCTGCAGTAAAATACAATGACAA GGGGCTGCAGTATGTAAAGATACCT GGGGCTGCAGCTAATTACATTCTAAA GGAAACAGCTATGACC
Complementary to +29 to +13 of CYP6B4v2 Identical to 1816 to 1803 of CYP6B4v2 Identical to 499 to 483 of CYP6B4v2 Identical to 448 to 433 of CYP6B4v2 Identical to 285 to 269 of CYP6B4v2 Sequence in pCAT vector upstream from polylinker
The center column contains the primer sequences used to generate the CYP6B4v2:CAT clones. The bold letters indicate nucleotides identical or complementary to the CYP6B4v2 gene. The underlined letters represent restriction site sequences engineered for use in subcloning.
2.3. DNA transient transfections and reporter gene assays Wildtype and mutant CYP6B4 promoter constructs were co-transfected into Sf9 (Spodoptera frugiperda) cells (Invitrogen Life Sciences) along with an actin:bgalactosidase transfection control plasmid. In xanthotoxin induction assays, the minimal functional CYP6B1 promoter:CAT construct (146/+22 CYP6B1:CAT) described in Petersen et al. (2003) served as a positive control and the pCAT basic vector served as a negative control. For all transfections, Sf9 cells from generations 10– 30 were grown in Sf900IISFM insect cell culture media (Gibco-BRL) supplemented with 10% v/v fetal bovine serum (FBS) (Sigma), 80 U/l penicillin, and 80 ug/l streptomycin (BioWhittaker, Walkersville, MD). For individual transfection assays, 10 ml of cells were plated at a density of 4 5 106 in 100 mm polystyrene v tissue culture plates (Corning) and incubated at 28 C. After 16–24 h, each plate of cells was transfected with 10 lg of CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase control plasmid using a calcium phosphate coprecipitate prepared as described in Sambrook and Russell (2001). After 16 h, cells were washed with 5 ml of Sf900IISFM medium and then 40 ll of 1 or 2 mg/ml xanthotoxin in methanol or DMSO (final concentrations 18.5 or 37 lM), 40 ll of 1.2 or 2.4 mg/ ml benzo(a)pyrene in DMSO (final concentrations of 18.5 or 37 lM), or 20 ll each of 1 mg/ml xanthotoxin and 1.2 mg/ml benzo(a)pyrene (18.5 lM of each) was added to 10 ml of medium supplemented with antibiotics and FBS. Control cells were treated with equivalent amounts of methanol or DMSO. After 24 h, cells were collected and lysed by freezing and thawing once in a volume of 900 ll of 1 Reporter Lysis Buffer (Promega) and cell lysates were cleared by centrifuging at 13 000g for 3 min. The resulting cell lysates were frov zen in liquid nitrogen and stored at 80 C. b-galactosidase enzyme activity in a 150 ll aliquot of each cell lysate was monitored by following the colorimetric conversion of the colorless substrate ONPG (O-nitrophenyl b-d-galactopyranoside) at 420 nm to a
yellow product. CAT activity in a 150 ll aliquot of each cell lysate was measured by monitoring the level of acetylated chloramphenicol produced in a 3–6 h reaction conducted using [14C] acetyl-CoA as in Sambrook and Russell (2001). CAT activities were normalized to the b-galactosidase activity defined for each transfection and are reported as a proportion of the basal activity obtained for the 506/+29 CYP6B4:CAT or 146/+22 CYP6B1:CAT constructs in the same transfection series. All transfections were done in triplicate. 2.4. Statistics Significant differences among treatments or constructs within a transfection series were determined using the mixed-analysis-of-variance and test-of-effectslices subprograms within SAS 8.2 (SAS Institute, Cary, NC). 3. Results 3.1. 50 deletion analysis of the CYP6B4 promoter To determine if the overlapping EcRE/ARE/XRExan element in the CYP6B4 promoter is necessary for basal or xanthotoxin-inducible expression, promoter constructs containing varying lengths of the 50 promoter region (to 1812, 506, 449, 286) fused to the CAT reporter gene were transfected into Sf9 cells and treated for 24 h with methanol or 18.5 lM xanthotoxin in methanol. Normalization of the CAT activities against b-gal activities derived from a co-transfected actin:b-gal control plasmid indicated that while the three shorter constructs (506/+29; 449/+29; 286/ +29) maintained the same low level of basal expression as the negative pCAT-Basic control plasmid (Fig. 2A,B), the longest construct (1812/+29) sometimes attained levels of basal expression as high as xanthotoxin-inducible expression of the 506/+29 construct (Fig. 2B). In the presence of xanthotoxin, the promoter construct with 506/+29 nucleotides of the CYP6B4 promoter, which contains the overlapping element, was significantly induced by xanthotoxin in
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
1133
Fig. 2. Basal and xanthotoxin-inducible expression of the CYP6B4 deletion mutant promoter constructs in the Sf9 cell transfection system. (A) and (B) are replicate experiments. In each, the schematic diagram of the deletion mutants of the CYP6B4 promoter:CAT construct shows putative response elements on the left side of each panel as patterned boxes, the TATA box as a white box and the transcription start site as a bent arrow and +1. The XRE-xan element is indicated by a black box, the EcRE element by crossed hashed lines, the XRE-AhR element by vertical stripes and the Oct-1 elements by diagonal lines. The longer promoter constructs 1812/+29 and 506/+29 contain all of the putative response elements identified in the CYP6B4 promoter. The two shortest promoter constructs, 449/+29 and 286/+29, lack the overlapping EcRE/ARE/XRE-xan element. On the right side of each panel, insect Sf9 cells were transfected with 10 lg of CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control using a calcium phosphate coprecipitate prepared as described in Sambrook and Russell (2001). Cells were induced with 40 ll of 1 mg/ml xanthotoxin for a final concentration of 18.5 lM or 40 ll of methanol alone and harvested as detailed in Materials and methods. Each treatment was repeated in triplicate with the CAT activity normalized to b-galactosidase activity and the average activity reported as a proportion of basal activity for the 506/+29 CYP6B4:CAT construct. Letters indicate significant differences determined by the mixed ANOVA procedure and an effect of slice test at a ¼ 0:05 using SAS 8.2 software.
three different transfection series (Fig. 2A,B and data not shown). The promoter construct with 1812/+29 nucleotides of the CYP6B4 promoter, which also contains the overlapping element, was significantly induced by xanthotoxin to a higher level than the 506/+29 CYP6B4:CAT construct in two independent transfection series (Fig. 2B and data not shown) and to a lower level in a third transfection series (Fig. 2A). The
promoter constructs with 449/+29 or 286/+29 nucleotides of the CYP6B4 promoter that lack the overlapping element but retain other putative response elements (i.e., XRE-AhR, Oct-1, EcRE) show either lower inducible expression than the 1812/+29 and 506/+29 constructs (Fig. 2A and data not shown) or no response at all to xanthotoxin (Fig. 2B and data not shown). These data indicate that the region containing
1134
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
the EcRE/ARE/XRE-xan element is required for the strongest response to xanthotoxin and that it functions in concert with additional upstream and downstream elements. In this same transfection series, the CYP6B1 promoter displays 20- to 30-fold higher basal activities and 17- to 20-fold higher xanthotoxin-inducible activities than the CYP6B4 promoter. 3.2. CYP6B promoter responses to xanthotoxin and benzo(a)pyrene To determine if the CYP6B4 and CYP6B1 promoters are capable of responding to the naturally occurring aryl hydrocarbon, benzo(a)pyrene, cells transfected with the wildtype CYP6B4 (506/+29) and CYP6B1 (146/+22) promoter constructs were induced with final concentrations of 18.5 and 37 lM benzo(a)pyrene or xanthotoxin. In addition, to determine if these promoters respond to these inducers using the same signaling cascade, cells transfected with these constructs were induced with a combined dose of xanthotoxin and benzo(a)pyrene at final concentrations of 18.5 lM for each. These transfection series, which are plotted separately for the CYP6B4 (Fig. 3) and CYP6B1 (Fig. 4) constructs because of substantial differences in their transcriptional activities, indicate that both promoters respond to benzo(a)pyrene and to xanthotoxin with the higher concentration of xanthotoxin more strongly activating transcription than the higher concentration of benzo(a)pyrene. These transfection series also indicate that combining two lower doses (18.5 lM) of benzo(a)pyrene and xanthotoxin activated the CYP6B4 or CYP6B1 promoters as much as the higher dose of benzopyrene (37 lM) suggesting an additive effect of the two compounds. In three independent transfection series, as the dose of xanthotoxin was increased from 18.5 to 37 lM, activity of the 506/+29 CYP6B4:CAT promoter construct increased from 2.5- to 13.4-fold (Fig. 3A), 2.4- to 8-fold (Fig. 3B) and 3.5- to 17.6-fold over constitutive levels (data not shown). In these same transfection series, benzo(a)pyrene induced the 506/+29 CYP6B4:CAT promoter construct from 7.4- to 8.8-fold (Fig. 3A), 5.0- to 5.5-fold (Fig. 3B) and 7.4- to 15.5fold (data not shown) as the dose was increased from 18.5 to 37 lM. By comparison, xanthotoxin induced the 146/+22 CYP6B1:CAT promoter construct from 1.9- to 3.5-fold (Fig. 4A), 2.3- to 11.2-fold (Fig. 4B) and 3.3- to 15.8-fold (not shown) over constitutive levels when the dose increased from 18.5 to 37 lM. Benzo(a)pyrene induced the 146/+22 CYP6B1:CAT promoter construct from 2.2- to 2.6-fold (Fig. 4A), 4.3to 7.6-fold (Fig. 4B) and 8.3- to 9.4-fold (data not shown) in these same trials as the dose was increased from 18.5 to 37 lM. In all three of these transfections, combining xanthotoxin and benzo(a)pyrene at 18.5 lM
each did not statistically increase activity over a single dose of xanthotoxin at 37 lM (Figs. 3 and 4 and data not shown).
4. Discussion The deletion studies reported here indicate that the CYP6B4 promoter utilizes a sequence in the region between 506 and 449 to activate transcription in response to xanthotoxin. Comparisons of this region with the 197 to 97 region of the CYP6B1 promoter already known to mediate transcriptional responses to xanthotoxin (Prapaipong, 1995; Petersen et al., 2003) indicate that these two promoter segments are 28% identical (31/110 nucleotides) overall with 11/12 nucleotides conserved (AAA(t/g)ACAATGAC) at the 50 end of the overlapping EcRE/ARE/XRE-xan region and substantial AT-richness in the downstream XRExan region (Hung et al., 1996). Site-directed mutagenesis in Sf9 cells has indicated that mutations in the terminal TGAC or the terminal C abolish basal and xanthotoxin-inducible expression from the more highly expressed CYP6B1 promoter (Brown, 2003; Petersen et al., 2003). Based on the conservation of this nucleotide sequence (but not its position) in the CYP6B4 promoter and the detrimental effects of its deletion, it is apparent that sequences found in the overlapping EcRE/ARE/XRE-xan region mediate some part of this promoter’s responses to xanthotoxin. As indicated in Fig. 1, the position of the overlapping element relative to the transcription start site and the sequences found within its core vary between the CYP6B4 and CYP6B1 promoters, which could explain the observation that the basal and inducible levels of expression from the CYP6B4 promoter never reach the high basal level of expression from the CYP6B1 promoter and that deletion of the EcRE/ARE/XRE-xan element from the CYP6B4 promoter does not completely eliminate its induction by xanthotoxin. Related to this, mutational analysis of the CYP6B1 promoter in the AT-rich region downstream within the XRE-xan element and several other 50 UTR elements has indicated that the high basal and inducible transcription levels of the CYP6B1 promoter depend on many interactive elements existing in the region between the EcRE/ARE/XRE-xan sequence and the translation start site (Brown et al., 2004). Variations in the EcRE/ ARE/XRE-xan sequence, including the additional EcRE element and Oct-1 elements in the CYP6B4 promoter and, probably most importantly, their more extended spacing contribute to the reduced transcription efficiency of this promoter. By analyzing promoter strengths from individual cytochrome P450 genes in a way that is not possible in P. glaucus larvae, which express a large number of
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
1135
Fig. 3. Activation of the wildtype CYP6B4 promoter by individual doses of xanthotoxin and benzo(a)pyrene at increasing concentrations and a combined dose. (A) and (B) are replicate experiments. Schematic diagram of the 506/+29 CYP6B4 promoter:CAT construct shows putative response elements as designated in Fig. 2. Insect Sf9 cells were transfected with 10 lg of 506/+29 CYP6B4:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control as designated in Fig. 2. Cells were induced with 40 ll of 1 or 2 mg/ml xanthotoxin in DMSO (final concentrations 18.5 or 37 lM), 40 ll 1.2 or 2.4 mg/ml benzo(a)pyrene in DMSO (final concentrations 18.5 or 37 lM) or a 20 ll each of 1 mg/ml xanthotoxin and 1.2 mg/ml benzo(a)pyrene (18.5 lM of each). Control cells were treated with 40 ll of DMSO. Cells were harvested as detailed in Materials and methods. Each treatment was repeated in triplicate with reporter gene assays normalized and statistically analyzed as in Fig. 2.
CYP6B4-like transcripts (Li et al., 2001), it is now clear that these two swallowtails have differentially evolved in their responses to xanthotoxin, with one (P. polyxenes) achieving high levels of expression of a single gene (CYP6B1) at all times due to the juxtaposition of many elements near the transcription site and another (P. glaucus) achieving substantially lower expression of multiple related genes (CYP6B4 and others) in the absence of inducer and moderate expression in the presence of inducer. Whereas the strong xanthotoxin-
inducible expression of a CYP6B1 protein efficient at metabolizing a range of furanocoumarins may be needed for P. polyxenes to tolerate continual exposure to furanocoumarins in its hostplants, the lower basal and xanthotoxin-inducible expression of a CYP6B4 protein (and its relatives) efficient at metabolizing a broad range of substrates may be needed to accommodate the occasional exposure of P. glaucus larvae to these toxins without compromising their viability in the absence of these toxins. At higher levels of these toxins, elevated
1136
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
Fig. 4. Activation of the wildtype CYP6B1 promoter by individual doses of xanthotoxin and benzo(a)pyrene at increasing concentrations and a combined dose. (A) and (B) are replicate experiments. Schematic diagram of the 146/+22 CYP6B1 promoter:CAT construct shows putative response elements as designated in Fig. 2. Insect Sf9 cells were transfected with 10 lg of 146/+22 CYP6B1:CAT reporter plasmid and 10 lg of actin:b-galactosidase internal control. Transfection methods are as described in Fig. 2 with the exception that the average transcriptional activity is reported as a proportion of basal activity for the 146/+22 CYP6B1:CAT construct.
metabolism can be attained by recruiting additional CYP6B4-like genes, such as those described in Li et al. (2001), to supplement the moderate transcription of this single CYP6B4 gene. Thus, in P. glaucus larvae carrying a collection of CYP6B4 genes, expression from CYP6B4 and CYP6B4-like promoters is undetectable in the absence of furanocoumarins and 300-fold induced in their presence (Li et al., 2001), and expression from the CYP6B1 promoter occurs at a detectable basal level and is 4- to 5-fold induced by xanthotoxin (Cohen et al., 1992; Petersen et al., 2001; Prapaipong et al., 1994). These differences in the expression patterns of CYP6B4 and CYP6B1 tran-
scripts depict two strategies for responding to environmental toxins that reflect the probability of these larvae encountering these toxins in their diet. Determining the evolutionary significance of inducible or constitutive expression of P450s in insects is complicated by the fact that only a tiny fraction of taxa have been examined and those that are most thoroughly characterized are widely distributed phylogenetically. Early evidence suggested that high constitutive expression of P450s may be characteristic of insecticide resistance whereas inducible expression is a defining attribute of allelochemical resistance (Feyereisen, 1999). In support of this, overexpression of P450 loci
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
has been associated with insecticide resistance in at least 19 P450 cases (Li et al., 2004). Among these, CYP6D1 from M. domestica is overexpressed in pyrethroid-resistant populations at such high levels that its induction by phenobarbital in susceptible populations is masked (Scott and Lee, 1993; Tomita et al., 1995; Kasai and Scott, 2000). CYP6A8 and CYP6G1 from D. melanogaster are overexpressed in DDT-resistant laboratory strains and field populations but at levels that still permit detection of CYP6A8 induction by phenobarbital (Maitra et al., 1996; Daborn et al., 2002). In those cases in which the molecular basis for overexpression has been analyzed, it appears that the constitutively high expression of these P450s associated with resistance to insecticides occurs as the result of insertions/deletions in cis-acting promoter and/or trans-acting regulatory loci. As examples, CYP6G1 expression is enhanced by the presence of a single transposable element in its promoter in many resistant strains (Daborn et al., 2002) and CYP6A8 expression is enhanced by inactivation of a trans-acting repressor expressed from the third chromosome rather than differences in its promoter (Maitra et al., 2000, 2002). Also in support of this, inducible expression of many allelochemical-metabolizing P450s in the CYP6B subfamilies of Papilio and Helicoverpa has been correlated with allelochemical resistances. However, as examples of allelochemical-induced P450s metabolizing synthetic insecticides (H. zea CYP6B8; Li et al., 2003) and arylhydrocarbon-induced P450s metabolizing natural allelochemicals (P. glaucus CYP6B4 and P. polyxenes CYP6B1; this study) have begun to accumulate, distinctions between allelochemical and insecticide metabolism become less clear. The fact that these last two CYP6B4 and CYP6B1 promoters respond to benzo(a)pyrene, an aryl hydrocarbon pervasive in the environment of these insects, in a manner paralleling their different transcriptional responses to xanthotoxin suggests the responses to both of these exogenous chemicals is moderated by the inherent strengths of these promoters. The fact that both promoters respond more strongly to the lower dose of benzo(a)pyrene than to the lower dose of xanthotoxin (when these chemicals are administered individually) and both respond substantially more strongly to higher doses of xanthotoxin than to higher doses of benzo(a)pyrene indicates that the molar quantities of these chemicals needed to saturate receptors responsible for these responses are lower for benzo(a)pyrene than for xanthotoxin. The dose-dependencies of the ‘‘combined’’ responses (when these chemicals are administered together) indicate that these chemicals additively enhance transcription either because they interact with the same receptor or because their signaling cascades interact at some point prior to promoter activation. While our results cannot completely eliminate
1137
the latter possibility, it is intuitively less likely that two receptors capable of binding different planar molecules have independently evolved than it is that a single receptor has evolved to be capable of binding both types of planar molecules with different affinities. In accord with this suggestion, a recent study has indicated that mammalian AhR function is agonistically affected by a variety of plant allelochemicals, including flavonoids (Zhang et al., 2003), that are biochemically related to the phenylpropanoid derivative (xanthotoxin) studied here. Even so, known AhR homologues from D. melanogaster and Caenorhabiditis elegans do not bind typical aryl hydrocarbon ligands, such as dioxin and b-naphthoflavone, despite the fact that these proteins contain PAS-B repeats embedded in PAS domains that are important for ligand binding in the vertebrate AhR proteins (Duncan et al., 1998; Powell-Coffman et al., 1998; Butler et al., 2001). Although ligand-dependent AhR proteins analogous to that found in vertebrates have not yet been identified in insects (Hahn, 2002), the induction of insect cytochrome P450 activities by various aryl hydrocarbons has been documented. In particular, cytochrome P450 activities in Spodoptera eridania, the southern armyworm, are induced by pentamethylbenzene, naphthalene and polychlorinated cyclic biphenyls (PCBs) (Anderson, 1978; Chang et al., 1983) but not by dioxin (Denison et al., 1985). Cytochrome P450 activities are also induced by benzo(a)pyrene in a mutant strain of Drosophila simulans that is susceptible to the toxic effects of benzo(a)pyrene but not in the wildtype strain that is resistant to benzo(a)pyrene (Fuchs et al., 1992). Our ability to activate expression of insect CYP6B promoters with benzo(a)pyrene in insect cells derived from another lepidopteran species provides us with the potential to biochemically dissect the receptors and transcriptional activators for the insect aryl hydrocarbon cascade. In addition, testing whether the CYP6B4 and CYP6B1 proteins can metabolize benzo(a)pyrene at any significant efficiency and whether the reaction products are toxic allows us to determine whether this response of the CYP6B promoters is adaptive as is the case with their response to xanthotoxin. Acknowledgements Ms. Erin Fancher made the 506/+29, 449/+29 and 286/+29 CYP6B4 promoter constructs, Dr. Hataichanoke Prapaipong Niamsup made the 146/ +22 CYP6B1 wildtype promoter and Dr. Weimin Li provided the CYP6B4v2 genomic DNA clone for making the 1812/+29 CYP6B4 promoter construct. The internal actin: b-galactosidase control plasmid was a gift from Dr. Lucy Cherbas at Indiana University. This
1138
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139
work has been supported by NSF grant IBN0212242 to MRB and USDA grant 01-35302-10884 to MAS and MRB. CMM was supported by fellowships from the University of Illinois Toxicology Scholars program and NIH Cell and Molecular Biology Training Grant at the University of Illinois Urbana-Champaign. RPB was supported by a fellowship from the University of Illinois Toxicology Scholars program. References Anderson, R.S., 1978. Aryl hydrocarbon hydroxylase induction in an insect, Spodoptera eridania (Cramer), by polychlorinated biphenyls (PCBs). Comparative Biochemistry and Physiology, Part C 60, 51–55. Antoniewski, C., Laval, M., Lepesant, J.A., 1993. Structural features critical to the activity of an ecdysone receptor binding site. Insect Biochemistry and Molecular Biology 23, 105–114. Baudry, J., Li, W., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Molecular docking of substrates and inhibitors in the catalytic site of CYP6B1, an insect cytochrome P450 monooxygenase. Protein Engineering 16, 577–587. Brown, R.A.P., 2003. Interactions among steroid and xenobiotic response cascades in the regulation of CYP6B1. Ph.D. Thesis, University of Illinois, Urbana-Champaign. Brown, R.P., Berenbaum, M.R., Schuler, M.A., 2004. Transcription of a lepidoteran cytochrome P450 promoter is modulated by multiple elements in its 50 UTR and repressed by 20-hydroxyecdysone. Insect Molecular Biology 13, 337–347. Butler, R.A., Kelley, M.L., Powell, W.H., Hahn, M.E., Van Beneden, R.J., 2001. An aryl hydrocarbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evidence that invertebrate AHR homologues lack 2,3,7,8-tetrachlorodibenzo-p-dioxin and b-naphthoflavone binding. Gene 278, 223–234. Chang, K.M., Wilkinson, C.F., Hetnarski, K., Murray, M., 1983. Aryl hydrocarbon hydroxylase in larvae of the southern armyworm (Spodoptera eridania). Insect Biochemistry 13, 87–94. Chen, J.S., Berenbaum, M.R., Schuler, M.A., 2002. Amino acids in SRS1 and SRS6 are critical for furanocoumarin metabolism by CYP6B1v1, a cytochrome P450 monooxygenase. Insect Molecular Biology 11, 175–186. Cherbas, L., Lee, K., Cherbas, P., 1991. Identification of ecdysone response elements by analysis of the Drosophila Eip28/29 gene. Genes and Development 5, 120–131. Cohen, M.B., Schuler, M.A., Berenbaum, M.R., 1992. A hostinducible cytochrome P-450 from a host-specific caterpillar: molecular cloning and evolution. Proceedings of the National Academy of Sciences of the United States of America 89, 10920–10924. Daborn, P.J., Yen, J.L., Bogwitz, M.R., Le Goff, G., Feil, E., Jeffers, S., Tijet, N., Perry, T., Heckel, D., Batterham, P., et al., 2002. A single P450 allele associated with insecticide resistance in Drosophila. Science 297, 2253–2256. Denison, M.S., Hamilton, J.W., Wilkinson, C.F., 1985. Comparative studies of aryl hydrocarbon hydroxylase and the Ah receptor in nonmammalian species. Comparative Biochemistry and Physiology, Part C 80, 319–324. Denison, M.S., Fisher, J.M., Whitlock Jr., ., J.P., 1988. The DNA recognition site for the dioxin–Ah receptor complex. Nucleotide sequence and functional analysis. Journal of Biological Chemistry 263, 17221–17224. Duncan, D.M., Burgess, E.A., Duncan, I., 1998. Control of distal antennal identity and tarsal development in Drosophila by spineless-aristapedia, a homolog of the mammalian dioxin receptor. Genes and Development 12, 1290–1303.
Feyereisen, R., 1999. Insect P450 enzymes. Annual Review of Entomology 44, 507–533. Fuchs, S., Spiegelman, V.S., Safaev, R.D., Belitsky, G.A., 1992. Xenobiotic-metabolizing enzymes and benzo[a]pyrene metabolism in the benzo[a]pyrene-sensitive mutant strain of Drosophila simulans. Mutation Research 269, 185–191. Hahn, M.E., 2002. Aryl hydrocarbon receptors: diversity and evolution. Chemico-Biological Interactions 141, 131–160. Hayes, J.D., Pulford, D.J., 1995. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Critical Reviews in Biochemistry and Molecular Biology 30, 445–600. Hung, C.F., Harrison, T.L., Berenbaum, M.R., Schuler, M.A., 1995a. CYP6B3: a second furanocoumarin-inducible cytochrome P450 expressed in Papilio polyxenes. Insect Molecular Biology 4, 149–160. Hung, C.F., Prapaipong, H., Berenbaum, M.R., Schuler, M.A., 1995b. Differential induction of cytochrome P450 transcripts in Papilio polyxenes by linear and angular furanocoumarins. Insect Biochemistry and Molecular Biology 25, 89–99. Hung, C.F., Holzmacher, R., Connolly, E., Berenbaum, M.R., Schuler, M.A., 1996. Conserved promoter elements in the CYP6B gene family suggest common ancestry for cytochrome P450 monooxygenases mediating furanocoumarin detoxification. Proceedings of the National Academy of Sciences of the United States of America 93, 12200–12205. Hung, C.F., Berenbaum, M.R., Schuler, M.A., 1997. Isolation and characterization of CYP6B4, a furanocoumarin-inducible cytochrome P450 from a polyphagous caterpillar (Lepidoptera: Papilionidae). Insect Biochemistry and Molecular Biology 27, 377–385. Kasai, S., Scott, J.G., 2000. Overexpression of cytochrome P450 CYP6D1 is associated with monooxygenase-mediated pyrethroid resistance in house flies from Georgia. Pesticide Biochemistry and Physiology 68, 34–41. Li, W., Berenbaum, M.R., Schuler, M.A., 2001. Molecular analysis of multiple CYP6B genes from polyphagous Papilio species. Insect Biochemistry and Molecular Biology 31, 999–1011. Li, W., Petersen, R.A., Schuler, M.A., Berenbaum, M.R., 2002. CYP6B cytochrome P450 monooxygenases from Papilio canadensis and Papilio glaucus: potential contributions of sequence divergence to host plant associations. Insect Molecular Biology 11, 543–551. Li, W., Schuler, M.A., Berenbaum, M.R., 2003. Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: specificity and substrate encounter rate. Proceedings of the National Academy of Science of the United States of America 100 (Suppl. 2), 14593–14598. Li, X., Schuler, M.A., Berenbaum, M.R., 2004. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics (in preparation). Ma, Q., 2001. Induction of CYP1A1. The AhR/DRE paradigm: transcription, receptor regulation, and expanding biological roles. Current Drug Metabolism 2, 149–164. Maitra, S., Dombrowski, S.M., Waters, L.C., Ganguly, R., 1996. Three second chromosome-linked clustered Cyp6 genes show differential constitutive and barbital-induced expression in DDTresistant and susceptible strains of Drosophila melanogaster. Gene 180, 165–171. Maitra, S., Dombrowski, S.M., Basu, M., Raustol, O., Waters, L.C., Ganguly, R., 2000. Factors on the third chromosome affect the level of Cyp6a2 and Cyp6a8 expression in Drosophila melanogaster. Gene 248, 147–156. Maitra, S., Price, C., Ganguly, R., 2002. Cyp6a8 of Drosophila melanogaster: gene structure, and sequence and functional analysis of the upstream DNA. Insect Biochemistry and Molecular Biology 32, 859–870.
C.M. McDonnell et al. / Insect Biochemistry and Molecular Biology 34 (2004) 1129–1139 Petersen, R.A., Zangerl, A.R., Berenbaum, M.R., Schuler, M.A., 2001. Expression of CYP6B1 and CYP6B3 cytochrome P450 monooxygenases and furanocoumarin metabolism in different tissues of Papilio polyxenes (Lepidoptera: Papilionidae). Insect Biochemistry and Molecular Biology 31, 679–690. Petersen, R.A., Niamsup, H., Berenbaum, M.R., Schuler, M.A., 2003. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals. Biochimica et Biophysica Acta 1619, 269–282. Powell-Coffman, J.A., Bradfield, C.A., Wood, W.B., 1998. Caenorhabditis elegans orthologs of the aryl hydrocarbon receptor and its heterodimerization partner the aryl hydrocarbon receptor nuclear translocator. Proceedings of the National Academy of Sciences of the United States of America 95, 2844–2849. Prapaipong, H., 1995. Transcriptional regulation of CYP6B1v3, a furanocoumarin-inducible P450 gene from the black swallowtail (Papilio polyxenes). Ph.D. Dissertation, University of Illinois, Urbana-Champaign. Prapaipong, H., Berenbaum, M.R., Schuler, M.A., 1994. Transcriptional regulation of the Papilio polyxenes CYP6B1 gene. Nucleic Acids Research 22, 3210–3217. Rushmore, T.H., Morton, M.R., Pickett, C.B., 1991. The antioxidant responsive element. Activation by oxidative stress and identification of the DNA consensus sequence required for functional activity. Journal of Biological Chemistry 266, 11632–11639. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
1139
Schmidt, J.V., Bradfield, C.A., 1996. Ah receptor signaling pathways. Annual Review of Cell and Developmental Biology 12, 55–89. Scott, J.G., Lee, S.S., 1993. Purification and characterization of a cytochrome P-450 from insecticide susceptible and resistant strains of housefly, Musca domestica L., before and after phenobarbital exposure. Archives of Insect Biochemistry and Physiology 24, 1–19. Sterling, K., Bresnick, E., 1996. Oct-1 transcription factor is a negative regulator of rat CYP1A1 expression via an octamer sequence in its negative regulatory element. Molecular Pharmacology 49, 329–337. Tomita, T., Liu, N., Smith, F.F., Sridhar, P., Scott, J.G., 1995. Molecular mechanisms involved in increased expression of a cytochrome P450 responsible for pyrethroid resistance in the housefly, Musca domestica. Insect Molecular Biology 4, 135–140. Wasserman, W.W., Fahl, W.E., 1997. Functional antioxidant responsive elements. Proceedings of the National Academy of Science of the United States of America 94, 5361–5366. Wen, Z., Pan, L., Berenbaum, M.R., Schuler, M.A., 2003. Metabolism of linear and angular furanocoumarins by Papilio polyxenes CYP6B1 co-expressed with NADPH cytochrome P450 reductase. Insect Biochemistry and Molecular Biology 33, 937–947. Whitlock Jr., ., J.P., 1999. Induction of cytochrome P4501A1. Annual Review of Pharmacology and Toxicology 39, 103–125. Zhang, S., Qin, C., Safe, S.F., 2003. Flavonoids as aryl hydrocarbon receptor agonists/antagonists: effects of structure and cell context. Environmental Health Perspectives 111, 1877–1882.